Methods of screening for secreted functional molecules

Abstract

Disclosed herein are methods, compositions, systems, and kits related to functional testing of soluble polypeptides in a single-cell format.

Description

METHODS OF SCREENING FOR SECRETED FUNCTIONAL MOLECULESCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Appl. No. 63 / 597,530, filed November 9, 2023, and U.S. Provisional Appl. No. 63 / 597,539, filed November 9, 2023. The entire content of both applications is incorporated herein by reference in its entirety.REFERENCE TO A SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (631020_00212_SL_ST26.xml; Size: 27,396 bytes; and Date of Creation: November 11, 2024) is herein incorporated by reference in its entirety.FIELD

[0003] The present technology relates generally to methods and compositions useful for the analysis and screening of soluble polypeptides, for example, as applied to the field of drug discovery, such as for the discovery of antibiotics, anti-bacterial peptides, anti-bacterial antibodies, and peptides that are capable of activating complement or recruiting immune cells. The methods, systems, kits, and compositions disclosed herein provide tools for rapidly, efficiently, and accurately screening and selecting active proteins, or polypeptides such as antibodies or fragments thereof from large libraries.BACKGROUND

[0004] Many assays for drug discovery that analyze soluble protein function require substantial quantities of purified proteins and use low- or medium-throughput (<10,000) assays to test protein function in well plates. Examples include cell-based assays, neutralization assays, or cellular activity-based polypeptide functional activation assays. Most importantly for biotechnology discovery purposes, the process of expressing, purifying, and analyzing protein is not readily compatible with direct selection of functional protein or peptide variants from variant libraries. Important examples of drug classes that often require soluble screening or cell activity-based assays to test for function include antibodies or proteins that neutralize pathogens such asinfectious agents (e.g., bacteria, viruses, fungi and parasites), bind to infectious agents, or target cancer cells. Antibodies can effectively target pathogens by several mechanisms such as by blocking infection (i.e., neutralization), by activating the complement system, by inducing antibody-dependent cell cytotoxicity (ADCC), and / or by recruiting immune cells for antibodydependent cellular phagocytosis (ADCP). Antibody complement systems include a set of immune proteins that when activated result in reduced pathogen activity due to pathogen membrane permeability, increased inflammation, immune cell recruitment / action, and pathogen death. Therefore, a need exists for improved and rapid assays for soluble protein or polypeptide function.SUMMARY

[0005] Disclosed herein are methods, compositions, systems, and kits related to functional testing of soluble polypeptides in a single-cell format.

[0006] In some aspects, a method is provided. In some embodiments, the method comprises (a) contacting an isolated cell with an infectious agent; (i) wherein the isolated cell secretes a test polypeptide, and (b) detecting whether the test polypeptide inhibits the infectious agent from infecting the cell. In some embodiments, step (b) comprises one or more of: (i) detecting the presence or absence of the infectious agent within the isolated cell; (ii) culturing the isolated cell; and (A) detecting whether the cultured isolated cells are alive or dead; (B) measuring the expansion of the cultured isolated cell after a specified time; or (C) detecting an altered cell characteristic of the cell caused by the infectious agent.

[0007] In some embodiments, the isolated cell is screened based on a detection of whether the test polypeptide inhibits the infectious agent from infecting the cell. In some embodiments, the isolated cell comprises a eukaryotic cell, optionally a mammalian cell, a plasma cell, a B cell, an antibody secreting cell, a genetically engineered cell.

[0008] In some embodiments, the infectious agent comprises a bacteria, parasite, fungus, pseudovirus, phage, or virus, for example, in some embodiments, the infectious agent comprises a bacteria, wherein the bacteria comprises one or more of Chlamydia spp., Anaplasma spp., Ehrlichia spp., Rickettsia spp., Orientia spp. And Coxiella spp., Salmonella spp., Francisella spp., Legionella pneumophila, Listeria monocytogenes, Mycobacterium spp., and Yersinia spp.

[0009] In some embodiments, the test polypeptide comprises an antibody, a VHH, a nanobody, a fragment of an antibody, antibody Fc region, or an antigen binding fragment. In some embodiments, the test polypeptide is linked to a chemical moiety that is also isolated with the cell.

[0010] In some embodiments, the infectious agent comprises a detectable marker. In some embodiments, the detectable marker of the infectious agent comprises one or more of a fluorescent marker, an enzyme, a polypeptide, a nucleic acid sequence, or a modified nucleic acid sequence. In some embodiments, detecting the presence or absence of the infectious agent within the cell comprises detecting the detectable marker linked to the infectious agent.

[0011] In some embodiments, the isolated cell comprises a detectable marker. In some embodiments, the detectable marker comprises a fluorescent marker, an enzyme, a polypeptide, a nucleic acid sequence, a transcriptomic signature, an altered cell characteristic, or a modified nucleic acid sequence.

[0012] In some embodiments, the altered cell characteristic comprises a cell size, an expansion rate, a permeability status, presence or absence of a nucleic acid, gene expression, protein expression, carbohydrates, post-translational protein modifications, or a cell morphology.

[0013] In some embodiments, the method comprises one or more of harvesting the cell, sequencing the nucleic acids encoding the test polypeptide, optionally wherein sequencing comprises DNA or RNA sequencing.

[0014] In some embodiments, the isolated cell is a single isolated cell and is in a well of a multiwell plate. In some embodiments, the isolated cell is in a chamber of a chip or wafer, in a droplet, such as an emulsion droplet, or in a NanoPen™.

[0015] In some embodiments, the method further comprises selecting the isolated cell or the microfluid droplet based on a detection of whether the test polypeptide inhibits the infectious agent from infecting the cell. In some embodiments, the selection is performed via flow cytometry or magnetic bead sorting. In some embodiments, step (b) comprises analyzing the isolated cell for one or more altered cell characteristics. In some embodiments, the isolated cell secreting the test polypeptide comprises a single isolated cell secreting the test polypeptide.

[0016] Also disclosed herein are compositions, kits, or systems. In some embodiments, the composition, kit or system comprises: one or more vectors encoding a test polypeptide, optionally, wherein one or more of the vectors are expression vectors, or, optionally, wherein one or more of the vectors are integration vectors. In some embodiments, the encoded test polypeptide comprises an antibody, a VHH, a nanobody, a fragment of an antibody, antibody Fc region, or an antigen binding fragment. In some embodiments, the test polypeptide is linked to a chemical moiety that is also isolated with the cell. In some embodiments, the antibody, VHH, nanobody, fragment of an antibody, antibody Fc region, or antigen binding fragment, or the test polypeptide linked to a chemical moiety is derived from a library of antibodies, or antigen binding fragments. In some embodiments, the composition, kit, or system further comprising a detectable marker linked to, or capable of being linked to, an infectious agent, wherein the detectable marker comprises a fluorescent marker, an enzyme, a polypeptide, or a nucleic acid sequence.

[0017] In some embodiments, the composition, kit, or system further comprising the infectious agent. In some embodiments, the infectious agent comprises a type of bacteria, virus, pseudovirus, parasite, fungus, or phage. In some embodiments, the infectious agent is transgenic or attenuated to reduce its infectious potential. In some embodiments, the bacteria comprises at least one of Chlamydia spp., Anaplasma spp., Ehrlichia spp., Rickettsia spp., Orientia spp. and Coxiella spp., Salmonella spp., Francisella spp., Legionella pneumophila, Listeria monocytogenes, and Yersinia spp. In some embodiments a detectable marker is linked to the isolated cell, wherein the detectable marker linked to the isolated cell comprises a fluorescent marker, an enzyme, a polypeptide, a carbohydrate, or a nucleic acid sequence. In some embodiments, the infected cell exhibits an altered cell characteristic as compared to the non-infected cell, wherein the altered cell characteristic is related to cell size, expansion rate, permeability status, presence or absence of a nucleic acid, gene expression, protein expression, carbohydrates, post-translational protein modifications, or cell morphology.

[0018] In some aspects, a method is provided. In some embodiments, the method includes (a) exposing an isolated cell to a test substrate; (i) wherein the isolated cell secretes a test polypeptide, (ii) wherein the isolated cell and the test substrate are exposed to complement proteins; and (iii) wherein if the test protein binds the test substrate, the complement proteins are activated; and (b) detecting an activation of the complement proteins.

[0019] In some embodiments, step (b) includes detecting an activated complement protein, or an activated complement complex. In some embodiments, step (b) includes providing a detection molecule that specifically binds to an activated complement protein or complement complex, and detecting the detection molecule bound to the activated complement protein or complement complex. In some embodiments, the method includes, after step (b), selecting the isolated cell based on the detection of activated complement proteins.

[0020] In some embodiments, the method includes, before after or during step (b), analyzing either the isolated polypeptide secreting cell or the test substrate for an altered cell characteristic. In some embodiments, the isolated polypeptide secreting cell includes a eukaryotic cell, bacterial cell, fungal cell, or insect cell, optionally a mammalian cell.

[0021] In some embodiments, the isolated polypeptide secreting cell includes an antibody secreting cell, a plasma cell, or a B cell. In some embodiments, the isolated polypeptide secreting cell includes a genetically engineered cell.

[0022] In some embodiments, the test substrate comprises one or more antigens, and includes for examples, one or more of (a) a mammalian, bacterial, fungal, insect, or yeast cell, optionally a cancer cell; (b) an infectious agent, optionally a bacterium, virus, pseudovirus, phage, fungus, yeast, or parasite; (c) an isolated protein, virus-like particle, recombinant viral particle, or nanoparticle; (d) a solid support, bead, polymer, hydrogel, or macromolecule linked to a binding target (e.g., an antigen); or (e) an engineered, biological, or synthetic support linked to a binding target (e.g., an antigen).

[0023] In some embodiments, the test substrate includes a mammalian cell, wherein activation of the complement proteins results in the mammalian cell exhibiting an altered cell characteristic as compared to a mammalian cell where complement proteins are not activated. In some embodiments, the altered cell characteristic includes one or more of cell lysis, phagocytosis, apoptosis, cell size, cell morphology, permeability status, delayed cell growth.

[0024] In some embodiments, the method includes at least complement protein Cl, wherein if the test polypeptide binds to the test substrate, a Cl complex is formed. In some embodiments, testpolypeptide includes an antibody, a VHH, a scFv, a nanobody, a fragment of an antibody, an antibody Fc region, and Fc fusion domain, or antigen binding fragment.

[0025] In some embodiments, wherein the complement proteins include one or more of: Cl, C2, C3, C4, C5, C6, C7, C8, C9, the soluble membrane attack complex (sMAC), any protein fragments thereof, and any combination thereof. In some embodiments, detecting an activation of the complement proteins includes detection of the one or more of complement proteins Cl, C2, C3, C4, C5, C6, C7, C8, C9, the soluble membrane attack complex (sMAC), and / or any protein fragments thereof.

[0026] In some embodiments, the complement proteins are provided in serum. In some embodiments, at least one complement protein is provided as an isolated complement protein. In some embodiments, the detection molecule is linked to the isolated polypeptide secreting cell via a bridge molecule. In some embodiments, the bridge molecule includes a moiety that binds the detection molecule. In some embodiments, the bridge molecule includes streptavidin or avidin. In some embodiments, the detection molecule includes a secondary antibody with a detectable label. In some embodiments, the detection molecule includes a fluorescent marker, an enzyme, polypeptide, or a nucleic acid sequence.

[0027] In some embodiments, the method includes harvesting the cell. In some embodiments, the method includes sequencing the DNA encoding the test polypeptide, optionally wherein sequencing includes whole transcriptome sequencing.

[0028] In some embodiments, the single, isolated polypeptide secreting cell is in a well of a multi-well plate. In some embodiments, isolated polypeptide secreting cell is in a chamber of a chip or wafer. In some embodiments, the isolated polypeptide secreting cell is in a droplet, such as an emulsion droplet, wherein exposing occurs within the droplet. In some embodiments, the isolated polypeptide secreting cell is in a Nanopen™.

[0029] In some embodiments, the method includes selecting the isolated polypeptide secreting cell or the microfluid droplet based on a detection of whether the test polypeptide activates complement. In some embodiments, the selection is performed via flow cytometry or magnetic bead sorting. In some embodiments, the isolated cell secreting the test polypeptide includes asingle isolated cell secreting the test polypeptide. In some embodiments, the test substrate includes an isolated cell, wherein the isolated cell expresses a cell surface molecule that binds the test polypeptide. In some embodiments, the cell surface molecule that binds the test polypeptide comprises an antigen.

[0030] Also disclosed herein are compositions, kits, or systems. In some embodiments, the composition, kit or system includes: a vector encoding a test protein, optionally, wherein one or more of the vectors are expression vectors, or, optionally, wherein one or more of the vectors are integration vectors; and at least one complement protein.

[0031] In some embodiments, the encoded test protein includes an antibody, a VHH, an scFv, a nanobody, a fragment of an antibody, antibody Fc region, an Fc fusion protein, or an antigen binding polypeptide fragment. In some embodiments, the antibody, a VHH, an scFv, a nanobody, a fragment of an antibody, antibody Fc region, an Fc fusion protein or antigen binding fragment is derived from a library of antibodies or antigen binding polypeptide fragments.

[0032] In some embodiments, at least one of the complement proteins are provided in serum. In some embodiments, the composition, kit or system includes a detection molecule capable of binding directly or indirectly to one of the at least one complement protein. In some embodiments, the composition, kit or system includes a bridge molecule capable of linking the at least one complement protein to the isolated polypeptide secreting cell.BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure la-b. (a) SARS-CoV-2 and (b) HIV receptors expression plasmids used to modify cell lines to make them permissible to virus or pseudovirus entry.

[0034] Figure 2. The generation of cells expressing ACE2 and TMPRSS2 for SARS-CoV-2 infection, which are also capable of antibody secretion, to enable large-scale compartment-based library screening for antibody SARS-CoV-2.

[0035] Figure 3. Generating a cell line includes ACE2, TMPRSS2 and IgG genes allowing neutralization assay to be performed in a single cell basis by linking protein secretion (in this case, an IgG) to viral infection along with a functional readout for infection.

[0036] Figure 4a-b. Cell line development for single-cell SARS-CoV-2 neutralization assays, (a) Incorporation of ACE2 and TMPRSS2 into the site-specific TARGATT cell line for transgene insertion, (b) Paired VH:VL library cloning in TARGATT cells.

[0037] Figure 5. Evaluation of SARS-CoV-2 Pseudovirus infectivity using different amounts of virus through flow cytometry analysis.

[0038] Figure 6a-b. Vector maps of (a) pCMV-EFla vector and (b) pBI vector, two examples of vectors that can enable protein or peptide secretion. In this case, the secreted protein is an IgG.

[0039] Figure 7. ELISA quantification comparison of IgG yield for transient IgG expression. Different leader peptide sequence combinations can provide different levels of secreted protein expression.

[0040] Figure 8. The FRT / FLP based site-directed integration system for IgG expression.

[0041] Figure 9. Integrase-based site-directed integration system for IgG expression.

[0042] Figure 10. CRISPR / Cas9 homologous-directed repair system for IgG expression into cell lines for analysis of soluble protein function.

[0043] Figure lla-c. Overview of several possible secreted protein expression platforms for library cloning into mammalian cells for secreted protein assays, (a) Integrase-based transgene insertion; (b) CRISPR / Cas9 homology-directed repair; (c) lentivirus-based library cloning.

[0044] Figure 12a-b. Expression of IgG in a single-directional format, (a) Expression of IgG as single-chain variable fragment, (b) Expression of full IgG in a bi-cistronic format with a p2A cleavage peptide.

[0045] Figure 13. Neutralizing activity of VRC01 and 910-30 via flow cytometry of HEKACE2 cells.

[0046] Figure 14a-b. Linked antibody secretion and SARS-CoV-2 infection for neutralization assays, (a) ELISA standard curve for IgG secreted by HEK293-ACE2. (b) 96-well neutralization assays for HEK293-ACE2 cells expressing neutralizing mAbs (first, second, fifth, and sixth group) or non-neutralizing mAbs (third and fourth group), with two different leader peptides (LP4 or LP5). Secreted mAb concentration is reported above each bar. IgG-secreting cells inhibited pseudovirus infection. 910-30 SARS-CoV-2 ICso is approximately 0.2 pg / mL.

[0047] Figure 15a-b. Single-cell isolation and antibody secretion inside emulsion droplets, (a) Single cells were encapsulated in 80 pm droplets and analyzed by light microscopy, (b) Cells were incubated either in bulk cell culture or inside droplets, where they secreted antibody. Supernatants were recovered and analyzed by ELISA to determine antibody concentrations (avg. + / - st. dev.). The concentration in droplets quickly exceeded 0.5 pg / mL by Day 2. *Extrapolation slightly above the standard curve.

[0048] Figure 16a-c. Example of high-throughput single-cell neutralization assay for mapping natively paired human antibodies against diverse SARS-CoV-2 variants, (a) Single TARGATT- HEK293-ACE2 cells secreting antibodies are captured inside emulsion droplets, (b) After around 24 h of antibody secretion, single cell droplets are merged with SARS-CoV-2 pseudovirus droplets. Cells secreting neutralizing antibody at sufficient concentration are protected from infection, (c) Cells are sorted into GFP- and GFP+ populations. Non-infected GFP- cells can be passaged for multiple screening rounds. DNA amplicons of sorted libraries are recovered for quantitative analysis and subsequent antibody expression. The renewable libraries can be screened repeatedly against diverse SARS-CoV-2 pseudoviruses separately, or against pseudovirus panels, to select for broad vs. strain-specific antibodies.

[0049] Figure 17. Yellow fever virus (YFV) neutralization detection in cells secretion anti- YFV monoclonal antibodies. Cells secreting mAb-17 were protected from YFV RVP infection; cells not expressing mAb-17 were infected by RVPs as demonstrated by expressed GFP after RVP exposure.

[0050] Figure 18a-d. ELISA quantification of antibody expression using different leader peptide and promoter combinations, (a) Table of Leader Peptide Amino Acid Sequences and Leader Peptide Pair Names, (b) Plasmid illustration of minimal human cytomegalovirus(miniCMV) bi-directional promoter to drive expression of heavy and light chains of antibody and dual promoters comprising CMV to express the heavy chain of the antibody and human elongation factor- 1 alpha (Efl a) driving expression of the light chain, (c) Sandwich ELISA quantification of VRC01 transient expression levels with different leader peptide combinations in each vector, (d) Sandwich ELISA quantification of CR3022 transient expression levels with different leader peptide combinations in each vector.

[0051] Figure 19. A CRISPR-Cas9 integration system for antibody secretion in mammalian cells.

[0052] Figure 20. Neutralization was demonstrated using CRISPR-Cas9 integration system for antibody secretion.

[0053] Figure 21. Quantification of cell-secreted antibodies demonstrated the use of CRISPR- Cas9 to achieve antibody secretion.

[0054] Figure 22a-b. Verification of CRISPR-Cas9-based genomic insertion of antibody genes into mammalian cells, (a) Gel electrophoresis of the genomic PCR using a downstream primer set to validate the successful gene-integration, (b) A PCR reaction using a human control primer set as an internal PCR control.

[0055] Figure 23 TARGATT gene integration of the mAb 2-15 sequence.

[0056] Figure 24. Neutralization activity of an anti-SARS-CoV2 antibody, 2-15, secreted from the TARGATT12-15 cells.

[0057] Figure 25. Quantification of antibody secretion from the TARGATT2-15 cells.

[0058] Figure 26a-b. (a) Gel electrophoresis of the genomic PCR using a downstream primer set to validate the successful gene-integration of TARGATT2-15 cells, (b) A PCR reaction using a human control primer set as an internal PCR control (panel b).

[0059] Figure 27. HIV-1 neutralization detection in cells secreting anti -HIV- 1 monoclonal antibodies. Cells secreting VRC34 were protected from HIV-1 pseudovirus infection; cells not expressing VRC34 were infected by pseudovirus as demonstrated by expressed GFP afterW6M.EnV.C2 HIV-1 pseudovirus exposure. n=2 replicates were performed at each condition. The initial cell density was 2,500 cells / well. Dilutions were made with pseudovirus particles; the number of cells and antibody concentrations were held constant across pseudovirus dilutions. WT- wild type, NC-negative control (no pseudovirus particles added).

[0060] Figure 28. Droplet merging using electrocoalescence. Top: Droplet merger is off. Droplets containing cells and droplets containing rhodamine are clearly separated, both in the bright field and when measuring rhodamine fluorescence. Bottom: Droplet merger is on using an electric field, with settings at 1.6 V. Droplet-containing cells merge with rhodamine 110 dye for visibility using microscopy, as shown in rhodamine 110 channel. Arrows indicate the presence of cells inside droplets. No rhodamine is present in the cell-containing droplets when the droplet merger voltage is “off,” whereas rhodamine is present inside droplets containing cells when the droplet merger voltage is “on”, indicating successfully merged droplets.

[0061] Figure 29. PCR amplification of variable heavy chain sequences from cell lines analyzed in high-throughput assays. Cell population libraries were sorted for GFP- or GFP+ expression prior to DNA recovery using a flow cytometer. These data demonstrate our ability to recover the DNA sequences of cells utilized in high-throughput droplet-based cell secretion protein functional assays.

[0062] Figure 30. SARS-CoV-2 droplet neutralization assay implementation with synthetic libraries. HEK293 / ACE2 cells expressing either VRC01, CR3022 910-30 or mAb 1-20 were pooled and single cells were captured and allowed to secrete antibody for 24 hours. Dropletcontaining cells and antibody were merged with droplets containing SARS-CoV-2 D614G RVPs allowing infection for 24 hours. After infection, cells were recovered from the droplets and allowed. Two days later, GFP- / mCherry+ (not infected cells / mAb producing) and GFP+ / mCherry+ (infected cells / mAb producing) cells were sorted. gDNA was extracted from both populations for sequencing, while 10% of the recovered GFP- / mCherry+ cells were expanded for a second round of droplet neutralization assay. Zero reads were observed in GFP+ populations for some clones, reflecting a total lack of infection events for those neutralizing antibody clones and providing the expected outcome with exceedingly high assay precision. Division calculations for clonal fraction of read fold-changes, defined as (GFP- read prevalence / GFP+ read prevalence), can result in adivide by zero error when zero reads are available (indicating complete neutralization inside droplets for certain antibody clones, for example). Mathematically the closest approximation for a divide by zero error would be infinity, however, those fold changes were artificially estimated here at a value of 9,999 for the purposes of comparison to other clones.

[0063] Figure 31. Droplet neutralization assay using HIV-1 pseudovirus with synthetic libraries. TZM / GFP cells expressing either 72A1, VRC01 or VRC34 were pooled. Next, single cells were captured and allowed to secrete antibody for 24 hours. Droplet-containing cells and antibody were next merged with droplets containing HIV pseudoviruses (generated using the sequence BG505.W6M.Env.C2) allowing infection for 24 hours. After infection, cells were recovered from the droplets and allowed. Two days later, GFP- / mCherry+ (not infected cells / mAb producing) and GFP+ / mCherry+ (infected cells / mAb producing) cells were sorted. gDNA was extracted from both populations. The non-neutralizing antibody (72A1) was greatly enriched in the GFP+ population, indicating low neutralization activity. This figure demonstrates the ability to successfully implement neutralization assays inside droplets for HIV-1 pseudovirus assays using NGS analysis of sorted cell libraries.

[0064] Figure 32. An in-droplet assay is implemented to determine the capacity of secreted proteins to activate complement against bacterial cells. A mammalian cell secretes a protein, which in some embodiments is an antibody, which is analyzed for its ability to activate complement in vitro. After co-encapsulation with bacterial cells and allowing sufficient time for the complement cascade to initiate, mammalian cells are then collected to detect whether they contain a complement reagent attached to their cell surface. Optionally, the secreted protein sequences can then be stained and analyzed between the two sorted mammalian cell populations to detect which mammalian cells encode a protein that activates complement pathway systems against bacteria.

[0065] Figure 33. An in-droplet assay is implemented to determine the capacity of secreted proteins to activate complement against cancer cells. A mammalian cell secretes a protein, which in some embodiments is an antibody, which is analyzed for its ability to activate complement in vitro. After co-encapsulation with cancer cells and allowing sufficient time for the complement cascade to initiate, mammalian cells are collected and analyzed for whether they contain a complement reagent attached to their cell surface. Optionally, the secreted protein sequences canbe analyzed between two sorted mammalian cell populations to detect which mammalian cells encode a protein that activates complement pathway systems against cancer cells.

[0066] Figure 34. An in-droplet assay is implemented to determine the capacity of secreted proteins to block bacterial infection in vitro. A mammalian cell secreting a protein, which in some embodiments is an antibody, is analyzed for its ability to inhibit the infection of bacterial cells in vitro. After the assay, mammalian cells are collected and sorted for whether they contain bacterial cells. The secreted protein sequences are analyzed between the two populations, revealing the secreted proteins that successfully inhibit bacterial infection.

[0067] Figure 35. C3b deposition over time for HEK293FT cells that produce m2C7 antibodies (m2C7 HEK-FT) compared with HEK293FT cells that do not produce antibodies (NC HEK-FT). These data demonstrate that C3b deposition on mammalian cells can effectively be used to identify those mammalian cells that secrete complement-activating antibodies. * indicates statistical significance. Statistical analysis was performed by using a paired, two-tailed Student’s t-test with *: p < 0.05.

[0068] Figure 36. Antibody secretion profile from HEK293FT cells that produce m2C7 antibodies (m2C7 HEK-FT) in droplets.

[0069] Figure 37. Antibody secretion profile from HEK293FT cells with exogenous m2C7 antibodies added over time, compared with NC group that contains HEK293FT cells without the addition of bacteria-specific antibody. * indicates statistical significance. Statistical analysis was performed by using a paired, two-tailed Student’s t-test assuming unequal variance with *: p < 0.05. The first bar in each set is 2C7 high bacteria; the second bar in each set is NC high bacteria.

[0070] Figure 38. FACS plot of HEK293FT cells that produce m2C7 antibodies (m2C7 HEK- FT). The m2C7 HEK-FT cells were analyzed at SONY MA900 that were stained with CellTrace Violet and CD19+, and the C3b deposition was detected by anti-C3b antibodies.DETAILED DESCRIPTION

[0071] The present invention is described herein using several definitions, as set forth below and throughout the application.

[0072] Unless otherwise specified or indicated by context, the terms “a,” “an,” and “the” mean “one or more.” For example, “an inhibitor of tumor cell aggregation” should be interpreted to mean “one or more inhibitors of tumor cell aggregation.” In another example, “a cell” should be interpreted to mean one or more cells. In contrast, “a single cell” means only one cell.

[0073] As used herein, “about,” “approximately,” “substantially,” and “significantly” will be understood by persons of ordinary skill in the art and will vary to some extent on the context in which they are used. If there are uses of these terms which are not clear to persons of ordinary skill in the art given the context in which they are used, “about” and “approximately” will mean plus or minus <10% of the particular term and “substantially” and “significantly” will mean plus or minus >10% of the particular term.

[0074] As used herein, the terms “include” and “including” have the same meaning as the terms “comprise” and “comprising” in that these latter terms are “open” transitional terms that do not limit claims only to the recited elements succeeding these transitional terms. The term “consisting of,” while encompassed by the term “comprising,” should be interpreted as a “closed” transitional term that limits claims only to the recited elements succeeding this transitional term. The term “consisting essentially of,” while encompassed by the term “comprising,” should be interpreted as a “partially closed” transitional term which permits additional elements succeeding this transitional term, but only if those additional elements do not materially affect the basic and novel characteristics of the claim.

[0075] As used herein, the terms "protein," "peptide," and "polypeptide" are used interchangeably and refer to a polymer of amino acid residues. The terms encompass amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer. A protein (e.g., test protein a.k.a. test polypeptide) may refer to a polypeptide, a peptide fused to another peptide (e.g., a fusion protein) or a peptide fused to another small molecule. The protein may comprise moieties such as synthetic chemical moieties or moieties found naturally as post translational modifications, or engineered modifications (e.g., detectable labels). The protein may be linked (e g., covalently linked) to a small molecule or exist as an antibody-drug conjugate (ADC).

[0076] The term “amino acid” refers to naturally occurring and synthetic amino acids, as well as amino acid analogues and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, y-carboxyglutamate, and O-phosphoserine. Amino acid analogues refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogues have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.

[0077] The term “microwell” is well known in the art, and typically refers to an enclosed or partially enclosed compartment with its diameter or width in at least one dimension between 0.1 microns and 4,999 microns. Either one, two, or zero of the other dimensions of the microwell may be open and connected to a broader reservoir.

[0078] Disclosed herein are methods, compositions, systems, and kits for the functional screening of soluble protein libraries in a rapid, high throughput, and cost-effective manner. By way of example and as described herein, cells capable of secreting test proteins (e.g., antibodies or antigen binding proteins, or antigen binding fragments of antibodies) are provided. The test proteins are assessed for their ability to (i) activate complement in the presence of complement proteins; or (ii) prevent infection.

[0079] General

[0080] As used herein “test substrate” refers to a substrate comprising a binding target, such as an antigen or infectious agent. Exemplary test substrates include molecules such as a protein, carbohydrate, lipid, nucleic acid, or any combination thereof, cells, viruses (e.g., “infectious agents”), proteins, small molecules, or specific test binding targets linked to a support, such as solid supports, vesicles, viral particles, etc. Thus, in some embodiments a test substrate comprises a support linked to the binding target, e.g., linked to an antigen or infectious agent. Accordingly,the test substrates may include but are not limited to cells (e.g., cancer cells, bacterial cells, fungal cells) parasites (e.g., multicellular parasites, singles cells parasites, or cells isolated from parasites), viruses, viral particles, pseudoviruses, infectious agents, proteins (e.g., antibody fragments, Fc fusion proteins, macromolecules, macromolecular fusions, conjugated polymers), vesicles, (e.g., extracellular vesicles, lipid vesicles) and solid-supports coated with proteins.

[0081] As used herein, the term “support” refers to any material that provides a substrate structure to which binding target (such as a protein, carbohydrate, lipid, nucleic acid, or any combination thereof), can be attached (e.g., a solid support with conjugated polymers). A support or substrate may be, but need not be, solid. Support materials include smooth solid supports (e.g., smooth metal, glass, quartz, plastic, silicon, wafers, carbon (e.g., diamond), and ceramic surfaces), as well as textured and porous materials. Solid supports need not be flat. Supports include any type of shape, including spherical shapes (e.g., beads). Accordingly, exemplary support materials include, but are not limited to, beads (including hydrogel, metal, and polymer beads), nanodiscs, gels, hydrogels, aerogels, rubbers, polymers, and other porous and / or non-rigid materials. A support material or substrate may comprise a biological support. Biological supports may be “natural”, e.g., cells or viruses expressing an endogenous binding target such as an antigen; “engineered” e.g., cells or viruses expressing an exogenous binding target such as an antigen; or “synthetic”, e.g., vesicles, viral particles, etc. comprising a binding target such as an antigen. As such, exemplary biological supports include but are not limited to vesicles, viral particles, cells, proteins, polymers, tissue particles, protein-based nanoparticles, polypeptide aggregates, macromolecules, and the like.

[0082] As used herein, the term “infectious agent” refers to agents that can infect a cell and encompass but are not limited to viruses, pseudoviruses, phage, bacteria, fungi, and parasites. For example, the infectious agent may include obligate intracellular bacteria (e.g., Chlamydia spp., Anaplasma spp., Ehrlichia spp., Rickettsia spp., Orientia spp. and Coxiella spp.) or facultative intracellular bacteria (e.g., Salmonella spp., Francisella spp., Legionella pneumophila, Listeria monocytogenes, Yersinia spp, Mycobacterium spp). In another example, the infectious agent may include the intracellular fungi Histoplasma capsulatum. In another example, the infectious agent may include a form of the parasites Plasmodium falciparum, Plasmodium vivax, Plasmodium spp., ov I.eishmania donovani. The infectious agent may be a single infectious agent (e.g., a single fungalspecies) or multiple infectious agents (e g., a plurality or mixture of bacteria or parasites or viruses). More than one type of infectious agent may contact or be exposed to a cell. For example, a cell may contact or be exposed to a set of bacteria to test for cross-reactivity of a test polypeptide against multiple species. An assay may not necessarily be limited to infectious agents. For example, a cell may contact or be exposed to multiple variants of binding targets (e.g., antigens) that were derived from infectious agents or from cancer cells, regardless of whether or not the binding targets are presented by cells directly.

[0083] Complement system

[0084] As used herein, “complement” “complement system” or “complement cascade” refers to a set of serum and cellular proteins that play important roles in innate and adaptive immunity. There are three major pathways of complement activation. The classical pathway is primarily activated by immune complexes, specifically IgG / IgM antibodies bound to antigen. Other activators include lipopolysaccharide, myelin, polyanionic compounds, C-reactive protein (CRP), and microbial DNA and RNA. The lectin pathway is activated by polysaccharides with freemannose groups and other sugars common to fungi and bacteria. The alternative pathway is mediated by direct C3 activation by “foreign” substances that often include microbial cell wall components. All three major pathways of complement activation converge on the central protein complement component 3 (C3). C3 is a central mediator of inflammation and is activated by most factors that cause inflammation.

[0085] The classical pathway is typically triggered by immune complexes, which are complexes of antigen bound with antibodies, generally belonging to the IgM or IgG isotypes. Immune complexes in turn bind to complement component Cl, which includes Clq, Clr, and Cis. The binding of Clq to an antibody-antigen complex triggers activation of Clr and Cis. Activated Cis then cleaves component C4 to produce C4a and C4b. C4b is capable of covalent attachment to cell surfaces, although only about five percent does so. The remaining 95 percent reacts with water to form a soluble, activated C4b. Component 2 can then associate with C4b, which after which it is activated by Cis to C2a and C2b. C4b and C2a combine to form C4bC2a, the classical pathway (CP) C3 convertase.

[0086] The CP convertase cleaves C3 to form C3a and C3b. Like activated C4b, C3b can covalently bind to cell surfaces or react with H2O and stay in solution. Activated C3b has multiple roles. By itself, it can serve as an opsonin to make the decorated cell or particle more easily ingested by phagocytes. In addition, C3b can associate with C4bC2a (the CP C3 convertase) to form a C5 convertase. The complex, termed C4bC2aC3b is termed the CP C5 convertase. Alternatively, C3b can form the core of another C3 convertase called the alternative pathway (AP) C3 convertase.

[0087] The alternative pathway (AP) is another mechanism by which C3 can become activated. It is typically activated by targets such as microbial surfaces and various complex polysaccharides and other materials. This alternative pathway can also be initiated spontaneously by the cleavage of the thioester bond in C3 by a water molecule to form C3(H2O). C3(H2O) binds factor B, which allows factor D to cleave factor B to Ba and Bb. Bb remains associated with C3(H2O) to form C3(H2O)Bb complex, which acts as a C3 convertase and cleaves C3, resulting in C3a and C3b.

[0088] C3b formed either via this process or via the classical or lectin pathways binds to targets (e.g., on cell surfaces) and forms a complex with factor B, which is subsequently cleaved by factor D and form Bb, resulting in C3bBb, which is termed the alternative pathway (AP) C3 convertase. Binding of another molecule of C3b to the AP C3 convertase produces C3bBbC3b, which is the AP C5 convertase.

[0089] The lectin complement pathway is initiated by binding of mannose-binding lectin (MBL) and MBL-associated serine protease (MASP) to carbohydrates. The MB 11 gene (known as LMAN1 in humans) encodes a type 1 integral membrane protein localized in the intermediate region between the endoplasmic reticulum and the Golgi. The MBL2 gene encodes the soluble mannose-binding protein found in serum. In the human lectin pathway, MASpl and MASP2 are involved in proteolysis of C4 and C2, leading to C3 convertase, which leads to production of a C5 convertase as described above for the CP.

[0090] C5 convertase generated via any of the three pathways cleave C5 to produce C5a and C5b. C5b then binds to C6, C7, and C8, which catalyzes polymerization of C9 to form the C5b-9 membrane attack complex (MAC). The assembling MAC inserts itself into the target cell membrane, forming a pore delineated by a ring of C9 molecules. MAC formation causes cell lysisof invading microbes, MAC formation on host cells can also cause lysis, but not necessarily. Sublytic amounts of MAC on the membrane of cells may affect cell function in a variety of ways. The small cleavage products C3a, C4a, and C5a are anaphylatoxins and mediate multiple reactions in the acute inflammatory response. C3a and C5a are also potent chemotactic factors that attract immune system cells such as neutrophils and macrophages into the area of crisis.

[0091] The term “complement activity” as used herein means the ability to activate the complement system. The complement activity may be measured with assay as described in the section headed “Assays.”

[0092] As used herein, a “complement pathway component” includes proteins from the classical, alternative, and lectin complement pathways, e g., Cl, C4, C2, C3 and fragments thereof, e.g., C4a, C4b, C2a, C2b, C4b, C2a, C3a, C3b, C4c, C4d, iC4b, C3d, C3i, C3dg. Also included are C5, C5b, C6, C7, C8, C9, Clinh, MASP1, MASP2, MBL, MAC, CR1, DAF, MCP, C4 binding protein (C4BP), Factor H, Factor B, C3bB, Factor D, Bb, Ba, C3bBb, properdin, C3bBb, CD59, C3aR, C5aR, ClqR, CR2, CR3, and CR4, as well as other complement pathway components, receptors and ligands not listed specifically herein.

[0093] The complement pathway component may also include the soluble membrane attack complex (sMAC), also known as C5b-9 or TCC) or components thereof. sMAC is generated on activation of complement and contains the C5b, C6, C7, C8, and C9 together with the regulatory proteins clusterin and / or vitronectin. Thus, the complement pathway component may also include clusterin and vitronectin.

[0094] As used herein, a “complement activation product” is a “complement pathway component” fragment as listed in the above paragraph, namely C4a, C4b, C2a, C2b, C4bC2a, C3a, C3b, C4c, C4d, iC4b, C3d, C3i, iC3b, C3c and C3dg. “C5” refers to human complement Component 5. As used herein, Factor C5, Component Factor 5 are synonymous with C5.

[0095] “ C5a” refers to the smaller fragment of C5 having approximately 77-74 amino acids and being about 7 kDa, that is produced when C5 is cleaved by C5 convertase when activated in the complement cascade. “C5b,” refers to the larger fragment of C5 that is produced when cleavedby C5 convertase when activated in the complement cascade. C5b consists of an alpha chain (about 104 kDa) and a beta chain (about 75 kDa) linked by a single disulfide residue.

[0096] For the disclosed methods, the detection of a molecules in any step in the complement pathway is generally sufficient to demonstrate success with detection of complement activation for every step in pathway activation before it. It can be assumed that activation of any given step would allow later steps to proceed, given sufficient time and availability of proteins for the complement cascade to continue. For example, detection of C5a is sufficient to establish the prior generation of earlier steps in the cascade, such as C3 convertase activity and C5 convertase activity. Similarly, detection of C3a at any given time can be assumed to be sufficient to demonstrate that C5 convertase activity will eventually be detectable in a sample. Detection of different steps in the complement cascade can be performed to understand the kinetics of complement pathway activation and the general timeline of complement activity, as well as the kinetics of the complement pathway being activated for a given biological system. The various steps in the complement pathway are known to proceed at different rates across distinct biological systems, and the detection of any specific active step in the complement pathway is sufficient to demonstrate activation of the complement cascade as a whole.

[0097] Methods of Screening

[0098] Alternative approaches for functional analysis of secreted polypeptide molecules currently known in the art (e.g., as shown by the microfluidics functional sorting services sold by the AbCheck company, as well by the example of Lin et al., (Lin, W. et al., (2022). Rapid microfluidic platform for screening and enrichment of cells secreting virus neutralizing antibodies. Lab on a Chip, 22(13), 2578-2589) require multi-cell droplet compartmentalization, along with sorting of a sensor cell and the polypeptide-secreting cell. These dual-cell approaches within a single droplet generally have much lower throughput compared to single-cell droplet systems. Additionally, these platforms present technical complexity to be able to sort and select for droplets containing multiple cells. In contrast, our approach enables the recovery of the polypeptide- secreting cell linked with a selection marker associated with the activity of the polypeptide (e.g., antibody), enabling facile selection of cells that show desired activity.

[0099] Some alternative published approaches may screen secreted polypeptides for the interruption of receptor binding as a proxy signal for polypeptide activity, including virus neutralization (e.g., blocking ACE2 binding to the SARS-CoV-2 fusion protein (see e.g., Shiakolas, A. R., Kramer, K. J., Johnson, N. V, Wall, S. C., Suryadevara, N., Wrapp, D., Periasamy, S., Pilewski, K. A., Raju, N., Nargi, R., Sutton, R. E., Walker, L. M., Setliff, I., Crowe, J. E., Bukreyev, A., Carnahan, R. H., McLellan, J. S. & Georgiev, I. S. Efficient discovery of SARS- CoV-2-neutralizing antibodies via B cell receptor sequencing and ligand blocking. Nat Biotechnol (2022). doi: 10.1038 / s41587-022-01232-2). However, a screen for receptor binding inhibition does not screen for neutralization directly, complement activation, or immune cell recruitment, and there are many antibodies that will be missed from a selection round when screening for the interruption of receptor binding. Also, receptor binding does not always result in preventing infection or complement activation. In contrast, herein we demonstrate the ability to screen for antibodies, antigen binding proteins, and antigen bind fragments of antibodies that neutralize infectious agents, or that activate complement and / or recruit immune cells in the presence of infectious agents, cancer cells, antigens presented on solid supports, or other targeted entities directly using the current technology.

[0100] As disclosed herein, it is highly advantageous to implement high-throughput assays using single cells, rather than multiple cells inside droplets, for enhanced throughput and simplicity for the assay. Additionally, it is advantageous to be able to sort single cells, rather than sorting droplets, because single cells can be sorted using a broader range of cellular equipment and techniques (e.g., many different types of FACS machines available from multiple different vendors), whereas droplet sorting often requires specialized and / or custom equipment to implement. Many hydrogel-based isolation techniques (e.g. the Gel Encapsulated Microenvironment (GEM) technology) also require extra steps that can reduce assay throughput and can provide additional complexity for assay implementation within a hydrogel environment.

[0101] Some alternative approaches perform binding assay screens for polypeptide secreting cells inside droplets (see e.g., Gerard, A., Woolfe, A., Mottet, G., Reichen, M., Castrillon, C., Menrath, V, Ellouze, S., Poitou, A., Doineau, R., Briseno-Roa, L., Canales-Herrerias, P, Mary, P, Rose, G., Ortega, C., Delince, M., Essono, S., Jia, B., lannascoli, B , Goff, O. R.-L., Kumar, R., Stewart, S. N., Pousse, Y, Shen, B., Grosselin, K., Saudemont, B., Sautel-Caille, A., Godina, A.,McNamara, S., Eyer, K., Millot, G. A., Baudry, J., England, P., Nizak, C ., Jensen, A., Griffiths, A. D., Bruhns, P. & Brenan, C. High-throughput single-cell activity-based screening and sequencing of antibodies using droplet microfluidics. Nature Biotechnology 1-7 (2020). doi : 10.1038 / s41587- 020-0466-7), for example, plasma cells secreting antibody. However, these technologies require droplet-based sorting which is complicated and inefficient. In contrast, the present approach allows sorting of cells directly using standard FACS equipment, and is flexible for a broad range of membrane protein-based selections, viral or bacterial neutralization assays, complement assays, and immune cell recruitment assays that show major advantages compared with the technologies described in the prior art. The procedures described here could be implemented with sorting cell droplets on a microfluidic chip as one variant of the procedure (e.g., sorting droplets before breaking the emulsions and collecting the cells), if desired.

[0102] In one aspect of the current disclosure, analysis and screening methods are provided. In some embodiments, the methods include: (a) contacting an isolated cell with an infectious agent, wherein the cell secretes a test polypeptide, and (b) detecting whether the test polypeptide inhibits the infectious agent from infecting the cell.

[0103] As used herein, the terms “inhibit” and “inhibiting” refer to reducing, preventing, or delaying infection of the cell by the infectious agent. The inhibition may be total (e.g., 100% inhibition) or partial (e.g., 50%, 60%, 70%, 80%, 90%, or 95% inhibition).

[0104] By way of example, but not by way of limitation, in some embodiments screening methods include one or more of: (a) detecting the presence or absence of the infectious agent within the cell; (b) culturing the cell and either detecting whether the cultured isolated cell is alive or dead; (c) measuring the population of the cultured isolated cell after a specified time; (d) detecting an altered cell characteristic of the cell caused by the infectious agent.

[0105] In some embodiments, the analysis and screening methods include: (a) exposing an isolated cell to a test substrate, (i) wherein the cell secretes a test polypeptide, (ii) wherein the cell and the test substrate are exposed to complement proteins, and (iii) wherein if the test polypeptide binds the test substrate, the complement proteins are activated. The methods further include (b) detecting an activation of the complement proteins.

[0106] As used herein, the term “screening” or “screening method” refers to the action of examining the cell or a cell population for the presence of one or more cells having a certain genotype or phenotype (e.g., one or more detectable characteristics) and selecting or isolating the cell based on the examination. For example, in some embodiments, screening cells may include selecting cells that secrete a protein that inhibits infection by an infectious agent, or selecting cells shown to secrete a polypeptide that activates complement. Such screening may include, without limitation, an analysis, examination, and / or comparison (to a control cell or population of cells) of cell death, growth rate, and / or expansion rate. Additionally or alternatively, the screening may include the detecting the presence or absence of any observable characteristics or expression / appearance of detectable markers.

[0107] By way of example, but not by way of limitation, in some embodiments screening methods include one or more of: (a) detecting the presence or absence of the infectious agent within the cell; (b) culturing the cell and either detecting whether the cultured isolated cell is alive or dead; (c) measuring the population of the cultured isolated cell after a specified time; (d) detecting an altered cell characteristic of the cell caused by the infectious agent. In other embodiments, screening methods include detecting the activation of complement.

[0108] The methods disclosed herein utilize an efficient platform that allows for rapid and high- throughput testing of candidate molecules. Thus, as used herein, “isolated cell” or “isolated cells” refers to a cell or group of cells that is physically separated from other cells or groups of cells in a reaction vessel, e.g., a multi-well plate, a microchip, a droplet, a microfluidics chip, a NanoPen™, and the like. For example, a single, isolated test polypeptide secreting cell should be interpreted to mean one cell that is separated from other test polypeptide secreting cells. For instance, a single isolated test polypeptide secreting cell may be placed in a container (e.g., a NanoPentm, or a droplet), essentially isolating the cell from other test polypeptide secreting cells.

[0109] In some embodiments, the methods disclosed herein include acquiring or detecting phenotypic and / or genotypic information about the cell after exposure to / contact with an infectious agent, binding target (e g., antigen target), (and concurrent secretion of the test protein). Accordingly, in some embodiments, such detection may be performed by an automated apparatus, e.g., a flow cytometer, fluorometer, luminometer, microscope, digital camera, plate reader,magnetic bead separation apparatus, etc. or by the human eye. In some embodiments, detecting is performed using a technique related to the sequencing of nucleic acids, e.g., Sanger sequencing, next generation sequencing (NGS), single-cell RNA sequencing (scRNA-seq), whole transcriptome single cell sequencing, etc.

[0110] As used herein, "culturing" means maintaining cells (e.g., isolated cells) under conditions selected such that the cells remain viable and able to divide. Such conditions include temperature, pH and culture medium. Typical culture conditions for numerous cell types are well known in the art.[0U1] As used herein, an “isolated cell” refers to any cell capable of being isolated and secreting a test protein, such as an antibody or antigen binding fragment. In some embodiments, an isolated cell is also capable being infected by a test substrate comprising an infectious agent, but for the expression of a test agent. The isolated cell may be any type of eukaryotic cell (e.g., mammalian cell, plant cell, insect cell, avian cell). For example, the isolated cell may be a human primary immune cell (e.g., a plasma cell, activated B cell, or other antibody secreting cell) that secretes an endogenous antibody. In another example, the isolated cell may be a genetically engineered cell that expresses and secretes an exogenous antibody or antigen binding fragment. For example, the isolated cell may include cells from established cell lines that have been genetically engineered to express an antibody or antigen binding fragment including but not limited to Chinese hamster ovary (CHO) cells, human embryonic kidney 293 (HEK293) cells BHK cells, Cos-7 cells, NSO cells, SP2 / 0 cells, YB2 / 0 cells, HT-1080, cells Huh-7, PER.C6 cells, and variants thereof, or others. In some embodiments, B cell lines may be used, for example Raji, ARH-77, MOPC-315, MOPC-21, or others. In other embodiments, an engineered bacterial, yeast, or fungal cell may be used.

[0112] In some embodiments, the isolated polypeptide secreting cell is a genetically engineered cell. As used herein, “genetically engineered”, or grammatical variations thereof, refers to the cell possessing one or more genetic modifications made by the hand of man. Such modifications include, for example, expression from an introduced or exogenous nucleic acid, modification of regulatory regions. Methods of introducing exogenous nucleic acids into eukaryotic cells are known in the art and include but are not limited to, transfection, lipofection, viral transduction,e.g., retroviral, lentiviral, or adenoviral transduction. In some embodiments, genetically engineered cells include nucleic acids that are integrated into the genome of the cell, while in some embodiments, genetically engineered cells include nucleic acids that remain separate from the genome, such as in epi somes.

[0113] In some embodiments, genetically engineered cells include nucleic acids which encode genes of interest operably controlled by one or more promoters or one or more enhancer sequences. In some embodiments, the promoters may have constitutive activity, i.e., the promoters continuously direct transcription of the nucleic acid under its control. Exemplary constitutive promoters include but are not limited to the cytomegalovirus (CMV) promoter and elongation factor la (EFla) promoter. In some embodiments, the one or more promoters are inducible, meaning that they respond to addition of another molecule. Exemplary inducible promoters include tetracycline inducible promoters, cumate inducible promoters, and estrogen receptor-based tamoxifen inducible promoters. In some embodiments, promoters are "strong" promoters, with relatively high levels of expression of the downstream sequence. In some embodiments, promoters are "weak" promoters, with relatively low levels of expression of the downstream sequence. By way of example but not by way of limitation, the mammalian CMV promoter is generally considered to be a strong promoter by those skilled in the art.

[0114] As used herein in some embodiments, a “test protein” or “test polypeptide” refers to a protein of interest secreted by the isolated cell that is, for example, a potential ligand and / or an inhibitor of the infectious agent (e.g., the protein inhibiting infection of a cell by the infectious agent), or that potentially: binds to the test sub state comprising a binding target such as an antigen and / or is needed to activate the complement cascade. The test polypeptide may be an endogenous protein or exogenous protein. For example, the test polypeptide may be an endogenous antibody produced by a primary immune cell (plasma cell or B cell). In another example, the test polypeptide may be an engineered antibody or antigen binding fragment (e.g., an exogenous peptide).

[0115] The antibody or antigen binding fragment may be of one or more of the following formats: IgG, IgM, IgA, Fab, Fc region, single-chain variable fragment (ScFv), Fab’2, very heavy domain (VHH), nanobody, or any fragment or fusion protein thereof. In some embodiments, the antibody may be a bispecific or other multispecific antibody. In some embodiments, the antibodymay be a trispecific antibody. In some embodiments, the secreted proteins may include antibody native heavy:light pairs. In some embodiments, the secreted polypeptide may constitute an Fc fusion protein. In some embodiments, the secreted polypeptide may constitute an Fc domain linked to a chemical moiety that is present in the droplet. In some embodiments, the chemical moiety may also have a barcode to enable identification of the chemical moiety from a library of chemicals. As used herein, “scFv” refers to single immunoglobulin heavy and single immunoglobulin light chain fused by a linker. As used herein, a “nanobody” refers to a protein comprising a single monomeric variable antibody domain. “Fab” fragment refers to the antigen-binding region of an antibody.

[0116] In some embodiments, the test polypeptide includes randomly paired heavy and light chains. In some embodiments, the antibody heavydight expression may be on the same mRNA transcript. In some embodiments, the antibody heavy and light chains may be expressed on separate mRNAs. In some embodiments, a bidirectional promoter may be used in between the heavy and light chain mRNAs. In some embodiments, the test polypeptide may be linked to an additional chemical moiety inside the droplet.

[0117] In some embodiments, the test polypeptide includes antibodies found in antibody gene libraries derived from human patients developed by screening of native human immune libraries. In some embodiments, the antibody gene libraries (e.g., test polypeptides) may be derived from animal sources, including mouse, transgenic mouse, camelid, shark, non-human primate, guinea pig, or other animals. In some embodiments, the antibody gene libraries may be synthetically generated. In certain embodiments, the libraries may include synthetically generated libraries with introduced diversity (for example, via targeted mutagenesis, site-saturation mutagenesis, DNA shuffling, error-prone PCR, somatic hypermutation, or other diversity introducing mechanisms). In some embodiments, the polypeptide library may be based on antibody genes with known activity. In some embodiments, the disclosed methods may be used to select for improved potency, selectivity, or breadth of diversified libraries derived from antibodies with known baseline activity.

[0118] In some embodiments, the test protein, or test polypeptide library variants may have some baseline activity (e g., infection inhibition or activation of complement), and the functional screen described is used to improve its potency, selectivity, or breadth of activity. In someembodiments, the starting protein or peptide library may have uncharacterized activity, and the functional assays described herein are used to characterize the functional activities of variants in the protein or peptide library and select for desired functional variants.

[0119] In some embodiments, the cell may be engineered to introduce genetic diversity to the secreted test proteins between selection rounds. Several mechanisms for introducing genetic diversity are known to individuals skilled in the art, including the expression of activation-induced cytidine deaminase (AID), expression of an error-prone polymerase, or the use of an orthogonal plasmid replication system.

[0120] In some embodiments, the test protein expression promoters may be varied to modulate the secreted protein concentrations, where stronger promoters influence the secreted concentration. Weaker promoters may be used to enable more potent secreted protein selection. In some embodiments, the amount of time of protein secretion may be varied to similarly adjust secreted protein concentrations. In some embodiments, by way of example, a shorter incubation time prior to the addition of test substrate can provide a lower soluble polypeptide concentration in supernatant, thereby selecting for more potently active or protective secreted molecules.

[0121] In embodiments, the complement proteins that are activated and detected include any of the complement proteins described herein including but not limited to C4a, C4b, C2a, C2b, C4b, C2a, C3a, C3b, C4c, C4d, iC4b, C3d, C3i, C3dg, C5, C5b, C6, C7, C8, C9, Clinh, MASP1, MASP2, MBL, MAC, CR1, DAF, MCP, C4BP, Factor H, Factor B, C3bB, Factor D, Bb, Ba, C3bBb, properdin, C3bBb, CD59, C3aR, C5aR, ClqR, CR2, CR3, CR4, sMAC, clusterin, and vitronectin, and any fragments thereof. For example, the detected activated proteins may include C3b, C3a, C5a, C5b, or C5b-9, with one or more activated proteins detected via a label, such as a fluorescent antibody. For instance, the detection of activation of the complement protein may include a detection of a signal of activation of the complement protein (e.g., via a bound fluorescent antibody) over a predetermined value or threshold, or may include the detection of a signal of activation of the complement protein in an isolated cell secreting the test protein over an isolated cell that is either not secreting the test polypeptide or is not in the presence of the test substrate (e g., a control cell). In some embodiments, the detected activated proteins may be identified viaco-incubation with immune cells to detect immune activation. In some embodiments, immune activation may be detected via ADCP or other immune cell function.

[0122] In some embodiments, the method includes screening or testing in the presence of one or more components of complement protein Cl (e.g., Clq, Clr, and Cis). For example, upon binding of the test polypeptide to the test substrate, a complement cascade may be activated, resulting in the appearance or formation of a Cl complex. Detection of the Cl complex may be made via inspection (e.g., visual or electron microscopy), and or labels that bind specifically to the Cl complex and / or Cl proteins as they are organized within the Cl complex.

[0123] In some embodiments, one or more complement proteins are provided inside a droplet. The serum may be sourced from any animal capable of activating complement (e.g., human serum, fetal bovine serum, or calf serum). The serum may be a whole, unfractionated serum that includes an entirety of the available complement proteins, or a fractionated serum that includes a fraction of complement proteins typically available in whole serum. In some embodiments, one or more complement proteins are provided by a synthetic and / or isolated source (e.g., an isolated complement protein). For example, one or more complement proteins may be expressed exogenously by a cell in the assay (e.g., by the isolated cell or by the test substrate). In another example, one or more complement proteins may be expressed in an in vitro system (e.g., bacterial expression system, yeast expression system, or mammalian expression system), purified, then added to the assay. In some embodiments, the assay utilizes complement proteins from both serum and exogenous or in vitro systems.

[0124] In some embodiments, one or more components of the system may include a detectable maker or label. The term “detectable marker,” “marker,” or “label”, as used herein, refers to any compound that can be detected and / or quantified while in or on the surface of a cell (e.g., an isolated cell), infectious agent, complement protein, peptide or nucleic acid useful in the compositions, methods and systems disclosed herein. Generally, the detectable marker may include a nucleic acid sequence, a protein, a fragment of a protein, a nucleic acid, a metabolite, a chemical label or dye, etc. Detectable makers may be expressed by the cell or by an infectious agent and are detectable by detection apparatus, such a fluorometer. For example, the detectable markers may include fluorescent proteins, enzymes, or other detectable gene products (e.g.,proteins, nucleic acid sequences, modified nucleic acid sequences, carbohydrates) expressed by the cell or infectious agent. The cell, infectious agent, or other protein or nucleic acid component may also be labeled directly with a detectable marker (e.g., via preincubating the cell or infectious agent with the detectable marker). Direct labeling methods of cells, infectious agents, proteins, and nucleic acids are well known to the skilled artisan and may include but are not limited to labeling cells or infectious agents with fluorescently labeled peptides, and fluorescent dyes.

[0125] In some embodiments, detectable markers are constitutively expressed in the isolated cell or infectious agent. The expressed detectable markers may also be inducible or otherwise controlled by ON / OFF switching (e.g., tetracycline-dependent promoters). For example, the isolated cell may include an inducible expression construct that induces transcription of an RNA encoding a fluorescent protein under conditions of infection by the infectious agent. In another example, the expression construct is initially induced to transcribe the RNA encoding the fluorescent protein, which becomes uninduced under conditions of infection. Likewise, the infectious agent may include inducible expression constructs that become selectively induced or uninduced after infecting the isolated cell.

[0126] In some embodiments, the delayed cell growth, altered cell morphology, membrane permeation (for example as mediated by the membrane attack complex), or death of the polypeptide secreting cell constitutes a detectable marker. In some embodiments, the recruitment of immune cells, activation of immune cells, or identification of immune-mediated cell activity (e.g., ADCP) constitutes a detectable marker.

[0127] By way of example but not by way of limitation, in some embodiments, the isolated cell and / or nucleic acid encoding a test polypeptide includes a barcode nucleic acid sequence. As used herein, “barcode” or “barcode sequence” refers to a unique nucleotide sequence used to identify a particular cell component or condition (e.g., the test polypeptide). Barcode sequences suitably include sequences that are not found in the genome, transcriptome, exogenous expression vectors, etc. present in the cell in which the barcodes are expressed so as to be readily identifiable.

[0128] In some embodiments, the infectious agent is associated with, or linked to, a detectable marker (e.g., an infectious agent marker). When linked to the infectious agent, the detectable maker allows tracking the infectious agent, e.g., as it infects, or attempts to infect, the isolated cell. Forexample, if the infectious agent infects the isolated cell, the detectable marker linked to the infectious agent may be detected within the isolated cell. In some embodiments, the detectable marker linked to the infectious agent may be activated or otherwise detectable only after the infectious agent has infected the cell. For example, the infectious agent may include a bacterium capable of releasing a mammalian expression vector for a reporter gene (e.g., green fluorescent protein (GFP)) into the infected cell that is subsequently transcribed and translated by the host cell, making the isolated cell detectable via the expressed GFP.

[0129] In some embodiments, the isolated cell is associated with, or linked to, a detectable marker (e.g., an isolated cell marker). The detectable agent linked to the isolated cell is capable of tracking the isolated cell during the screening process. In some embodiments, the detectable agent is active only while the isolated cell is alive and / or healthy. In some embodiments, the method includes using both the detectable marker linked to the isolated cell and the detectable marker linked to the infectious agent (e.g., the detectable markers discernable from each other). For example, the isolated cell may be labeled with GFP, while the infectious agent may be labeled with red fluorescent protein (RFP).

[0130] In some embodiments, the isolated cell and the test substrate are in the presence of a detection molecule that specifically binds to an activated complement protein. As used herein, “detection molecule” refers to a molecule that indicates the presence of an activation of complement. For example, in some embodiments, the detection molecule is a fluorescently labeled antibody that binds specifically an activated form of complement protein (e.g., C5a). Therefore, the detection molecule indicates the state activation of complement near or adjacent to the isolated cell (e.g., within a test volume). Exemplary detection molecules include, but are not limited to, fluorescent proteins, luminescent proteins, enzymes, tagged proteins, nucleic acid sequences. In embodiments, the detection molecule may directly or indirectly bind both the activated complement protein and the isolated cell (e.g., a protein on the surface of the isolated cell). By binding both the complement protein and the isolated cell, the detection molecule positively identifies those cells that secrete complement-activating test polypeptides. In some embodiments, the deposition or presence of complement proteins on the surface of a polypeptide secreting cell is determined by immune cell activation, including but not limited to ADCP.

[0131] In some embodiments, the method includes linking the complement protein to the isolated cell via a bridge molecule. As used herein, a “bridge molecule” is a peptide or compound that has binding sites for binding the isolated cell, such as a cell surface protein of the isolated cell, and to a complement protein (e.g., an activated complement protein). An illustration of the form and use of the bridge molecule is shown in FIGS. 32-33. Cell surface proteins that may be used by the bridge molecule to bind the isolated cell may include but not be limited to CD 19, or other cell surface molecules present on the polypeptide secreting cell such as cytokine receptors, hormone receptors, cell adhesion molecule receptors, and growth factor receptors. The cell surface protein may also be an exogenously expressed protein. Complement proteins targeted by the bridge molecule may include C5a, or any other complement protein described herein. Care can be taken so that the bridge protein does not compete with the detection molecule for binding to the complement protein.

[0132] The structure of the bridge molecule may include proteins and other molecules that allows the bridge molecule to bind both the isolated polypeptide secreting cell and the complement protein, which may include but not be limited to a bispecific antibody, a multispecific antibody, a nanobody, or molecules binding the isolated polypeptide secreting cell and the complement protein that are linked together. For example, the bridge molecule may include a streptavidin molecule that is bound to biotin labeled antibodies for the cell receptor and the complement protein, such as CD19 and C51, respectively, as shown in FIGS 31-32. Other conjugate systems may be used to bind the cell surface receptor-binding protein to the complement protein-binding protein include but are not limited to avidin and crosslinking compounds.

[0133] In embodiments, the use of a bridging molecule to detect soluble proteins is conceptually the same as using a secondary antibody in flow cytometry or ELISA, or performing a sandwich ELISA - these are standard practices to individuals known in the art and have been used extensively to detect soluble proteins and attach them to a surface. In embodiments, the use of a bridging molecule may include the generation of a custom reagent to capture a soluble protein and fix it to a surface, such as a cellular surface, for follow-up detection.

[0134] As described previously, in some embodiments, the method may include determining an altered cell characteristic of the isolated cell. As used herein, a “cell characteristic” or “alteredcell characteristic” may include any informative aspect of the cell (e.g., isolated cell) including but not limited to cell size (e.g., cell volume), cell shape, cell expansion rate (e.g., cell division rate), cell debris, cell morphology, cell membrane (e.g., cell membrane permeability or permeability status), release of cellular contents, and opsonization, DNA sequence (e.g., mutation), RNA sequence (e.g., transcriptome), or protein (e.g., proteome), the recruitment of immune cells, and the alternation of immune cell behavior (e.g. the activation of ADCP). For example, the complement activation on the surface of the isolated cell (e.g., the cell secreting an antibody that binds a receptor on the same cell, activating complement) may cause a detectable change in cell membrane permeability. The cell characteristic may comprise the presence or absence of a nucleic acid, a peptide, a lipid, or a carbohydrate. The cell characteristic may comprise gene expression profiles, protein expression profiles, carbohydrate profiles, lipid profiles, metabolome profiles, and post-translational protein modification profiles. For example, the infection of the isolated cell with the infectious agent may cause slowed cell growth or cell expansion. In another example, the method may include analyzing the cellular nucleic acid (e.g., transcriptome analysis) to identify one or more altered characteristics (e.g., as compared to a control cell). A cell characteristic that is detectable by a detection method may also be considered a detectable marker.

[0135] In some embodiments, the cell characteristic may include the effect upon or interaction with a neighboring immune cell. For example, a volume containing the isolated cell and the infectious agent may also include an immune cell, such as a macrophage or natural (NK) killer cells. Upon infection by the infectious agent, signals released by the infected cell may activate the immune cell to move forward (e.g., be recruited) to the infected cell and possibly engulf (e.g., by phagocytosis) or kill the cell via perforin / granzyme release. Therefore, measurable cell characteristic of the isolated cell may then include either the recruitment of the immune cell toward the isolated cell, or phagocytosis and NK-mediated death of the isolated cell, or detection of agents released by the immune cell (such as perforin / granzyme).

[0136] In some embodiments, the method includes both determining a cell characteristic of the isolated cell and detecting a detectable marker linked to the infectious agent. For example, the method may be include detecting an isolated cell that has successfully inhibited bacterial infection by (1) determining (e.g., via a microscope, by flow cytometry, or by other methods known to those experienced in the art) that the isolated cell has a healthy cell volume, or does not exhibit an alteredcharacteristic indicative of infection, and (2) that no detectable marker derived from the infectious agent is within the isolated cell volume.

[0137] In some embodiments, the cell characteristic may include the effect upon or interaction with a neighboring immune cell. For example, a volume containing the isolated cell and the test substrate may also include an immune cell, such as a macrophage, monocyte, or natural (NK) killer cell. Upon activation of the complement by the test protein, the immune cell may move toward, or may attempt to consume, the test substrate in a detectable manner. Therefore, a cell characteristic of the isolated cell may include recruitment of the immune cell toward the isolated cell and / or test substrate, or phagocytosis and NK-mediated death of the isolated cell and / or test substrate.

[0138] Exemplary fluorescent proteins for use as detectable markers include, but are not limited to, the molecules provided below, and functional variants thereof:

[0139] Green fluorescent protein (GFP), which has the sequence (SEQ ID NO: 1):MSKGEELFTG VVPILVELDG DVNGHKFSVS GEGEGDATYG KLTLKFICTT GKLPVPWPTL 60VTTFSYGVQC FSRYPDHMKQ HDFFKSAMPE GYVQERTIFF KDDGNYKTRA EVKFEGDTLV 120NRIELKGIDF KEDGNILGHK LEYNYNSHNV YIMADKQKNG IKVNFKIRHN IEDGSVQLAD 180HYQQNTPIGD GPVLLPDNHY LSTQSALSKD PNEKRDHMVL LEFVTAAGIT HGMDELYK 238

[0140] Red fluorescent protein (RFP), which has the sequence (SEQ ID NO: 2):MRGSHHHHHH GSAHGLTDDM TMHFRMEGCV DGHKFVIEGN GNGNPFKGKQ FINLCVIEGG 60PLPFSEDILS AAFXNRLFTE YPEGIVDYFK NSCPAGYTWH RSFRFEDGAV CICSADITVN 120VRENCIYHES TFYGVNFPAD GPVMKKMTTN WEPSCEKIIP INSQKILKGD VSMYLLLKDG 180GRYRCQFDTI YKAKTEPKEM PDWHFIQHKL NREDRSDAKN QKWQLIEHAI ASRSALP 237

[0141] Yellow fluorescent protein (YFP), which has the sequence (SEQ ID NO: 3):KGEELFTGVV PILVELDGDV NGHKFSVSGE GEGDATYGKL TLKFICTTGK LPVPWPTLVT 60TFXLQCFARY PDHMKRHDFF KSAMPEGYVQ ERTIFFKDDG NYKTRAEVKF EGDTLVNRIE 120LKGIDFKEDG NILGHKLEYN YNSHNVYIMA DKQKNGIKVN FKIRHNIEDG SVQLADHYQQ 180NTPIGDGPVL LPDNHYLSYQ SALSKDPNEK RDHMVLLEFV TAAGI

[0142] Blue fluorescent protein (BFP), which has the sequence (SEQ ID NO: 4):MSKGEELFTG VVPILVELDG DVNGHKFSVS GEGEGDATYG KLTLKFICTT GKLPVPWPTL 60VTTFXVQCFS RYPDHMKRHD FFKSAMPEGY VQERTIFFKD DGNYKTRAEV KFEGDTLVNR 120IELKGIDFKE DGNILGHKLE YNFNSHNVYI MADKQKNGIK VNFKIRHNIE DGSVQLADHY 180QQNTPIGDGP VLLPDNHYLS TQSALSKDPN EKRDHMVLLE FVTAAGITHG MDELYK

[0143] Cyan fluorescent protein (CFP), which has the sequence (SEQ ID NO: 5; SEQ ID NO:6):MVSKGEELFT GVVPILVELD GDVNGHKFSV SGEGEGDATY GKLTLKFICT TGKLPVPWPT 60LVTTLXVQCF ARYPDHMKQH DFFKSAMPEG YVQERTI FFK DDGNYKTRAE VKFEGDTLVN 120RIELKGIDFK EDGNILGHKL EYNAISDNVY ITADKQKNGI KANFKIRHNI EDGSVQLADH 180YQQNTPIGDG PVLLPDNHYL STQSALSKDP NEKRDHMVLL EFVTAAGITL GMDELYK

[0144] orMVSKGEELFT GVVPILVELD GDVNGHKFSV SGEGEGDATY GKLTLKFICT TGKLPVPWPT 60LVTTLXVQCF SRYPDHMKQH DFFKSAMPEG YVQERTI FFK DDGNYKTRAE VKFEGDTLVN 120RIELKGIDFK EDGNILGHKL EYNYISHNVY ITADKQKNGI KANFKIRHNI EDGSVQLADH 180YQQNTPIGDG PVLLPDNHYL STQSALSKDP NEKRDHMVLL EFVTAAGITL GMDELYK

[0145] mCherry, which has the sequence (SEQ ID NO: 7):MVSKGEEDNM AIIKEFMRFK VHMEGSVNGH EFEIEGEGEG RPYEGTQTAK LKVTKGGPLP 60FAWDILSPQF MYGSKAYVKH PADIPDYLKL SFPEGFKWER VMNFEDGGVV TVTQDSSLQD 120GEFIYKVKLR GTNFPSDGPV MQKKTMGWEA SSERMYPEDG ALKGEIKQRL KLKDGGHYDA 180EVKTTYKAKK PVQLPGAYNV NIKLDITSHN EDYTIVEQYE RAEGRHSTGG MDELYK

[0146] Exemplary luminescent proteins include, but are not limited to:

[0147] Renilla luciferase, which has the sequence (SEQ ID NO: 8):MTSKVYDPEL RKRMITGPQW WARCKQMNVL DSFINYYDSE KHAENAVIFL HGNAASSYLW 60RHWPHVEPV ARCIIPDLIG MGKSGKSGNG SYRLLDHYKY LTEWFKHLNL PKKI IFVGHD 120WGACLAFHYC YEHQDRIKAV VHAESVVDVI ESWDEWPDIE EDIALIKSEE GEKMVLENNF 180FVETMLPSKI MRKLEPEEFA AYLEPFKEKG EVRRPTLSWP REIPLVKGGK PDVVEIVRNY 240NAYLRASHDL PKMFIESDPG FFSNAIVEGA KKFPNTEFVK VKGLHFSQED APDEMGNYIK 300SFVERVLKNE Q

[0148] Firefly (Photinus pyralis) luciferase, which has the sequence (SEQ ID NO: 9):MEDAKNIKKG PAPFYPLEDG TAGEQLHKAM KRYALVPGT I AFTDAHIEVN ITYAEY FEMS 60 VRLAEAMKRY GLNTNHRIVV CSENSLQFFM PVLGALFIGV AVAPANDIYN ERELLNSMNI 120 SQPTVVFVSK KGLQKILNVQ KKLPI IQKI I IMDSKTDYQG FQSMYTFVTS HLPPGFNEYD 180 FVPESFDRDK T IALIMNSSG STGSPKGVAL PHRTACVRFS HARDPI FGNQ I I PDTAILSV 240 VPFHHGFGMF TTLGYLICGF RVVLMYRFEE ELFLRSLQDY KIQSALLVPT LFSFFAKSTL 300 IDKYDLSNLH E IASGGAPLS KEVGEAVAKR FHLPGIRQGY GLTETTSAIL ITPEGDDKPG 360 AVGKVVPFFE AKVVDLDTGK TLGVNQRGEL CVRGPMIMSG YVNDPEATNA LIDKDGWLHS 420 GDIAYWDEDE HFFIVDRLKS LIKYKGCQVA PAELESILLQ HPNI FDAGVA GLPGDDAGEL 480 PAAVVVLEHG KTMTEKE IVD YVASQVTTAK KLRGGVVFVD EVPKGLTGKL DARKIREILI 540 KAKKGGKSKL

[0149] As used herein, “expression” refers to either the transcription of a nucleic acid of DNA into RNA or the translation of said RNA into a protein or polypeptide, or both the transcription of DNA into RNA and translation of said RNA into a protein or polypeptide.

[0150] In some embodiments, the methods of the present disclosure use a single cell as a source of expression for the test polypeptide. In some embodiments, each isolated cell to be screened includes either a primary immune cell expressing a different test polypeptide, or a cell engineered to express a different test polypeptide. Successful inhibition of the infectious agent against the isolated cell by the test polypeptide can be detected by the presence, absence, or level of a detectable marker for either the isolated cell or the infectious agent, or by a cell characteristic or altered cell characteristic of the isolated cell.

[0151] In some embodiments, the test substrate (e.g., infectious agent) is a virus, or is derived from a virus. Exemplary, non-limiting viruses include, for example, Coronavirus A, B, C, D, flaviviruses, lentiviruses, influenza A, B, C, or D viruses, Epstein-Barr virus, herpes simplex virus, cytomegalovirus, respiratory syncytial virus, Ebola virus, Marburg virus, Dengue virus. In some embodiments, the test substrate (e.g., a virus is), or is derived from, human immunodeficiency virus (HIV), yellow fever virus, severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2), Epstein-Barr virus, herpes simplex virus, cytomegalovirus, respiratory syncytial virus, Ebolavirus, Marburg virus, or Dengue virus. In some embodiments, the test substrate (e.g., virus) is a pseudovirus. As used herein, “pseudovirus” refers to a replication incompetent virus, or viral-likeparticle, often based on retroviruses, lentiviruses, e.g., HIV, or vesicular stomatitis virus, which additionally include a key viral factor from another virus, e.g., SARS-CoV-2 surface glycoprotein (spike protein). Thus, the risk of infection to researchers using the pseudovirus is mitigated, compared to the use of wild type virus, while being useful as a tool for the discovery of novel neutralization agents against the wild type virus, as in the methods, compositions, and kits disclosed herein. In some embodiments, the test substrate is a virus-like particle or recombinant viral particle. In some embodiments, the test substrate is a synthetic molecule containing viral molecules, for example viral glycans or viral polypeptides. In some embodiments, the virus is capable of infecting a mammal, a fish, an avian, a plant, an insect, a yeast, or a bacterium. In some embodiments, the test substrate contains phage particles or phage-derived polypeptides.

[0152] In some embodiments, cells or droplets are selected via the presence or absence of the detectable marker of either the isolated cell or infectious agent. For example, isolated cells that infected by infectious agents expressing the detectable marker may be selected from isolated cells that are not infected. Selection may be performed via FACS, magnetic bead separation, or other methods known in the art. The cells may then be collected and / or harvested (e.g., lysed).

[0153] In some embodiments, cells or droplets may be selected via the detection molecule (e.g., a fluorescently labeled antibody binding C5a) and / or the detectable marker (e g., an isolated cell expressing a fluorescent protein). For example, isolated cells that secrete complement activating test polypeptides are labeled with the detection molecule, which may be separated from isolated cells that secrete test polypeptides that do not activate complement. Selection may be performed via FACS, magnetic bead sorting, or other methods known in the art. Once selected, the cells may be harvested, and have either the vector encoding the test polypeptide, the endogenous gene encoding the test polypeptide, a DNA barcode encoded by the test polypeptide, or an entire genome or transcriptome of the selected cell sequenced. Sequencing from multiple cells may then be used to generate libraries of sequences encoding test polypeptides associated with the expression / appearance, or lack of expression / appearance of the detectable marker in the given system. The sequencing may include any sequencing technology including but not limited to traditional Sanger sequencing, Next Generation Sequencing ("NGS") based sequencing, and whole transcriptome single cell sequencing.

[0154] In some embodiments, the test polypeptide-secreting cell may be a bacterial, yeast, fungal, insect, or mammalian cell. In some embodiments, the infectious agent may be a bacteria, yeast, fungal cell, or phage particle.

[0155] In some embodiments, the vector encoding the test polypeptide, the endogenous gene encoding the test polypeptide, a DNA barcode encoded by the test polypeptide sequenced, or an entire genome or transcriptome of the selected isolated cell is sequenced. The sequencing may include any nucleic acid sequencing technology including but not limited to traditional Sanger sequencing, Next Generation Sequencing ("NGS") based sequencing, RNA sequencing, and whole transcriptome single cell sequencing. Thus, in some embodiments, cells that express / contain the detectable maker from either the isolated cell or infectious agent may be separated from those not expressing the detectable marker by methods known in the art (e.g., fluorescence activated cell sorting (FACS), magnetic bead enrichment) and each group sequenced to produce libraries of sequences encoding test polypeptides associated with the expression / appearance, or lack of expression / appearance of the detectable marker in the given system.

[0156] In some embodiments, a readout of the screening method may be based on sequencing of cell populations after screening. In some embodiments, that readout may involve the identification of DNA barcodes linked to the antibodies and / or the test substrate (e.g., infectious agent) as a unique identifier of the antibody or viral infection variant, respectively. In some embodiments, the readout of the assay may be based on a protein tag, fluorescent markers, and sorting via flow cytometry. In some embodiments, the readout of the screening method may involve transcriptomic mRNA sequencing.

[0157] Secreted polypeptide libraries may be generated by methods well known in the art. By way of example but not by way of limitation, in some embodiments, an integrase may be used to insert genes comprising one or more test polypeptides into the cells to generate libraries. In some embodiments, stable cell pools may be used to generate libraries from transfected plasmids. In some embodiments, secreted protein libraries may be generated using a transposase.

[0158] In some embodiments, the isolated cell further includes a cell surface protein that binds the infectious agent (e.g., bacteria, virus, fungi, pseudovirus, phage, parasite) and assists intracellular infection of the infectious agent. The cell surface protein may be or exogenous. Forexample, the cell may be engineered to express a cell surface protein in a cell having little or no endogenous expression of the cell surface protein to increase infection efficiency. Cell surface proteins that act as infection receptors for bacteria include but are not limited to proteins associated with clathrin-dependent endocytosis, proteins associated with caveolin-dependent endocytosis, E- cadherin, and the tyrosine kinase receptor Met. Cell surface proteins that act as receptors for bacteria, fungi, and parasites are less well known than viral receptors, and not all cell receptors for viruses have been identified. Thus bacterial, fungal, viral and parasitic cell surface proteins may include those proteins not yet characterized as receptors for bacteria, fungi, viruses, and parasites. In isolated cells that are readily infected by the infectious agent, the isolated cell may not require or include exogenous expression of a cell surface protein to enable infection.

[0159] In some embodiments, isolated cells enclosed in microfluid droplets are released from the microfluid droplets before selection, or are released from the microfluid droplets after selection. Microfluid droplets can be broken using chemical reagents, including 1H,1H,2H,2H- Perfluoro-1 -octanol, or by other methods known to individuals skilled in the art. Optionally, a compound with potent activity (for example, a neutralizing antibody, a blocking antibody, an antibiotic) can be added to the system to prevent certain new biological activities like infection, complement deposition, or membrane attack complex formation after the droplets are merged together. As one salient example, the droplets are broken, and cells are recovered from droplets in the presence of high concentrations (1 mg / mL) of soluble 910-30 neutralizing IgG to prevent subsequent viral infection once cells were recovered together. As a second salient example, the droplets are broken, and cells are recovered from droplets in the presence of high concentrations (1 mg / mL) of soluble complement-blocking antibody to prevent subsequent complement deposition once cells were recovered together. Optionally, the recovered cells can be cultured for additional seconds, minutes, hours, days, weeks, or months prior to screening.

[0160] In some embodiments of the methods the selected cells are harvested. As used herein, harvesting means collecting the cells, lysing the cells, and / or isolating components of the lysed cells (e.g., isolating the DNA encoding the test polypeptide). The harvest may further include breaking the microfluid droplets. Methods for collecting (e.g., centrifugation), breaking droplets, and isolating DNA are known to the skilled artisan and some non-limiting examples are described herein.

[0161] In some embodiments, a readout of the screening method may be based on sequencing of cell populations after screening. In some embodiments, that readout may involve the identification of DNAbarcodes encoded by the antibodies and / or the test substrate (e.g., infectious agent) as a unique identifier of the antibody or viral infection variant, respectively. In some embodiments, the readout of the assay may be based on fluorescent markers and sorting via flow cytometry.

[0162] In some embodiments, a selectable marker, such as a drug resistance gene product, may be used to select cells (e.g., select cells having a detectable marker or specific cell characteristic). As used herein, “selectable marker” refers to any molecule or cell characteristic which permits the selection of a cell expressing the desired detectable marker or cell characteristic. In some embodiments, the selectable marker confers a survival advantage to the cells expressing the nucleic acid of interest. For example, in some embodiments, the selectable marker confers resistance to antibiotics, e.g., blasticidin, Hygromycin B, puromycin, zeocin, G418 / Geneticin, or others. Thus, treatment of cells with the antibiotic for which molecules conferring resistance are encoded on the nucleic acid of interest, selects cells expressing the nucleic acid of interest and, therefore, acts as a selectable marker. In some embodiments, the selectable marker may induce expression of a surface protein for affinity-based selection, some examples might include CD19, CD4, CD34, and other surface proteins. In some embodiments, the selectable marker may include an enzyme that enables cell survival, including but not limited to apoptosis pathway genes, glutathione S- transferase, antibiotic resistance markers, Bleomycin, Adenosine deaminase, Xanthine-guanine phosphoribosyltransferase, or others. In some embodiments, the selectable marker may be read as a result of Cre-lox or CRISPR gene activation resulting in chromosomal changes. In some embodiments, the selectable marker may constitute a genomic or transcriptomic signature detectable by sequencing.

[0163] In some embodiments, the test polypeptide, or test polypeptide library variants may have some baseline activity (e.g., inhibition of infection by the infectious agent), and the functional screen described is used to improve its potency, selectivity, or breadth of activity. In some embodiments, the starting protein or peptide library may have uncharacterized inhibitory activity, and the functional assays described herein are used to characterize the functional activities of variants in the protein or peptide library and select for desired functional variants. In someembodiments, a reduced, altered, activity or potency, or a more specific level of activity, potency, etc. is desired.

[0164] In some embodiments, the cell may be engineered to introduce genetic diversity to the secreted test polypeptides between selection rounds. Several mechanisms for introducing genetic diversity are known to individuals skilled in the art, including the expression of activation-induced cytidine deaminase (AID), expression of an error-prone polymerase, or the use of an orthogonal plasmid replication system.

[0165] In some embodiments, the test polypeptide expression promoters may be varied to modulate the secreted polypeptide concentrations, where stronger promoters influence the secreted concentration. Weaker promoters may be used to enable more potent secreted polypeptide selection. In some embodiments, the amount of time of polypeptide secretion may be varied to similarly adjust secreted protein concentrations. In some embodiments, by way of example, a shorter incubation time prior to the addition of the infectious agent can provide a lower soluble polypeptide concentration in supernatant, thereby selecting for more potently active or protective secreted molecules.

[0166] In some embodiments, an integrase, transposase, or CRISPR / Cas9 system may be used to insert genes into the cells for cloning libraries. In some embodiments, stable cell pools may be used to generate libraries from transfected plasmids. In some embodiments, secreted polypeptide libraries may be generated using an integrase. In some embodiments, secreted polypeptide libraries may be generated using a transposase. In some embodiments, secreted polypeptide libraries may be generated using CRISPR / Cas9 or related technologies.

[0167] In some embodiments, the test substrate includes, or is, the isolated polypeptide secreting cell. For example, the isolated cell may express both the test polypeptide and a cell surface protein that binds the test polypeptide, potentially activating complement against the isolated cell when the test polypeptide and test substrate (comprising a binding target such as an antigen) are bound. In this manner, the cell is activating complement against itself, however, the cell can still be selected without cell lysis occurring if the complement cascade is prevented from being fully activated (e.g., by the addition of eculizumab or other complement protein inhibitor, diluting the assay volume, or saturating binding sites for the complement cascade). In someembodiments, the cell lysis, permeation, delayed growth, or cell death constitutes a selectable or detectable marker that can be analyzed via sorting or sequencing.

[0168] In some embodiments of the method, single polypeptide secreting cells are isolated into compartments for functional screening of the secreted polypeptide. In some embodiments, the compartments may be 96- or 384 well plates. In some embodiments, the compartments may be printed(4’3)microwells, open microchambers, or Nanopens™. Nanopens are cell-containing devices that include nanoliter-scale wells arranged in an array, and have been commercially available via the Berkeley Lights company. In some embodiments, the nanofluidic chip or microfluidic device includes hundreds or thousands of individual chambers each capable of isolating a single cell. In some embodiments, the nanofluidic device or chip includes 1758 chambers, 3,500 chambers, 11,000 chambers, 14,000 chambers, or 20,000 chambers. Such nanofluidic chips are known in the art and available commercially, BLI OptoSelect™ Chip, BLI OptoSelect™ Chip 1750b, BLI OptoSelect™ Chip 3500, BLI OptoSelect™ Chip l Ik, BLI OptoSelect™ Chip 14K, BLI OptoSelect™ Chip 20k.

[0169] In some embodiments, the method utilizes a microchip (e.g., a “nanofluidic device”, “nanofluidic chip”, “chip”, or “wafer”), which may include fluidically interconnected circuit elements, including but not limited to region(s), flow path(s), channel(s), chamber(s), and / or pen(s) (e g., compartments or Nanopenstm), and at least one port configured to allow the fluid (and, optionally, micro-objects suspended in the fluid) to flow into and / or out of the microfluidic device. Typically, a microfluidic circuit of a microfluidic device will include a flow region, which may include a microfluidic channel, and at least one chamber, and will hold a volume of fluid of less than about 1 mL, e.g., less than about 750, 500, 250, 200, 150, 100, 75, 50, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, or 2 pL. In certain embodiments, the microfluidic circuit holds about 1-2, 1-3, 1-4, 1-5, 2-5, 2-8, 2-10, 2-12, 2-15, 2-20, 5-20, 5-30, 5-40, 5-50, 10-50, 10-75, 10-100, 20-100, 20-150, 20- 200, 50-200, 50-250, or 50-300 pL. The microfluidic circuit may be configured to have a first end fluidically connected with a first port (e.g., an inlet) in the microfluidic device and a second end fluidically connected with a second port (e.g., an outlet) in the microfluidic device. In some embodiments, droplets may be formed by alternative droplet generation technologies such as the Lightcast Discovery system.

[0170] A microchip may include a plurality of circuit elements (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 6000, 7000, 8000, 9000, 10,000, or more). In certain embodiments, one or more (e.g., all) of the at least one circuit elements is configured to hold a volume of fluid of about 100 pL to 1 nL, 100 pL to 2 nL, 100 pL to 5 nL, 250 pL to 2 nL, 250 pL to 5 nL, 250 pL to 10 nL, 500 pL to 5 nL, 500 pL to 10 nL, 500 pL to 15 nL, 750 pL to 10 nL, 750 pL to 15 nL, 750 pL to 20 nL, 1 to 10 nL, 1 to 15 nL, 1 to 20 nL, 1 to 25 nL, or 1 to 50 nL. In some embodiments, one or more (e.g., all) of the at least one circuit elements are configured to hold a volume of fluid of about 20 nL to 200nL, 100 to 200 nL, 100 to 300 nL, 100 to 400 nL, 100 to 500 nL, 200 to 300 nL, 200 to 400 nL, 200 to 500 nL, 200 to 600 nL, 200 to 700 nL, 250 to 400 nL, 250 to 500 nL, 250 to 600 nL, or 250 to 750 nL.

[0171] A “microfluidic channel” or “flow channel” as used herein refers to flow region of a microfluidic device having a length that is significantly longer than both the horizontal and vertical dimensions. The length of the channel is generally defined by the flow path of the channel. In the case of a straight channel, the length would be the “longitudinal axis” of the channel. The “horizontal dimension” or “width” of the channel is the horizontal dimension as observed in a transverse section oriented perpendicular to the longitudinal axis of the channel (or, if the channel is curved, perpendicular to an axis tangential to the flow path of the channel at the plane of the transverse section). The “vertical dimension” or “height” of the channel is the vertical dimension as observed in a transverse section oriented perpendicular to the longitudinal axis of the channel (or, if the channel is curved, perpendicular to an axis tangential to the flow path of the channel at the plane of the transverse section).

[0172] For example, the flow channel can be at least 5 times the length of either the horizontal or vertical dimension, e.g., at least 10 times the length, at least 25 times the length, at least 100 times the length, at least 200 times the length, at least 500 times the length, at least 1,000 times the length, at least 5,000 times the length, or longer. In some embodiments, the length of a flow channel is about 100,000 microns to about 500,000 microns, including any value therebetween. In some embodiments, the horizontal dimension is about 100 microns to about 1000 microns (e.g., about 150 to about 500 microns) and the vertical dimension is about 25 microns to about 200 microns, (e g., from about 40 to about 150 microns). It is noted that a flow channel may have a variety ofdifferent spatial configurations in a microfluidic device, and thus is not restricted to a perfectly linear element. For example, a flow channel may be, or include, one or more sections having, the following configurations: curve, bend, spiral, incline, decline, fork (e.g., multiple different flow paths), and any combination thereof In addition, a flow channel may have different cross-sectional areas along its path, widening and constricting to provide a desired fluid flow therein. The flow channel may include valves, and the valves may be of any type known in the art of microfluidics.

[0173] The microchips may be formed by known methods in the art. The substrates may be formed by several different types of materials, such as silicon, plastic, quartz, glass, plastic, or other suitable materials. Also, it should be appreciated that the size, shape and complexity of the microfluidic channels and structures that can be used in the microfluidic device depends on the materials used and the fabrication processes available for those materials. Typical system fabrication includes making trenches in a conducting material (silicon) or in a non-conducting substrate (e.g., glass or plastic) and converting them to channels by bonding a cover plate to the substrate. The microchips may be manufactured by injection molding using any suitable thermoplastic, for example, polycyclic olefin polyethylene co-polymers, poly methyl methacrylate (PMMA), polycarbonate, polyalkanes and polystyrenes. The microfluidic devices can be fabricated in accordance with the invention by compression molding and casting on a wide range of polymers. Polymers preferred for microfluidic devices are low melt viscosity polymers with minimal amount or number of leachable additives, for example, polycyclic olefin polyethylene copolymers.

[0174] Various layers can be formed to define the walls of the microfluidic channels. For example, the substrate may include various glass layers, and may include an elastomeric layer, wherein two glass layers interfaced to form one or more microfluidic channels. An elastomeric layer may be positioned between glass layers to form one or more microfluidic channels. For example, layers may include borosilicate glasses, pyrex, borofloat glass, Corning 1737, Corning Eagle 2000, silicon acrylic, polycarbonate, liquid crystal polymer, polymethylmethoxyacrylate (PMMA), Zeonor, polyolefin, polystyrene, polypropylene, and polythiols. Depending on the choice of the material different fabrication techniques may also be used.

[0175] In some embodiments, the compartments may be emulsion(6)droplets (See, for example, Figures 15, 16, 18, 28, and 29). In some embodiments, additional reagents may be added to the compartments after a certain amount of time has passed for the desired secreted test polypeptide to accumulate inside droplets. In well plates, reagent addition may occur by fluid addition. In printed(4,5)microwells, open microchambers, or Nanopen™, reagent addition may be accomplished by washing or fluid flow near the unsealed compartment. In emulsion droplets, reagent addition may occur by droplet merger. In some embodiments, droplet merger may be accomplished by electrocoalescence (See Example 26, Figure 29), printed pillar resistance, or other means of induced droplet fusion. In some embodiments, a droplet merger may be achieved using a commercially available device such as those made by Lightcast Discovery. In certain embodiments, the addition of reagents after the initial encapsulation of a library cell comprising a secreted polypeptide variant may be unnecessary.

[0176] In some embodiments, the reagents added to the compartments may contain the test substrate. In some embodiments, only a single test substrate, or single type of test substrate is added (e.g., a single cancer cell, or 10 cancer cells form the same tumor). In some embodiments, multiple test substrates are used. For example, the test substrate may include different strains of a test bacteria.

[0177] Compositions

[0178] In one aspect of the current disclosure, compositions are provided. In some embodiments, the compositions include an isolated cell engineered to secrete a test polypeptide. In some embodiments, the isolated cell includes a detectable marker. Detectable markers for the isolated cell may include but not be limited to a fluorescent marker, a fluorescent dye, a fluorescent moiety, an enzyme, a tagged protein, a cell morphology, a cell feature, cell death, slow growth, a transcriptome feature, or a nucleic acid sequence.

[0179] In some embodiments, the composition includes an isolated cell, that is engineered to both secrete a test polypeptide and express or show a detectable marker or altered cell characteristic if the test polypeptide does not inhibit infection. In some embodiments, the cell is a mammalian cell, an insect cell, an avian cell, a yeast cell, a plant cell, or a bacterial cell. In some embodiments, the cell is a human cell. In some embodiments, secretion of the test polypeptide is constitutive. Insome embodiments, secretion of the test polypeptide is inducible. Tn some embodiments, the test polypeptide is linked to a chemical moiety that may affect the performance of the test polypeptide within the droplet.

[0180] In some embodiments, the isolated cell is in a well of a multi-well plate. In some embodiments, the single, isolated cell is in a chamber of a microchip (e.g., chip or wafer). In some embodiments, the isolated cell is in a microfluid droplet, such as an emulsion droplet. In some embodiments, the isolated cell is in a Nanopen™.

[0181] In some embodiments, the composition includes a primary immune cell (e.g., plasma cell or activated B cell) in a well of a multi-well plate. In some embodiments, the primary immune cell is in a chamber of a microchip. In some embodiments, the primary immune cell is in a microfluid droplet, such as an emulsion droplet. In some embodiments, the primary immune cell is in a Nanopen™.

[0182] In some embodiments, the composition includes a detectable marker linked to the isolated cell and includes a fluorescent marker, an enzyme, a tagged protein, or a nucleic acid sequence. For example, the isolated cell may be engineered to constitutively express GFP. In some embodiments, the detectable marker includes a nucleic acid sequence, optionally a barcode sequence. In some embodiments, the detectable marker includes a fluorescent moiety. In some embodiments, the detectable marker comprises a marker for a chemical moiety within the droplet as well.

[0183] In some embodiments, the test polypeptide includes an antibody, a VHH (e.g., an antigen binding fragment of heavy chain only antibodies), a single-chain Fv, an Fc fusion, a nanobody, or antigen binding fragment thereof. In some embodiments, the antibody or antigen binding fragment is derived from a library of antibodies, or antigen binding fragments.

[0184] In some embodiments, the isolated polypeptide secreting cell is also engineered to introduce new gene diversity to the test protein between selection rounds. Several mechanisms for introducing genetic diversity are known to individuals skilled in the art, including the expression of activation-induced cytidine deaminase (AID), expression of an error-prone polymerase, or the use of an orthogonal plasmid replication system.

[0185] In another aspect of the current disclosure embodiments, the composition includes a vector encoding the test polypeptide. For example, the composition may include a library of vectors encoding a library of test polypeptides. The vector or library of vectors may be expression vectors or integration vectors.

[0186] Kits

[0187] In another aspect of the current disclosure, kits are provided. The kits as described herein may include suitable packaging of the respective components and compositions as disclosed. The kit include or be included within, systems for performing the methods as disclosed.

[0188] In some embodiments, the kits include one or more vectors for the expression of a test polypeptide into a cell, optionally, wherein one or more of the vectors are expression vectors, or, optionally, wherein one or more of the vectors are integration vectors. For example, the kit may include a library of vectors for expression in the isolated cell, each vector encoding a different test polypeptide.

[0189] Additionally or alternatively, in some embodiments, the kit may include at least one complement protein. For example, the kit may include one or more isolated complement proteins. In another example, the kit may include serum that includes complement proteins.

[0190] In some embodiments, the kits provide a vector for the expression of a test polypeptide into a cell and / or a detectable marker linked to the cell or a vector encoding a detectable marker linked to the cell, optionally, wherein one or more of the vectors are expression vectors, or, optionally, wherein one or more of the vectors are integration vectors. The detectable marker linked to the cell may be expressed constitutively or may appear constitutively, or may be induced. The detectable marker linked to the cell may be active or activated when the cell is not infected with an infectious agent, or may be active or activated when the cell is infected with the infectious agent. The test protein may include any type of test protein described herein including but not limited to antibody, a VHH, an scFv, a nanobody, a fragment of an antibody, antibody Fc region, an Fc fusion protein, or an antigen binding fragment. The test protein may be derived from a library of antibodies or antigen binding fragments.

[0191] In some embodiments, the kit includes an infectious agent selected from one or more of a bacterium, a virus, a fungi, or a parasite. In some embodiments, the bacteria is selected from one or more of Chlamydia spp., Anaplasma spp., Ehrlichia spp., Rickettsia spp., Orientia spp. and Coxiella spp., Salmonella spp., Francisella spp., Legionella pneumophila, Listeria monocytogenes, and Yersinia spp.

[0192] As used herein, “expression vector” refers to a vector that is used to express a nucleic acid sequence of interest encoded on the vector. In some embodiments, the expression vector expresses the nucleic acid as an RNA product. In some embodiments, the RNA expression product is translated to a polypeptide or protein. In some embodiments, a chemical moiety is also contained within the droplet that becomes associated with the secreted test polypeptide.

[0193] As used herein “integration vector” refers to a vector that is used to integrate a nucleotide sequence of interest into the genome of a target cell. Exemplary methods of integrating a nucleic acid into the genome of a cell are known in the art, e.g., CRISPR Cas9-based homologous recombination, retroviral or lentiviral transduction.

[0194] In some embodiments, the kit provides the bridge molecule capable of binding at least one complement protein to the isolated polypeptide secreting cell. For example, the bridge molecule may include antigen binding sites for CD19 and C5a.

[0195] In some embodiments, the kit provides a detection molecule capable of binding directly or indirectly to at least one complement protein. For example, the kit may include a fluorescently labeled antibody linked to an anti-C5a antibody. In some embodiments, the detection molecule is capable of binding directly or indirectly to the isolated polypeptide secreting cell. In some embodiments, the kit provides a bridge molecule capable of the binding directly or indirectly to both at least one complement protein and to the isolated cell. For example, the bridge molecule may include antigen binding sites for CD 19 and C5a.

[0196] In some embodiments, the test polypeptide is operably linked to a promoter. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is an inducible promoter. In some embodiments, the test peptide includes an antibody, or a portion thereof. In some embodiments, the test peptide is a single chain variable fragment (scFv) or ananobody. In some embodiments, the detectable marker linked to the polypeptide secreting cell, or the detectable marker linked to a test substrate, includes one or more of a fluorescent marker and a barcode. In some embodiments, the detectable marker is operably linked to an inducible promoter.

[0197] In some embodiments, kit includes the test substrate (e.g., a biding target). The test substrate may include but not be limited to a cell, an infectious agent, a cancer cell, a protein, an antigen linked to solid support, or a vesicle, as described herein.

[0198] In some embodiments, the detectable marker for the isolated cell includes a fluorescent marker, an enzyme, a polypeptide, a cell morphology, a cell phenotype, a transcriptomic signature, a genetic signature, or a nucleic acid sequence. In some embodiments, the detectable marker for secreted polypeptide activity includes a fluorescent marker, an enzyme, a polypeptide, or a nucleic acid sequence.EXAMPLES

[0199] The following Examples are illustrative and should not be interpreted to limit the scope of the claimed subject matter. We note that many of these examples, while specifically describing screening techniques for one type of infectious agent (e.g., viruses) can be easily modified to screen for another type of infectious agent (e.g., bacteria), target antigen, cancer cell, target protein, or other moiety recognized by the secreted polypeptide.

[0200] Example 1 : Establishment of a cell line for concurrent mAb secretion and infection by an infectious agent.

[0201] In this working example, SARS-CoV-2 receptor / co-receptors and anti-SARS-CoV-2 antibody were used as an example application of a neutralization assay performed with the same cell line for both protein secretion and infection by an infectious agent (e.g., viral infection) concurrently. A mammalian cell line was developed, expressing anti-viral antibodies (e.g., the test protein) and their respective viral entry receptors or co-receptors to permit viral infection concurrently with antibody secretion. As an example, virus application, an anti-SARS-CoV-2 antibody and its receptor human Angiotensin-converting enzyme 2 (hACE2) and / or Transmembrane Serine Protease 2 (TMPRSS2) were expressed in a mammalian cell line (Figure1). A bicistronic vector was constructed containing a human cytomegalovirus promoter, the ACE2 surface receptor of SARS-CoV-2 infection, an internal ribosome entry site (IRES), and the TMPRSS2 gene, allowing co-expressing hACE2 and TMPRSS2 in a mammalian expression vector. (The TMPRSS2 gene is optional and is not required for SARS-CoV-2 infection but can enhance the ability of virus to infect some cells). This expression cassette was cloned into a vector with a selectable marker for plasmid transfection, enabling transformed cell selection using the selectable marker. This plasmid was transfected into HEK293 cells by mixing the plasmid with lipofectamine transfection reagents. Two days after, the cell culture media was replenished, and the selection reagent respective to the selectable marker was added to the culture media for initiating the selection process. After 7-14 days, we obtained a stable cell pool, which was resistant to the selectable reagent. Then this pool of cells was stained with both fluorescent-conjugated anti- ACE2 and fluorescent-conjugated anti-TMPRSS2 (Figure 2). Cells were sorted for ACE2 and TMPRSS2 expression and the cells were rested for recovery. After the cell recovery with regular growth, limiting dilution cloning was performed to isolate a single clone. After 10-15 days, the single clone formed a cell colony which was transferred into 24 well plates allowing the cells to expand. After the cell expansion, the clones were stained with antiACE2 and anti-TMPRSS2 and selected the clone with highest ACE2 and TMPRSS2 expression (named, HEKACE2 / TMPRSS2).

[0202] We then transformed these cells to express complete IgG of antibodies with known SARS-CoV-2 neutralization capacity. Alternatively, we could express other IgG fragments such as single-chain variable fragment (Scfv), antigen-binding fragment (Fab), or bi-specific antibody. We cloned the desired antibody or antibody fragment into a mammalian vector with a selectable marker. Followed by transfection and selection with selection marker reagent, the IgG expressing HEKACE2 / TMPRSS2 stable pool was then subjected to limiting dilution cloning to isolate the individual secreted protein expressing clone, which in this case was an antibody IgG. After 10-15 days of cell expansion, we transferred 50 uL of cell culture media to evaluate the IgG expression by direct ELISA. The ELISA was performed by coating the IgG overnight in 96 well plates. The plates were washed with Phosphate-buffered saline with 0.05 % Tween 20 (PBST) and were blocked with 5% BSA in PBST for 2 hours. We washed the plates three times with PBST and added the HRP-conjugated rabbit anti-human Fc antibodies onto the well and incubated for two hours. The plates were washed with PBST four times and the 3,3',5,5'-TetramethylbenzidineLiquid Substrate was added for HRP reaction and stopped with 2M H2SO4 for detection. We analyzedthe plates using a plate reader at the absorbance wavelength of 450 nm. We then compared the absorbance of the IgG expressed by HEKACE2 / TMPRSS2 stable clones with IgG standard to estimate the relative IgG expression yield. We selected the highest IgG expressing clone as our candidate clone. We generated a cell line include ACE2, TMPRSS2 and IgG, allowing a neutralization assay to be performed in a single cell (Figure 3). Several strategies for cell line development can be used (Figure 4).

[0203] Example 2: Quantification of infection against viruses or pseudoviruses in a modified mammalian cell line capable of soluble protein secretion.

[0204] The HEK293 cell line can be used for protein expression or secretion in lab experiments. In this working example, we used a HEK293 cell line with ACE2 expression but no TMPRSS2 expression for the pseudovirus neutralization assay (Named HEKACE2). We infected a HEKACE2 with a strain of lentiviral-based pseudovirus encoding SARS-CoV-2CoV2 spike protein on the viral surface with a GFP reporter gene in the viral expression vector; SARS-CoV-2 pseudovirus infected cells would thus express GFP. We detached the HEKACE2 cells with 0.05 % trypsin and stopped the trypsin reaction with DMEM media with 10% FBS. We then counted the cell density and resuspended cells to a density of 3* 1O5cell / mL and added 100 pL of the cell suspension to each well in the 96 well plate. We retrieved an aliquot of frozen pseudovirus and added various amount of the virus (15 pL, 30 pL, 60 pL and 90 pL) to the 96 wells. The 96-well plates were incubated at 37°C for 48-72 hours before neutralization was quantified by acquiring GFP signal using flow cytometry. As indicated in Figure 5, the percentage of the pseudovirus infected HEKACE2 cells, reflected by the percentage GFP positive cells, correlated to the amount of virus added (Figure 5).

[0205] Example 3: Enabling protein secretion in single cells, with a library of encoded protein variants.

[0206] In this working example, we show methods to enable protein secretion of the test protein in single cells for subsequent protein secretion and assay-based selection. In this example, the secreted protein is an antibody IgG. We can obtain libraries of natively paired antibody heavy and light chain variable regions (VH:VL) from patients SARS-CoV-2 infection as described in the protocol in McDaniel et al(3). We cloned paired VH:VL sequences into a plasmid vector with oneCMV promoter and one EFl alpa promoter (pCMV-EFla, Figure 6) or a vector with a bidirectional promoter (Figure 6, pBI), similar to a format previously described(10,11 12 13 14). The cloning of a VH:VL library into the pCMV-EFla and pBI utilize Notl and Nhel cutting sites to clone the amplicon into the backbone vectors without the promoter and we then cloned in the dual promoters (CMV and EFla) or the bi-directional vector (Bi-CMV) using Nhel and Ncol site on the leader peptide region of the heavy chain and light chain, respectively. Prior studies have shown that changing a protein’s leader peptide can modulate the level of protein expression10’11’12’13’14). We designed different leader peptides to achieve varied levels of protein secretion. We designed three leader peptides that included an Nhel cut site for the heavy chain (Lell, Alb2 and L2B) and two leader peptides that included a Ncol cut site for the light chain (Lei 2 and Albi) (Table 1). We expressed two antibodies (anti -HIV antibody VRC01 and anti-SARS-CoV antibody, CR3022) with six different heavy chain and light chain leader peptide combinations (Table 2) in two different vectors (pBI or pCMV-EFla). We transfected these 24 IgG constructs into HEKACE2 cells (without TMPRSS2 expression) using lipofectamine. Three days post transfection, we detected the IgG expression via ELISA as described in Example 1. As shown in Figure 6, for both VRC01 and CR3022 antibodies, we observed that all leader peptide combinations enable IgG expression, and different leader peptide combinations could be selected for modulation of the concentrations of secreted antibody desired. With LP4 and LP5 we observed the highest two IgG expressions in the pCMV-EFla vector (Figure 7). We generated a stable IgG expressing pool by adding Blasticidin to a final concentration of 5 pg / mL.Table 1: Leader peptide amino acid sequences and DNA sequencesTable 2: Heavy chain and light chain leader peptide combinationsLeader Heavy chain Light chain peptide leader leader pair name peptide peptideLP1 Albi L2BLP2 Albi Lel lLP3 Albi Alb2LP4 Lei 2 Lel lLP5 Lei 2 Alb2LP6 Lei 2 L2B

[0207] Alternatively, we could express the natively paired VH:VL into HEKACE2 derived from the Flip-In HEK293 kit via Flp recombinase-mediated integration at the FRT site (Figure 8). To do so, we would first clone the IgG expression gene cassette into the pcDNA5 / FRT vector. We would then co-transfect the engineered pcDNA5 / FRT vector with Flp recombinase vector pOG44 into the HEK-Flp-In 293 with ACE2 expression. We would generate a library of IgG expressing cells by hygromycin selection. The Flp-mediated cloning has an advantage in that only a single protein variant is encoded by each cell, which is helpful for the selectivity of our assay, although not strictly necessary for assay implementation.

[0208] In an alternative working example, we used an integrase-based gene integration system to express IgG from HEK293ACE cells derived from the TARGATT™-HEK293 master cell lines. We cloned the IgG expression gene cassette into a donor vector containing the integrases recognition site, attB, blasticidin resistance marker and mCherry (Figure 9). We then cotransfected the donor plasmid and integrase expression plasmid into an engineered HEK cell line stably expressing ACE2. The attP landing pad was at the hHll gene locus

[0209] In another working example, we used the CRISPR homologous directed repair platform system to express the IgG in HEK-ACE2 cells. We co-transfected donor IgG expressing cassette (VH: VL sequences with dual promoter or bi-directional promoter) with homologous arms (Figure 10). The gRNA / Cas9 expressing vector provided integration of the natively paired VH:VL sequence into a safe harbor gene locus. Targeted safe harbor loci include CCR5, AAVS1, and Hipp 11 (Figure 10).

[0210] The cloning and transformation methods can be suitably matched to the cell lines, infectious agent, and cell-based functional activity model of interest. Several different cloning and transformation methods can be suitably used for generating libraries of secreted proteins into mammalian or other cells (Figure 11). Other types of cloning can be used to insert nucleic acids for protein secretion into host cells, which can include, without limitation, lentiviral gene transfer, infectious molecular clones, adenoviral vectors, adeno-associated viral vectors, chemical DNA transfection, chemical RNA transfection, mRNA encapsulated by nanoparticles, DNA encapsulated by nanoparticles, or other methods known to the art to induce cell expression of desired proteins and plasmid vectors.

[0211] Example 4: The generation of antibody protein libraries for cloning and soluble antibody functional analysis in VH:VL bidirectional format.

[0212] In this prophetic example, randomly paired VH:VL libraries or mutational VH:VL libraries can be synthesized via a gene synthesis service, where the VH and VL genes of the antibody are linked by a DNA linker. Alternatively, VH: VL gene libraries can be amplified directly from human, mouse, or non-human primate samples, as reported previously(15). In some embodiments, we can introduce diversity into the libraries using error-prone PCR, site- saturation mutagenesis, and / or DNA shuffling. We can clone the VH library by using a combination of Notl and Ncol and clone the VL library by using a combination of Nhel and Asci in a dual promoter (back-to-back format), or we can maintain the bi-directional promoter format as illustrated in Figure 6, by using first Notl and Asci to clone the full construct, and then using Ncol and Nhel to clone in the bidirectional promoter, similar to previous reports(16,17). We can transfect this plasmidinto the HEKACE2 cells for IgG expression. Alternatively, we can clone the gene cassette (dual promoters or bi-directional promoter with a heavy chain and a light chain) into the FLP / FRT based gene integration donor plasmids (Figure 8), integrase-based donor plasmids (Figure 9), or CRISPR / Cas9 donor plasmid for stable IgG integration (Figure 10) into a safe harbor gene locus. Several possible cloning strategies can be used for bidirectional antibody expression (Figure 11).

[0213] Example 5: Methods to enable synthetically generated antibody expression in standard one-direction format.

[0214] We can synthesize randomly paired VH:VL libraries or mutational VEEVL library via gene synthesis service. We can then clone the VH and VL separately into a mammalian expression vector and express the IgG in one open reading frame as illustrated in Figure 12a.IgG can be expressed in a single-chain variable fragment format with GS linker in between the heavy chain and light chain variable region.

[0215] Alternatively, full IgG can be expressed in a bi-cistronic format with a p2A cleavage peptide between the IgG heavy chain and the light chain (Figure 12B) (see Yellow Fever working examples, below). We transfected the plasmid and expressed the IgG.

[0216] We can integrate the one-directional format of IgG into a safe harbor locus expression site. Options for integration include FLP / FRT based gene integration (Figure 8), integrase-based donor plasmid (Figure 9), transposon-based integration, or with the use of CRISPR / Cas9 donor plasmids for stable IgG integration (Figure 10). Several cloning and transformation methods are suitable, depending on the cell line and functional model to be used for the secreted proteins (e.g., Figure 11).

[0217] Example 6: Application of the secreted protein assay in well plates as a compartment for selection of antibodies with viral neutralization properties.

[0218] In this working example, we show a functional assay using secreted protein along with a readout of secreted protein activity in the same cell lines. In this example, the secreted protein is an antibody, and the activity to be assayed is neutralization of SARS-CoV-2 pseudovirus, and the selection marker is GFP

[0219] 2xl04of HEKACE2 cells were seeded in a 96 well plate to reach a confluency of 70% at the time of transfection. Following the protocol included with the Lipofectamine™ 3000 Reagent Kit (Invitrogen), 100 ng of mAb in mammalian expression vector pBI per well was diluted in 5 pL of Opti-MEM™ Reduced Serum Media (Thermo Fisher Scientific), and 0.2 pL of P3000™ Reagent was added. Separately, 0.2 pL of Lipofectamine™ 3000 Reagent was also diluted in 5 pL Opti-MEM™. The diluted DNA was added to the diluted Lipofectamine™ 3000 Reagent and incubated at room temperature for 12 minutes. This DNA-lipid complex was then added to the HEKACE2 cells and incubated at 37°C for 3 days. As the pBI vector contains mCherry on the light chain of the mAb, the cells could be visualized using a fluorescence microscope or flow cytometry following transfection to confirm gene expression. Three days following transfection, the neutralization activity of the antibodies was be measured as described below.

[0220] SARS-CoV-2 Wuhan Hu-1 GFP reporter virus particles (Integral Molecular) were thawed and placed on ice, 60 pL of the reporter virus particles were added directly to the cell media. The 96-well plates were incubated at 37°C for 48-72 hours before neutralization was quantified by acquiring GFP signal using flow cytometry. ELISA analysis of IgG expression indicated that VCR01 has a higher IgG expression level than that of the antibody 910-30(17), an anti-SARS-CoV-2 antibody. Neutralization assay showed that HEKACE2 expressing VCR01 exhibited a higher GFP population than the HEKACE2 cell expressing 910-30 (Figure 13). Similar results were obtained when repeating the experiments (Figure 14). This assay may be modified to assay the neutralization of infectious bacteria.

[0221] Example 7: Selection of neutralizing antibodies from a library of antibodies encoded by cells capable of both antibody secretion and pseudovirus infection.

[0222] In this prophetic example, we generate a mixture of the stable cell lines expressing secreted VRC01 and 910-30, as described in Example 6. We perform limiting dilution isolation to generate single cells in a 96-well plate, with an average of 0.25 cells per well. Cells are permitted to expand for 40 days after the limiting dilution cloning, and then we add 30 pL of pseudovirus for direct neutralization assay. We retrieve the cells and sort the GFP+ populations, which were enriched for cells that were not protected from infection by the antibodies they secrete (i.e., were expressing non-neutralizing antibodies). We also sort the GFP- population to enrich for cellsprotected from infection (i.e., expressing neutralizing antibodies.) We retrieve the paired antibody DNA gene sequences from GFP- and GFP+ populations by extracting the RNA and performing RT-PCR for the antibody genes(22). We perform high-throughput sequencing to obtain the VH:VL information in the GFP- and GFP+ populations. We compare the frequency of antibody variants in each population and determine the neutralization capacity of each antibody in the population(21)pool. We find that VRC01 sequences were comparatively enriched in the GFP+ virus-infected group, whereas 910-30 sequences were comparatively enriched in the GFP- group, and these quantitative signals of selection demonstrate the ability of our secreted protein assays to test for the virus neutralization capacity of encoded antibodies secreted by cells.

[0223] To discover natively paired VH: VL antibodies directly from B cells, we clone the native VH:VL library from SARS-CoV-2 human patient samples into the IgG expressing vector and express in HEKACE2 cells as described in Example 3, Example 4 and Example 5. We perform limiting dilution cloning isolate the single cell in a 96 well with one cell per well. Forty days after the limiting dilution cloning, we add the 30 pL of pseudovirus for direct neutralization assay. We sort the GFP+ population, which was enriched for non-neutralizing antibodies. We sort the GFP- population to enrich the population for neutralizing antibodies. We retrieve the paired antibody DNA gene sequences from GFP- and GFP+ populations by extracting the RNA and performing RT-PCR for the antibody genes(22). We perform high-throughput sequencing analysis to obtain the VH:VL information. We compare the frequency of antibody variants in each population to determine the identify of neutralizing antibodies in the population(21).

[0224] Example 8: Application of secreted protein functional assays in printed microchambers as a compartment.

[0225] In this prophetic example, we first generate the paired VH:VL expressing HEKACE2 cells by one of the methods described in Example 3, Example 4, and Example 5. A population of cells is added into 125-pl wells molded in polydimethylsiloxane (PDMS) slides(2). Each slide contains 1.7 x 105wells; we process four slides simultaneously to include 68,000 IgG expressing HEKACE2 / TMPRSS2 cells at an approximately 1 : 10 cell-to-well ratio occupancy, enabling a greater than 95% probability of single-cell per well according to Poisson statistics. We incubate the slide at 37 °C 5% CO2 incubator for overnight, allowing IgG secretion. SARS-CoV-2pseudovirus is deposited over the microwells to diffuse inside and the PDMS slides are sealed with a dialysis membrane. We incubate the slides for 16 hours allowing the virus entry to the cells. The slides are washed, and the live cells are recovered from the slides in the presence of high concentrations (1 mg / mL) of soluble 910-30 neutralizing IgGto prevent subsequent viral infection once cells are pooled together. The cells are seeded into a 24 well plate to recovery and expand at 37 °C 5% CO2 incubator for two days. We centrifuge the cell and resuspend in FACS buffer. We recover GFP- and GFP+ populations and extract the RNA and performing RT-PCR for the antibody genes(22). We perform high-throughput sequencing analysis to obtain the VH:VL information. We compare the frequency of antibody variants in each population to determine the identify of neutralizing antibodies in the population(3 21)as described in Example 6.

[0226] Alternatively, we screen the anti-SARS-CoV-2 neutralizing antibody via Lightning Optofluidic System. We load the IgG expressing HEKACE2 / TMPRSS2 cells onto the OptoSelect™ chip with NanoPen™ chamber to isolate them in a one-cell-per-chamber basis and incubate overnight for cells to secret antibody. The SARS-CoV-2 pseudovirus is added to the chambers and incubate for three days. The live cells are recovered from the Nanopens™ in the presence of high concentrations (1 mg / mL) of soluble 910-30 neutralizing IgG to prevent subsequent viral infection once cells are recovered together. We isolate GFP- and GFP+ populations using fluorescence activated cell sorting (FACS) and extract the RNA and perform RT-PCR for the antibody genes(22). We perform high-throughput sequencing analysis to obtain the VH:VL information. We compare the frequency of antibody variants in each population to determine the identify of neutralizing antibodies in the population(3,21)as described in Example 6.

[0227] Alternatively, the screen includes replacing HEKACE2 / TMPRSS2 cells with test protein-expressing cells and incubating the cells in the presence of bacteria labeled with or expressing GFP. After incubation, we isolate GFP- and GFP+ populations using fluorescence activated cell sorting (FACS) and extract the RNA and perform RT-PCR for the antibody genes, as above.

[0228] Example 9: Application of the assay in emulsion droplet systems.

[0229] In this working example, we used a microfluidic device to encapsulate the IgG expressing HEKACE2 cells in cellular secretion media to form droplets with one cell perdroplet(6’2?’26). An example of cell isolation and antibody secretion using CHO cells transiently transfected for antibody secretion is shown in Figure 15.

[0230] We implemented this system for SARS-CoV-2 secreted protein neutralization assays using HEKACE2 cells. The workflow for neutralization assays using cells secreting proteins inside emulsion droplets is shown in Figure 16. We incubated the droplet for between 4 and 96 hours, although a broader time scale can also be used, allowing the secretion of the secreted protein (in this example, IgG) within the droplet. Subsequently, a second droplet containing SARS-CoV-2 pseudovirus was merged into the droplet with IgG expressing HEKACE2 cells. We used electrocoalescence to merge droplets(24), although alternative droplet merging methods are also known to persons skilled in the art and include micropillar resistance arrays. The merged droplets were further incubated for another 4-96 hours to allow pseudovirus infection or neutralization to occur, although a broader time scale can also be used. The droplets were broken, and the cells were recovered.

[0231] Droplets can be broken using chemical reagents, including 1H,1H,2H,2H-Perfluoro-1- octanol, or other methods known to individuals skilled in the art. Optionally, a potently neutralizing compound (for example, a high concentration of neutralizing antibody) can be added to the system to prevent any new pseudovirus infections after the droplets are merged together. As one salient example, the droplets are broken, and cells are recovered from droplets in the presence of high concentrations (1 mg / mL) of soluble 910-30 neutralizing IgG to prevent subsequent viral infection once cells were recovered together. Optionally, the recovered cells can be cultured for additional hours, days, weeks, or months prior to screening. Next, we isolated GFP- and GFP+ cell populations using fluorescence activated cell sorting (FACS) and extracted the RNA and performed RT-PCR for the antibody genes(22). We will perform high-throughput sequencing analysis to obtain the VH: VL information in the GFP- and GFP+ cell groups. We will compare the frequency of antibody variants in each population to determine the identify of neutralizing antibodies in the population(3,21)as described in Example 6, where GFP- cells are enriched for encoding antibodies that provide protection against SARS-COV-2 pseudovirus infection, whereas GFP+ cells are enriched for encoding antibodies that are not protective against SARS-CoV-2 or that do not express at sufficient quantities to provide protection inside droplets under the assay conditions used.

[0232] In a prophetic alternative, the screen includes replacing HEKACE2 / TMPRSS2 cells with test protein-expressing cells, encapsulating the cells via the microfluidic device , and incubating the cells in the presence of bacteria labeled with or expressing GFP. After incubation, the droplets are broken and GFP- and GFP+ populations are selected using fluorescence activated cell sorting (FACS) and extract the RNA and perform RT-PCR for the antibody genes, as above.

[0233] Example 10: Neutralizing antibody discovery from native antibody libraries(9’16,17,19).

[0234] In this prophetic example, we obtain the natively paired VH:VL library using a native paired VH:VL sequencing platform. The VH:VL amplicon can be delivered as IgG or IgG fragments via random gene integration using plasmid transfection and resistance gene marker selection, as well as via site-specific integration, as described in Example 3. We screen potent SARS-CoV-2 neutralizing antibodies using multiple methods for single cell isolation, including single cell isolation into well plates (Example 7), printed chambers (Example 8), or microfluid droplets (Example 9). We then sort the GPF- and GFP+HEKACE2 cells and perform RT-PCR to obtain paired VH:VL amplicons from each cell population. We perform PCR to add a primer barcode for next-generation sequence analysis of antibody populations, as described previously(16-17-19).

[0235] We choose 10 of the most prevalent VH:VL clones enriched in the GFP negative population and for gene synthesis. We then performed transient transfection of plasmids to express IgG in a suspension of Expi293 cells. 7 days after transfection, we centrifuge the culture and transfer the supernatant into 50 mb centrifuge tube. We add 0.5 mL of protein G resin and allow the reaction to carry on a bench rotator for 2 hours. We then pour the reaction mixture into the polypropylene columns to retain the protein G resin. We then elute IgG with 0.1 M glycine-HCl, pH 2.7 and neutralize the pH with IM Tris-HCl, pH 9.0. The purified IgGs are then concentrated and subjected to neutralization assay analysis of individual IgG. We quantified the IgG protein concentration by BCA protein assay. We then analyze the purity of the IgG by mixing 2pg of purified IgG with SDS-page sample buffer and run through the TGX Stain-Free Precast Gel. We perform serial dilution of the antibodies from 10 pg / mL to a final concentration of 0.001 pg / mL. We combine serially diluted antibodies with 30 pL SARS-CoV-2 pseudovirus and incubate the reaction for an hour at 37 °C. We then add the virus-antibody mixture into a 96 well with 2xl05ACE expressing HEK293 cells. We incubate at 37 °C 5% CO2 for three days . We analyze the antibodies' neutralization activity via flow cytometry analysis of the GFP signal to demonstrate the recovery of neutralizing antibodies that are enriched in the GFP- cell population.

[0236] Example 11 : Antibody library variant expression and directed evolution selection for potent neutralizing antibodies.

[0237] In this prophetic example, we mutate an anti-SARS-CoV-2 antibody by one of the methods from DNA shuffling, error prone-PCR, single-site directed mutagenesis to generate antibody variant libraries. To increase the mutational landscape, we can further perform combinatorial and / or sequential mutation. We clone the synthetic antibody mutant libraries into HEKACE2 cells described in Example 3. We screen the SARS-CoV 2 neutralizing antibodies by one of the approaches delineated in Example 7, Example 8 and Example 9. After the sorting of GFP- and GFP+ cells and subsequent recovery of the VH:VL sequences information via RT-PCR from the GFP-negative IgG-expressing HEKACE2 cells (enriched for secretion of neutralizing antibodies) , we re-deliver the screened VH:VL gene into the IgG expressing vectors detailed in Example 3 (named enriched IgG libraries) for subsequent rounds of screening. We can also perform sequential mutation using DNA shuffling, error prone-PCR, single site directed mutagenesis to enhance the diversity between screening rounds; other DNA sequencing and library diversity generation strategies can also be used and are known to those skilled in the art. We express both enriched libraries and enriched plus mutated IgG libraries on an IgG expressing platform, as presented in Example 3. We re-screen and obtain the neutralizing antibodies VH:VL sequences using methods described in Example 7, Example 8 or Example 9. We repeat the re-delivery and screen of enriched libraries for subsequent rounds to further enrich for neutralization potency, until a molecule with the desired neutralization potency is obtained. This process of re-screening, mutation, and re-delivery enables directed evolution selection for potently neutralizing antibodies.

[0238] Example 12: Antibody variant neutralization of many viral strains sequentially.

[0239] In this prophetic example, we use SARS-CoV-2 Wuhan Hu-1 strain as our pseudovirus for neutralization analysis to isolate the neutralizing antibodies from method described in Examples 10 and 11. We can recover the neutralizing IgG libraries expressing HEKACE2 cells through recovering the GFP- cells. We use another virus mutation variant such as S-D614G variantto perform sequential neutralization screening (Defined as second round) via cell isolation platforms as described in Example 7, Example 8 or Example 9. After the second round of screening, the populations are enriched for antibodies that exhibit neutralizing capabilities against both Wuhan Hu-1 and D614G.

[0240] Alternatively, after the FACS post sorting of GFP negative cells we extract the RNA from these cells and perform RT-PCR to obtain the VH:VL sequences. We then re-deliver the VH:VL pair into the HEKACE2 cells described at Example 3 to generate the secreted protein library after a single library sort. We then perform the second round of screening using the pseudovirus variant contain D614 mutation. These methods allow for the selection of neutralizing antibodies targeting multiple viral strains of interest.

[0241] Example 13: Antibody variant neutralization with many viral strains concurrently.

[0242] In this prophetic example, perform the pseudovirus neutralization using multiple virus strains at the same time. We first mix an equal amount of the virus from broad coronavirus strains, including SARS-CoV-2, SARS-Cov-2-D614G, SARS-CoV-1, MERS-CoV, with each pseudovirus contain YFP, GFP, DsRed and CFP, respectively. Alternatively, we can use different viral strains all derived from different SARS-CoV-2 variants (e.g., B.1.1.7, B.1.351, P.1, B.1.427, and B.1.429). In some embodiments, all viruses encode for the same reporter (e.g., GFP). In some embodiments, each virus encodes for a different DNA or RNA barcode that the target cells will express after infection. In some embodiments, authentic virus is used. In some embodiments, pseudovirus is used. We perform neutralization assays of antibody libraries with mixture of viral strains based on approaches described in Example 7 (multiple well plates based ), Example 8 (microchamber based) or Example 9 (microfluidic droplet based). For multiple-well plate assay in Example 7, we choose the well-containing cells showed no YFP, GFP, DsRed and CFP as candidate cells that express antibodies with broad neutralization. Other fluorescent markers can be used and are known to those skilled in the art. In both microchamber (Example 8) and microfluidic droplet-based methods (Example 9), after we retrieve cells from either microchambers (Example 8) or droplets (Example 9), we rest and expand cells for another 48 hours (the cells can be rested for any amount of time between 0 hours and multiple months depending on the experimental preference). We sort the cells with no YFP, GFP, DsRed and CFP expression, and also the cells that show fluorophore expression(i.e., were infected). We obtain the VH:VL pairing information of each population through RT- PCR gene recovery and high-throughput sequencing. We compare the sequences of both screening populations, and we then express the candidate antibodies enriched in the populations no YFP, GFP, DsRed and CFP from the HEK293Expi cells and purify the antibody for quantification. We evaluate individual antibody’s neutralization capability against SARS-CoV-2, SARS-Cov-2- D614G, SARS-CoV-1, and MERS-CoV according to the method described in Example 10.

[0243] Example 14: Antibody variant neutralization with many different viruses concurrently.

[0244] In this prophetic example, we perform the pseudovirus neutralization using multiple different virus types at the same time. We first mix an equal amount of the virus from different strains, including SARS-CoV-2, SARS-Cov-2-D614G, YFV, and DENV-1, with each pseudovirus contain YFP, GFP, DsRed and CFP, respectively. In some embodiments, all viruses encode for the same reporter (e.g., GFP). In some embodiments, each virus encodes for a different DNA or RNA barcode that the target cells will express after infection. In some embodiments, authentic virus is used. In some embodiments, pseudovirus is used. A cell line is generated that can be infected by any of the viruses used. In some embodiments, a cell that can be infected with SARS-CoV-2, SARS-Cov-2-D614G, YFV, and DENV-1 is generated by starting with Raji-DC-SIGN cells, which are used for in vitro infections with YFV and DENV-1 recombinant viral particles (RVPs) and modify Raji-DC-SIGN to express the ACE2 protein that enables infection also with SARS-CoV- 2. We next clone a library of antibodies to express and secrete antibody from the modified Raji- DC-SIGN-ACE2 cells and perform neutralization assays of antibody libraries with mixture of viruses based on approaches described in Example 7 (multiple well plates based ), Example 8 (microchamber based) or Example 9 (microfluidic droplet based). For multiple-well plate assay in Example 7, we choose the well-containing cells showed no YFP, GFP, DsRed and CFP as candidate cells that express antibodies with broad neutralization. In both microchamber (Example 8) and microfluidic droplet-based methods (Example 9), after we retrieve cells from either microchambers (Example 8) or droplets (Example 9), we rest and expand cells for another 48 hours (although cells can be rested from anywhere in between 0 hours and multiple months, depending on the preferences of the experiment).

[0245] Alternatively, the assay may be modified to perform bacterial neutralization using multiple different strains or species at the same time.

[0246] We sort the cells with no YFP, GFP, DsRed and CFP expression, and also the cells that show fluorophore expression (i.e., were infected). We obtain the VH:VL pairing information of each population through RT-PCR gene recovery and high-throughput sequencing. We compare the sequences of both screening populations, and we then express the candidate antibodies enriched in the populations no YFP, GFP, DsRed and CFP from the HEK293Expi cells to determine the sequences of neutralizing antibodies using a high-throughput assay. In some embodiments, each virus encodes a cell-specific barcode that encodes for the virus type, allowing for a high- throughput DNA-based readout of the infecting viruses in the library of bulk or single cells, in addition to high-throughput analysis of the antibody gene sequences in the infected or non-infected antibody populations. In some embodiments, single cell sequencing is used to link the barcode of the infecting virus to the DNA sequence of the antibody directly.

[0247] Example 15: Antibody expression with different leader peptide and promoter combinations.

[0248] In this working example, we tested the ability of HEK293 cells expressing ACE2 to be transiently transfected with plasmids containing 910-30 expressed with different leader peptide combinations (LP1, LP4, LP5 and LP6) for antibody secretion. Lipofectamine 3000 was used as a transfection reagent following the reverse transfection protocols in 96 well plates and incubated for two days at 37° C. Two days post-transfection, 40 pL of SARS-CoV-2 pseudovirus with GFP reporter gene was added to the cells and incubated at 37° C for another three days. Three days after adding the pseudovirus, the supernatant containing secreted IgG is removed from the cells for use in ELISA antibody quantification. The ELISA readout is illustrated in Figure 18. Antibodies VRC01 and CR3022 expressed by numerous peptide combinations showed successful antibody expression, indicating the successful secretion of antibodies using different leader peptides and promoter sequences. We note that similar leader sequences and / or promoter sequences may be used for the expression of test proteins (e.g., antibodies or antigen binding fragments) raised against bacteria.

[0249] Example 16: Use of CR1SPR-Cas9 to clone antibodies into soluble protein cell secretion platforms.

[0250] In this working example, we cloned an anti-SARS-Cov2 monoclonal antibody, 2-15, into a donor vector AAVS 1 Safe Harbor Targeting Knock-in HR Donor 2 vector, GE622A- 1 , from System Biosciences. We named the donor plasmid with 2-15 monoclonal antibody, pGE622A2- 15. We then co-transfected the 2-15 donor plasmid (pGE622A2-15) and the All-in-one Cas9 Smart Nuclease AAVS1 Targeting Plasmid (System Bioscience # CAS601A-1) into the Expi293 cells. The expression of the Cas9 nuclease and the gRNA after the transfection generated a double strain break at the Expi293 cell AAVS1 genome site. 2-15 gene sequence from the donor plasmid was integrated into the AAVS1 gene locus because of homologous recombination event (See illustration of the 2-15 gene integration below). We began the puromycin selection (at a concentration of 5 pg / mL) 1-week post-transfection to reduce the random integration Expi293 cells. The stable cell pool with 2-15 gene integration was named Expi2-15.

[0251] We seeded the Expi2- 15 andExpi293 cells into a 96-well plate with a density of 3.2x104cells per well. We then transfected the cell with ACE2 / TMRPSS2 expressing plasmid right after seeding these cells (both Expi2-15 and Expi293). For the positive control of the neutralization assay, we added purified 91030 antibody (5 pg / mL of final concentration) into ACE2 / TMRPSS2 expressing Expi293 cells. We aliquoted 20 pL of the culture media from each well for further IgG quantification analysis. We added 80 pL of the SARS CoV-2 reporter virus particle with spike protein D614G mutation and luciferases reporter gene to the ACE2 / TMPRSS2 expressing Expi2- 15 cells (ACE2 / TMPRSS2+ Expi2-15), ACE2 / TMPRSS2 expressing wild-type Expi293 cells (ACE / TMPRSS2+ Expi293) and ACE / TMPRSS2 expressing wild-type Expi293 cells with 5 pg / mL of 91030 (ACE / TMPRSS2+Expi293+91030).

[0252] Three days post adding the reporter virus, we removed the culture media and added 30 pL of PBS and 30 pL of diluted Renilla-Glo Assay Substrate (diluted Renilla-Glo Assay Substrate into the Assay Buffer at 1 TOO). We then detected luminescence in a luminometer after 10 minutes of incubation at room temperature. We calculated the average relative light unit (RLU) of the luminometer reading of each group. As shown in the figure below, both ACE2 / TMPRSS2+ Expi2- 15 and ACE / TMPRSS2+Expi293+91030 (Positive Control) groups showed a significant reductionin relative light units as compared with that of the ACE / TMPRSS2+ Expi293 group, indicating that 2-15 secreted from Expi2-15 cells is able to neutralize the SARS-CoV2 pseudovirus (Figure 20).

[0253] We validated the antibody expression level of the ACE2 / TMPRSS2+ Expi2-15 group via ELISA. The average antibody expression level is 0.23 pg / mL (n=6) antibody expression from the ACE / TMPRSS2+ Expi2-15, suggesting that Expi2-15 cells are able to secret functionally active 2-15 (Figure 21). The group, ACE / TMPRSS2+Expi293+91030, containing 5 ug / mL of the purified 91030 monoclonal antibody (calculated based on nanodrop of the purified 91030) was measured at a concentration of 3.9 pg / mL via ELISA as internal control for our ELISA assay.

[0254] We further performed genomic PCR to validate the integration of the 2-15 mab gene sequencing into the Expi2-15 cell line. We first isolated the genomic DNAfrom wild-type Expi293 and Expi2-15 cell lines. Then we performed PCR amplification to amplify the upstream gene integration region using GoTaq2 hot-start polymerase (Promega # M7405) and primers (Upstream primer set, Forward 5’ TCCTGAGTCCGGACCACTTT 3’ (SEQ ID NO: 18) and Reverse 5’ CACCGCATGTTAGAAGACTTCC 3’ (SEQ ID NO: 19)) validated and provided by the System Bioscience. A 1000 bp amplicon from the Expi2-15 cells indicated a successful gene integration compared with no PCR amplification from the wild-type Expi293 cells (see Figure 22a).

[0255] A separate PCR reaction using a human control primer set ( Forward 5'- ACCTCCAGTTAGGAAAGGGGACT-3' (SEQ ID NO: 20) Reverse 5'- AAGTTTTTCTTGAAAACCCATGGAA-3' (SEQ ID NO: 21)) for internal PCR control (Figure 22b).

[0256] Example 17: Use of TARGATT specific integration to clone antibodies into soluble protein cell secretion platforms.

[0257] In this working example, we followed the instruction manual of the TARGATT™ HEK master cell line knock-in kit to clone an anti-SARS-Cov2 monoclonal antibody, 2-15, into the TARGATT 24 CMV-MCS-attB (named pTARGATT2-15) to produce the donor plasmid. We then co-transfected the 2-15 donor plasmid (pTARGATT2-15) and the integrase plasmid into TARGATT HEK master cells. The integrase catalyzes a gene recombination event allowing theintegration of 2-15 monoclonal antibody, mCherry and blasticidin selectable marker into genome (See Figure 23).

[0258] Three days after transfection, we sub-cultured the transfected cell with a split ratio of 1 :20. Twenty-four hours after the sub-culture, we added blasticidin in a concentration of 10 pg / mL and maintained blasticidin selection pressure for two weeks. We then performed cell sorting to isolate the mCherry positive cells to enrich the 2-15 integrated cells (named TARGATT2-15). After the recovery of the TARGATT2-15 cells, we seeded the TARGATT2-15 and wild-type TARGATT cells into a 96-well plate with a density of 3.2* 104cells per well. We then transfected the cell with ACE2 / TMRPSS2 expressing plasmid right after seeding the cells (as described in Example 1 and in Figure 2). Two days after the transfection, we added purified 91030 antibody (5 pg / mL of final concentration) into unmodified TARGATT cells as positive control prior to the pseudovirus neutralization assay. We aliquoted 20 pL of the culture media from each well for further IgG quantification analysis.

[0259] We added 80 pL of the SARS CoV-2 reporter virus particle with spike protein D614G mutation and luciferases reporter gene to the ACE2 / TMPRSS2 expressing TARGATT2-15 cells (ACE2 / TMPRSS2+ TARGATT2-15), ACE2 / TMPRSS2 expressing wild-type TARGATT cells (ACE / TMPRSS2+TARGATTWT) and ACE / TMPRSS2 expressing wild-type TARGATT cells with 5 pg / mL of purified 91030 (ACE / TMPRSS2+91030). Three days post adding the reporter virus, we removed the culture media and added 30 pL of PBS and 30 pL of diluted Renilla-Glo Assay Substrate (diluted Renilla-Glo Assay Substrate into the Assay Buffer at 1: 100). We then detected luminescence in a luminometer after 10 minutes of incubation at room temperature. We calculated the average relative light unit (RLU) of the luminometer reading of each group. As shown in the figure below, both ACE2 / TMPRSS2+2-15 and ACE / TMPRSS2+91030 groups showed a significant reduced in relative light unit as compared with that of the ACE / TMPRSS2+WT group, indicating that 2-15 secreted from TARGATTHEK2- 15 cells is able to neutralize the SARS-CoV2 pseudovirus (Figure 24).

[0260] We validated the antibody expression level of the ACE2 / TMPRSS2+ TARGATT2-15 group via ELISA. The average antibody expression level is 0.44 pg / mL (n=6) antibody expression from the TARGATT2-15, demonstrating that TARGATT2-15 cells are able to secret functionallyactive 2-15 (see Figure 25). The group, ACE / TMPRSS2+91030, containing 5 pg / mL of the purified 91030 monoclonal antibody (calculated based on nanodrop of the purified 91030) was measured at a concentration of 2.74 pg / mL via ELISA as internal control for our ELISA assay.

[0261] We further performed genomic PCR to validate the integration of the 2-15 mab gene sequencing into the TARGATT2-15 cell line. We first isolated genomic DNA from wild-type TARGATT and TARGATT2-15 cell lines. Then we performed PCR amplification to amplify the downstream gene integration region using GoTaq2 hot-start polymerase (Promega # M7405) and primer sequences (Downstream primer set, Forward 5’ CCTTGTAGATGAACTCGCCGT 3’(SEQ ID NO: 22) and Reverse 5’ GGTGTCGTGATTATTCGAAGGG 3’(SEQ ID NO: 23)) validated and provided by the Applied StemCell, Inc. A 500 bp amplicon from the TARGATT2-15 group indicated a successful gene integration compared with no PCR amplification from the wild-type TARGATT cells (Figure 26).

[0262] Example 18: Use of rapid droplet-based assays to identify neutralizing antibodies using next-generation sequencing.

[0263] In this prophetic example, we clone antibodies into Raji-DCSIGNR cells and generate a synthetic library mixture to test the ability of droplet-based screening to identify neutralizing antibodies targeting yellow fever virus (YFV). We utilize lentiviral transduction ofRaji-DCSIGNR cells to evaluate their capacity to be used in high-throughput single-cell neutralization assays. We transduce Raji-DCSIGNR cells with a yellow fever virus neutralizing antibody, mAb-17, for antibody secretion, or with other antibodies (910-30, VRC01, and 2-15) that do not neutralize YFV. We encapsulate the cells in microfluidic droplets and incubate them for 24 hours (although the incubation time could range from minutes to several weeks depending on the goals of the experiment) to facilitate antibody secretion and accumulation within the droplet. Next, we merge the droplets using the electrocoalescence technique (other techniques for droplet merging can also be used and are known to those skilled in the art) and incubate overnight at 37 degrees Celsius to allow the pseudovirus to infect any cells that are not protected by secreted antibodies (the amount of incubation time and the temperature of incubation can vary according to the goals of the experiment). Droplets are broken, and the cells are recovered. After a brief incubation time (which can range from 0 minutes to several weeks depending on the goals of the experiment), we sortGFP+ and GFP- cells on a flow cytometer to separate the neutralizing and non-neutralizing cells. Cells are collected and genomic DNAis extracted for PCR-based amplification.

[0264] DNAis sent for next-generation sequencing to quantify the prevalence of each antibody clone in the dataset. The neutralizing antibodies are enriched in the set of GFP- cells, and depleted in the GFP+ cells, and neutralizing antibodies could be identified based on these enrichment features. These data will confirm that we can link antibody secreted protein functional neutralization properties to a reporter (that is expressed after the recombinant viral particle, RVP, infection event) as a cell line platform for direct screening of anti-YFV antibody neutralization in a rapid, high-throughput manner, and furthermore, that the sequences of neutralizing antibodies can be detected using next-generation sequencing analysis. We note that this assay may be modified to assay for other types of infectious agents, including bacteria.

[0265] Example 19: Secreted protein analysis for neutralization of HIV-1,

[0266] In this working example, TZM-GFP cells were used to test the ability of secreted proteins to neutralize human immunodeficiency virus 1 (HIV-1). We utilized lentiviral transduction TZM-GFP cells to evaluate their capacity for high-throughput single-cell neutralization assays. We transduced TZM-GFP cells(23)with an HIV-1 neutralizing antibody, VRC34, for antibody secretion, or with a control antibody that does not neutralize HIV-1 (72A1) We tested the cell lines after 2 days of antibody secretion in 96-well plates before adding HIV-1 pseudovirus particles (strain W6M.EnV.C2) to verify that the secreted antibody would provide protection from HIV-1 pseudoviruses (Figure 27). The cells expressing VRC34 were protected from HIV-1 pseudovirus infection, whereas cells that were not expressing VRC34 were unprotected from infection. These data confirmed that we can link antibody secreted protein functional neutralization properties to a GFP-based reporter (that is expressed after the pseudovirus infection event) as a cell line platform for direct screening of anti -HIV- 1 antibody neutralization in a rapid, high-throughput manner.

[0267] Example 20: Droplet merging techniques to enable soluble secretion assays inside droplets with a secreted protein cell library.

[0268] In this working example, we applied droplet merging techniques to demonstrate the encapsulation and droplet merger, and the recovery of DNA from cell libraries, to enable secretion cell assays. We first generated a synthetic cell library, where each cell secretes a separate antibody clone and also expresses ACE2, that could be used to screen for secreted protein function. We mixed four different cell groups expressing antibody clones into a single library (Table 3).

[0269] Table 3. Cells expressing known antibody clones were mixed and used as artificial cell libraries. HEK293-T clones expressing ACE2 and different monoclonal antibody clones were mixed as shown at IxlO6cells / mL in High glucose DMEM supplemented with 5% fetal bovine serum and 1% penicillin-streptomycin.Table 3

[0270] Cells were captured into single cell emulsions using a droplet generator (F02-HPB-8x, uFluidix, Canada), which generates ~80 pm diameter droplets. Next, droplets were loaded into a droplet merging device that applies an electric field to induce the merging of droplets. This device also generates droplets containing rhodamine 110 (diameter: ~40 pm. #83695, Sigma-Aldrich, USA) for merging with the cell droplets. (Fig. 28).

[0271] Example 21 : Recovery of DNA to identify secreted proteins in cell populations sorted with different selection markers after soluble protein secretion assays.

[0272] In this working example, we applied droplet merging techniques to demonstrate the encapsulation and droplet merger, and the recovery of DNAfrom cell libraries, to enable secretioncell assays. We generated and sorted a synthetic cell library (Table 3), with four different antibody clones, only some of which can potently neutralize SARS-CoV-2.

[0273] After droplet merger with SARS-CoV-2 pseudovirus that induces GFP expression in infected cells, cells were recovered from emulsions and sorted for expression of the GFP marker that indicates functional performance differences among the secreted antibodies in the library. In this case, the functional screen identified neutralizing antibodies, comparatively enriched in the GFP- cell population, and non-neutralizing antibodies were contained in the GFP+ cell population.

[0274] Genomic DNA was isolated from HEK cells using Quick-DNA Miniprep Kit (Zymo Research, USA). Next, heavy chain variable regions were amplified using Platinum Taq DNA Polymerase (ThermoFisher Scientific, USA) using primers anchoring the 3’ region of the cytomegalovirus promoter and the 5’ region of the heavy constant chain. The primer sequences used were: Forward: 5’-GGTGGGAGGTCTATATAAGCA-3’ (SEQ ID NO: 24), Reverse: 5’- CCAGAGGTGCTCTTGGAG-3’ (SEQ ID NO: 25). Polymerase chain reaction was carried out during 40 cycles using 51 °C as annealing temperature. PCR products were resolved in a 1% agarose gel, using a 1 Kb DNA ladder (#N0550S, New England BioLabs, USA) to control for size. The resulting DNA gels are shown in Figure 29. These data demonstrate our ability to recover the DNA sequences from cells utilized in high-throughput droplet-based cell secretion protein functional assays.

[0275] Example 22 Application of the single-cell assay using a synthetic library of antibodies with known neutralization properties against SARS-CoV-2 inside emulsion droplet systems

[0276] This working Example relates to the successful screening of a synthetic cell library secreting antibody molecules for the neutralization of SARS-CoV-2 pseudovirus. First, we mixed HEK-ACE2 expressing different monoclonal antibodies to generate a synthetic library consisting of 4 antibody-producing cells (the previously reported antibodies VRC01, CR3022, 910-30 and mAbl-20); VRC01 does not neutralize SARS-CoV-2 and serves as a negative control. We used a microfluidic device to encapsulate the synthetic library with DMEM media to form droplets, with one cell per droplet. We incubated the droplet for 24 hours, allowing the secretion of IgG within the droplet for antibody accumulation. Subsequently, a second droplet containing D614G SARS- CoV-2 pseudovirus was merged into the droplet with IgG expressing HEK-ACE2 cells. We usedelectrocoalescence to merge droplets, although alternative methods to merge droplets have been reported including the use of micropillar resistance arrays. The merged droplets were further incubated for another 24 hours to allow pseudovirus infection or neutralization to occur. The droplets were then broken, and the cells are recovered. Cells were allowed to recover for 48 hours. We isolated GFP- and GFP+ populations using fluorescence activated cell sorting (FACS) and extracted the gDNA from cell aliquots and performing PCR to recover the antibody gene libraries for NGS analysis. GFP- cells were also recovered and used as input for a subsequent round of screening for further enrichment for neutralizing clones. We performed high-throughput sequencing analysis on each sorted library of GFP- and GFP+ cells to obtain heavy chain sequence information. We compared the frequency of heavy chain antibody variants in each population to determine the effect of the droplet neutralization assay on neutralizing and non-neutralizing antibodies in the population (Figure 30, Table 4). Table 4 Raw sequence data and fold-change enrichment calculations for SARS-CoV-2 D614G neutralization assays. These data demonstrate the successful implementation of droplet neutralization assays for antibodies that neutralize SARS- CoV-2, with NGS being used to analyze the assay performance for many thousands of cells secreting polypeptide molecules in parallel.

[0277] Example 23 Application of the single-cell assay using a synthetic library of antibodies with known neutralization properties against HIV pseudoviruses inside emulsion droplet systems

[0278] This working Example relates to the successful screening of a synthetic cell library secreting antibody molecules for the neutralization of HIV pseudovirus. First, we mixed TZM- GFP cells expressing different monoclonal antibodies to generate a synthetic library consisting of 3 antibody-producing cells (the previously reported antibodies 72A1, VRC01, and VRC34); 72A1 does not neutralize HIV-1 and serves as a negative control. We used a microfluidic device to encapsulate the synthetic library with media to form droplets, with one cell per droplet. We incubated the droplet for 24 hours, allowing the secretion of IgG within the droplet for antibody accumulation. Subsequently, a second droplet containing HIV-1 BG505 W6M.Env.C2 pseudovirus was merged into the droplet with IgG expressing TZM-GFP cells. We used electrocoalescence to merge droplets, although alternative methods to merge droplets have been reported including the use of micropillar resistance arrays. The merged droplets were further incubated for another 24 hours to allow pseudovirus infection or neutralization to occur. The droplets were then broken, and the cells are recovered. Cells were allowed to recover for 48 hours. We isolated GFP- and GFP+ populations using fluorescence activated cell sorting (FACS) and extracted the gDNA from cell aliquots and performing PCR to recover the antibody gene libraries for NGS analysis. GFP- cells were also recovered and used as input for a subsequent round of screening for further enrichment for neutralizing clones.

[0279] We performed high-throughput sequencing analysis on each sorted library of GFP- and GFP+ cells to obtain heavy chain sequence information. We compared the frequency of heavy chain antibody variants in each population to determine the effect of the droplet neutralization assay on neutralizing and non-neutralizing antibodies in the population (Figure 31, Table 5).

[0280] Table 5 Raw sequence data and fold-change enrichment calculations for HIV-1 W6M.Env.C2 pseudovirus neutralization assays. These data demonstrate the successful implementation of droplet neutralization assays for antibodies that neutralize HIV-1, with NGS being used to analyze the assay performance for many thousands of cells secreting polypeptide molecules in parallel.

[0281] Example 24 Detection of an antibody that activates complement against a bacterial cell inside a compartment

[0282] In this prophetic example, an antibody-secreting cell is encapsulated in a droplet. The antibody-secreting cell may be naturally derived (e.g., a plasma cell or in vitro activated B cell), or may be a mammalian cell (e.g., HEK293, CHO) or an insect, bacterial, fungal, or yeast cell that secretes antibody or Fc fusion proteins of various types / formats. Some secreted proteins in the library may activate complement proteins. A target moiety is also encapsulated within droplet. Possible targets could be, but are not limited to, a bacterial cell, mammalian cell, cancer cell, a bead, or an antigen associated with a bead (Figure 34). Droplets can be merged with human serum depleted of IgG / IgM. These droplets may also contain, an anti-complement protein molecule (e.g., anti-C5a neoepitope antibody, mouse IgG2a or other detectable molecule), and a bridgingmolecule to link to the polypeptide secreting cell surface (e.g., streptavidin tetramer of mixed biotinylated anti-mouse IgG2a and anti-cell surface protein, e.g., anti-CD19).

[0283] The bridging molecule and the anti-complement molecule could be the same molecule, or could be pre-conjugated prior to the assay, or may associate within the isolated droplet. Other types of serum could be contained in the assay, and synthetic elements of the complement pathway could be used and encapsulated in the droplet to ensure that complement reactions can proceed inside the droplet if antibody binding is sufficient to induce complement activity.

[0284] If the antibody is capable of inducing complement, then the antibody binds to the test substrate, complement is activated, and the complement cascade forms new molecules (C5a being one example). The bridging molecule may associate complement cascade molecules (e g., C5a) with cell secreting antibodies. The detection molecule from the complement cascade may be detected on the surface of the polypeptide secreting cells. In some cases, droplets are broken, and cells are recovered, and the released C5a is detected on cells using flow cytometry. In some cases, droplets are broken, and cells are recovered, and the released C5a is detected on cells using magnetic bead sorting. In some cases, the C5a associated with cells is detected via microscopy inside droplets. In some cases, other complement pathway molecules are detected (e.g., C3b, C3a, C5a, C5b, C5b-9). In some cases, the activation of complement proteins results in membrane attack complex formation and / or cell membrane permeability. In some cases, the activation of complement proteins is detected by the recruitment of immune cells. In some cases, recruitment of immune cells results in ADCP.

[0285] In this example, droplets may be broken in the presence of C5 blockade (e.g., eculizumab) and / or with saturating anti-cell surface protein, e.g., anti-CD19, so that no additional conversion occurs and no new complexes are captured on cells after droplet breakage. In some cases, the droplets are broken in the presence of saturating blocking molecule that prevents new association of C5a with antibody-secreting cells. The droplets may be broken in a large volume to dilute droplet assay volumes 100-1000-fold. The cells may be stained with a fluorescent antibody that targets a different epitope on the complement cascade protein (e.g., C5a but not at the neoepitope). Flow cytometry may be used to distinguish high-CD5a cells from low-CD5a cells (or other complement cascade detection molecule, if not C5a). In some cases, a change in cell featuresor cell morphology may be detected. In some cases, the recruitment of immune cells or ADCP may be detected.

[0286] Example 25 Detection of an antibody that activates complement against a mammalian cell inside a compartment

[0287] In this prophetic example an antibody-secreting cell is encapsulated in a droplet. The antibody-secreting cell may be naturally derived (e.g., a plasma cell or in vitro activated B cell) or may be a mammalian cell (e.g., HEK293, CHO) or an insect, bacterial, fungal, or yeast cell that secretes antibody or Fc fusion proteins of various types / formats. Some secreted proteins in the library may activate complement. A target moiety is also encapsulated within droplet. In this example, the target moiety is a mammalian cell, optionally a cancer cell. Droplets can be merged with human serum depleted of IgG / IgM. These droplets may also contain anti-complement protein molecules (e.g., anti-C5a neoepitope antibody, mouse IgG2a or other detectable molecule) and a bridging molecule to link to polypeptide secreting cell surface (e.g., streptavidin tetramer of mixed biotinylated anti-mouse IgG2a and anti-cell surface protein, e.g., anti-CD19).

[0288] The bridging molecule and the anti-complement molecule could be the same molecule, or could be pre-conjugated prior to the assay, or may associate inside the droplet. Other types of serum could be contained in the droplet. Alternatively, synthetic elements of the complement pathway could be used and encapsulated inside the droplet to ensure that complement reactions can proceed inside the droplet if antibody binding enables complement activity. Once the antibody binds to target, complement is activated, and the complement cascade forms new molecules (C5a being one example). The bridging molecule then connects complement cascade molecule (e.g., C5a) with cell secreting antibodies. The detection molecule from the complement cascade is detected on the surface of the polypeptide secreting cells. In some cases, droplets are broken, and cells are recovered, and the released C5a is detected on cells using flow cytometry. In some embodiments, droplets are broken, and cells are recovered, and the released C5a is detected on cells using magnetic bead sorting. In some cases, the C5a associated with cells is detected via microscopy inside droplets. In some cases, other complement pathway molecules are detected (e.g., C3b, C3a, C5a, C5b, C5b-9). In some cases, the secreted polypeptide binding to the target enables the bridging of complement cascade molecules with the polypeptide secreting cell and therecruiting of immune cells. In some cases, the recruiting of immune cells is detected by the detection of ADCP.

[0289] Droplets may be broken in the presence of C5 blockade (e.g., eculizumab) and with saturating anti-cell surface protein, e.g., anti-CD19, so that no additional conversion occurs and no new complexes are captured on cells. Droplets may be broken in the presence of saturating blocking molecule that prevents new association of C5a with antibody-secreting cell. Droplets may be broken in a large volume to dilute droplet assay volumes 100-1000-fold. The cells may be stained with a fluorescent antibody that targets a different epitope on the complement cascade protein (e.g., C5a but not at the neoepitope). Flow cytometry may be used to distinguish high- CD5a cells from low-CD5a cells (or other complement cascade detection molecule, if not C5a). In some cases, magnetic bead sorting may be used to detect complement pathway activation by the secreted polypeptide.

[0290] Example 26 Detection of an antibody that activates complement against a cancer cell inside a compartment

[0291] In this prophetic example, an antibody-secreting cell is encapsulated in a droplet. The antibody-secreting cell may be naturally derived (e.g., a plasma cell or in vitro activated B cell), or may be a mammalian cell (e.g., HEK293, CHO) or an insect, bacterial, fungal, or yeast cell that secretes antibody or Fc fusion proteins of various types / formats; some secreted proteins in the library may activate complement proteins. A target moiety may also be encapsulated within droplet. In this example, the target moiety is a cancer cell (Figure 33). The cancer cell could be a primary cancer cell (i.e., from a patient or animal biopsy), a cultured cancer cell, a patient-derived xenograft (PDX), an organoid, or a cancer cell line.

[0292] Droplets can be merged with human serum depleted of IgG / IgM. These droplets may also contain, an anti -complement protein molecule (e.g., anti-C5a neoepitope antibody, mouse IgG2a or other detectable molecule), and a bridging molecule to link to the polypeptide secreting cell surface (e.g., streptavidin tetramer of mixed biotinylated anti-mouse IgG2a and anti-cell surface protein, e.g., anti-CD19).

[0293] The bridging molecule and the anti -complement molecule could be the same molecule, or could be pre-conjugated prior to the assay, or may associate within the isolated droplet. Other types of serum could be contained in the assay, and synthetic elements of the complement pathway could be used and encapsulated in the droplet to ensure that complement reactions can proceed inside the droplet if antibody binding is sufficient to induce complement activity.

[0294] If the antibody is capable of inducing complement, then the antibody binds to the test substrate, complement is activated, and the complement cascade forms new molecules (C5a being one example). The bridging molecule may associate complement cascade molecules (e.g., C5a) with cell secreting antibodies. The detection molecule from the complement cascade may be detected on the surface of the polypeptide secreting cells. In some cases, droplets are broken, and cells are recovered, and the released C5a is detected on cells using flow cytometry. In some cases, droplets are broken, and cells are recovered, and the released C5a is detected on cells using magnetic bead sorting. In some cases, the C5a associated with cells is detected via microscopy inside droplets. In some cases, other complement pathway molecules are detected (e.g., C3b, C3a, C5a, C5b, C5b-9). In some cases, the activation of complement proteins results in membrane attack complex formation and / or cell membrane permeability. In some cases, the activation of complement proteins is detected by the recruitment of immune cells. In some cases, recruitment of immune cells results in ADCP.

[0295] In this example, droplets may be broken in the presence of C5 blockade (e.g., eculizumab) and / or with saturating anti-cell surface protein, e.g., anti-CD19, so that no additional conversion occurs and no new complexes are captured on cells after droplet breakage. In some cases, the droplets are broken in the presence of saturating blocking molecule that prevents new association of C5a with antibody-secreting cells. The droplets may be broken in a large volume to dilute droplet assay volumes 100-1000-fold. The cells may be stained with a fluorescent antibody that targets a different epitope on the complement cascade protein (e.g., C5a but not at the neoepitope). Flow cytometry may be used to distinguish high-CD5a cells from low-CD5a cells (or other complement cascade detection molecule, if not C5a). In some cases, a change in cell features or cell morphology may be detected. In some cases, the recruitment of immune cells or ADCP may be detected.

[0296] In some embodiments, the antibody activates the complement cascade and a MAC complex that lyses a target cell inside a droplet. Instead of detecting the complement cascade molecules directly, instead a molecule released by the target cell is detected, enabling the identification of secreted polypeptides that initiate cell lysis of the target cell inside a droplet.

[0297] Example 27 Detection of specific C3b deposition on antibody-secreting mammalian cells after complement activation in the presence of targeted bacteria

[0298] In this working example, we evaluate the ability of anti-gonorrheal antibody 2C7 to activate complement and deposit C3b on a HEK293FT cell line. The HEK293FT cell line secretes 2C7 antibodies that can specifically bind to fixed N. gonorrhoeae (m2C7 HEK-FT), and we compared C3b deposition on this cell line to a negative control HEK293FT cell line that does not produce antibodies (NC HEK-FT).

[0299] We co-cultured 0.5 million m2C7 HEK-FT cells with 10 million CFU of fixed N. gonorrhoeae, and separately co-cultured 0.5 million of NC HEK-FT cells with 10 million CFU of fixed N. gonorrhoeae in a 48 well plate (hisher Scientific, 3548) at a final volume of 270 pL of low IgG DMEM media (50 % heat-inactivated FBS, 1% Penicillin / Streptomycin, 2% HEPES, 1% non-essential amino acid, and 1 % L-glutamine) containing 10% IgG / IgM / IgA Depleted Human Complement Pooled Serum (Pel-Freez Biologicals, 34041-10). Both groups were incubated at 37 °C at 5 % CCk for 30 minutes or 2 hours. After incubation, the supernatant of each group was collected and the cells were detached using Accutase (Sigma- Aldrich, A6964-100ML). The cells were washed twice with 15mM EDTA in PBS. After that, cells were labeled with unconjugated anti-C3b antibodies (Invitrogen, MAI 70053) and washed twice with FACS buffer (0.5 w% BSA and 2mM EDTA in PBS). Then the cells were labeled with an Anti-Mouse IgG (Fc specific)-FITC antibody (Sigma-Aldrich, F5387-.5ML), which binds to the mouse Fc of anti-C3b antibodies bound on cells, and then washed twice with FACS buffer. Cells were then labeled with Anti-CD19 Mouse Monoclonal Antibody (PE (Phycoerythrin) / Cy5®) (BioLegend, 302210) which bound to the CD 19 expression reporter molecules that were expressed on m2C7 HEK-FT cells, and washed twice with FACS buffer. The washed cells were fixed with fixation buffer (BioLegend, 420801) and washed twice with FACS buffer and strained at 300 pL of FACS buffer.

[0300] Cells were analyzed for C3b deposition using a SONY MA900 flow cytometer. Each group was evaluated in triplicate. The m2C7 and NC HEK-FT cells in the different groups could be readily distinguished by the PE-Cy5 signal, and the degree of C3b deposition was measured by calculating the percentage of FITC-positive cells as shown in Figure 35. These data demonstrate that the m2C7 HEK-FT mammalian cells that produce specific antibodies against fixed N. gonorrhoeae had more C3b deposited compared to cell lines that do not produce antibodies, indicating that C3b deposited on mammalian cells can serve as a specific marker of complement activation function. C3b deposition could distinguish between cells secreting complementactivating anti -gonorrheal antibody both at 30 minute and at 2 hour time points.

[0301] Example 28 Secreted m2C7, an anti-gonococcal antibody produced by mammalian cells, attains sufficient concentration inside droplet compartments to support complement activation within the droplet

[0302] In this working example, we applied emulsion droplet capture techniques to capture the HEK293FT cells that produce m2C7 antibodies (m2C7 HEK-FT) inside emulsion droplets, and used sandwich ELISA to measure the concentration of secreted antibody after various time periods. To capture m2C7 HEK-FT cells in droplets, the m2C7 HEK-FT cells were resuspended in 7 mL of low IgG DMEM media with containing 20% IgG / IgM / IgA Depleted Human Complement Pooled Serum at the concentration of 3.7 million cells / mL and loaded into a syringe for microfluidic injection. In parallel, 20 mL of oil with surfactant (RAN Biotechnologies, HFE7500- 500g and 008-FluoroSurfactant-2wtH-500G) was loaded into a syringe. Each syringe was connected to capillary tubing and installed at pumps, and the capillary tubing were connected to micro medical tubing to connect with a droplet generator chip. The syringe containing cells and the syringe containing media was pumped at 20 pL / min and the syringe containing oil was pumped at 120 pL / min. Droplets produced and exiting the tubing were collected in a 50 mL conical tube for 30 minutes. 3 tubes collected the droplets for 30 minutes, and leftover cells in the syringe were collected in another 50 mL conical tube. Each 50 mL conical tube was incubated at 37 °C at 5 % CO for either 30 minutes, 1 hour, or 1.5 hours, and the tube containing leftover cells from the syringe was maintained at -20 °C. After the incubation, the emulsions were broken with 1H,1H,2H,2H-Perfluoro-1 -octanol, 97% (PFO) (Sigma-Aldrich, 370533-25G) in the presence of low IgG DMEM media. The aqueous phase was collected for each group.

[0303] After collecting the aqueous phase, a sandwich ELISA was performed to measure the antibody concentration from each incubation time. The capture antibody was Anti-Human IgG (H+L) (Sigma-Aldrich, SAB3701367-1MG) and the detection antibody was 2A peptide antibody (Novus Biologicals, NBP2-59627H) which recognized a 2A peptide on the end of the light chain. ELISA data was collected in triplicate. The concentration of antibodies secreted from cells during different incubation times are shown in Figure 36, allowing an estimation of the approximate antibody concentration profile over time.

[0304] After determining the antibody-secretion profile as shown in Figure 36, we verified whether the concentration of m2C7 from droplets is sufficient to induce complement activation against fixed N. gonorrhoeae. We followed the same procedure as in Example 27, Detection of specific C3b deposition on antibody-secreting mammalian cells after complement activation in the presence of targeted bacteria, including using a high bacteria concentration of 10 million CFU of fixed N. gonorrhoeae per 270 pL, with a change that we used only negative control antibody secreting cells and added soluble antibody at defined concentrations and time points to mimic the steady accumulation of antibodies that occurs inside droplets. In the ‘2C7’ group, soluble 2C7 antibody was added every 20 minutes to approximate the antibody concentration profiles increasing over time as shown in Figure 36, and to evaluate the extent of C3b deposition in a setting of continual antibody secretion from a mammalian cell in the presence of fixed N. gonorrhoeae bacterial cells. We found that C3b deposition was higher at all evaluated time points in the 2C7 group compared with the group where no antibody was added, with the largest difference in C3b deposition occurring at the 1 hour incubation time point (Figure 37). These data validate complement-based assay performance in well plate assays under conditions that closely model the conditions inside a droplet environment.

[0305] Example 29 Droplet-based complement activation and detection of C3b deposition on antibody-secreting cells co-captured inside droplets with fixed gonorrhea bacteria

[0306] In this example, we assessed C3b deposition on antibody-secreting cells co-captured with fixed N. gonorrhoeae in a droplet environment. This was achieved by applying dropletcapturing techniques to encapsulate HEK293FT cells that produce m2C7 antibodies (m2C7 HEK- FT) with fixed N. gonorrhoeae.

[0307] We first prepared m2C7 HEK-FT cells and HEK293FT cells that do not produce antibodies (NC HEK-FT) at 1 million / mL of prewarmed PBS. m2C7 HEK-FT cells were dyed with CellTrace Violet (Thermo Scientific, C34557), washed, and resuspended in low IgG DMEM media containing 20% IgG / IgM / IgA Depleted Human Complement Pooled Serum at a final volume of 3 mL. The fixed N. gonorrhoeae was prepared at low IgG DMEM media at 55.5 million CFU / mL at a final volume of 4 mL. Each sample was loaded into a syringe for microfluidic injection. Single-cell emulsions were generated as described in Example 28 Secreted m2C7, an anti -gonococcal antibody produced by mammalian cells, attains sufficient concentration inside droplet compartments to support complement activation within the droplet. The emulsions were collected for 40 minutes, incubated at 37 °C at 5 % CO for 40 minutes. After incubation, the emulsions were broken with !H,lH,2H,2H-Perfluoro-l-octanol, 97% (PFO) (Sigma-Aldrich, 370533-25G) in the presence of low IgG DMEM media. The aqueous phase was collected for each group. A total of 670,000 cells were recovered from the aqueous phase. The recovered cells were stained with anti-CD19 (BioLegend, 302210) and anti-C3b (Cedarlane Labs, CL7631F) to label the m2C7 HEK-FT that expressed CD19 on cell surface and deposited C3b. The labeled cells were analyzed at SONY MA900.

[0308] We were able to observe C3b deposition on m2C7 HEK-FT cells as shown in Figure 38. These data demonstrate that C3b can be deposited on antibody-secreting cells by the activation of antibody-dependent complement inside a droplet environment.REFERENCES CITEDAll references provided in this disclosure, including those listed below, are incorporated herein by reference in their entireties.1. Mortensen, Richard M., and Robert E. Kingston. “Selection of Transfected Mammalian Cells.” Current Protocols in Molecular Biology, vol. 86, no. 1, Apr. 2009, 10.1002 / 0471142727. mb0905s86.DeKosky, B. J., Kojima, T., Rodin, A., Charab, W Ippolito, G. C., Ellington, A. D. & Georgiou, G. In-depth determination and analysis of the human paired heavy- and lightchain antibody repertoire. Nat. Med. 21, 86-91 (2015). Wang, B., DeKosky, B. J., Timm, M. R., Lee, J., Normandin, E., Misasi, J., Kong, R., McDaniel, J. R., Delidakis, G., Leigh, K. E., Niezold, T, Choi, C. W., Viox, E. G., Fahad, A., Cagigi, A., Ploquin, A., Leung, K., Yang, E. S., Kong, W.-P, Voss, W. N., Schmidt, A. G , Moody, M. A., Ambrozak, D. R., Henry, A. R., Laboune, F., Ledgerwood, J. E., Graham, B. S., Connors, M., Douek, D. C., Sullivan, N. J., Ellington, A. D., Mascola, J. R. & Georgiou, G. Functional interrogation and mining of natively paired human VH:VL antibody repertoires. Nature Biotechnology 36, 152-155 (2018). DeKosky, B. J., Ippolito, G. C., Deschner, R. P, Lavinder, J. J., Wine, Y, Rawlings, B. M., Varadarajan, N., Giesecke, C., Domer, T, Andrews, S. F., Wilson, P. C., Hunicke-Smith, S. P, Willson, C. G., Ellington, A. D. & Georgiou, G. High-throughput sequencing of the paired human immunoglobulin heavy and light chain repertoire. Nat Biotech 31, 166-169 (2013). As shown within the Berkeley Lights website at www.berkeleylights.com. Lagerman, C. E., Lopez Acevedo, S. N., Fahad, A. S., Hailemariam, A. T, Madan, B. & DeKosky, B. J. Ultrasonically-guided flow focusing generates precise emulsion droplets for high-throughput single cell analyses. Journal of Bioscience and Bioengineering 128, 226-233 (2019). Georgina To'a Salazar, et al., Antibody Therapies Targeting Complex Membrane Proteins, Engineering, Volume 7, Issue 11, 021, Pages 1541-1551. Hoffmann, M., Kleine-Weber, H., Schroeder, S., Kruger, N., Herrler, T., Erichsen, S., Schiergens, T. S., Herrler, G., Wu, N.-H., Nitsche, A., Muller, M. A., Drosten, C. & Pbhlmann, S. SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell 181, 271 -280. e8 (2020). Nat Protoc. 2016 Mar; 11 (3): 429-42. doi: 10.1038 / nprot.2016.024. Epub 2016 Feb 4.Kulmala A, Huovinen T, Lamminmaki U. Improvement of Fab expression by screening combinatorial synonymous signal sequence libraries. Microb Cell Fact. 2019 Sep 16;18(1):157. doi: 10.1186 / sl2934-019-1210-l. PMID: 31526395; PMCID: PMC6745802. Zalucki YM, Beacham IR, Jennings MP Biased codon usage in signal peptides: a role in protein export. Trends Microbiol. 2009 Apr;17(4): 146-50. doi: 10.1016 / j.tim.2009.01.005. Epub 2009 Mar 21. PMID: 19307122. Zhang J, Collins A, Chen M, Knyazev I, Gentz R. High-density perfusion culture of insect cells with a biosep ultrasonic filter. Biotechnol Bioeng. 1998 Aug 5;59(3):351 -9. doi: 10.1002 / (sici)1097-0290(19980805)59:3<351::aid-bitll>3.0.co;2-h. PMID: 10099346. Arnold CE, Parekh RN, Yang W, Wittrup KD. Leader peptide efficiency correlates with signal recognition particle dependence in Saccharomyces cerevisiae. Biotechnol Bioeng. 1998 Aug 5;59(3):286-93. PMID: 10099339. Khorshidi S, Zomorodipour A, Behmanesh M, Vatandoost J, Bos MH. Functional expression of the human coagulation factor IX using heterologous signal peptide and propeptide sequences in mammalian cell line. Biotechnol Lett. 2015 Sep;37(9): 1773-81. doi: 10.1007 / sl0529-015-1868-3. Epub 2015 Jun 24. Erratum in: Biotechnol Lett. 2015 Oct;37(10):2097. PMID: 26105559. Mukhamedova M, Wrapp D, Shen CH, Gilman MSA, Ruckwardt TJ, Schramm CA, Ault L, Chang L, Derrien-Colemyn A, Lucas SAM, Ransier A, Darko S, Phung E, Wang L, Zhang Y, Rush SA, Madan B, Stewart-Jones GBE, Costner PJ, Holman LA, Hickman SP, Berkowitz NM, Doria-Rose NA, Morabito KM, DeKosky BJ, Gaudinski MR, Chen GL, Crank MC, Misasi J, Sullivan NJ, Douek DC, Kwong PD, Graham BS, McLellan JS, Mascola JR. Vaccination with prefusion-stabilized respiratory syncytial virus fusion protein induces genetically and antigenically diverse antibody responses. Immunity. 2021 Apr 13;54(4):769-780.e6. doi: 10.1016 / j.immuni.202L 03.004. Epub 2021 Apr 5. PMID: 33823129; PMCID: PMC8099422.Fahad, A. S. et al. Functional Profiling of Antibody Immune Repertoires in Convalescent Zika Virus Disease Patients. Front. Immunol. 12, (2021). Banach, B. B. et al. Paired heavy and light chain signatures contribute to potent SARS- CoV-2 neutralization in public antibody responses. bioRxiv 2020.12.31.424987 (2021) doi: 10.1101 / 2020.12.31.424987. DeKosky, B. J. et al. In-depth determination and analysis of the human paired heavy- and light-chain antibody repertoire. Nat. Med. 21, 86-91 (2015). Wang, B. et al. Functional interrogation and mining of natively paired human VH:VL antibody repertoires. Nature Biotechnology 36, 152-155 (2018). Tian, M. et al. Induction of HIV Neutralizing Antibody Lineages in Mice with Diverse Precursor Repertoires. Cell 166, 1471-1484. el8 (2016). Jin, W., Madan, B., Mussman, B. K., Hailemariam, A. T, Fahad, A. S., Wolfe, J. R., Kwon, Y. D., Zhang, B., Shapiro, L., Kwong, P. D. & DeKosky, B. J. The Covalent SNAP Tag for Protein Display Quantification and Low-pH Protein Engineering. Journal of Biotechnology (2020). doi : 10.1016 / j jbiotec.2020.06.011 Georgiou, G., Ippolito, G. C., Beausang, J., Busse, C. E., Wardemann, H. & Quake, S. R. The promise and challenge of high-throughput sequencing of the antibody repertoire. Nature Biotechnology 32, 158-168 (2014). Gludish DW, Boliar S, Caldwell S, Tembo DL, Chimbayo ET, Jambo KC, Mwandumba HC, Russell DG. TZM-gfp cells: a tractable fluorescent tool for analysis of rare and early HIV-1 infection. Sci Rep. 2020 Nov 16; 10(1): 19900. doi: 10.1038 / s41598-020-76422-6. PMID: 33199722; PMCID: PMC7670428. Abate AR, Hung T, Mary P, Agresti JJ, Weitz DA. High-throughput injection with microfluidics using picoinjectors. Proc Natl Acad Sci U S A. 2010 Nov 9; 107(45): 19163- 6. doi: 10.1073 / pnas.1006888107. Epub 2010 Oct 20. PMID: 20962271; PMCID: PMC2984161.25. Seah, Y. F. S., Hu, H. & Merten, C. A. Microfluidic single-cell technology in immunology and antibody screening. Molecular Aspects of Medicine 59, 47-61 (2018).26. Debs, B. E., Utharala, R., Balyasnikova, I. V., Griffiths, A. D. & Merten, C. A. Functional single-cell hybridoma screening using droplet-based microfluidics. Proceedings of the National Academy of Sciences 109, 11570-11575 (2012).

[0309] It will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The invention illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention. Thus, it should be understood that although the present invention has been illustrated by specific embodiments and optional features, modification and / or variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.Citations to a number of patent and non-patent references may be made herein. Any cited references are incorporated by reference herein in their entireties. In the event that there is an inconsistency between a definition of a term in the specification as compared to a definition of the term in a cited reference, the term should be interpreted based on the definition in the specification.

Claims

CLAIMS1. A method comprising:(a) contacting an isolated cell with an infectious agent;(i) wherein the isolated cell secretes a test polypeptide, and(b) detecting whether the test polypeptide inhibits the infectious agent from infecting the cell.

2. The method of claim 1, wherein step (b) comprises one or more of:(i) detecting the presence or absence of the infectious agent within the isolated cell;(ii) culturing the isolated cell; and(A) detecting whether the cultured isolated cells are alive or dead;(B) measuring the expansion of the cultured isolated cell after a specified time; or(C) detecting an altered cell characteristic of the cell caused by the infectious agent.

3. The method of claims 1 or 2, wherein the isolated cell is screened based on a detection of whether the test polypeptide inhibits the infectious agent from infecting the cell.

4. The method of any one of the previous claims, wherein the isolated cell comprises a eukaryotic cell, optionally a mammalian cell.

5. The method of any one of the previous claims, wherein the isolated cell comprises a plasma cell, a B cell, or an antibody secreting cell.

6. The method of any one of the previous claims, wherein the isolated cell comprises a genetically engineered cell.

7. The method of any one of the previous claims, wherein the infectious agent comprises a bacteria, parasite, fungus, pseudovirus, phage, or virus.

8. The method of claim 7, wherein the bacteria comprises one or more of Chlamydia spp., Anaplasma spp., Ehrlichia spp., Rickettsia spp., Orientia spp. And Coxiella spp., Salmonella spp., Francisella spp., Legionella pneumophila, Listeria monocytogenes, Mycobacterium spp., and Yersinia spp.

9. The method of any one of the previous claims, wherein the test polypeptide comprises an antibody, a VHH, a nanobody, a fragment of an antibody, antibody Fc region, or an antigen binding fragment.

10. The method of any one of the previous claims, wherein the test polypeptide is linked to a chemical moiety that is also isolated with the cell.

11. The method of any one of the previous claims, wherein the infectious agent comprises a detectable marker.

12. The method of claim 11, wherein the detectable marker of the infectious agent comprises one or more of a fluorescent marker, an enzyme, a polypeptide, a nucleic acid sequence, or a modified nucleic acid sequence.

13. The method of claim 12, wherein detecting the presence or absence of the infectious agent within the cell comprises detecting the detectable marker linked to the infectious agent.

14. The method of any one of the preceding claims, wherein the isolated cell comprises a detectable marker.

15. The method of any one of the preceding claims, wherein the isolated cell comprises a detectable marker.

16. The method of claim 15, wherein the detectable marker comprises a fluorescent marker, an enzyme, a polypeptide, a nucleic acid sequence, a transcriptomic signature, an altered cell characteristic, or a modified nucleic acid sequence.

17. The method of claim 16, wherein the altered cell characteristic comprises a cell size, an expansion rate, a permeability status, presence or absence of a nucleic acid, gene expression, protein expression, carbohydrates, post-translational protein modifications, or a cell morphology.

18. The method of any one of the previous claims, further comprising harvesting the cell.

19. The method of any one of the previous claims, further comprising sequencing the nucleic acids encoding the test polypeptide, optionally wherein sequencing comprises DNA or RNA sequencing.

20. The method of any one of the previous claims, wherein the isolated cell is a single isolated cell and is in a well of a multi-well plate.

21. The method of any one of claims 1-19, wherein the isolated cell is in a chamber of a chip or wafer.

22. The method of any of claims 1-19, wherein the isolated cell is in a droplet, such as an emulsion droplet.

23. The method of any of claims 1-19, wherein the isolated cell is in a NanoPen™.

24. The method of any one of the previous claims, further comprising selecting the isolated cell or the microfluid droplet based on a detection of whether the test polypeptide inhibits the infectious agent from infecting the cell.

25. The method of claim 22, wherein the selection is performed via flow cytometry or magnetic bead sorting.

26. The method of claim 1, wherein step (b) comprises analyzing the isolated cell for one or more altered cell characteristics.

27. The method of any one of the previous claims, wherein the isolated cell secreting the test polypeptide comprises a single isolated cell secreting the test polypeptide.

28. A composition, kit, or system comprising: one or more vectors encoding a test polypeptide, optionally, wherein one or more of the vectors are expression vectors, or, optionally, wherein one or more of the vectors are integration vectors.

29. The composition, kit, or system of claim 28, wherein the encoded test polypeptide comprises an antibody, a VHH, a nanobody, a fragment of an antibody, antibody Fc region, or an antigen binding fragment.

30. The composition, kit, or system of claim 28, wherein the test polypeptide is linked to a chemical moiety that is also isolated with the cell.

31. The composition, kit, or system of claims 29-30, wherein the antibody, VHH, nanobody, fragment of an antibody, antibody Fc region, or antigen binding fragment, or the test polypeptide linked to a chemical moiety is derived from a library of antibodies, or antigen binding fragments.

32. The composition, kit, or system of any one of claims 28-31, further comprising a detectable marker linked to, or capable of being linked to, an infectious agent, wherein the detectable marker comprises a fluorescent marker, an enzyme, a polypeptide, or a nucleic acid sequence.

33. The composition, kit, or system of claim 32, further comprising the infectious agent.

34. The composition, kit, or system of claim 33 wherein the infectious agent comprises a type of bacteria, virus, pseudovirus, parasite, fungus, or phage;35. The composition, kit, or system of claims 32-33, wherein the infectious agent is transgenic or attenuated to reduce its infectious potential.

36. The composition, kit, or system of claim 34, wherein the bacteria comprises at least one of Chlamydia spp., Anaplasma spp., Ehrlichia spp., Rickettsia spp., Orientia spp. and Coxiella spp., Salmonella spp., Fr and sella spp., Legionella pneumophila, Listeria monocytogenes, and Yersinia spp.

37. The composition, kit, or system of any one of claims 28-36, further comprising a detectable marker linked to the isolated cell, wherein the detectable marker linked to the isolated cell comprises a fluorescent marker, an enzyme, a polypeptide, a carbohydrate, or a nucleic acid sequence.

38. The composition, kit, or system of any one of claims 28-37, wherein the infected cell exhibits an altered cell characteristic as compared to the non-infected cell, wherein the altered cell characteristic is related to cell size, expansion rate, permeability status, presence or absence of a nucleic acid, gene expression, protein expression, carbohydrates, post-translational protein modifications, or cell morphology.

39. A method comprising:(a) exposing an isolated cell to a test substrate;(i) wherein the isolated cell secretes a test polypeptide,(ii) wherein the isolated cell and the test substrate are exposed to complement proteins; and(iii) wherein if the test protein binds the test substrate, the complement proteins are activated; and(b) detecting an activation of the complement proteins.

40. The method of claim 39, wherein step (b) comprises detecting an activated complement protein, or an activated complement complex.

41. The method of claim 39 or 40, wherein step (b) comprises providing a detection molecule that specifically binds to an activated complement protein or complement complex, and detecting the detection molecule bound to the activated complement protein or complement complex.

42. The method of any one of the previous claims, comprising, after step (b) selecting the isolated cell based on the detection of activated complement proteins.

43. The method of any one of the previous claims, comprising, before, after, or during step (b), analyzing either the isolated polypeptide secreting cell or the test substrate for an altered cell characteristic.

44. The method of any one of the previous claims, wherein the isolated polypeptide secreting cell comprises a eukaryotic cell, bacterial cell, fungal cell, or insect cell, optionally a mammalian cell.

45. The method of any one of the previous claims, wherein the isolated polypeptide secreting cell comprises an antibody secreting cell, a plasma cell, or a B cell.

46. The method of any one of the previous claims, wherein the isolated polypeptide secreting cell comprises a genetically engineered cell.

47. The method of any one of the previous claims, wherein the test substrate comprises one or more of(a) a mammalian, bacterial, fungal, insect, or yeast cell, optionally a cancer cell;(b) an infectious agent, optionally a bacterium, virus, pseudovirus, phage, fungus, yeast, or parasite;(c) an isolated protein, virus-like particle, recombinant viral particle, or nanoparticle;(d) a solid support, bead, polymer, hydrogel, or macromolecule linked to a binding target;(e) an engineered, biological, or synthetic support linked to a binding target.

48. The method of claim 47, wherein the test substrate comprises a mammalian cell, wherein activation of the complement proteins results in the mammalian cell exhibiting an altered cell characteristic as compared to a mammalian cell where complement proteins are not activated.

49. The method of claims 43 or 48, wherein the altered cell characteristic comprises one or more of cell lysis, phagocytosis, apoptosis, cell size, cell morphology, permeability status, delayed cell growth.

50. The method of any one of the previous claims, comprising at least complement protein Cl, wherein if the test polypeptide binds to the test substrate, a Cl complex is formed.

51. The method of any one of the previous claims, wherein the test polypeptide comprises an antibody, a VHH, a scFv, a nanobody, a fragment of an antibody, an antibody Fc region, and Fc fusion domain, or antigen binding fragment.

52. The method of any one of the previous claims, wherein the complement proteins comprise one or more of: Cl, C2, C3, C4, C5, C6, C7, C8, C9, the soluble membrane attack complex (sMAC), any protein fragments thereof, and any combination thereof.

53. The method of claim 52, wherein detecting an activation of the complement proteins includes detection of the one or more of complement proteins Cl, C2, C3, C4, C5, C6, C7, C8, C9, the soluble membrane attack complex (sMAC), and / or any protein fragments thereof.

54. The method of claim 52, wherein the detection of the one or more of proteins Cl, C2, C3, C4, C5, C6, C7, C8, or C9, sMAC or any protein fragments thereof is based on an antibody that binds only the activated form one of the one or more of proteins Cl, C2, C3, C4, C5, C6, C7, C8, or C9, sMAC or any protein fragments thereof.

55. The method of any one of the previous claims, wherein the complement proteins are provided in serum.

56. The method of any one of the previous claims, wherein at least one complement protein is provided as an isolated complement protein.

57. The method of any one of the claims 40-56, wherein the detection molecule is linked to the isolated polypeptide secreting cell via a bridge molecule.

58. The method of claim 57, wherein the bridge molecule comprises an antibody that binds the surface of the isolated polypeptide secreting cell.

59. The method of claim 57 or claim 58, wherein the bridge molecule comprises a moiety that binds the detection molecule.

60. The method of any one of claims 56-59, wherein the bridge molecule comprises streptavidin or avidin.

61. The method of any one of claims 39-60, wherein the detection molecule comprises a secondary antibody with a detectable label.

62. The method of any one of claims claim 39-61 , wherein the detection molecule comprises a fluorescent marker, an enzyme, polypeptide, or a nucleic acid sequence.

63. The method of any one of the previous claims, further comprising: harvesting the cell.

64. The method of any one of the previous claims, further comprising sequencing the DNA encoding the test polypeptide, optionally wherein sequencing comprises whole transcriptome sequencing.

65. The method of any one of the previous claims, wherein the single, isolated polypeptide secreting cell is in a well of a multi-well plate.

66. The method of any one of claims 39-64, wherein the isolated polypeptide secreting cell is in a chamber of a chip or wafer.

67. The method of any of claims 39-64, wherein the isolated polypeptide secreting cell is in a droplet, such as an emulsion droplet, wherein exposing occurs within the droplet.

68. The method of any of claims 39-64, wherein the isolated polypeptide secreting cell is in a Nanopen™.

69. The method of any one of the previous claims, further comprising selecting the isolated polypeptide secreting cell or the microfluid droplet based on a detection of whether the test polypeptide activates complement.

70. The method of claim 64, wherein the selection is performed via flow cytometry or magnetic bead sorting.

71. The method of any one of the previous claims, wherein the isolated cell secreting the test polypeptide comprises a single isolated cell secreting the test polypeptide.

72. The method of any one of the previous claims, wherein the test substrate comprises an isolated cell, wherein the isolated cell expresses a cell surface molecule that binds the test polypeptide.

73. The method of any of the previous claims, wherein the complement protein is associated with the cell secreting the test polypeptide.

74. A composition, kit, or system comprising: a vector encoding a test protein, optionally, wherein one or more of the vectors are expression vectors, or, optionally, wherein one or more of the vectors are integration vectors; and at least one complement protein.

75. The composition, kit, or system of claim 74, wherein the encoded test protein comprises an antibody, a VHH, an scFv, a nanobody, a fragment of an antibody, antibody Fc region, an Fc fusion protein, or an antigen binding polypeptide fragment.

76. The composition, kit, or system of claim 74, wherein the antibody, a VHH, an scFv, a nanobody, a fragment of an antibody, antibody Fc region, an Fc fusion protein or antigen binding fragment is derived from a library of antibodies or antigen binding polypeptide fragments.

77. The composition, kit, or system of any one of claims 72-74, wherein the at least one of the complement proteins are provided in serum.

78. The composition, kit, or system of any one of claims 72-75, further comprising a detection molecule capable of binding directly or indirectly to one of the at least one complement protein.

79. The composition, kit, or system of any one of claims 74-78, further including a bridge molecule capable of linking the at least one complement protein to the isolated polypeptide secreting cell.

Images