Genetically engineered strain based on trna modification, preparation method therefor, and use thereof

Abstract

Provided are a genetically engineered strain based on tRNA modification, a preparation method therefor, and a use thereof. Specifically, an inhibitory tRNA coding sequence is directly recombined into a yeast cell genome, and the problem that an inhibitory tRNA gene cannot be normally expressed when directly inserted into a yeast cell genome is solved, thereby achieving the purpose of preparing an unnatural amino acid protein.

Description

A genetically engineered strain based on tRNA modification, and its preparation method and application Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to a genetically engineered strain and a preparation method and application thereof. Background Art

[0002] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) technology is a revolutionary gene editing tool that is widely used in the fields of biology and medical research. It is based on the natural immune system of bacteria and archaea, and can accurately edit, add or delete gene sequences. The core components of CRISPR technology include CRISPR sequences and Cas proteins. The CRISPR sequence is a DNA sequence that contains a series of repeated and spaced sequences that come from foreign viruses or plasmids that bacteria or archaea have encountered. Cas protein is the core protein in the CRISPR system, which can recognize and cut these foreign DNA sequences. Compared with traditional gene editing methods, CRISPR technology is faster and more accurate, and can achieve large-scale gene editing in a short period of time.

[0003] Amber-codon tRNA is a special tRNA that corresponds to the amber codon in the genetic code. The amber codon is a stop codon, and when encountered, protein synthesis is terminated. However, by introducing amber-codon tRNA into yeast cells, it is possible to insert unnatural amino acids. This is achieved by pairing a specific unnatural amino acid with the amber codon, thereby inserting it into the protein sequence. To achieve this, it is first necessary to design and synthesize an unnatural amino acid that can pair with the amber codon, allowing it to be recognized by the amber-codon tRNA and incorporated into the protein. The introduction of amber-codon tRNA eliminates the amber codon as a signal to terminate protein synthesis and instead signals the insertion of the unnatural amino acid. When amber-codon tRNA and the corresponding unnatural amino acid are present in yeast cells, protein synthesis does not stop at the amber codon, but instead inserts the unnatural amino acid, thereby modifying the protein.

[0004] The introduction of unnatural amino acids can alter the structure and properties of some drug molecules, thereby modifying their activity, stability, and pharmacokinetic properties. The synthesis of unnatural amino acids allows the design and synthesis of more active and selective drug molecules, improving their efficacy and reducing side effects. Furthermore, the introduction of unnatural amino acids can alter drug solubility, lipid solubility, and drug binding properties, thereby improving their absorption and distribution, enhancing their bioavailability and efficacy in the body. Furthermore, the introduction of unnatural amino acids can increase the stability of drug molecules, reduce drug degradation and ineffectiveness, and extend their shelf life.

[0005] However, the inserted amber codon tRNA gene may have sequence instability or structural problems, resulting in its inability to be correctly recognized and transcribed by yeast cells. Secondly, the amber codon tRNA gene may be incompatible with the transcription and translation machinery of yeast cells, resulting in its inability to be expressed normally. In addition, other metabolic pathways and regulatory mechanisms within yeast cells may also affect the expression of amber codon tRNA genes. For example, yeast cells may have certain negative regulatory mechanisms that inhibit the expression of amber codon tRNA genes. Alternatively, the expression of amber codon tRNA genes may be affected by intracellular environmental factors, such as nutritional conditions or temperature.

[0006] Therefore, a technology for expressing amber codon tRNA in yeast is provided, which can achieve the purpose of synthesizing proteins containing unnatural amino acids in yeast cells.

[0007] Summary of the Invention

[0008] The present invention utilizes CRISPR technology to integrate inhibitory tRNA into cells, so that the modified strain can efficiently and stably express inhibitory tRNA, thereby realizing the ability to express proteins containing non-natural amino acids (NCAAs) extracellularly.

[0009] The first aspect of the present invention provides a nucleic acid construct, wherein the structure of the nucleic acid construct is formula (I): Z1-Z2-Z3,

[0010] Wherein, Z1-Z3 are elements used to constitute the structure;

[0011] Each "-" is independently a bond or a nucleotide linking sequence;

[0012] Z1 is the promoter sequence;

[0013] Z2 is none or a connection sequence;

[0014] Z3 is the gene sequence of inhibitory tRNA.

[0015] Furthermore, the promoter is selected from tDNA, SNR52, SNR6, Pol III, U6, U3, SCR1, RPR1 or H1.

[0016] Furthermore, the promoter is preferably tDNA or SNR52.

[0017] Furthermore, the inhibitory tRNA is selected from amber codon tRNA, ochre codon tRNA or opal codon tRNA; preferably amber codon tRNA; further preferably tRNA TAG Pyl .

[0018] Furthermore, the structure of formula (I) is selected from Z1-Z2-tDNA TAG Pyl , the tDNA TAG Pyl Select from wild type or mutant.

[0019] Furthermore, the structure of formula (I) is selected from tDNA-Z2-tDNA TAG Pyl , the tDNA TAG Pyl Select from wild type or mutant.

[0020] Furthermore, the tDNA is selected from tDNA Arg tDNA Ala tDNA Asp tDNA Cys tDNA Gln , tDNA Leu tDNA Pro tDNA Tyr tDNA Val tDNA Ser tDNA Gly tDNA His tDNA Ile tDNA Lys tDNA Met tDNA Phe tDNA Thr or tDNA Glu .

[0021] Further preferably, the promoter is selected from tDNA UCU Arg .

[0022] Further preferably, the structure of formula (I) is selected from tDNA Arg -Z2-tDNA TAG Pyl; Further preferably, the structure of formula (I) is selected from tDNA UCU Arg -Z2-tDNA TAG Pyl .

[0023] Further preferably, the Z2 is selected from a linker sequence, and the linker sequence is selected from CTTTGTTTCT, i.e., SEQ ID NO: 30.

[0024] Furthermore, the Z3 is a single copy or multiple copy gene sequence of an inhibitory tRNA, and further preferably, the number of the multiple copies is less than or equal to 6.

[0025] Furthermore, the sequence number of the structure of formula (I) is SEQ ID NO: 25-29.

[0026] The second aspect of the present invention provides a genetically engineered strain having a nucleic acid construct comprising at least one inhibitory tRNA gene sequence integrated into its genome.

[0027] Furthermore, the nucleic acid construct is the nucleic acid construct described in the first aspect of the present invention.

[0028] Furthermore, the strain is derived from bacteria, mammalian cells, human cells, plant cells, yeast cells, insect cells or any combination thereof.

[0029] Furthermore, the cell extract is more preferably selected from any one of the following sources: Escherichia coli, Kluyveromyces lactis, wheat germ cells, Spodoptera frugiperda insect cells, rabbit reticulocytes, CHO cells, COS cells, VERO cells, BHK cells, human fibrosarcoma HT1080 cells, or a combination thereof.

[0030] Further preferably, the cell extract is derived from yeast cells.

[0031] Further, the yeast cell is selected from Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia minuta, Ogataeaminuta, Pichia lindneri, Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia sp., Saccharomyces cerevisiae. cerevisiae), brewer's yeast, sugarcane molasses yeast, Saccharomyces sp., Hansenula polymorpha, Candida utilis, Kluyveromyces, or a combination thereof.

[0032] More preferably, the Kluyveromyces further includes: Kluyveromyces lactis (Kluyveromyces, K. lactis), Kluyveromyces marxianus, Kluyveromyces dobzhanskii, Kluyveromyces aestuarii, Kluyveromyces nonfermentans, Kluyveromyces wickerhamii, Kluyveromyces thermotolerans, Kluyveromyces fragilis, Kluyveromyces hubeiensis, Kluyveromyces polysporus, Kluyveromyces siamensis, Kluyveromyces syringae, Kluyveromyces truncatum ... yarrowii) or one or a combination thereof; preferably, the yeast cell is a Kluyveromyces cell, more preferably a Kluyveromyces lactis cell.

[0033] Further preferably, the nucleic acid construct is integrated into the genome of the strain via an insertion site, and the insertion site is UPF1 or endogenous tDNA.

[0034] The third aspect of the present invention provides a method for preparing a genetically engineered strain according to the second aspect of the present invention, wherein the nucleic acid construct is inserted into the genome of the strain via the UPF1 site.

[0035] Furthermore, the nucleic acid construct is inserted into the genome of the strain via any position in the UPF1 site.

[0036] The fourth aspect of the present invention provides a method for preparing a genetically engineered strain provided in the second aspect of the present invention, wherein the nucleic acid construct is inserted into the genome of the strain via 1 to 1000 bp from the 5' end and / or 3' end of the endogenous tDNA sequence; preferably 100 to 800 bp; further preferably 200 to 500 bp; and most preferably 300 bp.

[0037] Furthermore, the nucleic acid construct is inserted into the 3' segment of the endogenous tDNA sequence.

[0038] The fifth aspect of the present invention provides a method for synthesizing proteins incorporating non-natural amino acids, using the genetically engineered strain described in the fifth aspect of the present invention to provide inhibitory tRNA.

[0039] The sixth aspect of the present invention provides a cell-free synthesis system for synthesizing proteins incorporated with non-natural amino acids, wherein the system at least comprises a cell extract derived from the genetically engineered strain provided by the second aspect of the present invention.

[0040] Furthermore, the system also includes aminoacyl-tRNA synthetase and unnatural amino acids.

[0041] Furthermore, the aminoacyl-tRNA synthetase is selected from natural or mutant Pyl-tRNA synthetase (PylRS), Leu-tRNA synthetase (LeuRS), Tyr-tRNA synthetase (TyrRS), Phe-tRNA synthetase (PheRS) or TrP-tRNA synthetase (TrpRS), and is more preferably PylRS.

[0042] Furthermore, the aminoacyl-tRNA synthetase is selected from natural or mutant MaPylRS, MmPylRS, MbPylRS, EcTyrRS, MjTyrRS, EcLeuRS, ScPheRS, ScTrpRS, BsTrpRS

[0043] Furthermore, the non-natural amino acids refer to amino acids other than the 20 natural amino acids.

[0044] Furthermore, the structural formula of the non-natural amino acid is a compound of formula (2) or a salt thereof.

[0045] wherein n is selected from a natural number of 1-20, R1 is selected from a substituted or unsubstituted C5-C60 aryl or heteroaryl group, a substituted or unsubstituted C1-C20 alkyl group, a substituted or unsubstituted C2-C20 alkenyl group or a substituted or unsubstituted C2-C20 alkynyl group, and A is selected from O or -CH2-.

[0046] In another preferred embodiment, n is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.

[0047] In another preferred embodiment, n is a natural number selected from 1-10.

[0048] In another preferred embodiment, n is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0049] In another preferred embodiment, n is a natural number selected from 1-6.

[0050] In another preferred embodiment, n is selected from 1, 2, 3, 4, 5 or 6.

[0051] In another preferred embodiment, the R1 is selected from substituted or unsubstituted C5-C30 aryl or heteroaryl.

[0052] In another preferred embodiment, the R1 is selected from substituted or unsubstituted phenyl.

[0053] In another preferred embodiment, the R1 is selected from substituted or unsubstituted C2-C20 alkenyl.

[0054] In another preferred embodiment, the R1 is selected from substituted or unsubstituted C2-C10 alkenyl.

[0055] In another preferred embodiment, the R1 is selected from substituted or unsubstituted C2-C6 alkenyl.

[0056] In another preferred embodiment, the R1 is selected from substituted or unsubstituted C2-C20 alkynyl.

[0057] In another preferred embodiment, the R1 is selected from substituted or unsubstituted C2-C10 alkynyl.

[0058] In another preferred embodiment, the R1 is selected from substituted or unsubstituted C2-C6 alkynyl.

[0059] In another preferred embodiment, the A is selected from O.

[0060] In another preferred embodiment, the A is selected from -CH2-.

[0061] In another preferred embodiment, the substituents are substituents commonly used in the art, such as aryl, heteroaryl, alkyl, cycloalkyl, aryloxy, heteroaryloxy, alkyloxy, cycloalkyloxy, hydroxyl, thiol, ester, carboxyl, cyano, halogen, nitro, sulfonic acid, azide, alkenyl, alkynyl, phosphate, etc.

[0062] In another preferred embodiment, the structural formula of the non-natural amino acid is selected from one or a combination of the following, or a salt form thereof:

[0063] The seventh aspect of the present invention provides a use of the genetically engineered strain provided in the second aspect of the present invention or the cell-free synthesis system provided in the sixth aspect of the present invention in the cell-free synthesis of proteins incorporated with non-natural amino acids.

[0064] The eighth aspect of the present invention provides a kit, which includes the cell-free synthesis system provided by the sixth aspect of the present invention.

[0065] The ninth aspect of the present invention provides a method for cell-free synthesis of proteins incorporated with non-natural amino acids, comprising the following steps: step (1), providing the cell-free synthesis system provided in the sixth aspect of the present invention or the kit provided in the eighth aspect of the present invention; step (2), adding a DNA molecule encoding an exogenous protein to the synthesis system or kit described in step (1), and obtaining the protein through reaction in the presence of aminoacyl-tRNA synthetase and non-natural amino acids.

[0066] Furthermore, the exogenous protein is selected from the group consisting of: luciferin, luciferase (such as firefly luciferase), fluorescent protein (such as green fluorescent protein, yellow fluorescent protein, red fluorescent protein), aminoacyl-tRNA synthetase, glyceraldehyde-3-phosphate dehydrogenase, catalase, actin, variable region of an antibody, luciferase mutation, α-amylase, enterobactin A, hepatitis C virus E2 glycoprotein, insulin precursor, interferon αA, cytokine, interferon α2b, interleukin-1β, lysozyme, serum albumin, single-chain antibody fragment (scFV), transthyretin, tyrosinase, xylanase, or a combination thereof.

[0067] Furthermore, the exogenous protein includes a wild-type protein, a mutant protein or a recombinant protein.

[0068] The advantages of the present invention are:

[0069] (1) The inhibitory tRNA gene is directly recombined into the yeast cell genome, which solves the problem that the inhibitory tRNA gene cannot be expressed normally when it is directly inserted into the yeast cell genome.

[0070] (2) The designed inhibitory tRNA structure can normally transcribe inhibitory tRNA and can normally transport non-natural amino acids to specific stop codons (such as TAG), thereby achieving the purpose of preparing non-natural amino acid proteins.

[0071] (3) By inserting non-natural amino acids at specific positions, the production of special functional proteins can be achieved, which has great development potential in the fields of chemical industry, pharmaceuticals, etc.

[0072] (4) The recombinant strain has a stable structure and can be industrially produced, thereby further realizing the industrial production of non-natural amino acid proteins.

[0073] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] FIG1 shows the structure of the insert sequence 3002 of the present invention.

[0075] FIG2 shows the sequencing results of Example 1.

[0076] FIG3 shows the sequencing results of Example 4.

[0077] Figures 4 to 7 demonstrate the activity of strains modified 1 to 10 for the insertion efficiency of unnatural amino acids. Figures 4 and 6 demonstrate the activity of strains modified with insertions near the endogenous tDNA, while Figures 5 and 7 demonstrate the activity of strains modified with insertions at the UPF1 site. In Figures 4 to 7, the insertion sequences corresponding to wt and upf1-wt are identical, and the insertion sequences corresponding to mut1 to mut1 to upf1-4 are identical, respectively. DETAILED DESCRIPTION

[0078] It should be noted that, unless there is any conflict, the embodiments and features in the embodiments of this application can be combined with each other.

[0079] The present invention will be further described below in conjunction with the specific embodiments and examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. Experimental methods in the following examples where specific conditions are not specified are preferably performed in accordance with or with reference to the conditions indicated in the specific embodiments described above, and may then be performed under conventional conditions or as recommended by the manufacturer.

[0080] Unless otherwise specified, percentages and parts mentioned in the present invention are percentages and parts by weight.

[0081] Unless otherwise specified, the materials and reagents used in the examples of the present invention are all commercially available products.

[0082] Unless otherwise specified, the temperature units in this application are degrees Celsius (°C).

[0083] Nouns and terms

[0084] The following is an explanation or description of the meaning of some of the relevant "nouns" and "terms" used in the present invention, so as to better understand the present invention. The corresponding explanation or description applies to the full text of the present invention, both below and above. When the present invention involves references, the definitions of relevant terms, nouns, and phrases in the references are also quoted, but when they conflict with the definitions in the present invention, the definitions in the present invention shall prevail. When the definitions in the references conflict with the definitions in the present invention, it does not affect the cited components, substances, compositions, materials, systems, formulations, types, methods, equipment, etc., which are subject to the contents determined in the references.

[0085] In the present invention, preferred embodiments such as “preferred”, “better”, “more preferred”, “better”, “most preferred”, and “further preferred” do not constitute any limitation on the scope of the invention and the scope of protection, and are not used to limit the scope and embodiments of the present invention, but are only used to provide some embodiments as examples.

[0086] In the description of the present invention, preferred modes such as “one of the preferred ones”, “one of the preferred modes”, “one of the preferred embodiments”, “one of the preferred examples”, “preferred example”, “in a preferred embodiment”, “some preferred examples”, “in some preferred modes”, “preferably”, “preferably”, “preferably”, “more preferably”, “more preferably”, “further preferably”, “most preferably”, and illustrative enumeration modes such as “one of the embodiments”, “one of the modes”, “example”, “specific example”, “for example”, “as an example”, “for example”, “such as”, etc., do not constitute any limitation on the scope of the invention and the scope of protection, and the specific features described in each mode are included in at least one specific embodiment of the present invention. In the present invention, the specific features described in each mode can be combined in a suitable manner in any one or more specific embodiments. In the present invention, the technical features or technical solutions corresponding to each preferred mode can also be combined in any suitable manner.

[0087] In the present invention, “any combination thereof” means “greater than 1” in terms of quantity, and means a group consisting of the following situations in terms of coverage: “any one of them, or a group consisting of at least two of them”.

[0088] In the present invention, the descriptions of "one or more", "one or more" and "one or more" have the same meaning as "at least one", "at least one", "a combination thereof", "or a combination thereof", "and a combination thereof", "or any combination thereof", "and any combination thereof", etc., and can be used interchangeably to indicate that the quantity is equal to "1" or "greater than 1".

[0089] In the present invention, "or / and" and "and / or" are used to represent "optionally one of them or optional combination thereof", and also represent at least one of them.

[0090] The term "about" can refer to a value or composition that is within an acceptable error range for a particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined. For example, as used herein, the expression "about 100" includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0091] Sequence identity (or homology) is determined by comparing two aligned sequences along a predetermined comparison window (which can be 50%, 60%, 70%, 80%, 90%, 95% or 100% of the length of the reference nucleotide sequence or protein) and determining the number of positions at which identical residues occur. Typically, this is expressed as a percentage. The measurement of sequence identity of nucleotide sequences is a method well known to those skilled in the art.

[0092] The prior art means described in the present invention in terms of “usually”, “conventional”, “general”, “frequently”, “often”, etc. are also cited as references to the content of the present invention. Unless otherwise specified, they can be regarded as one of the preferred ways of some technical features of the present invention. It should be noted that they do not constitute any limitation on the scope of coverage and protection scope of the invention.

[0093] All documents mentioned in the present invention and documents directly or indirectly cited by these documents are incorporated by reference in this application as if each document was individually incorporated by reference.

[0094] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (including but not limited to the embodiments) can be combined with each other to form new or preferred technical solutions, as long as they can be used to implement the present invention. Due to space limitations, they will not be listed one by one.

[0095] In vitro protein synthesis reaction refers to the reaction of synthesizing protein in an in vitro cell-free synthesis system, which at least includes the translation process. It includes but is not limited to IVT reaction (in vitro translation reaction), IVTT reaction (in vitro transcription and translation reaction), and IVDTT reaction (in vitro replication transcription and translation reaction). In the present invention, IVTT reaction is preferred. IVTT reaction, corresponding to IVTT system, is the process of transcribing and translating DNA into protein (Protein) in vitro. Therefore, we also refer to this type of in vitro protein synthesis system as D2P system, D-to-P system, D_to_P system, DNA-to-Protein system; the corresponding in vitro protein synthesis method is also called D2P method, D-to-P method, D_to_P method, DNA-to-Protein method.

[0096] "Cell-free system" refers to a method of in vitro protein synthesis that is not secretory expression through intact cells. It should be noted that in the in vitro cell-free protein synthesis system of the present invention, it is also allowed to add cell components to promote the reaction, but the added cells are not primarily intended to secrete and express exogenous target proteins. In addition, in the D2P system without intact cells constructed under the guidance of the present invention, a small amount of intact cells are intentionally added (for example, the protein content provided by them is not more than 30wt% compared to the protein content provided by the cell extract). Such a "circumvention" method is also included in the scope of protection of the present invention.

[0097] Exogenous protein: The target expression product of the in vitro protein synthesis system of the present invention is not synthesized by host cell secretion, but is synthesized in vitro based on an exogenous nucleic acid template, and may also be referred to as target protein. The exogenous protein may be a protein, a fusion protein, a mixture of protein-containing molecules or fusion protein molecules; it also broadly includes polypeptides. The product obtained after an in vitro protein synthesis reaction based on a nucleic acid template encoding the target protein may be a single substance or a combination of two or more substances. "Exogenous protein", "target protein", "target protein", "target translation product" have the same meaning and can be translated as "objective protein", "interested protein", "objective translated product", "interested protein product", etc., and can be used interchangeably in the present invention.

[0098] D2P, DNA-to-Protein, refers to the process from DNA template to protein product. For example, D2P technology, D2P system, D2P method, D2P kit, etc.

[0099] "The expression system of the present invention", "the in vitro expression system of the present invention", "the in vitro cell-free expression system", and "the in vitro cell-free expression system" are used interchangeably and all refer to the in vitro protein expression system of the present invention. Other descriptions may also be used, such as: in vitro protein synthesis system, in vitro protein synthesis system, cell-free system, cell-free system, cell-free protein synthesis system, cell-free in vitro protein synthesis system, in vitro cell-free protein synthesis system, in vitro cell-free synthesis system, CFS system (cell-free system), CFPS system (cell-free protein synthesis system), etc. According to the reaction mechanism, it may include an in vitro translation system (which may be abbreviated as an IVT system, a mR2P system), an in vitro transcription-translation system (which may be abbreviated as an IVTT system, a D2P system), an in vitro replication-transcription-translation system (which may be abbreviated as an IVDTT system, a D2P system), etc. In the present invention, the IVTT system is preferred. We also refer to the in vitro protein synthesis system as a "protein synthesis factory" ("Protein Factory" or "proteinfactory" or "Proteinfactory"). The in vitro protein synthesis system provided by the present invention adopts an open description method for its components. The cell-free protein synthesis system of the present invention uses exogenous DNA, mRNA or a combination thereof as the nucleic acid template for protein synthesis, and achieves in vitro synthesis of the target protein by artificially controlling the addition of substrates and transcription- and translation-related protein factors required for protein synthesis.

[0100] In the present invention, "protein" and "protein" have the same meaning and can be used interchangeably.

[0101] In the present invention, “system” and “system” are both translated as system and can be used interchangeably.

[0102] In the present invention, "protein synthesis amount", "protein expression amount" and "protein expression yield" have the same meaning and can be used interchangeably.

[0103] In the present invention, cell extract, cell extract, cell lysate, cell disrupted product and cell lysate have the same meaning and can be used interchangeably. In English, cell extract, cell lysate and the like can be used as descriptions.

[0104] In the present invention, energy system, energy system, and energy supply system have the same meaning and can be used interchangeably. Energy regeneration system and energy regeneration system have the same meaning and can be used interchangeably. The energy regeneration system is a preferred embodiment or component of the energy system.

[0105] Furthermore, the present invention provides a cell-free protein synthesis system, which at least includes a cell extract or a cell lysate.

[0106] Further preferably, the cell-free protein synthesis system further comprises one or more components selected from the following group: a substrate for RNA synthesis, a substrate for protein synthesis, polyethylene glycol or its analogues, magnesium ions, potassium ions, a buffer, RNA polymerase, an energy regeneration system, dithiothreitol, and an optional aqueous solvent.

[0107] Further preferably, the substrate for synthesizing RNA includes: nucleoside monophosphate, nucleoside triphosphate or a combination thereof.

[0108] Further preferably, the substrate for synthesizing protein includes 20 natural amino acids and unnatural amino acids.

[0109] Further preferably, the magnesium ions are derived from a magnesium ion source, and the magnesium ion source is selected from the following group: magnesium acetate, magnesium glutamate, or a combination thereof.

[0110] Further preferably, the potassium ions are derived from a potassium ion source, and the potassium ion source is selected from the group consisting of potassium acetate, potassium glutamate, or a combination thereof.

[0111] Further preferably, the energy regeneration system is selected from the group consisting of: a creatine phosphate / creatine phosphate enzyme system, a glycolysis pathway and an intermediate energy system thereof, or a combination thereof.

[0112] Further preferably, the energy regeneration system comprises a glucose / phosphate system, and the phosphate is selected from the following group: tripotassium phosphate, triammonium phosphate, trisodium phosphate, dipotassium hydrogen phosphate, diammonium hydrogen phosphate, disodium hydrogen phosphate, potassium dihydrogen phosphate, ammonium dihydrogen phosphate, sodium dihydrogen phosphate, or a combination thereof.

[0113] Further preferably, the buffer is selected from the group consisting of 4-hydroxyethylpiperazineethanesulfonic acid, tris(hydroxymethyl)aminomethane, or a combination thereof.

[0114] Further preferably, the in vitro protein synthesis system contains polyethylene glycol (PEG) or an analog thereof. The concentration of the PEG or its analog is not particularly limited. Typically, the concentration (w / v) of the PEG or its analogue is 0.1-8%, preferably 0.5-4%, and more preferably 1-2%, based on the total weight of the protein synthesis system. Representative PEGs are selected from the group consisting of PEG 3000, PEG 3350, PEG 6000, and PEG 8000, or a combination thereof.

[0115] Further preferably, the polyethylene glycol includes polyethylene glycol with a molecular weight (Da) of 200-10000, such as PEG200, 400, 1500, 2000, 4000, 6000, 8000, 10000, etc., preferably, polyethylene glycol with a molecular weight of 3000-10000.

[0116] In the present invention, the RNA polymerase is not particularly limited and can be selected from one or more RNA polymerases. A typical RNA polymerase is T7 RNA polymerase.

[0117] An optional scheme is that the in vitro protein synthesis system provided by the present invention includes: cell extract, 4-hydroxyethylpiperazineethanesulfonic acid, potassium acetate, magnesium acetate, adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytosine triphosphate (CTP), thymidine triphosphate (TTP), amino acid mixture, creatine phosphate, dithiothreitol (DTT), creatine phosphate kinase, and RNA polymerase.

[0118] In the present invention, the cell extract does not contain intact cells. A typical cell extract includes ribosomes, aminoacyl-tRNA synthetases, initiation factors and elongation factors required for protein synthesis, and termination and release factors. In addition, the cell extract also contains some other proteins derived from the cytoplasm of the cell, especially soluble proteins.

[0119] In the present invention, the proportion of the cell extract in the in vitro cell-free protein synthesis system is not particularly limited. Generally, the cell extract accounts for 20-70% of the in vitro cell-free protein synthesis system, preferably 30-60%, and more preferably 40-50%.

[0120] In the present invention, the protein content of the cell extract is 20-100 mg / mL, preferably 50-100 mg / mL. The protein content is determined by Coomassie Brilliant Blue assay.

[0121] The present invention also provides a vector or vector combination containing the nucleic acid construct of the present invention. Preferably, the vector is selected from the group consisting of bacterial plasmids, bacteriophages, yeast plasmids, animal cell vectors, and shuttle vectors; the vector is a transposon vector. Methods for preparing recombinant vectors are well known to those skilled in the art. Any plasmid or vector may be used as long as it is replicable and stable in the host.

[0122] Those skilled in the art can construct expression vectors containing the promoter and / or target gene sequence of the present invention using well-known methods, including in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombination techniques, etc.

[0123] Template DNA

[0124] The template DNA is a nucleotide sequence encoding any target protein to be synthesized, which can be an original sequence, an artificially synthesized sequence, or an artificially modified sequence. The corresponding RNA and / or protein can be synthesized using the template DNA.

[0125] In the present invention, the preparation method of the cell extract is not limited. A preferred preparation method is

[0126] The following steps are involved:

[0127] (i) providing cells;

[0128] (ii) washing the cells to obtain washed cells;

[0129] (iii) disrupting the washed cells to obtain a crude cell extract;

[0130] (iv) performing solid-liquid separation on the crude cell extract to obtain a liquid portion, which is the cell extract.

[0131] In the present invention, the solid-liquid separation method is not particularly limited, and a preferred method is centrifugation.

[0132] In a preferred embodiment, the centrifugation is performed in a liquid state.

[0133] In the present invention, the centrifugation conditions are not particularly limited. A preferred centrifugation condition is 5000-100000 g, preferably 8000-30000 g.

[0134] In the present invention, the centrifugation time is not particularly limited. A preferred centrifugation time is 0.5 min-2 h, preferably 20 min-50 min.

[0135] In the present invention, the centrifugation temperature is not particularly limited. Preferably, the centrifugation is performed at 1-10°C, more preferably, at 2-6°C.

[0136] In the present invention, the washing treatment method is not particularly limited. A preferred washing treatment method is to use a washing liquid at a pH of 7-8 (preferably 7.4). The washing liquid is not particularly limited. Typically, the washing liquid is selected from the following group: potassium 4-hydroxyethylpiperazineethanesulfonate, potassium acetate, magnesium acetate, or a combination thereof.

[0137] In the present invention, the cell disruption treatment method is not particularly limited. A preferred cell disruption treatment includes high-pressure disruption and freeze-thaw (such as liquid nitrogen low-temperature) disruption.

[0138] The nucleoside triphosphate mixture in the in vitro cell-free protein synthesis system is adenosine triphosphate, guanosine triphosphate, cytosine triphosphate, and uridine triphosphate. In the present invention, the concentration of each mononucleotide is not particularly limited, and the concentration of each mononucleotide is generally 0.5-5 mM, preferably 1.0-2.0 mM.

[0139] The amino acid mixture in the in vitro cell-free protein synthesis system may include natural or unnatural amino acids, including D- or L-amino acids. Representative amino acids include (but are not limited to) the 20 natural amino acids: glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine, and histidine. The concentration of each amino acid is typically 0.01-0.5 mM, preferably 0.02-0.2 mM, such as 0.05, 0.06, 0.07, or 0.08 mM.

[0140] In a preferred embodiment, the in vitro cell-free protein synthesis system further comprises polyethylene glycol or its analogues. The concentration of polyethylene glycol or its analogues is not particularly limited. Generally, the concentration (w / v) of polyethylene glycol or its analogues is 0.1-8%, preferably 0.5-4%, and more preferably 1-2%, based on the total weight of the biosynthesis system. Representative examples of PEG include (but are not limited to): PEG3000, PEG8000, PEG6000, and PEG3350. It should be understood that the system of the present invention may also include polyethylene glycols of various other molecular weights (e.g., PEG200, 400, 1500, 2000, 4000, 6000, 8000, 10000, etc.).

[0141] In a preferred embodiment, the in vitro cell-free protein synthesis system further contains sucrose. The concentration of sucrose is not particularly limited. Generally, the concentration of sucrose is 0.03-40 wt %, preferably 0.08-10 wt %, and more preferably 0.1-5 wt %, based on the total weight of the protein synthesis system.

[0142] A particularly preferred in vitro cell-free protein synthesis system contains the following components in addition to yeast cell extract: 22 mM 4-hydroxyethylpiperazineethanesulfonic acid at pH 7.4, 30-150 mM potassium acetate, 1.0-5.0 mM magnesium acetate, 1.5-4 mM nucleoside triphosphate mixture, 0.08-0.24 mM amino acid mixture, 25 mM creatine phosphate, 1.7 mM dithiothreitol, 0.27 mg / mL creatine phosphokinase, 1%-4% polyethylene glycol, 0.5%-2% sucrose, and 0.027-0.054 mg / mL T7 RNA polymerase.

[0143] The present invention will be further described below with reference to specific examples, which should be understood to be merely illustrative of the present invention.

[0144] The present invention is not intended to limit the scope of the present invention. The experimental methods in the following examples, for which specific conditions are not specified, generally follow conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are by weight. The present invention uses Kluyveromyces lactis (abbreviated as K. lactis or KL) as an example, but the same design, analysis, and experimental methods are also applicable to other eukaryotic cells such as yeast and animal cells, as well as prokaryotic cells.

[0145] This invention uses Kluyveromyces lactis (K. lactis) as an example, but the same design, analysis, and experimental methods are applicable to other lower eukaryotic cells, such as yeast, as well as higher animal cells. The genetic modification method used in this invention is CRISPR-Cas9 technology, but is not limited to this technique and can be any known, existing genetic modification method.

[0146] An in vitro protein synthesis reaction mixture system, also described as an in vitro protein synthesis reaction mixture, a reaction mixture system, or a reaction mixture, refers to a mixed system comprising an in vitro protein synthesis system and a nucleic acid template encoding a target protein; it may be homogeneous or heterogeneous, and may be a liquid system such as a solution, an emulsion, or a suspension.

[0147] Protein of the present invention The final concentrations of the components in the Factory are as follows: 80% (v / v) Kluyveromyces lactis extract, 15 mM glucose, 320 mM maltodextrin (measured as glucose monomers), 24 mM tripotassium phosphate, 1.8 mM nucleoside triphosphate mixture (a mixture of adenosine triphosphate, guanosine triphosphate, cytosine triphosphate, and uridine triphosphate, with a final concentration of each nucleoside triphosphate of 1.8 mM), 0.7 mM amino acid mixture (glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine, and histidine, with a final concentration of each amino acid of 0.7 mM), magnesium L-aspartate, 80 mM potassium acetate, 2% (w / v) polyethylene glycol 8000, 9.78 mM NaCl, pH 8.0 Tris·HCl buffer, 6% (w / v) trehalose. Wherein, the lactic acid Kluyveromyces extract includes endogenously expressed T7 RNA polymerase. The lactic acid Kluyveromyces extract is modified in the following manner: using a modified strain based on the lactic acid Kluyveromyces strain ATCC8585; using the method described in CN109423496A, the coding gene of T7 RNA polymerase is integrated into the genome of lactic acid Kluyveromyces to obtain a modified strain so that it can endogenously express T7 RNA polymerase; using the modified strain to culture cell raw materials, and then preparing cell extracts. The preparation process of lactic acid Kluyveromyces cell extract adopts conventional technical means, and is prepared with reference to the method described in CN109593656A. In summary, the preparation steps include: providing an appropriate amount of raw materials of lactic acid Kluyveromyces cells that have been fermented and cultured, quick-freezing the cells with liquid nitrogen, breaking the cells, and collecting the supernatant by centrifugation to obtain a cell extract. The protein concentration in the obtained lactic acid Kluyveromyces cell extract is 20-40 mg / mL. In the following examples, the cell extract is selected with (i.e., prock, N-E-propargyloxycarbonyl-L-lysine hydrochloride) is a representative of non-natural amino acids (abbreviated as NCAA), but the NCAA of the present invention is not limited to only referring to prock.

[0148] Preferably, the present invention provides a tDNA Pyl The method for mutant screening is as follows:

[0149] (1) tDNA UCU Arg -tDNA TAG Pyl (3002) structure (see Figure 1), five different tDNA TAG PylThe insert fragments of the sequences (1 wild type and 4 mutants) were respectively inserted into the following two sites in the genome of Kluyveromyces lactis (a total of 10 structures). It should be noted that in this example, only tDNA UCU Arg It is a representative of a promoter, but is not intended to limit the promoter of the present invention.

[0150] (2) Designing a CRISPR / Cas9-based sgRNA action site for the UPF1 gene, the nucleotide sequence of the sgRNA action site is:

[0151] UPF1:5'-CATTGCATAACTTGGTCAGC-3' (SEQ ID No: 1);

[0152] The insertion site was selected in the middle of the UPF1 gene. Primers 1 and 2 were designed near the insertion site for PCR amplification of the left homology arm; primers 3 and 4 were used for PCR amplification of the right homology arm. The primer sequences are as follows:

[0153] Primer 1:

[0154] 5'-CTGTTTCTTTGAGAGACGATGAC-3'(SEQ ID No: 2)

[0155] Primer 2:

[0156] 5'-CAACAGTTCGGCTTCTAGTGATGAGGAACGCCACATCTTCTCTA

[0157] CTTTTAGCAG-3' (SEQ ID No: 3)

[0158] Primer 3:

[0159] 5'-CCTTGCTTGAGAAGGTTTTGGGACGCTCGAAGAGAGCTCAGTGTCC

[0160] GAGTTA-3' (SEQ ID No: 4)

[0161] Primer 4: 5'-CTTTGAGCCCACTCCATTG-3' (SEQ ID No: 5)

[0162] (3) Using the 3002 structure-positive strain as a template and primers 5 and 6 as primers, PCR amplified the insert fragment with some homology arm sequences;

[0163] The primer sequences are as follows:

[0164] Primer 5:

[0165] 5'-AGTACGATTAACTGCTAAAAGTAGAGAAGATGTGGCGTTCCTC

[0166] ATCACTAGAAGC-3'(SEQ ID No: 6)

[0167] Primer 6:

[0168] 5'-TGACCAAGTTATGCAATGCTAACTCGGACACTGAGCTTCTTCGA

[0169] GCGTCCCAAAAC-3' (SEQ ID No: 7)

[0170] (4) Designing a CRISPR / Cas9-based sgRNA action site for the endogenous tRNA gene, the nucleotide sequence of the sgRNA action site is:

[0171] Endogenous tRNA gene: 5′-AGATGAGAAGAGACTGCGAG-3′ (SEQ ID No: 8);

[0172] Primers 7 and 8 were designed approximately 1000 bp to the left of the insertion site to PCR amplify the left homology arm; and primers 9 and 10 were designed approximately 1000 bp to the right of the insertion site to PCR amplify the right homology arm. The primer sequences are as follows:

[0173] Primer 7:

[0174] 5'-GTCAGTTTCATTAGCCTCA-3' (SEQ ID No: 9)

[0175] Primer 8:

[0176] 5'-CTCCGTCAAAGTTCCTGATTCAGTCTCTTCTCATCTCCACTAG-3'(SEQ ID No: 10)

[0177] Primer 9:

[0178] 5'-GTAGCAGGTACAGGAGAAAGAGTAAATAATGCGAGCGGAATTTGAGC-3' (SEQ ID No: 11)

[0179] Primer 10:

[0180] 5'-GCCTGTCAAGTTATAACCAG-3'(SEQ ID No: 12)

[0181] (5) Using the 3002 structure-positive strain as a template and primers 11 and 12 as primers, PCR amplified the target fragment; the primer sequences are as follows:

[0182] Primer 11:

[0183] 5'-GAGATTACTAGTGGAGATGAGAAGAGACTGAATCAGGAACTTTGACGGAG-3' (SEQ ID No: 13)

[0184] Primer 12:

[0185] 5'-CCAGCTCAAATTCCGCTCGCATTATTTACTCTTTCTCCTGTACCTGC-3' (SEQ ID No: 14)

[0186] (5) The left and right homology arm PCR products obtained in step (2) and the insert fragment PCR product obtained in step (3) were overlap PCR connected to obtain 5 different tDNA TAG Pyl A total of 5 gene editing vectors were obtained by sequencing.

[0187] (6) The left and right homology arm PCR products obtained in step (4) and the insert fragment PCR product obtained in step (5) were connected by overlap PCR. TAG Pyl A total of 5 gene editing vectors were obtained by sequencing.

[0188] (7) A total of 10 gene editing vectors obtained in steps (6) and (7) were transformed into lactic acid Kluyveromyces strains respectively.

[0189] (8) The IVTT technology was used to translate the GFP-TAG-RFP structure in large quantities. The expression level of RFP was used to reflect the read-through rate of the termination codon TAG, and the control group without the addition of non-natural amino acids was used to reflect the fidelity of the amber codon tRNA in transporting amino acids.

[0190] Example 1: Construction of gene editing vector (modification 4)

[0191] We commissioned Qingke Biotechnology Co., Ltd. to synthesize Escherichia coli containing a tRNA sequence plasmid (order number: SH0052101), with the sequence number being SEQ ID No: 15.

[0192] (2) Design primers to amplify the left and right homology arms of the endogenous tRNA gene after it is inserted into the target gene. When designing the primers, ensure that there is a 40 bp repeat sequence between different fragments. Finally, use the connecting primers for overlap PCR connection. The connecting primers are:

[0193] Primer 13: CATTACATCCAGACTCAGAGCTAGGAGATACTACTTTGGAATGC (SEQ ID No: 16)

[0194] Primer 14: AGTCTCTCTGACCAGCATATTGTGTATAACTACTGTTGTTGG (SEQ ID No: 17)

[0195] (3) Overlap PCR amplification was performed using the PCR products of the left and right homology arms and the insert as templates. The PCR amplification reaction system was as follows: PCR product mixture 3 μL; primer 13 0.5 μL; primer 14 0.5 μL; 2xMix 10 μL; ddH2O 6 μL. The PCR amplification reaction program was as follows: 95°C for 3 min; 35 cycles of 95°C for 30 s, 60°C for 1 min, 72°C for 3 min; 72°C for 5 min; and 20°C for 1 min.

[0196] After the overlap PCR is completed, the size of the connected fragments is observed by electrophoresis. The PCR products of the correct size are selected and sequenced by Qingke Biotechnology Co., Ltd. (sequencing results are shown in Figure 2). After sequencing comparison, the correct sequence can be used as a gene editing vector.

[0197] Example 2: Preparation of Kluyveromyces lactis competent cells

[0198] (1) Take out the glycerol culture of Kluyveromyces lactis strain stored in a -80℃ refrigerator and place it on ice. After thawing, streak it on a YPD plate and then culture it at 30℃ until obvious colonies grow.

[0199] (2) Pick a single colony from the plate and inoculate it into 100 ml of liquid YPD in a 250 ml conical flask. Incubate at 30°C and 200 rpm for 18 h.

[0200] (3) Transfer the culture medium to a 50 ml centrifuge tube, with a maximum of 40 ml per tube. Centrifuge at 4°C, 5000 rpm for 5 min. Discard the supernatant and add an equal volume of 1 M sorbitol. Gently pipette to mix. Centrifuge at 4°C, 5000 rpm for 5 min. Discard the supernatant. Repeat 2-3 times, then add 3-5 ml of 1 M sorbitol and gently pipette to mix. Aliquot 100 μl / tube into small centrifuge tubes and quickly transfer to a -80°C freezer for storage.

[0201] Example 3: Gene editing vectors were transferred into competent Kluyveromyces lactis strains

[0202] (1) Prepare experimental materials such as sgRNA, gene editing vectors, and competent cells in advance, and dissolve them on ice for later use.

[0203] (2) Add about 2 ng of gene editing vector and about 0.2 ng of sgRNA to the competent cells, mix gently by pipetting, and transfer to an electroporation cup.

[0204] (3) Adjust the electroporator parameters to 2KV, place the cells in the electroporation cup prepared in step (2) and perform electric shock treatment. Then, add about 700ul of YPD culture medium to the electroporation cup, gently pipette and mix, and transfer to a centrifuge tube. Incubate at 200rpm and 30℃ for about 30min.

[0205] (4) After the shaking culture is completed, evenly spread the liquid in the centrifuge tube on the YPD agarose plate and culture it overnight at 30℃.

[0206] Example 4: Identification of gene-edited Kluyveromyces lactis strains

[0207] The tRNA gene contained in the gene editing vector transcribes a specific tRNA that recognizes the stop codon TAG. This gene is not present in wild-type Kluyveromyces lactis strains. Therefore, two specific primers were designed based on this gene sequence, and two primers were designed based on the nearby Kluyveromyces lactis genome, forming two pairs of four primers. The primer sequences are as follows:

[0208] Primer15: GACAAATAGTAGCTCGCGTG (SEQ ID No: 18)

[0209] Primer16: TTCTGATTAGAAGTCAGACGCG (SEQ ID No: 19)

[0210] Primer17: TCCAATGATCTCCCACAGG (SEQ ID No: 20)

[0211] Primer18: TGATGATCAAGAACCACTCG (SEQ ID No: 21)

[0212] The reaction system is: 1 μL of nucleic acid from a single clone, 0.5 μL of Primer 15, 0.5 μL of Primer 17, 10 μL of 2xMix, and 8 μL of ddH2O. Alternatively, the reaction system is: 1 μL of nucleic acid from a single clone, 0.5 μL of Primer 16, 0.5 μL of Primer 18, 10 μL of 2xMix, and 8 μL of ddH2O.

[0213] The response program was as follows: 95°C for 3 min; 95°C for 30 s, 57°C for 1 min, 72°C for 3 min, 35 cycles; 72°C for 5 min; 20°C for 1 min.

[0214] Single clones from the transformation plates were picked, and nucleic acid was extracted before PCR amplification using the two primer pairs described above. PCR products were electrophoresed on a 1.5% agarose gel. Positive strains showed bands using both primer pairs, while negative strains showed no bands.

[0215] The monoclonal strains initially identified as positive after identification were preserved, and their nucleic acids were amplified by PCR using primers designed on two genomes. The resulting PCR products were sequenced by Qingke Biotechnology Co., Ltd. The primers are as follows:

[0216] Primer19:GTCCGCTTCTTACAATGGATACAGTTTCTCGC (SEQ ID No: 22)

[0217] Primer20:CTTTGTTGAACATCATCCCGGTGAGAATGCC (SEQ ID No: 23)

[0218] Sequencing primer: TGACTCTGACTCATTTCTTGCG (SEQ ID No: 24)

[0219] The reaction system was as follows: 1 μL of monoclonal strain nucleic acid; 0.5 μL of primer 5; 0.5 μL of primer 6; 10 μL of 2xMix; and 8 μL of ddH2O.

[0220] The response program was as follows: 95°C for 3 min; 95°C for 30 s, 65°C for 1 min, 72°C for 3 min, 35 cycles; 72°C for 5 min; 20°C for 1 min.

[0221] The sequencing result, ie, the inserted sequence (SEQ ID No: 25), was compared with the theoretical sequence (see FIG3 ). If the inserted sequences of the two sequences were consistent, the tested strain was determined to be a positive strain that had successfully undergone gene editing.

[0222] Example 5: Following a similar procedure, strains 1 to 3 and 5 to 10 were obtained (the insertion sequences of strains 1 to 3 and 5 were SEQ ID Nos: 26 to 29, respectively; the insertion sequences corresponding to strains 6 to 10 were identical to those of strains 1 to 5, differing only in the insertion sites between strains 1 to 5 and 6 to 10).

[0223] Example 6: Lysate Preparation

[0224] The test strain stored in a -80°C freezer was streaked on a YPD plate, and a single colony was picked to inoculate into a 250 mL Erlenmeyer flask containing 100 mL of seed culture medium. The culture was shaken at 200 rpm in a 30°C shaker for 24 h. The seed liquid was transferred to a 1000 mL Erlenmeyer flask containing 400 mL of fermentation medium. The culture was shaken at 200 rpm in a 30°C shaker until the harvest period. The cells were collected by high-speed centrifugation, and cell lysate was prepared under liquid nitrogen protection.

[0225] Example 7: Verification of the expression efficiency of target protein synthesized in vitro by introducing non-natural amino acids

[0226] (1) Configure Protein Factory

[0227] (2) The following cell-free in vitro translation conditions were used:

[0228] Protein Factory 100μl

[0229] Prock (unnatural amino acid) 500mM 1μl

[0230] 3 μl of GFP-TAG-RFP dual fluorescence reporter gene PCR product

[0231] Final concentration of Mapylrs: 5 μM

[0232] Ex485nm / Em535 was used to detect the fluorescence intensity of EGFP, and Ex535nm / Em595nm was used to detect the fluorescence intensity of RFP. The efficiency of the introduction of the unnatural amino acid was determined based on the RFP / GFP ratio and the fluorescence intensity of RFP (see Figures 4-7).

[0233] As shown in Figures 4-5, all the transformed strains can express normally and all show strong RFP fluorescence values, indicating that the transformed strains have successfully achieved the purpose of introducing non-natural amino acids into proteins and have high activity, especially the strain of transformation 1 (wt in Figure 4) has a very high read-through rate. As shown in Figures 6-7, the transformed strains have good fidelity in the process of introducing non-natural amino acids. In particular, the strain of transformation 1 (wt in Figure 6) has extremely high fidelity. It can be seen that the strains obtained by genetic modification of the present invention have a high read-through rate and fidelity for the in vitro expression of non-natural amino acids, have good activity, and have extremely high reference value for the expanded application of the field of in vitro introduction of non-natural amino acids.

[0234] The sequences used in the present invention are shown in Table 1 below

[0235] Table 1

[0236] Based on the above ideal embodiment of this application, and through the above description, relevant staff can make various changes and modifications without deviating from the technical concept of this application. The technical scope of this application is not limited to the content in the specification, and its technical scope must be determined according to the scope of the claims.

Claims

1. A nucleic acid construct, characterized in that: The structural formula of the nucleic acid construct is (I): Z1-Z2-Z3, In the formula, Z1-Z3 are elements used to constitute the structure respectively; Each "-" is independently a bond or a nucleotide linking sequence; Z1 is the promoter sequence; Z2 is none or a connection sequence; Z3 is the gene sequence of inhibitory tRNA.

2. The nucleic acid construct according to claim 1, characterized in that: in, The promoter is selected from tDNA, SNR52, SNR6, Pol III, U6, U3, SCR1, RPR1 or H1.

3. The nucleic acid construct according to any one of claims 1 to 3, characterized in that: The inhibitory tRNA is selected from amber codon tRNA, ochre codon tRNA or opal codon tRNA; preferably amber codon tRNA; further preferably tRNA TAG Pyl .

4. The nucleic acid construct according to any one of claims 2 to 4, wherein the structure of formula (I) is selected from Z1-Z2-tDNA TAG Pyl , the tDNA TAG Pyl Select from wild type or mutant.

5. The nucleic acid construct according to any one of claims 2 to 5, wherein the structure of formula (I) is selected from tDNA-Z2-tDNA TAG Pyl .

6. The nucleic acid construct according to any one of claims 2 to 6, wherein Z2 is selected from a linker sequence, and the linker sequence is selected from CTTTGTTTCT.

7. The nucleic acid construct according to any one of claims 1 to 6, characterized in that The Z3 is a single copy or multiple copy gene sequence of an inhibitory tRNA, and preferably, the number of the multiple copies is less than or equal to 6.

8. A genetically engineered strain, characterized in that: A nucleic acid construct containing at least one inhibitory tRNA gene sequence is integrated into the genome of the strain.

9. The genetically engineered strain according to claim 8, characterized in that: The nucleic acid construct is the nucleic acid construct according to any one of claims 1 to 7.

10. A genetically engineered strain according to claim 8 or 9, characterized in that: The strain is derived from bacteria, mammalian cells, human cells, plant cells, yeast cells, insect cells or any combination thereof.

11. A genetically engineered strain according to any one of claims 8 to 10, characterized in that: The yeast cell is selected from Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia minuta, Ogataeaminuta, Pichia lindneri, Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia g uercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia sp., Saccharomyces cerevisiae. cerevisiae), brewer's yeast, sugar cane molasses yeast, Saccharomyces sp., Hansenula polymorpha, Candida utilis, Kluyveromyces, or a combination thereof.

12. The genetically engineered strain according to any one of claims 8 to 11, characterized in that: The nucleic acid construct is integrated into the genome of the strain via an insertion site, wherein the insertion site is UPF1 or endogenous tDNA.

13. A method for preparing a genetically engineered strain according to any one of claims 8 to 12, characterized in that: The nucleic acid construct is inserted into the genome of the strain via the UPF1 site.

14. A method for preparing a genetically engineered strain according to any one of claims 8 to 12, characterized in that: The nucleic acid construct is inserted into the genome of the strain via 1 to 1000 bp from the 5' end and / or 3' end of the endogenous tDNA sequence; preferably 100 to 800 bp; more preferably 200 to 500 bp.

15. A method for synthesizing a protein incorporating an unnatural amino acid, characterized in that: The inhibitory tRNA is provided by using the genetically engineered strain described in any one of claims 8 to 12.

16. A cell-free synthesis system for synthesizing proteins incorporating unnatural amino acids, characterized in that: The system at least comprises a cell extract, and the cell extract is derived from the genetically engineered strain according to any one of claims 8 to 12.

17. The cell-free synthesis system according to claim 16, characterized in that: The system also includes an aminoacyl tRNA synthetase and an unnatural amino acid.

18. Use of the genetically engineered strain according to claims 8 to 12 or the cell-free synthesis system according to claim 16 or 17 in the cell-free synthesis of proteins incorporating unnatural amino acids.

19. A kit, characterized in that: The kit comprises the components of the cell-free protein synthesis system according to claim 16 or 17.

20. A method for cell-free synthesis of proteins incorporating unnatural amino acids, characterized in that: The method comprises the following steps: step (1), providing the cell-free protein synthesis system according to claim 16 or 17 or the kit according to claim 19; step (2), adding a DNA molecule encoding an exogenous protein to the synthesis system or the kit according to step (1), and obtaining the protein by reaction in the presence of aminoacyl tRNA synthetase and non-natural amino acids.

Images