Protection method for and use of enzyme recognition site, and gene cloning method
By designing a guide sequence, the dCas enzyme guides the enzyme recognition site in the target gene sequence, resulting in steric hindrance, solving the problem that enzyme recognition site is difficult to protect in the prior art, effectively protecting the enzyme recognition site, and reducing the technical difficulty.
Patent Information
- Application Number
- PCT/CN2024/126514
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-11-23
- Filing Date
- 2024-10-22
- Publication Date
- 2025-05-30
AI Technical Summary
In the prior art, during plasmid construction and gene cloning, it is difficult to effectively protect the enzyme recognition site from the recognition and cleavage of restriction endonucleases, resulting in increased difficulty in non-purpose DNA cleavage and technical difficulties.
The guide sequence is designed to guide the dCas enzyme to cover the enzyme recognition site in the target gene sequence, creating steric hindrance, and preventing the recognition and cleavage of restriction enzymes.
Effectively protect enzyme recognition sites, avoid non-purpose DNA cleavage, and reduce the technical difficulty caused by excessive restriction enzyme recognition sites.
Smart Images

Figure CN2024126514_30052025_PF_FP_ABST
Abstract
Description
Enzyme recognition site protection method and application thereof, gene cloning method
[0001] This application claims priority to Chinese patent application No. 202311579327.4, filed on November 23, 2023, the entire contents of which are incorporated by reference into this application. Technical Field
[0002] The present disclosure relates to the field of molecular biology technology, and in particular to a method for protecting an enzyme recognition site and an application thereof, a gene cloning method, and a gene cloning reagent system. Background Art
[0003] As medicine and testing technologies continue to advance, people are increasingly realizing that DNA and RNA testing are essential tools and key steps in achieving precision medicine. Through nucleic acid testing and analysis, researchers are gaining insights into the pathogenic mechanisms of many genetic diseases, enabling them to differentiate specific cancer types and diagnose infectious diseases.
[0004] Summary of the Invention
[0005] On the one hand, a method for protecting an enzyme recognition site is provided, which comprises designing a guide sequence to guide the dCas enzyme to cover the enzyme recognition site to be protected in the target gene sequence, so that the enzyme recognition site to be protected is protected from recognition and cleavage by a restriction endonuclease.
[0006] In some embodiments, the target gene sequence includes: a non-target recognition site with the same base sequence and at least one target recognition site, and the enzyme recognition site to be protected is also referred to as the target recognition site.
[0007] In some embodiments, the target gene sequence comprises any one of a plasmid and a linear DNA fragment.
[0008] In some embodiments, the guide sequence includes: a single-stranded nucleotide chain; the single-stranded nucleotide chain includes: a first fragment and a second fragment connected from the 5' end to the 3' end, wherein the first fragment is used to bind to the target gene sequence, and the second fragment is used to bind to the dCas enzyme.
[0009] On the other hand, a gene cloning method is provided, which includes: preparing a ribonucleoprotein complex solution, preparing a sample solution, and preparing an enzyme cleavage system, and performing enzyme cleavage. The ribonucleoprotein complex includes: a dCas enzyme and a guide sequence. The sample includes: a target gene sequence and the ribonucleoprotein complex; wherein the guide sequence guides the dCas enzyme to cover the enzyme recognition site to be protected in the target gene sequence. The enzyme cleavage system includes: a restriction endonuclease and the sample, and under the protection of the dCas enzyme, the enzyme recognition site to be protected is protected from recognition and cleavage by the restriction endonuclease.
[0010] In some embodiments, the target gene sequence includes: non-target recognition sites of the same base sequence and at least one target recognition site, and the enzyme recognition site to be protected is also referred to as the target recognition site. During the enzyme cleavage step, the non-target recognition site of the target gene sequence is recognized and cleaved by the restriction endonuclease.
[0011] In another aspect, a gene cloning reagent system is provided, comprising: a ribonucleoprotein complex solution; wherein the ribonucleoprotein complex solution comprises: a dCas enzyme solution and a guide sequence solution. In the dCas enzyme solution, the concentration of the dCas enzyme ranges from 1 μmol / L to 20 μmol / L; the ratio of the volume of the dCas enzyme solution to the volume of the ribonucleoprotein complex solution ranges from 1:10 to 3:10. In the guide sequence solution, the concentration of the guide sequence ranges from 2 μmol / L to 9 μmol / L; the ratio of the volume of the guide sequence solution to the volume of the ribonucleoprotein complex solution ranges from 1:10 to 3:10.
[0012] In some embodiments, the ribonucleoprotein complex solution further comprises a first buffer solution. The first buffer solution comprises 1000 mmol / L to 1500 mmol / L NaCl, 400 mmol / L to 600 mmol / L Tris-HCl, 80 mmol / L to 150 mmol / L MgCl2, and 800 μg / mL to 1500 μg / mL of recombinant protein. The pH of the first buffer solution ranges from 7.9 to 8.1. The ratio of the volume of the first buffer solution to the volume of the ribonucleoprotein complex solution ranges from 1:10 to 3:10.
[0013] In some embodiments, the gene cloning reagent system further comprises: a sample solution. The sample solution comprises: the ribonucleoprotein complex solution and the target gene sequence solution. The ratio of the volume of the ribonucleoprotein complex solution to the volume of the sample solution is in the range of 3:20 to 1:2. The copy number of the target gene sequence is greater than or equal to 10 3; The ratio of the volume of the target gene sequence solution to the volume of the sample solution ranges from 1:20 to 1:4.
[0014] In some embodiments, the sample solution further comprises a second buffer solution. The second buffer solution comprises 1000 mmol / L to 1500 mmol / L NaCl, 400 mmol / L to 600 mmol / L Tris-HCl, 80 mmol / L to 150 mmol / L MgCl2, and 800 μg / mL to 1500 μg / mL of recombinant protein. The pH of the second buffer solution ranges from 7.9 to 8.1, and the ratio of the volume of the second buffer solution to the volume of the sample solution ranges from 1:10 to 3:10.
[0015] In some embodiments, the gene cloning reagent system further comprises an enzyme digestion system. The enzyme digestion system comprises the sample solution and a restriction endonuclease solution; the ratio of the volume of the sample solution to the volume of the enzyme digestion system ranges from 1:10 to 1:2. The concentration of the restriction endonuclease in the restriction endonuclease solution ranges from 4 U / μL to 20 U / μL. The ratio of the volume of the restriction endonuclease solution to the volume of the enzyme digestion system ranges from 1:20 to 1:10.
[0016] In some embodiments, the enzymatic digestion system further comprises a third buffer solution comprising 100 mmol / L to 330 mmol / L Tris-HCl, 80 mmol / L to 150 mmol / L MgCl2, 660 mmol / L to 1000 mmol / L KCl, and 0.5 mg / mL to 1.5 mg / mL bovine serum albumin; the pH of the third buffer solution ranges from 7.9 to 8.5; and the ratio of the volume of the third buffer solution to the volume of the enzymatic digestion system ranges from 1:10 to 3:20.
[0017] In another aspect, there is provided an application of the method for protecting the enzyme recognition site as described in any one of the above embodiments in plasmid construction.
[0018] In another aspect, there is provided an application of the method for protecting the enzyme recognition site as described in any one of the above embodiments in the construction of a recombinant library.
[0019] In another aspect, there is provided an application of the method for protecting the enzyme recognition site as described in any of the above embodiments in the linearization of a plasmid in the RNA pharmaceutical production process. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] To more clearly illustrate the technical solutions of the present disclosure, the following briefly introduces the drawings required for use in some embodiments of the present disclosure. Obviously, the drawings described below are only drawings of some embodiments of the present disclosure, and those skilled in the art can also derive other drawings based on these drawings. Furthermore, the drawings described below are schematic diagrams and are not intended to limit the actual dimensions of the products, actual processes of the methods, actual timing of signals, and the like involved in the embodiments of the present disclosure.
[0021] FIG1 is a structural diagram of a plasmid provided according to some embodiments of the present disclosure;
[0022] FIG2 is a structural diagram of the dCas9 enzyme provided according to some embodiments of the present disclosure;
[0023] FIG3 is a flow chart of a gene cloning method according to some embodiments of the present disclosure;
[0024] FIG4 is a structural diagram corresponding to each step of the gene cloning method provided according to some embodiments of the present disclosure;
[0025] FIG5 is a gel electrophoresis diagram provided according to some embodiments of the present disclosure. DETAILED DESCRIPTION
[0026] The following will be combined with the accompanying drawings to clearly and completely describe the technical solutions in some embodiments of the present disclosure. Obviously, the embodiments described are only some embodiments of the present disclosure, not all embodiments. Based on the embodiments provided by the present disclosure, all other embodiments obtained by ordinary technicians in this field are within the scope of protection of the present disclosure.
[0027] Unless the context requires otherwise, throughout the specification and claims, the term "comprise" and its other forms, such as the third person singular form "comprises" and the present participle form "comprising", are to be interpreted as open and inclusive, that is, "including, but not limited to". In the description of the specification, the terms "one embodiment", "some embodiments", "exemplary embodiments", "example", "specific example" or "some examples" are intended to indicate that the particular features, structures, materials or characteristics associated with the embodiment or example are included in at least one embodiment or example of the present disclosure. The schematic representation of the above terms does not necessarily refer to the same embodiment or example. In addition, the particular features, structures, materials or characteristics may be included in any one or more embodiments or examples in any appropriate manner.
[0028] In the following, the terms "first" and "second" are used for descriptive purposes only and should not be understood to indicate or imply relative importance or implicitly specify the number of the technical features indicated. Therefore, a feature defined as "first" or "second" may explicitly or implicitly include one or more of the features. In the description of the embodiments of the present disclosure, unless otherwise specified, "plurality" means two or more.
[0029] When describing some embodiments, the expressions "coupled" and "connected" and their derivatives may be used. The term "connected" should be understood in a broad sense. For example, "connection" can be a fixed connection, a detachable connection, or an integral connection; it can be directly connected or indirectly connected through an intermediate medium. The term "coupled" indicates, for example, that two or more components are in direct physical or electrical contact. The term "coupled" or "communicatively coupled" may also refer to two or more components that are not in direct contact with each other, but still cooperate or interact with each other. The embodiments disclosed herein are not necessarily limited to the contents of this document.
[0030] “At least one of A, B and C” has the same meaning as “at least one of A, B or C” and both include the following combinations of A, B and C: A only, B only, C only, the combination of A and B, the combination of A and C, the combination of B and C, and the combination of A, B and C.
[0031] “A and / or B” includes the following three combinations: A only, B only, and a combination of A and B.
[0032] As used herein, "about," "substantially," or "approximately" includes the stated value and an average value that is within an acceptable range of deviation from the particular value as determined by one of ordinary skill in the art taking into account the measurements in question and the errors associated with the measurement of the particular quantity (i.e., the limitations of the measurement system).
[0033] As used herein, "parallel", "perpendicular", and "equal" include the situations described and situations similar to the situations described, and the range of the similar situations is within an acceptable deviation range, wherein the acceptable deviation range is as determined by a person of ordinary skill in the art taking into account the measurement in question and the errors associated with the measurement of the specific quantity (i.e., the limitations of the measurement system). For example, "parallel" includes absolute parallelism and approximate parallelism, wherein the acceptable deviation range of approximate parallelism can be, for example, a deviation within 5°; "perpendicular" includes absolute perpendicularity and approximate perpendicularity, wherein the acceptable deviation range of approximate perpendicularity can also be, for example, a deviation within 5°. "Equal" includes absolute equality and approximate equality, wherein the acceptable deviation range of approximate equality can be, for example, that the difference between the two equals is less than or equal to 5% of either one.
[0034] It will be understood that when a layer or element is referred to as being on another layer or substrate, it can be directly on the other layer or substrate, or intervening layers may be present therebetween.
[0035] Exemplary embodiments are described herein with reference to cross-sectional and / or plan views that are idealized exemplary drawings. In the drawings, the thickness of layers and the area of regions are exaggerated for clarity. Therefore, variations in shape relative to the drawings due to, for example, manufacturing techniques and / or tolerances are contemplated. Therefore, the exemplary embodiments should not be construed as limited to the shapes of the regions shown herein, but rather include deviations in shape due to, for example, manufacturing. For example, an etched region shown as a rectangle will typically have curved features. Therefore, the regions shown in the drawings are schematic in nature, and their shapes are not intended to illustrate the actual shape of regions of the device and are not intended to limit the scope of the exemplary embodiments.
[0036] In this application, DNA (deoxyribonucleic acid) is a long-chain polymer composed of four deoxynucleotides: adenine deoxynucleotide (dATP), thymine deoxynucleotide (dTTP), cytosine deoxynucleotide (dCTP), and guanine deoxynucleotide (dGTP). Deoxynucleotides are composed of phosphate, deoxyribose, and bases; there are four main bases: A (adenine), G (guanine), C (cytosine), and T (thymine). The size unit of a DNA fragment is base pairs, with commonly used units being bp (base pairs), kilobase pairs (kbp), and megabase pairs (Mbp).
[0037] In this application, RNA (ribonucleic acid) is a carrier of genetic information found in biological cells and some viruses and viroids. Its primary function in the body is to guide protein synthesis. RNA is a macromolecular polymer composed of ribonucleotides, which are composed of phosphate, ribose, and bases. There are four main bases: A (adenine), G (guanine), C (cytosine), and U (uracil).
[0038] In the present application, a plasmid is a small circular DNA molecule outside the cell chromosome that can replicate autonomously. Plasmids exist in many bacteria, yeast and other organisms.
[0039] In the present application, restriction endonuclease is an endonuclease that hydrolyzes double-stranded DNA at a specific nucleotide sequence. Restriction endonuclease is an endonuclease that can recognize and cut a specific double-stranded DNA sequence in an organism. It is an enzyme that can cut off foreign DNA, that is, it can limit the invasion of heterologous DNA and make it lose its vitality, but it has no damaging effect on its own DNA, so that the original genetic information of the cell can be protected. Since this cutting action is carried out inside the DNA molecule, it is called restriction endonuclease. Restriction endonuclease is generally composed of the first letter of the genus name of the microorganism and the first two letters of the species name, and the fourth letter represents the strain (strain).
[0040] In this application, the enzyme recognition site (or recognition site) refers to a specific sequence of bases on DNA. The restriction endonuclease can recognize this sequence and cut the DNA sequence into two segments. Usually, different enzymes have different recognition sequences.
[0041] During the plasmid construction process, restriction endonucleases are typically used to recognize specific nucleotide sequences (i.e., the restriction endonuclease recognition sites) in double-stranded DNA molecules and cleave the phosphodiester bonds in the DNA strands at specific locations to complete the enzymatic cleavage step. In this step, as shown in FIG1 , if multiple identical restriction endonuclease recognition sites are present in a double-stranded DNA molecule 100 (e.g., a linear DNA fragment or plasmid), the restriction endonuclease will cut the DNA molecule into multiple fragments, making subsequent plasmid construction impossible or resulting in the formation of only linearized fragments.
[0042] Exemplarily, as shown in FIG1 , a double-stranded DNA molecule 100 is a plasmid formed by a plasmid vector pUC57 and a gene insertion sequence, wherein the plasmid comprises 3388 base pairs. Among them, EcoRV (431) indicates that the sequence from 431 base pairs is GATATC, which is a recognition site sequence for the restriction endonuclease EcoRV; EcoRV (3353) indicates that the sequence from 3353 base pairs is GATATC, which is another recognition site sequence for the restriction endonuclease EcoRV. That is, in the plasmid, there are two recognition sites for the restriction endonuclease EcoRV, and the sequence of the recognition site is 5'-GATATC-3'. Among them, the cutting position 110 is located between the base T and the base A from the 5' end to the 3' end in the sequence of the recognition site.
[0043] It should be noted that FIG1 is used to illustrate the situation where the double-stranded DNA molecule 100 has two identical restriction endonuclease recognition sites. The recognition sites of other restriction endonucleases in the plasmid and other information of the plasmid are not introduced here.
[0044] In the related art, the above problems can be solved by replacing the restriction endonuclease or plasmid vector. However, replacing the restriction endonuclease or plasmid vector has the problems of long replacement cycle and low efficiency, and there is also the problem that the solution of replacing the plasmid vector is difficult to implement.
[0045] Based on this, an embodiment of the present disclosure provides a method for protecting an enzyme recognition site, which includes: designing a guide sequence to guide the dCas enzyme to cover the enzyme recognition site to be protected in the target gene sequence, so that the enzyme recognition site to be protected is protected from recognition and cleavage by the restriction endonuclease.
[0046] Exemplarily, the dCas enzyme is a dCas9 (dead Cas9) enzyme. As shown in Figure 2, the dCas9 enzyme is a mutant of the Cas9 protein, in which both the RuvC1 and HNH nuclease active regions of the Cas9 protein undergo mutations. Therefore, the dCas9 enzyme retains only the ability to enter the genome via the guide sequence, but its cleavage activity is completely lost. In other words, the dCas9 enzyme can enter the genome via the guide sequence, but it will not cleave the genome.
[0047] In some examples, the target gene sequence includes non-target recognition sites and at least one target recognition site of the same base sequence, and the enzyme recognition site to be protected is referred to as the target recognition site.
[0048] Exemplarily, the target gene sequence includes any of a plasmid and a linear DNA fragment. For example, the linear DNA fragment is a PCR amplification product or a ligation product of multiple gene fragments. PCR stands for polymerase chain reaction. PCR is a molecular biology technique used to amplify specific DNA fragments and can be considered a specialized form of DNA replication in vitro. Its most significant feature is its ability to significantly increase the size of minute amounts of DNA.
[0049] For example, the copy number of the target gene sequence is greater than or equal to 10 3 The copy number refers to the number of a gene (which can be a plasmid) in the genome of a certain organism. Here, the copy number refers to the number of base pairs contained in the target gene sequence, that is, the number of base pairs contained in the target gene sequence is greater than or equal to 10. 3 .
[0050] The guide sequence is gRNA (guide RNA). In some examples, the guide sequence includes: a single-stranded nucleotide; the single-stranded nucleotide includes: a first fragment and a second fragment connected in sequence from the 5' end to the 3' end, wherein the first fragment is used to bind to the target gene sequence, and the second fragment is used to bind to the dCas enzyme.
[0051] The target recognition site of the target gene sequence can be protected from recognition and cleavage by the restriction endonuclease because the target gene sequence bound to the dCas enzyme produces steric hindrance at the target recognition site. When the restriction endonuclease cleaves the target gene sequence, the steric hindrance prevents the restriction endonuclease from completing normal recognition and cleavage.
[0052] Therefore, the enzyme recognition site protection method provided in the embodiments of the present disclosure can protect the restriction endonuclease recognition site in the target gene sequence. When the target gene sequence has multiple restriction endonuclease recognition sites, non-target DNA cutting can be avoided, reducing the technical difficulty caused by too many restriction endonuclease recognition sites.
[0053] In some examples, the first fragment of the guide sequence is paired with the base sequence near the target recognition site of the target gene sequence, so that the dCas enzyme bound to the second fragment binds to the vicinity of the target recognition site, covering the target recognition site of the target gene sequence, and generating steric hindrance at the target recognition site. When the restriction endonuclease cuts the target gene sequence, the steric hindrance prevents the restriction endonuclease from completing normal recognition and cutting, thereby achieving the purpose of protecting the enzyme recognition site.
[0054] It should be noted that after the first fragment is combined with the target gene sequence, the sequence in the target gene sequence that is combined with the first fragment is called the binding sequence. Among them, in the above-mentioned "pairing of the first fragment of the guide sequence with the base sequence near the target recognition site of the target gene sequence", "near" means that after the first fragment is combined with the target gene sequence, the binding sequence includes the target recognition site, or the number of bases between the target recognition site and the binding sequence is less than or equal to 15. This can ensure that the dCas enzyme covers the target recognition site of the target gene sequence, generates steric hindrance at the target recognition site, and makes it impossible for the restriction endonuclease to complete normal recognition and cutting.
[0055] For example, the number of bases between the target recognition site and the binding sequence is 1, 2, 4, 5, 8, 10, 11, 13 or 15, etc., which is not limited here.
[0056] Exemplarily, the first fragment is a 20-base sequence. The 20-base sequence binds to the target gene sequence through the principle of base complementary pairing, guiding the dCas enzyme bound to the second fragment to the target recognition site and covering the target recognition site. The dCas enzyme generates steric hindrance at the target recognition site, preventing the target recognition site of the target gene sequence from being recognized and cut by the restriction endonuclease.
[0057] In the target gene sequence, the sequence downstream of the first fragment must be an NGG sequence, where N is A (adenine), G (guanine), C (cytosine), or T (thymine). Furthermore, the first fragment should match the target gene sequence to avoid complex secondary structures. In biochemistry and structural biology, secondary structure refers to the three-dimensional general formula of a local segment of a biological macromolecule, such as a protein or nucleic acid (DNA or RNA).
[0058] The second fragment is used to bind to the dCas enzyme. When the dCas enzyme is dCas9 enzyme, the second fragment is a fixed base sequence. The sequence of the second fragment is: 5'-GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3'.
[0059] In some examples, in the first segment of the guide sequence, the ratio of the sum of the number of guanine and cytosine to the number of bases in the first segment is greater than or equal to 30% and less than or equal to 70%.
[0060] Illustratively, in the first segment of the guide sequence, the ratio of the sum of the number of guanine (G) and cytosine (C) to the number of bases in the first segment is 30%, 40%, 50%, 60% or 70%, etc., which is not limited here.
[0061] Since three hydrogen bonds are formed between guanine (G) and cytosine (C), the pairing combination of guanine (G) and cytosine (C) is relatively stable. Therefore, by setting the ratio of the sum of the number of guanine and cytosine to the number of bases in the first fragment to be greater than or equal to 30%, the stability of the binding of the first fragment to the target gene sequence can be guaranteed. In addition, by setting the ratio of the sum of the number of guanine and cytosine to the number of bases in the first fragment to be less than or equal to 70%, it is convenient to subsequently release the binding between the guide sequence and the target gene sequence. Regarding the step of releasing the binding between the guide sequence and the target gene sequence, the embodiments of the present disclosure are not introduced in detail.
[0062] Exemplarily, the guide sequence includes: 5'-AGGAUAUCUUCAGGUAGUCCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3', wherein AGGAUAUCUUCAGGUAGUCC is the first segment, and GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU is the second segment.
[0063] For example, there is a restriction endonuclease EcoRV recognition site in a gene sequence of the plasmid, the sequence of the recognition site is 5'-GATATC-3', and the recognition site is the target recognition site that needs to be avoided from being recognized and cut by the restriction endonuclease EcoRV. The first segment of the guide sequence AGGAUAUCUUCAGGUAGUC binds to the base sequence near the target recognition site.
[0064] The bound dCas enzyme GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGCUUUU binds to the vicinity of the target recognition site, covering the target recognition site and generating steric hindrance at the target recognition site. The steric hindrance makes it impossible for the restriction endonuclease EcoRV to recognize the recognition site and complete normal cutting, thereby protecting the enzyme recognition site.
[0065] Exemplarily, the restriction endonuclease includes any one of type I restriction endonuclease, type II restriction endonuclease and type III restriction endonuclease.
[0066] Among them, type I restriction endonuclease is a complex multi-subunit enzyme with both restriction and methylase activity. Type I restriction endonuclease was first discovered in Escherichia coli strains. Type II restriction endonucleases can specifically recognize rotationally symmetrical (also known as palindromic) nucleic acid sequences of four or six nucleotides, and cut the phosphodiester bonds in the DNA double strand at specific nucleotides in the recognition region, producing defined restriction fragments and gel bands. Type III restriction endonucleases can recognize two independent non-palindromic sequences, which are in reverse order. In addition, it cuts DNA approximately 20 to 30 bp downstream of the recognition site. Typically, type III restriction endonucleases are heterodimers with two different subunits.
[0067] For example, the restriction endonuclease is any one of BamHI, KpnI, EcoRI, HindIII, NdeI and XhoI.
[0068] The enzyme recognition site protection method provided in the embodiments of the present disclosure can be applied in plasmid construction. By protecting the restriction endonuclease recognition sites from being recognized and cut by the restriction endonuclease, the technical difficulty caused by too many restriction endonuclease recognition sites can be reduced.
[0069] The enzyme recognition site protection methods provided in the embodiments of the present disclosure can be applied to the construction of recombinant libraries, such as fragment libraries and plasmid libraries. By protecting restriction endonuclease recognition sites from recognition and cleavage by restriction endonucleases, the technical difficulty associated with an excessive number of restriction endonuclease recognition sites can be reduced.
[0070] The enzyme recognition site protection method provided in the embodiments of the present disclosure can be applied to the linearization of plasmids in the RNA pharmaceutical process. By protecting the restriction endonuclease recognition sites from being recognized and cut by the restriction endonuclease, the technical difficulty caused by too many restriction endonuclease recognition sites can be reduced.
[0071] The embodiments of the present disclosure further provide a gene cloning method, as shown in FIG3 , which includes steps S1 to S3 .
[0072] S1: As shown in FIG4 , a ribonucleoprotein complex solution is prepared. The ribonucleoprotein complex includes: a dCas enzyme and a guide sequence.
[0073] For the introduction of guide sequence and dCas enzyme, please refer to the above content and will not be repeated here.
[0074] A ribonucleoprotein complex (RNP) is a complex formed by a specific protein and a specific RNA. In this case, the specific protein is the dCas enzyme, and the specific RNA is the guide sequence. The dCas enzyme and the guide sequence bind to form the ribonucleoprotein complex.
[0075] In some examples, the step of preparing the ribonucleoprotein complex solution includes: mixing the dCas enzyme solution, the guide sequence solution, and the first buffer solution, and storing them at room temperature.
[0076] The first buffer solution comprises: 1000 mmol / L to 1500 mmol / L NaCl, 400 mmol / L to 600 mmol / L Tris-HCl, 80 mmol / L to 150 mmol / L MgCl2, and 800 μg / mL to 1500 μg / mL of recombinant protein. The pH of the first buffer solution ranges from 7.9 to 8.1. The ratio of the volume of the first buffer solution to the volume of the ribonucleoprotein complex solution ranges from 1:10 to 3:10. The first buffer solution serves as a carrier solution for the ribonucleoprotein complex solution.
[0077] NaCl is called sodium chloride in Chinese. It is a white crystal that is easily soluble in water. For example, in the first buffer solution, the molar concentration of NaCl is 1000 mmol / L, 1100 mmol / L, 1200 mmol / L, 1300 mmol / L, 1400 mmol / L, or 1500 mmol / L, etc., but is not limited thereto.
[0078] The Chinese name of Tris-HCl is tris(hydroxymethyl)aminomethane hydrochloride, and its molecular formula is C4H 11 For example, in the first buffer solution, the molar concentration of Tris-HCl is 400 mmol / L, 450 mmol / L, 500 mmol / L, 550 mmol / L, or 600 mmol / L, etc., which is not limited here.
[0079] MgCl2 is also known as magnesium chloride in Chinese and is a colorless, deliquescent crystal. Exemplarily, in the first buffer solution, the molar concentration of MgCl2 is 80 mmol / L, 90 mmol / L, 100 mmol / L, 110 mmol / L, 120 mmol / L, 130 mmol / L, 140 mmol / L, or 150 mmol / L, etc., but is not limited thereto.
[0080] A recombinant albumin is an artificially synthesized protein obtained by applying recombinant DNA or recombinant RNA technology. For example, the mass concentration of the recombinant albumin in the first buffer solution is 800 μg / mL, 900 μg / mL, 1000 μg / mL, 1100 μg / mL, 1200 μg / mL, 1300 μg / mL, 1400 μg / mL, or 1500 μg / mL, etc., although this is not a limitation.
[0081] Exemplarily, the pH value of the first buffer solution is 7.9, 8.0 or 8.1, etc., which is not limited here.
[0082] Illustratively, the ratio of the volume of the first buffer solution to the volume of the ribonucleoprotein complex solution is 1:10, 3:20, 1:5, 1:4 or 3:10, etc., which is not limited here.
[0083] In some examples, in the dCas enzyme solution, the concentration of the dCas enzyme ranges from 1 μmol / L to 20 μmol / L.
[0084] Illustratively, in the dCas enzyme solution, the molar concentration of the dCas enzyme is 1 μmol / L, 2 μmol / L, 4 μmol / L, 7 μmol / L, 9 μmol / L, 13 μmol / L, 15 μmol / L, 18 μmol / L or 20 μmol / L, etc., which is not limited here.
[0085] In some examples, the ratio of the volume of the dCas enzyme solution to the volume of the ribonucleoprotein complex solution ranges from 1:10 to 3:10.
[0086] Exemplarily, the ratio of the volume of the dCas enzyme solution to the volume of the ribonucleoprotein complex solution is 1:10, 3:20, 1:5, 1:4 or 3:10, etc., which is not limited here.
[0087] In some examples, the concentration of the guide sequence in the guide sequence solution ranges from 2 μmol / L to 9 μmol / L.
[0088] Illustratively, in the guide sequence solution, the molar concentration of the guide sequence is 2 μmol / L, 3 μmol / L, 4 μmol / L, 5 μmol / L, 6 μmol / L, 7 μmol / L, 8 μmol / L or 9 μmol / L, etc., which is not limited here.
[0089] In some examples, the ratio of the volume of the guide sequence solution to the volume of the ribonucleoprotein complex solution ranges from 1:10 to 3:10.
[0090] Illustratively, the ratio of the volume of the guide sequence solution to the volume of the ribonucleoprotein complex solution is 1:10, 3:20, 1:5, 1:4, or 3:10, etc., which is not limited here.
[0091] By mixing the above-mentioned dCas enzyme solution, guide sequence solution and first buffer solution, a ribonucleoprotein complex solution including dCas enzyme and guide sequence at an appropriate concentration can be prepared for protecting the enzyme recognition site in the subsequent gene cloning step.
[0092] S2: As shown in FIG4 , a sample solution is prepared, wherein the sample includes: a target gene sequence and a ribonucleoprotein complex; wherein the guide sequence guides the dCas enzyme to cover the enzyme recognition site to be protected in the target gene sequence.
[0093] For example, as shown in Figure 4, taking the target gene sequence as a linear DNA sequence, the target gene sequence has two enzyme recognition sites with the same base sequence, one of which is a non-target recognition site and the other is a target recognition site. The guide sequence guides the dCas enzyme to bind to the vicinity of the target recognition site, covering the target recognition site, while the dCas enzyme is not bound near the non-target recognition site.
[0094] In some examples, preparing the sample solution includes mixing a ribonucleoprotein complex solution, a target gene sequence solution, and a second buffer solution, and storing the solution at room temperature. For example, the room temperature storage time range is greater than or equal to 20 minutes to ensure that the dCas enzyme fully binds to the target gene sequence.
[0095] The second buffer solution is a carrier solution for the sample solution.
[0096] The second buffer solution includes: 1000 mmol / L to 1500 mmol / L NaCl, 400 mmol / L to 600 mmol / L Tris-HCl, 80 mmol / L to 150 mmol / L MgCl2, and 800 μg / mL to 1500 μg / mL of recombinant protein. The pH of the second buffer solution ranges from 7.9 to 8.1. The ratio of the volume of the second buffer solution to the volume of the sample solution ranges from 1:10 to 3:10.
[0097] Illustratively, in the second buffer solution, the molar concentration of NaCl is 1000 mmol / L, 1100 mmol / L, 1200 mmol / L, 1300 mmol / L, 1400 mmol / L or 1500 mmol / L, etc., which is not limited here.
[0098] Illustratively, in the second buffer solution, the molar concentration of Tris-HCl is 400 mmol / L, 450 mmol / L, 500 mmol / L, 550 mmol / L or 600 mmol / L, etc., which is not limited here.
[0099] Illustratively, in the second buffer solution, the molar concentration of MgCl2 is 80mmol / L, 90mmol / L, 100mmol / L, 110mmol / L, 120mmol / L, 130mmol / L, 140mmol / L or 150mmol / L, etc., which is not limited here.
[0100] Illustratively, in the second buffer solution, the mass concentration of the recombinant protein is 800 μg / mL, 900 μg / mL, 1000 μg / mL, 1100 μg / mL, 1200 μg / mL, 1300 μg / mL, 1400 μg / mL or 1500 μg / mL, etc., which is not limited here.
[0101] Illustratively, the pH value of the second buffer solution is 7.9, 8.0, or 8.1, etc., which is not limited here.
[0102] Illustratively, the ratio of the volume of the second buffer solution to the volume of the sample solution is 1:10, 3:20, 1:5, 1:4, or 3:10, etc., which is not limited here.
[0103] It should be noted that the components of the first buffer solution are the same as those of the second buffer solution, and the content of each component in the first buffer solution and the content of each component in the second buffer solution may be the same or different, which is not limited here.
[0104] In some examples, the ratio of the volume of the ribonucleoprotein complex solution to the volume of the sample solution ranges from 3:20 to 1:2.
[0105] Illustratively, the ratio of the volume of the ribonucleoprotein complex solution to the volume of the sample solution is 3:20, 1:5, 1:4, 3:10, 7:20, 2:5, 9:20 or 1:2, etc., which is not limited here.
[0106] In some examples, the ratio of the volume of the target gene sequence solution to the volume of the sample solution ranges from 1:20 to 1:4.
[0107] Illustratively, the ratio of the volume of the target gene sequence solution to the volume of the sample solution is 1:20, 1:10, 3:20, 1:5, or 1:4, etc., which is not limited here.
[0108] By mixing the ribonucleoprotein complex solution, the target gene sequence solution and the second buffer solution, a sample solution is prepared in which the dCas enzyme is bound near the target recognition site of the target gene sequence. In this sample solution, the dCas enzyme covers the target recognition site of the target gene sequence, generating steric hindrance.
[0109] S3: As shown in FIG4 , an enzyme cleavage system is prepared, which includes a restriction endonuclease and a sample, and enzyme cleavage is performed; under the protection of the dCas enzyme, the enzyme recognition site to be protected is protected from recognition and cleavage by the restriction endonuclease.
[0110] The target gene sequence includes: non-target recognition sites of the same base sequence and at least one target recognition site. The enzyme recognition site to be protected is also called the target recognition site. In the enzyme cleavage step, the non-target recognition site of the target gene sequence is recognized and cleaved by the restriction endonuclease.
[0111] That is, in the enzyme cleavage step, the target recognition site of the target gene sequence can be protected from recognition and cleavage by the restriction endonuclease, while the non-target recognition site of the target gene sequence is recognized and cleaved by the restriction endonuclease.
[0112] That is, the target recognition site of the target gene sequence is protected from recognition and cleavage by the restriction endonuclease. At the same time, the non-target recognition site of the target gene sequence is recognized and cleaved by the restriction endonuclease, so that the target gene sequence is cut to obtain two gene fragments, for example, the first gene fragment and the second gene fragment.
[0113] Exemplarily, in this step, the enzyme digestion time range is 15 minutes to 30 minutes. For example, the enzyme digestion time is 15 minutes, 18 minutes, 20 minutes, 22 minutes, 25 minutes, 28 minutes or 30 minutes, etc., which are not limited here. By setting this enzyme digestion time range, it can be ensured that the restriction endonuclease fully digests the sample, that is, the non-target recognition site of the target gene sequence is fully cut, and the target recognition site of the target gene sequence is not damaged, so that the target recognition site of the target gene sequence is protected from recognition and cutting by the restriction endonuclease.
[0114] In some examples, the step of preparing the enzyme digestion system includes: mixing a sample solution, a restriction endonuclease solution, and a third buffer solution.
[0115] The third buffer solution includes: 100 mmol / L to 330 mmol / L Tris-HCl, 80 mmol / L to 150 mmol / L MgCl2, 660 mmol / L to 1000 mmol / L KCl, and 0.5 mg / mL to 1.5 mg / mL bovine serum albumin. The pH of the third buffer solution ranges from 7.9 to 8.5. The ratio of the volume of the third buffer solution to the volume of the enzymatic digestion system ranges from 1:10 to 3:20. The third buffer solution serves as the carrier solution for the enzymatic digestion system.
[0116] Illustratively, the molar concentration of Tris-HCl is 100 mmol / L, 120 mmol / L, 130 mmol / L, 150 mmol / L, 180 mmol / L, 200 mmol / L, 230 mmol / L, 250 mmol / L, 280 mmol / L, 300 mmol / L or 330 mmol / L, etc., but is not limited thereto.
[0117] Illustratively, the molar concentration of MgCl2 is 80mmol / L, 90mmol / L, 100mmol / L, 110mmol / L, 120mmol / L, 130mmol / L, 140mmol / L or 150mmol / L, etc., which is not limited here.
[0118] KCl, also known as potassium chloride in Chinese, is a type of hydrochloride salt. It occurs as white crystals or crystalline powder and is readily soluble in water. Exemplary molar concentrations of KCl include 660 mmol / L, 680 mmol / L, 720 mmol / L, 750 mmol / L, 780 mmol / L, 800 mmol / L, 830 mmol / L, 870 mmol / L, 900 mmol / L, 960 mmol / L, or 1000 mmol / L, among others, although this is not a limitation.
[0119] Bovine serum albumin (BSA) is an albumin in bovine serum. Exemplarily, the mass concentration of BSA is 0.5 mg / mL, 0.7 mg / mL, 0.9 mg / mL, 1.2 mg / mL, 1.4 mg / mL or 1.5 mg / mL, etc., but is not limited thereto.
[0120] Illustratively, the pH value of the third buffer solution is 7.9, 8.0, 8.1, 8.2, 8.3, 8.4 or 8.5, etc., which is not limited here.
[0121] Illustratively, the ratio of the volume of the third buffer solution to the volume of the enzyme digestion system is 1:10, 1:8, or 3:20, etc., which is not limited here.
[0122] In some examples, the ratio of the volume of the sample solution to the volume of the enzyme digestion system ranges from 1:10 to 1:2.
[0123] For example, the ratio of the volume of the sample solution to the volume of the enzyme digestion system is 1:10, 1:5, 3:10, 2:5 or 1:2, etc., which is not limited here.
[0124] In some examples, the concentration of the restriction endonuclease in the restriction endonuclease solution ranges from 4 U / μL to 20 U / μL.
[0125] The activity of an enzyme, or the amount of enzyme, is expressed in units of activity (U). In 1961, the Enzymology Commission of the International Biochemical Union proposed the use of a unified "International Unit" (IU) to express enzyme activity. This unit is defined as the amount of enzyme required to catalyze the conversion of one micromole (μmol) of substrate into product per minute under optimal conditions (25°C), i.e., 1 IU = 1 μmol / min. In other words, the enzyme content can be expressed as the number of units of activity per gram or milliliter of enzyme preparation (U / g or U / ml), where U is the abbreviation for IU.
[0126] For example, in the restriction endonuclease solution, the concentration of the restriction endonuclease is 4 U / μL, 5 U / μL, 7 U / μL, 8 U / μL, 10 U / μL, 12 U / μL, 14 U / μL, 15 U / μL, 16 U / μL, 17 U / μL, 18 U / μL or 20 U / μL, etc., which is not limited here.
[0127] In some examples, the ratio of the volume of the restriction endonuclease solution to the volume of the enzyme digestion system ranges from 1:20 to 1:10.
[0128] Illustratively, the ratio of the volume of the restriction endonuclease solution to the volume of the enzyme digestion system is 1:20, 3:40 or 1:10, etc., which is not limited here.
[0129] An enzyme digestion system suitable for the reaction of the restriction endonuclease with the sample can be prepared by mixing the sample solution, the restriction endonuclease solution and the third buffer solution.
[0130] The gene cloning method provided in the embodiments of the present disclosure uses a guide sequence to guide the dCas enzyme to bind near the enzyme recognition site (i.e., the target recognition site), covering the enzyme recognition site and generating steric hindrance, thereby protecting it from recognition and cleavage by the restriction endonuclease, thereby achieving the purpose of protecting the enzyme recognition site. This can reduce the technical difficulty caused by too many restriction endonuclease recognition sites.
[0131] The embodiments of the present disclosure further provide a gene cloning reagent system, which includes: a ribonucleoprotein complex solution, a sample solution, and an enzyme cleavage system. For an introduction to the ribonucleoprotein complex solution, the sample solution, and the enzyme cleavage system, refer to the above content and will not be repeated here.
[0132] In order to objectively evaluate the technical effects of the embodiments of the present disclosure, the technical solutions provided by the present disclosure will be described in detail and exemplarily through the following experimental examples and comparative examples.
[0133] Example 1
[0134] First, prepare a ribonucleoprotein complex solution. Mix the dCas enzyme solution, guide sequence solution, and first buffer solution to obtain a ribonucleoprotein complex solution. The first buffer solution contains: 1000 mmol / L NaCl, 500 mmol / L Tris-HCl, 100 mmol / L MgCl2, and 1000 μg / mL of recombinant protein. The pH of the first buffer solution is 7.9. The specific volumes of various reagents are shown in Table 1.
[0135] Table 1
[0136] Then, a sample solution was prepared by mixing the ribonucleoprotein complex solution, the target gene sequence solution, and the second buffer solution, and storing the mixture at room temperature for 20 minutes to obtain a sample solution.
[0137] In the sample provided in this embodiment, the target gene sequence is a circular plasmid formed by connecting the insertion sequence 1 and the plasmid vector pUC57, which is called the first plasmid.
[0138] The sequence of insertion sequence 1 is: 5'--3'. A recognition site for the restriction endonuclease EcoRV exists within insertion sequence 1, and the sequence of this recognition site is 5'-GATATC-3'. As shown in Figure 1, the cleavage position 110 of the restriction endonuclease EcoRV is located between base T and base A from the 5' end to the 3' end of the recognition site.
[0139] The plasmid vector pUC57 contains a recognition site for the restriction endonuclease EcoRV. The sequence of the recognition site is identical to that of the recognition site in the inserted sequence 1, both being 5'-GATATC-3'.
[0140] That is, in the first plasmid formed by ligating Insertion Sequence 1 to the plasmid vector pUC57, there are two recognition sites for the restriction endonuclease EcoRV: one recognition site is located in Insertion Sequence 1, and the other recognition site is located in the plasmid vector pUC57.
[0141] This guide sequence is referred to as guide sequence 1, and the base sequence of guide sequence 1 is: 5'-AACUUUGAUAUCAGCGGUCUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3', wherein AACUUUGAUAUCAGCGGUCU is the first segment, and GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU is the second segment.
[0142] The purpose of designing the guide sequence 1 is to use the guide sequence 1 to guide the dCas enzyme to bind to the recognition site located near the insertion sequence 1 in the first plasmid. Whether the dCas enzyme binds to the recognition site located in the insertion sequence 1 under the guidance of the guide sequence 1 and generates steric hindrance to protect the recognition site from recognition and cleavage by the restriction endonuclease EcoRV, the specific results are shown in the gel electrophoresis diagram of Figure 5 below, which will not be described in detail here.
[0143] The second buffer solution includes: 1000 mmol / L NaCl, 500 mmol / L Tris-HCl, 100 mmol / L MgCl2, 1000 μg / mL recombinant protein, and the pH of the second buffer solution is 7.9. The specific volumes of various reagents used are shown in Table 2.
[0144] Table 2
[0145] Then, an enzyme digestion system is prepared by mixing the sample solution, the restriction endonuclease solution, and the third buffer solution to obtain an enzyme digestion system, with the digestion time ranging from 15 minutes to 30 minutes.
[0146] In the enzyme digestion system provided in this embodiment, the restriction endonuclease is EcoRV, and the sequence of the recognition site of the restriction endonuclease EcoRV is 5'-GATATC-3'.
[0147] The third buffer solution includes: 100 mmol / L Tris-HCl, 100 mmol / L MgCl2, 1000 mmol / L KCl, and 1 mg / mL bovine serum albumin. The pH value of the third buffer solution is 8.5. The specific volume usage of each reagent is shown in Table 3.
[0148] Table 3
[0149] In this step, the restriction endonuclease EcoRV recognizes and cuts the recognition site in the first plasmid.
[0150] It is understood that, in the first plasmid, the recognition site located in the plasmid vector pUC57 will be recognized and cut under the action of the restriction endonuclease EcoRV.
[0151] If the dCas enzyme binds to the vicinity of the recognition site in the insertion sequence 1 under the guidance of the guide sequence 1 and covers the recognition site, the recognition site in the insertion sequence 1 can be protected from recognition and cleavage by the restriction endonuclease EcoRV. After this enzyme cleavage step, the first plasmid is cut into a linear fragment.
[0152] If the dCas enzyme does not bind to the recognition site located in the insertion sequence 1 under the guidance of the guide sequence 1, it cannot protect the recognition site in the insertion sequence 1 from recognition and cleavage by the restriction endonuclease EcoRV. Then, after the enzyme cleavage step, the first plasmid is cut into two linear fragments.
[0153] Specifically, referring to the gel electrophoresis diagram in Figure 5, it can be seen that there is a band at 2000bp to 4000bp and a band at 500bp to 650bp. The presence of two bands indicates that the cut first plasmid has become two linear fragments. It should be noted that in Figure 5, "Example 1" represents the test results of this example. Among them, the two "Examples 1" indicate that this example was implemented twice.
[0154] Therefore, it can be seen that the dCas enzyme does not bind to the vicinity of the recognition site located in the insertion sequence 1 under the guidance of the guide sequence 1, thereby failing to protect the recognition site in the insertion sequence 1 from recognition and cutting by the restriction endonuclease EcoRV, and the design of the guide sequence 1 is invalid.
[0155] Example 2
[0156] First, a ribonucleoprotein complex solution is prepared. The preparation of the ribonucleoprotein complex solution is the same as in Example 1. The specific steps can be referred to the introduction in Example 1 and will not be repeated here.
[0157] Then, a sample solution was prepared by mixing the ribonucleoprotein complex solution, the target gene sequence solution, and the second buffer solution, and storing the mixture at room temperature for 20 minutes to obtain a sample solution.
[0158] In the sample provided in this embodiment, the target gene sequence is a circular plasmid formed by connecting the insertion sequence 2 and the plasmid vector pUC57, which is called the second plasmid.
[0159] Among them, the sequence of the inserted sequence 2 is: 5'-TTAAGCACCGGTGGAGTGACGACCTTCAGCACGTTCGTACTGTTCAACGATGGTGTAGTCTTCGTTGTGGGAGGTGATGTCCAGTTTGATGTCGGTTGTAAGCACCCGGCAGCTGAACCGGTTTTTTTAGCCATGTAGGTGGTTTTAACTTCAGCGTCGTAGTGACCACC GTCTTTCAGTTTCAGACGCATTTTGATTTCACCTTTCAGAGCACCGTCTTCCGGGTACATACGTTCGGTGGAAGCTTCCCAACCCATGGTTTTTTTCTGCATAACCGGACCATCGGACGGGAAGTTG GTACCACGCAGTTTAACTTTGTAGATGAACTCACCGTCTTGCAGGGAGGAGTCCTGGGTAACGGTAACAACAACCACCGTCTTCGAAGTTCATAACACGTTCCCATTTGAAACCTTCCGGGAAGGATAT CTTCAGGTAGTCCGGGATGTCAGCCGGGTGTTTAACGTAAGCTTTGGAACCGTACTGGAACTGCGGGGACAGGATGTCCCAAGCGAACGGCAGCGGACCACCTTTGGTAACTTTCAGTTTAGCGGTCTGGGTACCTTCGTACGGACGACCTTCACCTTCACCTTCGATTTCGAACTCGTGACCGTTAACGGAACCTTCCATACGAACTTTGAAACGCATGAACTCTTTGATAACGTCTTCGGAGGAAGCCAT-3'. Insert 2 contains a recognition site for the restriction endonuclease EcoRV, and the sequence of the recognition site is 5'-GATATC-3'.
[0160] The plasmid vector pUC57 contains a recognition site for the restriction endonuclease EcoRV. The sequence of the recognition site is identical to that of the recognition site in the insertion sequence 2, both being 5'-GATATC-3'.
[0161] That is, in the second plasmid formed by ligating Insertion Sequence 2 to the plasmid vector pUC57, there are two recognition sites for the restriction endonuclease EcoRV: one recognition site is located in Insertion Sequence 2, and the other recognition site is located in the plasmid vector pUC57.
[0162] This guide sequence is referred to as guide sequence 2, and the base sequence of guide sequence 2 is: 5'-AGGAUAUCUUCAGGUAGUCCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3', wherein AGGAUAUCUUCAGGUAGUCC is the first segment, and GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU is the second segment.
[0163] The purpose of designing the guide sequence 2 is to use the guide sequence 2 to guide the dCas enzyme to bind to the recognition site located near the insertion sequence 2 in the second plasmid. Whether the dCas enzyme binds to the recognition site located in the insertion sequence 2 under the guidance of the guide sequence 2 and covers the recognition site, and generates steric hindrance to protect the recognition site from recognition and cleavage by the restriction endonuclease EcoRV, please refer to the gel electrophoresis diagram in the subsequent Figure 5 for details, which will not be described in detail here.
[0164] The components of the second buffer solution and the specific volumes and amounts of various reagents used are the same as those in Example 1 and will not be repeated here.
[0165] Afterwards, the enzymatic digestion system was prepared. The steps for preparing the enzymatic digestion system were the same as those in Example 1 and will not be repeated here.
[0166] In this step, the restriction endonuclease EcoRV recognizes and cuts the recognition site in the second plasmid.
[0167] It is understood that, in the second plasmid, the recognition site located in the plasmid vector pUC57 will be recognized and cut under the action of the restriction endonuclease EcoRV.
[0168] If the dCas enzyme binds to the vicinity of the recognition site in the insertion sequence 2 under the guidance of the guide sequence 2 and covers the recognition site, the recognition site in the insertion sequence 2 can be protected from recognition and cleavage by the restriction endonuclease EcoRV. After this enzyme cleavage step, the second plasmid becomes a linear fragment.
[0169] If the dCas enzyme does not bind to the vicinity of the recognition site in the insertion sequence 2 under the guidance of the guide sequence 2, it cannot protect the recognition site in the insertion sequence 2 from recognition and cleavage by the restriction endonuclease EcoRV. After the enzyme cleavage step, the second plasmid becomes two linear fragments.
[0170] Specifically, referring to the gel electrophoresis diagram in Figure 5, it can be seen that there is only one band between 3000bp and 4000bp. This data result indicates that the second plasmid was cut into a linear fragment. It should be noted that in Figure 5, "Example 2" represents the test results of this example. Among them, the two "Example 2"s indicate that this example was implemented twice.
[0171] Therefore, it can be seen that the dCas enzyme can bind to the vicinity of the recognition site located in the insertion sequence 2 under the guidance of the guide sequence 2, thereby protecting the recognition site in the insertion sequence 2 from recognition and cutting by the restriction endonuclease EcoRV, and the design of the guide sequence 2 is effective.
[0172] Comparative Example 1
[0173] First, a sample solution was provided. Compared to Example 1, no ribonucleoprotein complex solution was added to this sample solution. The target gene sequence in this sample solution was the first plasmid. That is, the first plasmid contained two recognition sites for the restriction endonuclease EcoRV: one recognition site was located in the insertion sequence 1, and the other recognition site was located in the plasmid vector pUC57.
[0174] Then, the sample solution containing the first plasmid is subjected to enzyme digestion in an enzyme digestion system. The steps for preparing the enzyme digestion system are the same as those in Example 1 and will not be repeated here.
[0175] In this step, the restriction endonuclease EcoRV recognizes and cuts the recognition site in the first plasmid.
[0176] It is understood that in the first plasmid, the recognition site located in the plasmid vector pUC57 will be recognized and cut under the action of the restriction endonuclease EcoRV. At the same time, the recognition site located in the insertion sequence 1 will also be recognized and cut under the action of the restriction endonuclease EcoRV. Therefore, the first plasmid will be cut into two linear fragments.
[0177] Specifically, referring to the gel electrophoresis diagram of FIG5 , it can be seen from “Comparative Example 1” that there is a band at 2000 bp to 4000 bp and a band at 500 bp to 650 bp. The appearance of two bands indicates that the first plasmid was cut into two linear fragments.
[0178] This comparative example further illustrates that in Example 1, the first plasmid was cut into two linear fragments. Therefore, in Example 1, the dCas enzyme did not bind to the vicinity of the recognition site in the insertion sequence 1 under the guidance of the guide sequence 1, and thus could not protect the recognition site in the insertion sequence 1 from recognition and cleavage by the restriction endonuclease EcoRV, and the design of the guide sequence 1 was invalid.
[0179] Comparative Example 2
[0180] First, a sample solution was provided. Compared to Example 2, no ribonucleoprotein complex solution was added to this sample solution. The target gene sequence in this sample solution was the second plasmid. Specifically, the second plasmid contained two recognition sites for the restriction endonuclease EcoRV: one recognition site located in the insertion sequence 2 and the other recognition site located in the plasmid vector pUC57.
[0181] Then, the sample solution containing the second plasmid is subjected to enzyme digestion in an enzyme digestion system. The steps for preparing the enzyme digestion system are the same as those in Example 1 and will not be repeated here.
[0182] In this step, the restriction endonuclease EcoRV recognizes and cuts the recognition site in the second plasmid.
[0183] It is understood that in the second plasmid, the recognition site located in the plasmid vector pUC57 will be recognized and cut under the action of the restriction endonuclease EcoRV. At the same time, the recognition site located in the insertion sequence 2 will also be recognized and cut under the action of the restriction endonuclease EcoRV. Therefore, the second plasmid will be cut into two linear fragments.
[0184] Specifically, referring to the gel electrophoresis diagram of FIG5 , it can be seen from “Comparative Example 2” that there is a band at 2000 bp to 4000 bp and a band at 400 bp to 500 bp. The appearance of two bands indicates that the second plasmid is cut into two linear fragments.
[0185] This comparative example further illustrates that in Example 2, there is only one band at 3000bp to 4000bp, indicating that the second plasmid was cut into a linear fragment. Therefore, under the guidance of guide sequence 2, the dCas enzyme can bind to the vicinity of the recognition site in insert sequence 2, thereby protecting the recognition site in insert sequence 2 from recognition and cleavage by the restriction endonuclease EcoRV, indicating that the design of guide sequence 2 is effective.
[0186] The above example uses the enzyme recognition site protection method provided in the embodiments of the present disclosure to protect the recognition site in the inserted sequence from being cut by the restriction endonuclease. It can be understood that the enzyme recognition site protection method provided in the embodiments of the present disclosure can also be used to protect the recognition site in the plasmid vector from being recognized and cut by the restriction endonuclease.
[0187] The above description is merely a specific embodiment of the present disclosure, but the scope of protection of the present disclosure is not limited thereto. Any changes or substitutions that a person skilled in the art can conceive within the technical scope disclosed in the present disclosure should be included within the scope of protection of the present disclosure. Therefore, the scope of protection of the present disclosure should be based on the scope of protection of the claims.
Claims
1. A method for protecting an enzyme recognition site, comprising: The guide sequence is designed to guide the dCas enzyme to cover the enzyme recognition site to be protected in the target gene sequence, so that the enzyme recognition site to be protected is protected from recognition and cleavage by the restriction endonuclease.
2. The method for protecting an enzyme recognition site according to claim 1, wherein: The target gene sequence includes: a non-target recognition site with the same base sequence and at least one target recognition site. The enzyme recognition site to be protected is also called the target recognition site.
3. The method for protecting an enzyme recognition site according to claim 1 or 2, wherein: The target gene sequence includes: any one of a plasmid and a linear DNA fragment.
4. The method for protecting an enzyme recognition site according to any one of claims 1 to 3, wherein: The guide sequence includes: a single-stranded nucleotide; the single-stranded nucleotide includes: a first fragment and a second fragment connected from the 5' end to the 3' end, wherein the first fragment is used to bind to the target gene sequence, and the second fragment is used to bind to the dCas enzyme.
5. A gene cloning method comprising: preparing a ribonucleoprotein complex solution, the ribonucleoprotein complex comprising: a dCas enzyme and a guide sequence; Preparing a sample solution, the sample comprising: a target gene sequence and the ribonucleoprotein complex; wherein the guide sequence guides the dCas enzyme to cover the enzyme recognition site to be protected in the target gene sequence; An enzyme cutting system is prepared, the enzyme cutting system comprising: a restriction endonuclease and the sample, and enzyme cutting is performed; under the protection of the dCas enzyme, the enzyme recognition site to be protected is protected from recognition and cutting by the restriction endonuclease.
6. The gene cloning method according to claim 5, wherein: The target gene sequence includes: a non-target recognition site of the same base sequence and at least one target recognition site, and the enzyme recognition site to be protected is also called the target recognition site; In the enzyme cleavage step, the non-target recognition site of the target gene sequence is recognized and cleaved by the restriction endonuclease.
7. A gene cloning reagent system, comprising: Ribonucleoprotein complex solution; Wherein, the ribonucleoprotein complex solution comprises: a dCas enzyme solution and a guide sequence solution; In the dCas enzyme solution, the concentration range of the dCas enzyme is 1 μmol / L to 20 μmol / L; the ratio of the volume of the dCas enzyme solution to the volume of the ribonucleoprotein complex solution is in the range of 1:10 to 3:10; In the guide sequence solution, the concentration range of the guide sequence is 2 μmol / L to 9 μmol / L; the ratio of the volume of the guide sequence solution to the volume of the ribonucleoprotein complex solution is in the range of 1:10 to 3:
10.
8. The gene cloning reagent system according to claim 7, wherein: The ribonucleoprotein complex solution further comprises: a first buffer solution; The first buffer solution comprises: 1000mmol / L to 1500mmol / L NaCl, 400mmol / L to 600mmol / L Tris-HCl, 80mmol / L to 150mmol / L MgCl2, and 800μg / mL to 1500μg / mL recombinant protein, and the pH value range of the first buffer solution is 7.9 to 8.1; The ratio of the volume of the first buffer solution to the volume of the ribonucleoprotein complex solution is in the range of 1:10 to 3:
10.
9. The gene cloning reagent system according to claim 7 or 8, further comprising: Sample solution; Wherein, the sample solution includes: the ribonucleoprotein complex solution and the target gene sequence solution; The ratio of the volume of the ribonucleoprotein complex solution to the volume of the sample solution is in the range of 3:20 to 1:2; The copy number of the target gene sequence is greater than or equal to 10 3 ; The ratio of the volume of the target gene sequence solution to the volume of the sample solution ranges from 1:20 to 1:
4.
10. The gene cloning reagent system according to claim 9, wherein: The sample solution further includes: a second buffer solution; The second buffer solution comprises: 1000mmol / L to 1500mmol / L NaCl, 400mmol / L to 600mmol / L Tris-HCl, 80mmol / L to 150mmol / L MgCl2, and 800μg / mL to 1500μg / mL recombinant protein, and the pH value range of the second buffer solution is 7.9 to 8.1; The ratio of the volume of the second buffer solution to the volume of the sample solution is in the range of 1:10 to 3:
10.
11. The gene cloning reagent system according to claim 9 or 10, further comprising: Enzyme digestion system; Wherein, the enzyme digestion system comprises: the sample solution and the restriction endonuclease solution; The ratio of the volume of the sample solution to the volume of the enzyme digestion system is in the range of 1:10 to 1:2; In the restriction endonuclease solution, the concentration of the restriction endonuclease is in the range of 4U / μL to 20U / μL; the ratio of the volume of the restriction endonuclease solution to the volume of the enzyme digestion system is in the range of 1:20 to 1:
10.
12. The gene cloning reagent system according to claim 11, wherein: The enzyme digestion system further comprises: a third buffer solution; The third buffer solution comprises: 100 mmol / L to 330 mmol / L Tris-HCl, 80 mmol / L to 150 mmol / L MgCl2, 660 mmol / L to 1000 mmol / L KCl, and 0.5 mg / mL to 1.5 mg / mL bovine serum albumin; The pH value range of the third buffer solution is 7.9-8.5; the ratio range of the volume of the third buffer solution to the volume of the enzyme cleavage system is 1:10-3:
20.
13. Use of the method for protecting an enzyme recognition site as claimed in any one of claims 1 to 4 in plasmid construction.
14. Use of the method for protecting an enzyme recognition site as claimed in any one of claims 1 to 4 in the construction of a recombinant library.
15. Use of the method for protecting enzyme recognition sites as claimed in any one of claims 1 to 4 in the linearization of plasmids in the process of RNA pharmaceutical preparation.
Citation Information
Patent Citations
APPLICATIONS OF CRISPRi IN HIGH THROUGHPUT METABOLIC ENGINEERING
CN112703250A
Gene silencing via genome editing
CN113473845A
Reagents and methods for controlling protein function and interaction
US20220025003A1