CHEMICAL MODIFICATIONS IN mRNA POLY(A) TAIL

Modified mRNA sequences with optimized modifications in the 5'-cap and poly(A) tail address stability and immunogenicity issues, enhancing translation efficiency and broadening therapeutic applications beyond COVID-19 vaccines.

WO2025111430A1PCT designated stage expired Publication Date: 2025-05-30PRIME MEDICINE INC

Patent Information

Application Number
PCT/US2024/056831
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-11-21
Filing Date
2024-11-21
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

Current mRNA therapeutics face challenges with stability, immunogenicity, translation efficiency, and delivery, limiting their application beyond COVID-19 vaccines.

Method used

Development of modified mRNA sequences with optimized 5'-cap, poly(A) tail, and site-specific modifications to enhance stability and reduce immunogenicity, including the use of nucleotide and non-nucleotide modifications in the poly(A) tail.

Benefits of technology

The modified mRNA compositions demonstrate improved stability and translation efficiency, potentially expanding the therapeutic applications of mRNA beyond vaccines.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024056831_30052025_PF_FP_ABST
    Figure US2024056831_30052025_PF_FP_ABST
Patent Text Reader

Abstract

Provided herein are modified mRNA sequences and compositions comprising the same, as well as using the same in methods for gene editing.
Need to check novelty before this filing date? Find Prior Art

Description

CHEMICAL MODIFICATIONS IN mRNA POLY(A) TAILCROSS REFERENCE TO RELATED APPLICATIONS

[0001] The present application claims priority to and the benefits of U.S. Provisional Application No. 63 / 601.392. filed November 21, 2023, the contents of which are herein incorporated by reference in their entirety.SEQUENCE LISTING

[0002] This application includes and incorporates by reference in its entirety a Sequence Listing XML in the required .xml format. The Sequence Listing XML file that has been electronically filed contains the information of the nucleotide and / or amino acid sequences disclosed in the patent application using the symbols and format in accordance with the requirements of 37 C.F.R. §§1.832 through 1.834.

[0003] The Sequence Listing XML filed herewith serves as the electronic copy required by § 1.834(b)(1).

[0004] The Sequence Listing XML is identified as follows: “272059-557696_SL-as- filed.xml” (163,924 bytes in size), which was created on November 20. 2024.FIELD OF THE INVENTION

[0005] The present disclosure describes modified mRNA sequences and compositions comprising the same, as well as using the same in methods for gene editing.BACKGROUND

[0006] Great progress has been achieved in the development of messenger RNA (mRNA) as a therapeutic agent, especially as vaccines for COVID-19. Despite the progress and FDA approvals of mRNA vaccines, the stability, immunogenicity, translation efficiency, and delivery of mRNAs are still pivotal issues that need to be addressed to extend mRNA therapeutics to multiple therapeutic areas. mRNAs are intrinsically unstable and prone to degradation. To obtain the best mRNA therapeutic efficacy, it is necessary to optimize the chemistry of 5'-cap, poly-A tail, and site-specific modifications for reducing immunogenicity and increasing stability’ of the coding region, and optimization of UTRs.SUMMARY

[0007] Provided herein are modified mRNA sequences and compositions comprising the same, as well as using the same in methods for gene editing.

[0008] In certain aspects, the disclosure provides a modified mRNA comprising:(i) a 5’ cap region, a 5’ untranslated region (5’UTR), an open reading frame encoding a protein, and a 3’ untranslated region (3’ UTR); and(ii) a poly(A) tail sequence located 3’ to the 3’ UTR, wherein the poly (A) tail sequence comprises at least 15 nucleotides and wherein the poly(A) tail sequence comprises at least one modification, wherein the at least one modification is a nucleotide modification, a non-nucleotide modification, or a combination thereof.

[0009] In another aspect, the disclosure provides a modified mRNA comprising:(i) a 5’ cap region, a 5’ untranslated region (5’UTR), an open reading frame encoding a prime editor, and a 3’ untranslated region (3’ UTR); and(ii) a poly(A) tail sequence located 3’ to the 3‘ UTR, wherein the poly (A) tail sequence comprises at least 15 nucleotides and wherein the poly(A) tail sequence comprises at least one modification, wherein the at least one modification is a nucleotide modification, a non-nucleotide modification, or a combination thereof.

[0010] In another aspect, the disclosure provides a modified mRNA comprising:(i) at least an open reading frame encoding a protein; and(ii) a poly(A) tail sequence located downstream to the open reading frame encoding the protein, wherein the poly (A) tail sequence comprises at least 15 nucleotides and wherein the poly(A) tail sequence comprises at least one modification, wherein the at least one modification is a nucleotide modification, a non-nucleotide modification, or a combination thereof.

[0011] In another aspect, the disclosure provides a modified mRNA comprising:(i) at least an open reading frame encoding a prime editor; and(ii) a poly (A) tail sequence located 3’ to the open reading frame encoding the prime editor, wherein the poly (A) tail sequence comprises at least 15 nucleotides and wherein the poly(A) tail sequence comprises at least one modification, wherein the at least one modification is a nucleotide modification, a non-nucleotide modification, or a combination thereof.

[0012] In some embodiments, the at least one modification is a nucleotide modification.

[0013] In some embodiments, the nucleotide modification comprises a phosphate modification, a base modification, a sugar modification, or a combination thereof.

[0014] In some embodiments, wherein the at least one modification is a non-nucleotide modification.

[0015] In some embodiments, the nucleotide modification comprises N6-methyladenosine (m6A), N6-methyl-2’-O-methyladenosine (2’0Me-m6A), xanthine, allyaminouracil, allyaminothymidine, hypoxanthine, digoxigeninated adenine, digoxigeninated cytosine, digoxigeninated guanine, digoxigeninated uracil, 6- chloropurineriboside, N6-methyladenine, methylpseudouracil, 2-thiocytosine, 2-thiouracil, 5- methyluracil. 4-thiothymidine, 4- thiouracil, 5.6-dihydro-5-methyluracil, 5,6-dihydrouraciL 5-[(3- lndolyl)propionamide-N- allyl]uracil, 5 -aminoallylcytosine, 5 -aminoallyluracil, 5 -bromouracil, 5- bromocytosine, 5- carboxy cytosine, 5-carboxymethylesteruracil, 5 -carboxy uracil, 5-fluorouracil, 5- formylcytosine, 5-formyluracil, 5-hydroxy cytosine, 5-hydroxymethylcytosine, 5- hydroxymethyluracil, 5-hydroxyuracil, 5 -iodocytosine, 5-iodouracil, 5-methoxy cytosine, 5- meth oxy uracil, 5-methylcytosine, 5-methyluracil, 5-propargylaminocytosine, 5- propargylaminouracil, 5-propynylcytosine, 5-propynyluracil, 6-azacytosine, 6-azauracil, 6- chloropurine, 6-thioguanine, 7-deazaadenine, 7-deazaguanine, 7-deaza-7- propargylaminoadenine, 7- deaza-7-propargylaminoguamne, 8-azaadenine. 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8- oxoguanine, araadenine, aracytosine, araguanine, arauracil, biotin- 16-7-deaza-7- propargyl aminoguanine, biotin- 16-aminoallylcytosine, biotin- 16-aminoallyluracil, cyanine 3-5- propargylaminocytosine, cyanine 3-6- propargylaminouracil, cyanine 3-aminoallylcytosine, cyanine 3-aminoallyluracil, cyanine 5- 6-propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5 -aminoallylcytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallyluracil, dabcyl-5-3 - aminoallyluracil, desthiobiotin- 16-aminoallyl-uracil, desthiobi otin-6-aminoallylcytosine, isoguanine, N1- ethylpseudouracil, N'-methoxymethylpseudouracil. N'-methyladenine. N1- methylpseudouracil, N1-propyl pseudouracil, N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6- methyladenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thienouracil, xanthosine, 3-deazaadenine, 2,6-diaminoadenine, 2,6-daminoguanine, 5 -carboxamide- uracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2- methyl-thio- N6-isopentenyladenine (ms2i6A), 2-methylthio- N6-methyladenine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenine (io6A). 2-methylthio- N6-(cis- hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyladenine (g6A), N6-threonylcarbamoyladenine (t6A), 2-methylthio- N6-threonyl carbamoyladenine (ms2t6A), bymethyl- N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2- methylthio- N6-hydroxynorvalyl carbamoyladenine (ms2hn6A), N6, N6- dimethyladenine (m62A), and \6-acetyladenine (ac6A), or a combination thereof.

[0016] In some embodiments, the nucleotide modification comprises a sugar modification.

[0017] In some embodiments, the sugar modification comprises6-phosphate-A 2’-thioribose, 2’. 3 ‘-dideoxyribose. 2’-amino-2’- deoxyribose, 2’ deoxyribose, 2’-azido-2’- deoxyribose, 2’-fluoro-2’-deoxyribose, 2’-O- methylribose, 2’-O-methyldeoxyribose, 3’-amino-2’,3’- dideoxyribose, 3 ‘-azido-2’, 3 ‘- dideoxyribose, 3 ‘-deoxyribose, 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3’- O-methylribose, 5 ‘-aminoribose, 5 ’-thioribose. 5-nitro-l-indolyl-2’-deoxyribose, 5’-biotin-ribose, 2’- O,4’-C-methylene-linked, 2'-O,4’-C-amino-linked ribose, 2’-O,4’-C-thio-linked ribose, or a combination thereof.

[0018] In some embodiments, the nucleotide modification comprises a phosphate modification.

[0019] In some embodiments, the phosphate modification comprises phosphorothioate, a stereospecific phosphorothioate. a 6’ -phosphate, phosphorodithioate, thiophosphate, 5’-O- methylphosphonate, 3’-O-methylphosphonate, 5 ’-hydroxyphosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, guanidinopropyl phosphoramidate, or a combination thereof.

[0020] In some embodiments, the non-nucleotide modification comprises a hairpin, a C2-C6 linker, an ethylene glycol linker, 2’ -5’ linkages, an abasic deoxyribonucleotide, an abasic ribonucleotide, an abasic 2 ’-substituted ribonucleotide or a combination thereof.

[0021] In some embodiments, the non-nucleotide modification comprises an inverted nucleotide located in the 3 ’terminal nucleotide of the poly (A) tail sequence.

[0022] In some embodiments, wherein the inverted nucleotide comprises

[0023] In some embodiments, the non-nucleotide modification comprises an abasic deoxyribonucleotide, abasic ribonucleotide, abasic 2 ’-substituted ribonucleotide.

[0024] In another aspect, the disclosure comprises a modified nucleic acid sequence comprising, 5’ to 3’, a phosphate group, about 5 to about 120 unmodified adenosine nucleotides, and 1 to about 25 modifications, wherein the modifications are a nucleotide modification, a non-nucleotide modification, or a combination thereof, and wherein the total length of the modified nucleic acid sequence is about 15 nucleotides to about 180 nucleotides.

[0025] In some embodiments, the modifications are nucleotide modifications.

[0026] In some embodiments, the nucleotide modifications comprise a phosphate modification, a base modification, a sugar modification, or a combination thereof.

[0027] In some embodiments, the nucleotide modifications comprise a base modification.

[0028] In some embodiments, the nucleotide modifications comprise a sugar modification.

[0029] In some embodiments, the nucleotide modifications comprise a phosphate modification.

[0030] Another aspect of the disclosure provides a modified nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-13 and 15-48.

[0031] Another aspect of the disclosure provides a method for producing a modified mRNA, the method comprising ligating at least an open reading frame enconding a protein with the modified nucleic acid sequence disclosed herein.

[0032] Another aspect of the disclosure provides a method for producing a modified mRNA, the method comprising ligating at least an open reading frame encoding a prime editor with the modified nucleic acid sequence discolosed herein.

[0033] In some embodiments, the ligation comprises a self-templated enzymatic ligation.

[0034] In some embodiments, the ligation comprises a templated enzymatic ligation.

[0035] Another aspect of the disclosure provides a prime editing system comprising (a) a prime editing guide RNA (PEgRNA) or one or more polynucleotides encoding the PEgRNA; and (b) the modified mRNA disclosed herein or the modified mRNA produced by the method disclosed herein.

[0036] Another aspect of the disclosure provides a lipid nanoparticle comprising the prime editing system disclosed herein.

[0037] Another aspect of the disclosure provides a method for editing a gene, the method comprising contacting the gene with the prime editing system or the lipid nanoparticle described herein.INCORPORATION BY REFERENCE

[0038] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.BRIEF DESCRIPTION OF THE DRAWINGS

[0039] The novel features of the methods and compositions provided herein are set forth with particularity in the appended claims. A better understanding of the features and advantages of the methods and compositions provided herein will be obtained by reference to the followingdetailed description that sets forth illustrative embodiments, in which the principles of the methods and compositions provided herein are utilized, and the accompanying drawings of which:

[0040] FIG. 1 shows possible sites of modifications in poly(A) tail (nucleotide and nonnucleotide modifications).

[0041] FIG. 2A shows a schematic of ligation without splint of modified 30-mer to poly(A) tail of mRNA.

[0042] FIG. 2B shows a schematic of ligation with splint with inverted dA modified oligo(A) as an example.

[0043] FIG. 3 shows a gel image of RNase T1 digested ligated mRNA in comparison to parent mRNA. Here, an unmodified 60A-tail is present in the parent mRNA and the parent mRNA is ligated with a 30-nt long idU synthetic oligo(A), with details in Table 1. Lane 1: low range ssRNA ladder (NEB, Cat. No. N0364S); lane 2: parent mRNA after RNase T1 digestion; lane 3: ligated mRNA after RNase T1 digestion (Image converted to grayscale and colors inverted for better visualization).

[0044] FIG. 4 shows a trace generated from Agilent Fragment Analyzer showing ligated mRNA purity generated by ligation of parent mRNA with unmodified 60A-tail ligated to 30- nt long idU synthetic oligo(A). The peak at 15-nt is a lower internal marker for sample preparation. The mRNA purity by ‘Smear Analysis' method was obtained by calculating the area-under-the-curve (AUC) between 5700-nt to 7123-nt bounds.

[0045] FIG. 5 shows the first round of poly (A) ligated mRNA library in vitro protein expression screening. Each mRNA with different poly (A) ligation was mixed with HEK3 guide RNA at 1 : 1 mass ratio. 96 ng total RNA of each combination was dosed to one well using Messenger Max. Protein expression at 6 and 24 h was quantified by FastScan Cas9 ELISA kit. Modified mRNAs shown contain sequence numbers corresponding to the modified poly(A) sequences shown in Table 1.

[0046] FIG. 6 shows the second round of poly (A) ligated mRNA library in vitro protein expression screening. Each mRNA was mixed with HEK3 guide RNA at 1: 1 mass ratio. 96 ng total RNA of each combination was dosed to one well using Messenger Max. Protein expression at 6, 24, 48, and 72 h was quantified by FastScan Cas9 ELISA kit. Modified mRNAs shown contain sequence numbers corresponding to the modified poly(A) sequences shown in Table 1.

[0047] FIG. 7 shows a time dependent poly (A) ligated mRNAs in vitro editing. Top performing mRNAs from second round of expression screening were selected to evaluate theability of gene editing in time dependent manner. Each mRNA was mixed with HEK3 guide RNA at 1 : 1 mass ratio. RNA with different mass of each combination was dosed to one well using Messenger Max. Next generation sequencing was used to quantify desired edits at each time point. Modified mRNAs shown contain sequence numbers corresponding to the modified poly (A) sequences shown in Table E

[0048] FIG. 8 shows PE retention. PE retention was calculated as the ratio of cellular PE expression at 24 h to 6 h.

[0049] FIG. 9A shows in vivo protein expression of PE mRNAs containing representative poly(A) modifications. It show s the expression of PE in the whole liver w as assessed using Cas9-Cas9 ELISA at various time points following the i.v administration of 1.5 mpk of control mRNAOOl and mRNA containing Seq-1 to mice.

[0050] FIG. 9B shows shows in vivo protein expression of PE mRNAs containing representative poly(A) modifications. It show s a comparison of PE expression betw een control mRNAOOl and mRNA containing Seq-1. The relative abundance of PE was normalized to the expression level of control mRNAOO 1 at 3 h timepoint.

[0051] FIG. 10 shows in vitro protein expression of modified poly(A) ligated mRNAs and control mRNAs. Each mRNA w as mixed with HEK3 guide RNA at 1 : 1 mass ratio. 96 ng total RNA of each combination was dosed to one well using Messenger Max. Protein expression at 6 and 24 h was quantified by FastScan Cas9 ELISA kit. Modified mRNAs shown contain sequence numbers corresponding to the modified poly(A) sequences in Table 1.

[0052] FIG. 11 shows PE retention of modified poly (A) ligated mRNAs. PE retention was calculated as the ratio of cellular PE expression at 24 h to 6 h. mRNAs containing modified sequence corresponding to the modified poly(A) sequences shown in Table 1.

[0053] FIG. 12 shows in vitro Prime Editing of mRNAs containing modified poly(A) sequences at 72 h after transfection. Each mRNA was mixed with HEK3 guide RNA at 1 : 1 mass ratio and dosed to HEK293T cells using Messenger Max. Next generation sequencing was used to quantify desired edits. mRNAs containing modified sequences corresponding to the modified poly(A) sequences shown in Table 1.

[0054] FIG. 13 shows in vitro protein expression of modified poly(A) ligated mRNAs. Each mRNA w as mixed with HEK3 guide RNA at 1 : 1 mass ratio. 96 ng total RNA of each combination was dosed to one well using Messenger Max. Protein expression at 2, 6, 24. and 48 h was quantified by FastScan Cas9 ELISA kit. Modified mRNAs shown contain sequence numbers corresponding to the modified poly(A) sequences shown in Table 1 .

[0055] FIG. 14 shows PE retention of modified poly(A) ligated mRNAs. Data shown in FIG. 13 are used for calculating protein expression retention ratio at 24 h to 6 h. PE retention was calculated as the ratio of cellular PE expression at 24 h to 6 h. Modified mRNAs shown contain sequence numbers corresponding to the modified poly (A) sequences shown in Table 1.

[0056] FIG. 15 shows in vitro protein expression of mRNAs containing modified poly(A) sequences. Each mRNA was mixed with HEK.3 guide RNA at 1: 1 mass ratio. 96 ng total RNA of each combination was dosed to one well using Messenger Max. Protein expression at 2, 6, 24, and 48h was quantified by FastScan Cas9 ELISA kit. mRNAs shown contain modified poly (A) sequence numbers corresponding to the sequences shown in Table 1.

[0057] FIG. 16 shows PE retention of modified poly(A) ligated mRNAs. PE retenttion was calculated as the ratio of cellular PE expression at 24 h to 6 h. Modified mRNAs shown contain sequence numbers corresponding to the modified poly (A) sequences shown in Table 1.

[0058] FIG. 17 shows in vitro Prime Editing of mRNAs containing poly(A) modifications at 72 h after transfection. Each mRNA was mixed with HEK3 guide RNA at 1 : 1 mass ratio and dosed to HEK293T cells using Messenger Max. Next generation sequencing was used to quantify desired edits. Modified mRNAs shown contain sequence numbers corresponding to the modified poly (A) sequences shown in Table 1.DETAILED DESCRIPTION

[0059] Provided herein, in some embodiments, are modified mRNA sequences and compositions comprising the same, as well as using the same in methods for gene editing.

[0060] The following description and examples illustrate embodiments of the present disclosure in detail. It is to be understood that this disclosure is not limited to the particular embodiments described herein and as such can vary'. Those of skill in the art will recognize that there are numerous variations and modifications of this disclosure, which are encompassed within its scope. Although various features of the present disclosure can be described in the context of a single embodiment, the features can also be provided separately or in any suitable combination. Conversely, although the present disclosure can be described herein in the context of separate embodiments for clarify, the present disclosure can also be implemented in a single embodiment.Definitions

[0061] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary' skill in the art.

[0062] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. As used herein, the singular forms “a”, “an"’ and ‘‘the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms '‘including”, ‘'includes”, ‘"having”, '‘has”, “with”, or variants thereof as used herein mean “comprising”.

[0063] Unless otherwise specified, the words “comprising”, “comprise”, “comprises”, “having”, “have”, “has”, “including”, “includes”, “include”, “containing”, “contains” and “contain” are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0064] Reference to “some embodiments”, “an embodiment”, “one embodiment’’, or “other embodiments” means that a particular feature or characteristic described in connection with the embodiments is included in at least one or more embodiments, but not necessarily all embodiments, of the present disclosure.

[0065] The term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e.. the limitations of the measurement system. For example, “about” can mean within 1 standard deviation, per the practice in the art.Alternatively, “about” can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated, the term “about” meaning within an acceptable error range for the particular value should be assumed.

[0066] The term “substantially” as used herein may refer to a value approaching 100% of a given value. In some embodiments, the term may refer to an amount that may be at least about 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 99.99% of a total amount. In some embodiments, the term may refer to an amount that may be about 100% of a total amount.

[0067] The terms “protein” and “polypeptide” can be used interchangeably to refer to a polymer of two or more amino acids joined by covalent bonds (e.g., an amide bond) that can adopt a three-dimensional conformation. In some embodiments, a protein or polypeptidecomprises at least 10 amino acids, 15 amino acids, 20 amino acids, 30 amino acids or 50 amino acids joined by covalent bonds (e.g, amide bonds). In some embodiments, a protein comprises at least two amide bonds. In some embodiments, a protein comprises multiple amide bonds. In some embodiments, a protein comprises an enzyme, enzyme precursor proteins, regulatory protein, structural protein, receptor, nucleic acid binding protein, a biomarker, a member of a specific binding pair (e.g, a ligand or aptamer), or an antibody. In some embodiments, a protein may be a full-length protein (e.g, a fully processed protein having certain biological function). In some embodiments, a protein may be a variant or a fragment of a full-length protein. For example, in some embodiments, a Cas9 protein domain comprises an H840A amino acid substitution compared to a naturally occurring S pyogenes Cas9 protein. A variant of a protein or enzyme, for example a variant reverse transcriptase, comprises a polypeptide having an amino acid sequence that is about 60% identical, about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 96% identical, about 97% identical, about 98% identical, about 99% identical, about 99.5% identical, or about 99.9% identical to the amino acid sequence of a reference protein.

[0068] In some embodiments, a protein comprises one or more protein domains or subdomains. As used herein, the term '‘polypeptide domain’’, “protein domain”, or “domain” when used in the context of a protein or polypeptide, refers to a polypeptide chain that has one or more biological functions, e.g, a catalytic function, a protein-protein binding function, or a protein-DNA function. In some embodiments, a protein comprises multiple protein domains. In some embodiments, a protein comprises multiple protein domains that are naturally occurring. In some embodiments, a protein comprises multiple protein domains from different naturally occurring proteins. For example, in some embodiments, a prime editor may be a fusion protein comprising a Cas9 protein domain of S pyogenes and a reverse transcriptase protein domain of Moloney murine leukemia virus. A protein that comprises amino acid sequences from different origins or naturally occurring proteins may be referred to as a fusion, or chimeric protein.

[0069] The term “polynucleotide,” “oligonucleotide,” or “nucleic acid molecule” can be any polymeric form of nucleotides, including DNA, RNA, a hybridization thereof, or RNA-DNA chimeric molecules. In some embodiments, a polynucleotide comprises cDNA, genomic DNA, mRNA, tRNA, rRNA, or microRNA. In some embodiments, a polynucleotide is double stranded, e.g, a double-stranded DNA in a gene. In some embodiments, a polynucleotide is single-stranded or substantially single-stranded, e.g, single-stranded DNA or an mRNA. In some embodiments, a polynucleotide is a cell-free nucleic acid molecule. Insome embodiments, a polynucleotide circulates in blood. In some embodiments, a polynucleotide is a cellular nucleic acid molecule. In some embodiments, a polynucleotide is a cellular nucleic acid molecule in a cell circulating in blood.

[0070] Polynucleotides can have any three-dimensional structure. The following are nonlimiting examples of polynucleotides: a gene or gene fragment (for example, a probe, primer. EST or SAGE tag), an exon, an intron, intergenic DNA (including, without limitation, heterochromatic DNA), messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), a ribozyme, cDNA, a recombinant polynucleotide, a branched polynucleotide, a plasmid, a vector, isolated DNA, isolated RNA, sgRNA, guide RNA, a nucleic acid probe, a primer, an snRNA. a long non-coding RNA, a snoRNA, a siRNA, a miRNA, a tRNA-derived small RNA (tsRNA), an antisense RNA, an shRNA, or a small rDNA-derived RNA (srRNA).

[0071] In some embodiments, a polynucleotide comprises deoxyribonucleotides, ribonucleotides or analogs thereof. In some embodiments, a polynucleotide comprises modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure can be imparted before or after assembly of the polynucleotide. The sequence of nucleotides can be interrupted by non-nucleotide components. A polynucleotide can be further modified after polymerization, such as by conjugation with a labeling component.

[0072] In some embodiments, a polynucleotide is composed of a specific sequence of four nucleotide bases: adenine (A); cytosine (C); guanine (G); thymine (T); and uracil (U) for thymine when the polynucleotide is RNA. In some embodiments, the polynucleotide may comprise one or more other nucleotide bases, such as inosine (I), which is read by the translation machinery as guanine (G).

[0073] A “coding nucleotide sequence." as used herein, refers to a nucleotide sequence that encodes a gene product, e.g., a non protein-encoding RNA or a protein gene product. A “sequence encoding a prime editor,’' as used herein, refers to a nucleotide sequence that encodes a prime editor.

[0074] A “messenger RNA” (“mRNA”), as used herein, refers to a nucleic acid comprising an open reading frame encoding a protein, and a poly -A tail (also referred to as poly-A region). An mRNA may also comprise a 5’ untranslated region (5’ UTR) that is 5’ to (upstream of) the open reading frame, and a 3’ untranslated region that is 3’ to (downstream of) the open reading frame. An mRNA may also comprise a 5’ cap at the 5’ end of the mRNA. An “open reading frame encoding a protein,” as used herein, refers to a nucleicacid sequence comprising a coding sequence, that leads to the production of the protein when the open reading frame is translated. The nucleic acid sequence may be an RNA sequence, in which case translation of the RNA sequence produces a polypeptide with the amino acid sequence of the protein. The nucleic acid sequence may be a DNA sequence, in which case the protein is produced when an RNA polymerase uses the DNA sequence to transcribe an RNA molecule comprising an RNA sequence that is complementary to theDNA sequence, and translation of the RNA sequence produces a polypeptide with the amino acid sequence of the protein. An RNA molecule that can be translated is referred to as a messenger RNA, or mRNA.

[0075] Translation is the process in which the RNA coding sequence is used to direct the production of a polypeptide. The first step in translation is initiation, in which a ribosome associates with an mRNA, and a first transfer RNA (tRNA) carrying a first amino acid associates with the first codon, or START codon. The next phase of translation, elongation, involves three steps. First, a second tRNA with an anticodon that is complementary' to codon following the START codon, or second codon, and carrying a second amino acid, associates with the mRNA. Second, the carbon atom of terminal, non-side chain carboxylic acid moiety of the first amino acid reacts with the nitrogen of the terminal, non-side chain amino moiety of the second amino acid carried, forming a peptide bond between the two amino acids, with the second amino acid being bound to the second tRNA, and the first amino acid bound to the second amino acid, but not the first tRNA. Third, the first tRNA dissociates from the mRNA, and the ribosome advances along the mRNA, such that the position at which the first tRNA associated with the ribosome is now occupied by the second tRNA, and the position previously occupied by the second tRNA is now- free for an additional tRNA carrying an additional amino acid to associate with the mRNA. These three steps of 1) association of a tRNA carrying amino acid, 2) formation of a peptide bond, w hich adds an additional amino acid to a growing polypeptide, and 3) advancement of the ribosome along the mRNA, continue until the ribosome reaches a STOP codon, which results in termination of translation. Generally, tRNAs that associate with STOP codons do not carry an amino acid, so the association of a tRNA that does not carry an amino acid during the elongation step results in cleavage of the bond betw een the polypeptide and the tRNA carrying the final amino acid in the polypeptide, such that the polypeptide is released from the ribosome.

[0076] Alternatively, ribosomes may dissociate from the mRNA and release the polypeptide if no tRNA associates with the STOP codon.

[0077] As used herein, the terms "modified" or “modification’' refers to chemical modification with respect to the A, C, G, T and U nucleotides. In some embodiments, modifications may be on the nucleoside base and / or sugar portion of the nucleosides that comprise the polynucleotide. In some embodiments, the modification may be on the intemucleotide linkage (e.g., phosphate backbone). In some embodiments, multiple modifications are included in the modified nucleic acid molecule. In some embodiments, a single modification is included in the modified nucleic acid molecule.

[0078] The term “prime editor (PE)” refers to the polypeptide or polypeptide components involved in prime editing. Prime editors may comprise multiple polypeptides or protein domains. In some embodiments, a prime editor includes a polypeptide domain having DNA binding activity (e.g., a DNA binding domain). In some embodiments, a prime editor comprises a polypeptide that comprises a DNA binding domain. In some embodiments, a prime editor includes a polypeptide domain having DNA polymerase activity (e.g., a DNA polymerase domain). In some embodiments, a prime editor comprises a polypeptide that comprises a DNA polymerase domain. In some embodiments. a prime editor comprises a polypeptide domain having DNA binding activity (e g., a DNA binding domain), and a polypeptide domain having DNA polymerase activity' (e.g., a DNA polymerase domain). In some embodiments, a prime editor comprises a polypeptide that comprises a DNA binding domain and a polypeptide that comprises a DNA polymerase domain.

[0079] In some embodiments, the prime editor further comprises a polypeptide domain having a nuclease activity. In some embodiments, the polypeptide domain having the nuclease activity comprises a nickase, or a fully active nuclease. In some embodiments, the DNA binding domain comprises a nuclease domain or nuclease activity. In some embodiments, the nuclease domain is a nickase, or a fully active nuclease. As used herein, the term “nickase” refers to a nuclease capable of cleaving only one strand of a double-stranded DNA target.

[0080] In some embodiments, the prime editor comprises a polypeptide domain that is an inactive nuclease. In some embodiments, the DNA binding domain comprises a nuclease domain that is an inactive nuclease. In some embodiments, the polypeptide domain having DNA binding activity (e.g., programmable DNA binding activity) comprises a nucleic acid guided DNA binding domain, for example, a CRISPR-Cas protein, for example, a Cas9 nickase, a Cpfl nickase, or another CR1SPR- Cas nuclease. In some embodiments, the DNA binding domain is a nucleic acid guided DNA binding domain for example, a CRISPR-Casprotein, for example, a Cas9 nickase, a Cpfl nickase, or another CRISPR-Cas nuclease. In some embodiments, the DNA binding domain (e.g.. a nucleic acid guided DNA binding domain is a Cas protein domain. In some embodiments, the Cas protein is a Cas9. In some embodiments, the Cas protein domain comprises a nickase or comprises a nickase activity.

[0081] In some embodiments, the polypeptide domain having DNA polymerase activity comprises a template-dependent DNA polymerase, for example, a DNA-dependent DNA polymerase or an RNA- dependent DNA polymerase. In some embodiments, the DNA binding domain comprises a template- dependent DNA polymerase for example, a DNA- dependent DNA polymerase or an RNA-dependent DNA polymerase. In some embodiments, the DNA polymerase domain comprises a reverse transcriptase domain (RT domain) or a reverse transcriptase (RT). In some embodiments, the DNA polymerase domain is a RT domain or a RT. In some embodiments, a prime editor comprises a reverse transcriptase (RT) activity. For example, the first polypeptide of the prime editor may have activity for target primed reverse transcription. In some embodiments, the polypeptide domain having DNA polymerase activity comprises a reverse transcriptase activity (e.g., activity for target primed reverse transcription).

[0082] In some embodiments, the prime editor comprises additional polypeptides involved in prime editing, for example, a polypeptide domain having a 5’ endonuclease activity, e.g., a 5’ endogenous DNA flap endonuclease (e.g., FEN1), for helping to drive the prime editing process towards the edited product formation. In some embodiments, the prime editor further comprises an RNA-protein recruitment polypeptide, for example, a MS2 coat protein.

[0083] The term “complement, “complementary,” or “complementarity” as used herein, refers to the ability of two polynucleotide molecules to base pair with each other. Complementary polynucleotides may base pair via hydrogen bonding, which may be Watson Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding. For example, an adenine on one polynucleotide molecule will base pair to a thymine or uracil on a second polynucleotide molecule and a cytosine on one polynucleotide molecule will base pair to a guanine on a second polynucleotide molecule. Two polynucleotide molecules are complementary to each other when a first polynucleotide molecule comprising a first nucleotide sequence can base pair with a second polynucleotide molecule comprising a second nucleotide sequence. For instance, the two DNA molecules 5'-ATGC-3' and 5'-GCAT-3' are complementary, and the complement of the DNA molecule 5'-ATGC-3' is 5 -GCAT-3'. A percentage of complementarity indicates the percentage of nucleotides in a polynucleotide molecule which can base pair with a second polynucleotide molecule (e.g., 5, 6, 7, 8, 9, 10 out of 10 being50%, 60%, 70%, 80%, 90%, and 100% complementary, respectively). ‘‘Perfectly complementary” means that all the contiguous nucleotides of a polynucleotide molecule will base pair with the same number of contiguous nucleotides in a second polynucleotide molecule. “Substantially complementary” as used herein refers to a degree of complementarity that can be 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% over all or a portion of two polynucleotide molecules. In some embodiments, the portion of complementarity may be a region of 10, 15, 20, 25, 30, 35, 40, 45, 50, or more nucleotides. “Substantial complementary" can also refer to a 100% complementarity over a portion of two polynucleotide molecules. In some embodiments, the portion of complementarity' between the two polynucleotide molecules is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%. or 99% of the length of at least one of the two polynucleotide molecules or a functional or defined portion thereof.

[0084] The term “subject” and its grammatical equivalents as used herein may refer to a human or a non-human. A subject may be a mammal. A human subject may be male or female. A human subject may be of any age. A subject may be a human embryo. A human subject may be a newborn, an infant, a child, an adolescent, or an adult. A human subject may be up to about 100 years of age. A human subject may be in need of treatment for a genetic disease or disorder.

[0085] The terms “treatment” or “treating” and their grammatical equivalents may refer to the medical management of a subject with an intent to cure, ameliorate, or ameliorate a symptom of, a disease, condition, or disorder. Treatment may include active treatment, that is, treatment directed specifically toward the improvement of a disease, condition, or disorder. Treatment may include causal treatment, that is, treatment directed toward removal of the cause of the associated disease, condition, or disorder. In addition, this treatment may include palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, condition, or disorder. Treatment may include supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the disease, condition, or disorder. In some embodiments, a condition may be pathological. In some embodiments, a treatment may not completely cure or prevent a disease, condition, or disorder. In some embodiments, a treatment ameliorates, but does not completely cure or prevent a disease, condition, or disorder. In some embodiments, a subject may be treated for 12 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 2 weeks, 3 weeks, 4 weeks, 2 months. 3 months, 4 months. 5 months, 6 months, 1 year, 2 years. 3 years, 4 years, 5 years, 6 years, indefinitely, or life of the subject.

[0086] The term “ameliorate” and its grammatical equivalents means to decrease, suppress, attenuate, diminish, arrest, or stabilize the development or progression of a disease.

[0087] The terms “prevent” or “preventing” means delaying, forestalling, or avoiding the onset or development of a disease, condition, or disorder for a period of time. Prevent also means reducing risk of developing a disease, disorder, or condition. Prevention includes minimizing or partially or completely inhibiting the development of a disease, condition, or disorder. In some embodiments, a composition, e.g, a pharmaceutical composition, prevents a disorder by delaying the onset of the disorder for 12 hours, 24 hours, 2 days, 3 days, 4 days,5 days, 6 days, 7 days, 2 weeks, 3 weeks, 4 weeks, 2 months, 3 months, 4 months, 5 months,6 months, 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, indefinitely, or life of a subject.

[0088] The term “effective amount” or “therapeutically effective amount” may refer to a quantity of a composition, for example a composition comprising a construct, that can be sufficient to result in a desired activity upon introduction into a subject as disclosed herein. An effective amount of the prime editing compositions can be provided to the target gene or cell, whether the cell is ex vivo or in vivo.

[0089] An effective amount can be the amount to induce, for example, at least about a 2- fold change (increase or decrease) or more in the amount of target nucleic acid modulation (e.g., expression of a gene to produce functional a protein) observed relative to a negative control. An effective amount or dose can induce, for example, about 2-fold increase, about 3- fold increase, about 4-fold increase, about 5-fold increase, about 6-fold increase, about 7-fold increase, about 8-fold increase, about 9-fold increase, about 10-fold increase, about 25-fold increase, about 50-fold increase, about 100-fold increase, about 200-fold increase, about 500- fold increase, about 700-fold increase, about 1000-fold increase, about 5000-fold increase, or about 10.000-fold increase in target gene modulation (e.g., expression of a target gene to produce a functional protein).

[0090] The amount of target gene modulation may be measured by any suitable method known in the art. In some embodiments, the “effective amount” or “therapeutically effective amount” is the amount of a composition that is required to ameliorate the symptoms of a disease relative to an untreated patient. In some embodiments, an effective amount is the amount of a composition sufficient to introduce an alteration in a gene of interest in a cell (e.g, a cell in vitro or in vivo).

[0091] For purposes of this disclosure, the chemical elements are identified in accordance with the Periodic Table of the Elements. CAS version, Handbook of Chemistry and Physics. 75thEd. Additionally, general principles of organic chemistry are described in “OrganicChemistry,” Thomas Sorrell, University Science Books, Sausalito: 1999, and “March’s Advanced Organic Chemistry.” 5thEd., Ed.: Smith, M.B. and March. J., John Wiley and Sons, New York: 2001 , the entire contents of which are hereby incorporated by reference.Modified mRNAs

[0092] An aspect of the disclosure provides a modified mRNA comprising:(i) a 5’ cap region, a 5’ untranslated region (5’UTR), an open reading frame encoding a protein, and a 3’ untranslated region (3’ UTR); and(ii) a poly(A) tail sequence located 3’ to the 3‘ UTR wherein the poly (A) tail sequence comprises at least 15 nucleotides and wherein the poly(A) tail sequence comprises at least one modification, wherein the at least one modification is a nucleotide modification, a nonnucleotide modification, or a combination thereof.

[0093] In some embodiments, the open reading frame encodes a prime editor. In some embodiments, the open reading frame encodes a BXB1. In some embodiments, the open reading frame encodes MLHldn.

[0094] Another aspect of the disclosure provides a modified mRNA comprising:(i) a 5’ cap region, a 5’ untranslated region (5’UTR), an open reading frame encoding a prime editor, and a 3’ untranslated region (3’ UTR); and(ii) a poly(A) tail sequence located 3’ to the 3’ UTR, wherein the poly(A) tail sequence comprises at least 15 nucleotides and wherein the poly(A) tail sequence comprises at least one modification, wherein the at least one modification is a nucleotide modification, a nonnucleotide modification, or a combination thereof.

[0095] Another aspect of the disclosure provides a modified mRNA comprising:(i) at least an open reading frame encoding a protein; and(ii) a poly(A) tail sequence located downstream of the open reading frame encoding a protein, wherein the poly(A) tail sequence comprises at least 15 nucleotides and wherein the poly(A) tail sequence comprises at least one modification, wherein the at least one modification is a nucleotide modification, a nonnucleotide modification, or a combination thereof.

[0096] Another aspect of the disclosure provides a modified mRNA comprising:(i) at least an open reading frame encoding a prime editor; and(ii) a poly(A) tail sequence located downstream of the open reading frame encoding, wherein the poly(A) tail sequence comprises at least 15 nucleotides and wherein the poly(A) tail sequence comprises at least one modification, wherein the at least one modification is a nucleotide modification, a nonnucleotide modification, or a combination thereof.

[0097] In some embodiments, the poly (A) tail sequence comprises about 15 nucleotides to about 180 nucleotides. In some embodiments, the poly(A) tail sequence comprises about 15 nucleotides to about 150 nucleotides. In some embodiments, the poly(A) tail sequence comprises about 15 nucleotides to about 120 nucleotides. In some embodiments, the poly(A) tail sequence comprises about 15, 20, 25, 30, 35, 40, 45, 50, 55. 60. 65. 70. 75. 80. 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, or 180 nucleotides.

[0098] In some embodiments, the poly(A) tail sequence comprises about 5 to about 180 unmodified adenosine nucleotides. In some embodiments, the poly(A) tail sequence comprises about 5 to about 150 unmodified adenosine nucleotides. In some embodiments, the poly(A) tail sequence comprises about 5 to about 120 unmodified adenosine nucleotides. In some embodiments, the poly(A) tail sequence comprises about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110. 115, 120, 125, 130, 135. 140, 145, 150, 155, 160, 165, 170, 175, or 180 unmodified adenosine nucleotides.

[0099] In some embodiments, the poly(A) tail sequence comprises about 5 to about 180 modified adenosine nucleotides. In some embodiments, the poly(A) tail sequence comprises about 5 to about 150 modified adenosine nucleotides. In some embodiments, the poly (A) tail sequence comprises about 5 to about 120 modified adenosine nucleotides. In some embodiments, the poly(A) tail sequence comprises about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, or 180 modified adenosine nucleotides.

[0100] In some embodiments, the poly(A) tail sequence comprises about 5 to about 180 modified nucleotides. In some embodiments, the poly(A) tail sequence comprises about 5 to about 150 modified nucleotides. In some embodiments, the poly (A) tail sequence comprises about 5 to about 120 modified nucleotides. In some embodiments, the poly(A) tail sequence comprises about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60. 65. 70, 75, 80, 85, 90, 95, 100, 105. 110, 115, 120. 125, 130. 135, 140, 145, 150, 155. 160, 165. 170, 175, or 180 modified nucleotides.

[0101] In some embodiments, the poly(A) tail sequence comprises from 1 to about 25 modifications. In some embodiments, the poly(A) tail sequence comprises from 1 to about 20 modifications. In some embodiments, the poly(A) tail sequence comprises from about 5 to about 25 modifications. In some embodiments, the poly(A) tail sequence comprises from about 5 to about 25 modifications. In some embodiments, the poly(A) tail sequence comprises from 1, 2, 3, 4, 5, 6. 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22. 23. 24, or 25 modifications.

[0102] In some embodiments, wherein the at least one modification is a nucleotide modification.

[0103] In some embodiments, the nucleotide modification comprises a phosphate modification, a base modification, a sugar modification, or a combination thereof.

[0104] In some embodiments, the at least one modification is a non-nucleotide modification.

[0105] In some embodiments, the at least one modification is a nucleotide modification, wherein the nucleotide modification comprises the same nucleotide modification.

[0106] In some embodiments, the at least one modification is a nucleotide modification, wherein the nucleotide modification comprises different nucleotide modifications.

[0107] In some embodiments, the at least one modification is a non-nucleotide modification, wherein the non-nucleotide modification comprises the same non-nucleotide modification.

[0108] In some embodiments, the at least one modification is a non-nucleotide modification, wherein the non-nucleotide modification comprises different non-nucleotide modifications.

[0109] In some embodiments, the at least one modification is a combination of nucleotide and non-nucleotide modifications.

[0110] In some embodiments, the nucleotide modification comprises a base modification.

[0111] In some embodiments, the base modification comprises N6-methyladenosine (m6A), N6-methyl-2’-O-methyladenosine (2’0Me-m6A), xanthine, allyaminouracil, allyaminothymidine, hypoxanthine, digoxigeninated adenine, digoxigeninated cytosine, digoxigenmated guanine, digoxigeninated uracil, 6- chloropurineriboside, N6-methyladenine, methylpseudouracil, 2-thiocytosine, 2-thiouracil, 5- methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6-dihydrouracil, 5-[(3- Indolyl)propionamide-N- allyl]uracil, 5 -aminoallylcytosine, 5 -aminoallyluracil. 5 -bromouracil. 5- bromocytosine, 5- carboxycytosine, 5-carboxymethylesteruracil, 5-carboxyuracil, 5 -fluorouracil, 5- formylcytosine, 5-formyluracil, 5-hydroxy cytosine, 5-hydroxymethylcytosine, 5- hydroxymethyluracil, 5-hydroxyuracil, 5 -iodocytosine, 5-iodouracil, 5-methoxy cytosine, 5- methoxyuracil. 5-methylcytosine, 5-methyluracil, 5-propargylaminocytosine, 5- propargylaminouracil, 5-propynylcytosine, 5-propynyluraciL 6-azacytosine, 6-azauraciL 6- chloropurine, 6-thioguanine, 7-deazaadenine, 7-deazaguanine, 7-deaza-7- propargylaminoadenine, 7- deaza-7-propargylaminoguamne, 8-azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8- oxoguanine, araadenine, aracytosine, araguanine, arauracil. biotin- 16-7-deaza-7- propargylaminoguanine, biotin- 16-aminoallylcytosine, biotin- 16-aminoallyluracil, cyanine 3-5- propargylaminocytosine, cyanine 3-6- propargylaminouracil, cyanine 3-aminoallylcytosine, cyanine 3-aminoallyluracil, cyanine 5- 6-propargylaminocytosine, cyanine 5 -6-propargylamino uracil, cyanine 5 -aminoallylcytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallyluracil. dabcyl-5-3 - aminoallyluracil, desthiobiotin- 16-aminoallyl-uracil, desthiobiotin-6-aminoallyl cytosine, isoguanine, N1- ethylpseudouracil, N'-methoxymethylpseudouracil. N'-methyladenine. N1- methylpseudouracil, N'-propylpseudouracil. N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6- methyladenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thi enouracil, xanthosine, 3-deazaadenine, 2,6-diaminoadenine, 2,6-daminoguanine, 5 -carboxamide- uracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2- methyl-thio- N6-isopentenyladenine (ms2i6A), 2-methylthio- N6-methyladenine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenine (io6A). 2-methylthio- N6-(cis- hydroxyisopentenyl)adenine (ms2io6A). N6-glycinylcarbamoyladenine (g6A), N6- threonylcarbamoyladenine (t6A), 2-methylthio- N6-threonyl carbamoyl adenine (ms2t6A), N6- methyl- N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2- methylthio- N6-hydroxynorvalyl carbamoyladenine (ms2hn6A), N6, N6- dimethyladenine (m62A), and N6-acetyladenine (ac6A), or a combination thereof.

[0112] In some embodiments, the base modification comprises N6-methyladenosine (m6A). In some embodiments, the base modification comprises N6-methyl-2’-O- methyladenosine (2’0Me-m6A).

[0113] In some embodiments, the nucleotide modification comprises a sugar modification.

[0114] In some embodiments, the sugar modification comprises6 -phosphate-A , 2’ -thioribose, 2’, 3 ‘-dideoxyribose, 2’-amino-2’- deoxyribose, 2’ deoxyribose, 2’-azido-2’- deoxyribose, 2'-fluoro-2’-deoxyribose, 2’-O- methylribose, 2’-0-methyldeoxyribose, 3’-amino-2’,3’- dideoxyribose. 3 ‘-azido-2’, 3 ‘- dideoxyribose. 3 ’-deoxyribose, 3’-O-(2-nitrobenzyl)-2’-deoxyribose, 3’- O-methylribose. 5 ‘-aminoribose, 5 ’-thioribose, 5-nitro-l-indolyl-2’-deoxyribose, 5’-biotin-ribose, 2’- O,4’-C- methylene-linked, 2’-O,4’-C-amino-linked ribose, 2’-O,4’-C-thio-linked ribose or a combination thereof.

[0115] In some embodiments, the nucleotide modification comprises a phosphate modification.

[0116] In some embodiments, the phosphate modification comprises phosphorothioate, a stereospecific phosphorothioate, a 6’ -phosphate, phosphorodithioate, thiophosphate, 5’-O-methylphosphonate, 3’-O-methylphosphonate. 5 ’-hydroxy phosphonate.hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate. methylphosphonate, phenylphosphonate, ethylphosphonate, H- phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, guanidinopropyl phosphoramidate, or a combination thereof, a C2-C6 linker, an ethylene glycol linker.

[0117] In some embodiments, the non-nucleotide modification comprises a hairpin, a C2-C6 linker, an ethylene glycol linker, 2’-5’ linkages, or a combination thereof. In some embodiments, the non-nucleotide modification comprises a hairpin,, tetra ethylene glycol, 2’-5’ linkages, or a combination thereof. In some embodiments, the non-nucleotide modification comprises a hairpin. In some embodiments, the non-nucleotide modification comprises a C2- Ce linker. In some embodiments, the non-nucleotide modification comprises a C2 linker, a C3 linker, a C4 linker, a Cs linker, or a Ce linker. In some embodiments, the non-nucleotide5’~-0^x0H modification comprises C3, SpC3 jn someembodiments, the non-nucleotide modification comprises an ethylene glycol linker. In some embodiments, the ethylene glycol linker comprises from one to eight ethylene glycol moieties. In some embodiments, the ethylene glycol linker comprises a single ethylene glycol moiety (e.g., -OCH2CH2-). In some embodiments, the ethylene glycol linker comprises a di-, tri-, tetra-, penta-, hexa-, hepta-, or octa-ethylene glycol linker. In some embodiments, the non-nucleotide modificationcomprisesTE<^ . In some embodiments, the non-nucleotide modification comprises tetra-ethylene glycol.

[0118] In some embodiments, the non-nucleotide modification comprises an inverted nucleotide located in the 3 ’terminal nucleotide of the poly (A) tail sequence.

[0119] In some embodiments, the inverted nucleotide comprises

[0120] In some embodiments, the non-nucleotide modification comprises an abasic deoxyribonucleotide, abasic ribonucleotide, abasic 2 ’-substituted ribonucleotide.

[0121] In some embodiments, the poly(A) tail sequence further comprises a deoxyribose sugar at the 3’ end.

[0122] In some embodiments, the prime editor comprises a Cas protein and a DNA polymerase.

[0123] Another aspect of the disclosure provide a modified nucleic acid sequence comprising, 5’ to 3’, a phosphate group, about 5 to about 180 unmodified adenosine nucleotides, and 1 to about 25 modifications, wherein the modifications are a nucleotide modification, a non-nucleotide modification, or a combination thereof, and wherein the total length of the modified nucleic acid sequence is about 1 nucleotides to about 180 nucleotides.

[0124] In some embodiments, the modified nucleic acid sequence comprises about 15 nucleotides to about 180 nucleotides. In some embodiments, the modified nucleic acid sequence comprises about 15 nucleotides to about 150 nucleotides. In some embodiments, the modified nucleic acid sequence comprises about 15 nucleotides to about 120 nucleotides. In some embodiments, the modified nucleic acid sequence comprises about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150. 155, 160, 165, 170, 175. or 180 nucleotides.

[0125] In some embodiments, the modified nucleic acid sequence comprises about 5 to about 180 unmodified adenosine nucleotides. In some embodiments, the modified nucleic acid sequence comprises about 5 to about 150 unmodified adenosine nucleotides. In some embodiments, the modified nucleic acid sequence comprises about 5 to about 120 unmodified adenosine nucleotides. In some embodiments, the modified nucleic acid sequence comprises about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, or 180 unmodified adenosine nucleotides.

[0126] In some embodiments, the modified nucleic acid sequence comprises from 1 to about 25 modifications. In some embodiments, the modified nucleic acid sequence comprises from 1 to about 20 modifications. In some embodiments, the modified nucleic acid sequence comprises from about 5 to about 25 modifications. In some embodiments, the modified nucleic acid sequence comprises from about 5 to about 25 modifications. In someembodiments the modified nucleic acid sequence comprises from 1, 2, 3, 4, 5, 6, 7. 8, 9, 10, 11. 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23. 24. or 25 modifications.

[0127] In some embodiments, the modified nucleic acid sequence further comprises a deoxyribose sugar at the 3’ end.

[0128] In some embodiments, the modifications are nucleotide modifications.

[0129] In some embodiments, the nucleotide modifications comprise a phosphate modification, a base modification, a sugar modification, or a combination thereof.

[0130] In some embodiments, the nucleotide modifications are the same.

[0131] In some embodiments, the nucleotide modifications are different.

[0132] In some embodiments, the modifications are non-nucleotide modifications.

[0133] In some embodiments, the non-nucleotide modifications are the same.

[0134] In some embodiments, the non-nucleotide modifications are different.

[0135] In some embodiments, the modifications are a combination of nucleotide and non-nucleotide modifications.

[0136] In some embodiments, the nucleotide modifications comprise a base modification.

[0137] In some embodiments, the base modification comprises N6-methyladenosine (m6A), N6-methyl-2’-O-methyladenosine (2’0Me-m6A), xanthine, allyaminouracil, allyaminothymidine, hypoxanthine, digoxigeninated adenine, digoxigeninated cytosine, digoxigenmated guanine, digoxigeninated uracil, 6- chloropurineriboside, N6-methyladenine, methylpseudouracil, 2-thiocytosine, 2-thiouracil, 5- methyluracil, 4-thiothymidine, 4- thiouracil, 5,6-dihydro-5-methyluracil, 5,6-dihydrouracil, 5-[(3- Indolyl)propionamide-N- allyl]uracil, 5-aminoallylcytosine, 5 -aminoallyluracil, 5 -bromouracil, 5- bromocytosine, 5- carboxy cytosine. 5-carboxymethylesteruracil. 5 -carboxy uracil, 5-fluorouracil, 5- formylcytosine, 5-formyluracil, 5-hydroxy cytosine, 5-hydroxymethylcytosine, 5- hydroxymethyluracil, 5-hydroxyuracil, 5 -iodocytosine, 5-iodouracil, 5-methoxy cytosine, 5- methoxy uracil, 5-methylcytosine, 5-methyluracil, 5-propargylaminocytosine. 5- propargylaminouracil, 5-propynylcytosine, 5-propynyluracil, 6-azacytosine, 6-azauracil, 6- chloropurine, 6-thioguanine, 7-deazaadenine, 7-deazaguanine, 7-deaza-7- propargylaminoadenine, 7- deaza-7-propargylaminoguamne, 8-azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8- oxoguanine, araadenine, aracytosine, araguanine, arauracil. biotin- 16-7-deaza-7- propargyl aminoguanine, biotin- 16-aminoallylcytosine, biotin- 16-aminoallyluracil, cyanine 3-5- propargylaminocytosine, cyanine 3-6- propargylaminouracil, cyanine 3-aminoallylcytosine, cyanine 3-aminoallyluracil, cyanine 5-6-propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5 -aminoallylcytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallyluracil. dabcyl-5-3 - aminoallyluracil, desthiobiotin- 1 -aminoallyl-uracil, desthiobiotin-6-aminoallylcytosine, isoguanine, N1- ethylpseudouracil, N'-methoxymethylpseudouracil. N'-methyladenine. N1- methylpseudouracil, N'-propylpseudouracil. N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6- methyladenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thi enouracil, xanthosine, 3-deazaadenine, 2,6-diaminoadenine, 2,6-daminoguanine, 5 -carboxamide- uracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2- methyl-thio- N6-isopentenyladenine (ms2i6A), 2-methylthio- N6-methyladenine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenine (io6A). 2-methylthio- N6-(cis- hydroxyisopentenyl)adenine (ms2io6A). N6-glycinylcarbamoyladenine (g6A), N6- threonylcarbamoyladenine (t6A), 2-methylthio- N6-threonyl carbamoyladenine (ms2t6A), N6- methyl- N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A). 2- methylthio- N6-hydroxynorvalyl carbamoyladenine (ms2hn6A), N6, N6- dimethyladenine (m62A), and N6-acetyladenine (ac6A), or a combination thereof.

[0138] In some embodiments, the nucleotide modifications comprise a sugar modification.

[0139] In some embodiments, the sugar modification comprises6 -phosphate-A , 2’-thioribose, 2’, 3 ‘-dideoxyribose, 2’-amino-2’- deoxyribose, 2’ deoxyribose, 2’-azido-2’- deoxyribose, 2’-fluoro-2’-deoxyribose, 2’-O- methylribose, 2’-O-methyldeoxyribose, 3'-amino-2’,3’- dideoxyribose, 3 ‘-azido-2’, 3 ‘- dideoxyribose, 3 ‘-deoxyribose, 3’-O-(2-nitrobenzyl)-2’-deoxyribose, 3‘- O-methylribose, 5 ‘-aminoribose, 5 ’-thioribose, 5-nitro-l-indolyl-2’-deoxyribose, 5’-biotin-ribose, 2’- O,4’-C- methylene-linked, 2’-O,4’-C-amino-linked ribose, 2’-O,4’-C-thio-linked ribose, or a combination thereof.

[0140] In some embodiments, the nucleotide modifications comprise a phosphate modification.

[0141] In some embodiments, the phosphate modification comprises phosphorothioate, a stereospecific phosphorothioate, a 6’ -phosphate, phosphorodithioate, thiophosphate, 5'-O-methylphosphonate. 3’-O-methylphosphonate, 5 ’-hydroxy phosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphoramidate. carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H- phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, guanidinopropyl phosphoramidate, or a combination thereofor a combination thereof.

[0142] In some embodiments, the non-nucleotide modification comprises a hairpin, a C2-C6 linker, an ethylene glycol linker, 2’ -5’ linkages, or a combination thereof. In some embodiments, the non-nucleotide modification comprises a hairpin,, tetra ethylene glycol, 2’-5’ linkages, or a combination thereof. In some embodiments, the non-nucleotide modification comprises a hairpin. In some embodiments, the non-nucleotide modification comprises a C2- Ce linker. In some embodiments, the non-nucleotide modification comprises a C2 linker, a C3 linker, a C4 linker, a C5 linker, or a Ce linker. In some embodiments, the non-nucleotidemodification comprises C3, SpC3 jn someembodiments, the non-nucleotide modification comprises an ethylene glycol linker. In some embodiments, the ethylene glycollinker comprises from one to eight ethylene glycol moieties. In some embodiments, the ethylene glycol linker comprises a single ethylene glycol moiety (e.g., -OCH2CH2-). In some embodiments, the ethylene glycol linker comprises a di-, tri-, tetra-, penta-, hexa-, hepta-, or octa-ethylene glycol linker. In some embodiments, the non-nucleotide modificationcomprisesTE<^ . In some embodiments, the non-nucleotide modification comprises tetra-ethylene glycol.

[0143] In some embodiments, the non-nucleotide modifications comprise an inverted nucleotide located in the 3 ’terminal nucleotide of the poly (A) tail sequence.

[0144] In some embodiments, the inverted nucleotide comprises

[0145] In some embodiments, the non-nucleotide modification comprises an abasic deoxyribonucleotide, abasic ribonucleotide, abasic 2 ’-substituted ribonucleotide.

[0146] A modified nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-13 and 15-48, as shown in Table A.

[0147] Table A. Modified poly(A) tail compoundsP = phosphate; A or (A) adenosine; 3’-dT-5’ = inverted deoxy thy mi dine; 3’-dA-5’ = inverted deoxyadenosine; 3’-dU-5’ = inverted deoxyuracil; * indicates phosphorothioate; mA = 2’0Me adenosine; LNA-A = locked nucleic acid(A); m6A = N6-methyladenosine; moeA = 2’-O-methoxyethyl ribose(A) (2’MOE-A); araA= arabinose(A); FANA-A = 2'-Fluoro- arabinose(A); 25 A = 2’ -5 ’-adenosine; L-rA = L-ribo adenosine; H-dA = homo-DNA(A); UNA-A = unlocked nucleic acid (A); GNA-A = glycol nucleic acid (A); SpC3 - Cs linker (propyl); TEG - triethylene glycol linker; = stereospecific Sp phosphorothioate linkage; 6’- phosphate A or ExNA-A (extended nucleic acid (A)).

[0148] Another aspect of the disclosure provides a method for producing a modified mRNA, the method comprising ligating 5’ cap region, a 5’ untranslated region (5’UTR), an open reading frame encoding a protein, and a 3’ untranslated region (3’ UTR) with the modified nucleic acid sequence disclosed herein.

[0149] Another aspect of the disclosure provides a method for producing a modified mRNA, the method comprising ligating a 5‘ cap region, a 5’ untranslated region (5’UTR), an open reading frame encoding a protein, and a 3’ untranslated region (3’ UTR) encoding a prime editor with the modified nucleic acid sequence disclosed herein.

[0150] Another aspect of the disclosure provides a method for producing a modified mRNA, the method comprising ligating an open reading frame encoding a proteinwith the modified nucleic acid sequence disclosed herein.

[0151] Another aspect of the disclosure provides a method for producing a modified mRNA, the method comprising ligating an open reading frame encoding a prime editor with the modified nucleic acid sequence disclosed herein.

[0152] In some embodiments, the ligation comprises a self-templated enzymatic ligation.

[0153] In some embodiments, the ligation comprises a templated enzymatic ligation.

[0154] In some embodiments, the enzymatic ligation is catalyzed by a nucleic acid ligase to generate a natural phosphodiester linkage between the open reading frame encoding a protein and the modified nucleic acid sequence as disclosed herein, or between the open reading frame encoding a prime editor with the modified nucleic acid sequence as disclosed herein.

[0155] Ligation

[0156] Free 3’ ends and phosphoroylated 5’ ends are brought into proximity by way of sequence complementarity' resulting in base pairing hybridization either between the RNA fragments directly (self-templated) or via an additional complementary DNA splint (splinted). Subsequent enzymatic catalysis by a nucleic acid ligase can generate a natural phosphodiester linkage between fragments, yielding the full-length PEgRNA. In some embodiments, a nucleic acid ligase is T4 RNA Ligase I, T4 RNA Ligase II, or T4 DNA Ligase.

[0157] FIG. 2A-2B show a potential fragment functionalization for enzymatic split synthesis, where '‘Upstream” or 5’ end RNA fragments have a free 3’ OH available for ligation, while "Downstream" or 3’ end poly(A) RNA fragments are terminally functionalized with a 5 ’-monophosphate.

[0158] Self-templated Ligation: In some embodiments, two functionalized, singlestranded RNA fragments with complementary base pairs are hybridized for enzymatic ligation (e.g., ligase-mediated conjugation) as shown in FIG. 2A. In some embodiments, the fragments take natural advantage of the sequence complementarity driven structure of any region within the RNA to help facilitate a very' specific ligation reaction betw een the fragments. Once these fragments are annealed under controlled buffered conditions, the RNA duplex forms a native secondary structure mimic to the full length RNA, resulting in a net increase in the effective local concentration of the terminal 3’-OH and 5 ’-monophosphate functional ends required for ligase activity. Subsequent ligase catalysis forms a phosphodiester bond between the RNA fragments which covalently seals the nick and generates a full-length RNA.

[0159] Template Ligation: In some embodiments, tyvo functionalized, singlestranded RNA fragments are conjugated with ligase, similarly to self-templated ligation. In addition, a short, complementary’ nucleic acid splint facilitates a trimeric secondary structure formation dunng templated ligation. The nucleic acid splint is designed such that it bears proximal sequence complementarity of both the 3’ end of the upstream RNA fragment and 5’end of the downstream RNA fragment to facilitate a splinted trimeric structure as shown in FIG. 2B. Consequently, the RNA fragments may or may not require complementarity at the ligation site, and so the advantage of templated ligation for RNA synthesis is that the splinted approach enables ligation atRNA locations which lack secondary7structure and anywhere in the sequence without extensions. In some embodiments, the splint is a DNA strand. In some embodiments, the splint is a modified nucleic acid strand.

[0160] Prime Editing

[0161] Another aspect of the present disclosure includes a prime editing system comprising: (a) a prime editing guide RNA (PEgRNA) or one or more polynucleotides encoding the PEgRNA; and (b) the modified mRNA disclosed herein or the modified mRNA produced by the methods described herein. In some embodiments, the modified mRNA encodes a prime editor. In some embodiments, the prime editor comprises a DNA binding domain and a DNA polymerase domain. In some embodiments, the DNA binding domain is a CRISPR associated (Cas) protein domain.

[0162] The term '‘prime editing” refers to programmable editing of a target DNA using a prime editor complexed with a PEgRNA to incorporate an intended nucleotide edit into the target DNA through target-primed DNA synthesis. A target polynucleotide, e.g., a target gene of prime editing may comprise a double stranded DNA molecule having two complementary strands: a first strand that may be referred to as a “target strand” or a “nonedit strand”, and a second strand that may be referred to as a “non-target strand,” or an “edit strand.” In some embodiments, in a prime editing guide RNA (PEgRNA), a spacer sequence is complementary7or substantially complementary to a specific sequence on the target strand, which may be referred to as a “search target sequence”. In some embodiments, the spacer sequence anneals with the target strand at the search target sequence. The target strand may also be referred to as the “non-Protospacer Adjacent Motif (non-PAM strand).” In some embodiments, the non-target strand may also be referred to as the “PAM strand”. In some embodiments, the PAM strand comprises a protospacer sequence and optionally a protospacer adjacent motif (PAM) sequence. In prime editing using a Cas-protein-based prime editor, a PAM sequence refers to a short DNA sequence immediately adjacent to the protospacer sequence on the PAM strand of the target gene. A PAM sequence may be specifically recognized by a programmable DNA binding protein, e.g., a Cas nickase or a Cas nuclease In some embodiments, a specific PAM is characteristic of a specific programmable DNA binding protein, e.g., a Cas nickase or a Cas nuclease. A protospacer sequence refers toa specific sequence in the PAM strand of the target gene that is complementary to the search target sequence. In a PEgRNA, a spacer sequence may have a substantially identical sequence as the protospacer sequence on the edit strand of a target gene, except that the spacer sequence may comprise Uracil (U) and the protospacer sequence may comprise Thymine (T).

[0163] In some embodiments, the double stranded target DNA comprises a nick site on the PAM strand (or non-target strand). As used herein, a “nick site” refers to a specific position in between two nucleotides or two base pairs of the double stranded target DNA. In some embodiments, the position of a nick site is determined relative to the position of a specific PAM sequence. In some embodiments, the nick site is the particular position where a nick will occur when the double stranded target DNA is contacted with a nickase, for example, a Cas nickase, that recognizes a specific PAM sequence. In some embodiments, the nick site is upstream of a specific PAM sequence on the PAM strand of the double stranded target DNA. In some embodiments, the nick site is downstream of a specific PAM sequence on the PAM strand of the double stranded target DNA. In some embodiments, the nick site is 3 base pairs upstream of the PAM sequence, and the PAM sequence is recognized by a Streptococcus pyogenes Cas9 nickase, aP. lavamentivorans Cas9 nickase, a C. diphtheriae Cas9 nickase, a A. cinerea Cas9, a S. aureus Cas9, or a A. lari Cas9 nickase. In some embodiments, the nick site is 3 base pairs upstream of the PAM sequence, and the PAM sequence is recognized by a Cas9 nickase, wherein the Cas9 nickase comprises a nuclease active HNH domain and a nuclease inactive RuvC domain. In some embodiments, the nick site is 2 base pairs upstream of the PAM sequence, and the PAM sequence is recognized by a S. thermophilus Cas9 nickase.

[0164] In some embodiments, a PEgRNA complexes with and directs a prime editor to bind to the search target sequence of the target gene. In some embodiments, the bound prime editor generates a nick on the edit strand (PAM strand) of the target gene at the nick site. In some embodiments, a primer binding site (PBS) of the PEgRNA anneals with a free 3' end formed at the nick site, and the prime editor initiates DNA synthesis from the nick site, using the free 3' end as a primer. Subsequently, a single-stranded DNA encoded by the editing template of the PEgRNA is synthesized. In some embodiments, the newly synthesized single-stranded DNA comprises one or more intended nucleotide edits compared to the endogenous target gene sequence. In some embodiments, the editing template of a PEgRNA is complementary to a sequence in the edit strand except for one or more mismatches at the intended nucleotide edit positions in the editing template partially complementary to theediting template may be referred to as an “editing target sequence”. Accordingly, in some embodiments, the newly synthesized single stranded DNA has identity or substantial identity to a sequence in the editing target sequence, except for one or more insertions, deletions, or substitutions at the intended nucleotide edit positions.

[0165] In some embodiments, the newly synthesized single-stranded DNA equilibrates with the editing target on the edit strand of the target gene for pairing with the target strand of the target gene. In some embodiments, the editing target sequence of the target gene is excised by a flap endonuclease (FEN), for example, FEN1. In some embodiments, the FEN is an endogenous FEN, for example, in a cell comprising the target gene. In some embodiments, the FEN is provided as part of the prime editor, either linked to other components of the prime editor or provided in trans. In some embodiments, the newly synthesized single stranded DNA, which comprises the intended nucleotide edit, replaces the endogenous single stranded editing target sequence on the edit strand of the target gene. In some embodiments, the newly synthesized single stranded DNA and the endogenous DNA on the target strand form a heteroduplex DNA structure at the region corresponding to the editing target sequence of the target gene. In some embodiments, the newly synthesized single-stranded DNA comprising the nucleotide edit is paired in the heteroduplex with the target strand of the target DNA that does not comprise the nucleotide edit, thereby creating a mismatch between the two otherwise complementary strands.. In some embodiments, the mismatch is recognized by DNA repair machinery, e.g., an endogenous DNA repair machinery. In some embodiments, through DNA repair, the intended nucleotide edit is incorporated into the target gene.

[0166] In some embodiments, the Cas protein domain has nickase activity. In some embodiments, the Cas protein domain is a Cas9. In some embodiments, the Cas9 comprises a mutation in an HNH domain. In some embodiments, the Cas9 comprises a H840A mutation in the HNH domain. In some embodiments, the Cas protein domain is a Cas 12b. In some embodiments, the Cas protein domain is a Casl2a, Casl2b, Casl2c, Casl2d, Casl2e, Casl4a, Casl4b, Casl4c, Casl4d, Casl4e, Casl4f, Casl4g, Casl4h, Casl4u, or a Cascp.

[0167] In some embodiments, the DNA polymerase domain is a reverse transcriptase. In some embodiments, the reverse transcriptase is a retrovirus reverse transcriptase. In some embodiments, the reverse transcriptase is a Moloney murine leukemia vims (M-MLV) reverse transcriptase. In some embodiments, the DNA polymerase and the DNA binding domain are fused or linked to form a fusion protein.Delivery

[0168] The prime editing systems comprising the modified mRNA described herein can be delivered to a cellular environment with any approach known in the art. Components of a prime editing composition can be delivered to a cell by the same mode or different modes. For example, in some embodiments, a prime editor can be delivered as a polypeptide or a polynucleotide (DNA or RNA) encoding the polypeptide. In some embodiments, a PEgRNA can be delivered directly as an RNA or as a DNA encoding the PEgRNA.

[0169] In some embodiments, the polynucleotide encoding one or more prime editing composition components is a part of, or is encoded by, a vector. In some embodiments, the vector is a viral vector. In some embodiments, the vector is a non- viral vector. Exemplary delivery methods are shown in Table B below.Table B: Exemplary delivery methods

[0170] In some embodiments, a prime editing system, for example, pnme editor polypeptide components and PEgRNA / ngRNA are introduced to a target cell by nanoparticles. In some embodiments, the prime editor polypeptide components and the PEgRNA and / or ngRNA form a complex in the nanoparticle. Any suitable nanoparticle design can be used to deliver genome editing system components or nucleic acids encoding such components. In some embodiments, the nanoparticle is inorganic. In some embodiments, the nanoparticle is organic. In some embodiments, a prime editing composition is delivered to a target cell, e.g., a hepatocyte, in an organic nanoparticle, e.g., a lipid nanoparticle (LNP) or polymer nanoparticle.

[0171] In some embodiments, LNPs are formulated from cationic, anionic, neutral lipids, or combinations thereof. In some embodiments, neutral lipids, such as the fusogenic phospholipid DOPE or the membrane component cholesterol, are included to enhance transfection activity and nanoparticle stability. In some embodiments, LNPs are formulated with hydrophobic lipids, hydrophilic lipids, or combinations thereof. Lipids may be formulated in a wide range of molar ratios to produce an LNP. Any lipid or combination of lipids that are known in the art can be used to produce an LNP. Exemplary lipids used to produce LNPs are provided in Table C below.

[0172] In some embodiments, components of a prime editing system form a complex prior to delivery to a target cell. For example, a PEgRNA can form a complex prior to delivery to the target cell. In some embodiments, a prime editing polypeptide (e.g., a prime editor fusion protein) and a guide polynucleotide (e.g., a PEgRNA or ngRNA) form a ribonucleoprotein (RNP) for delivery to a target cell. In some embodiments, the RNP comprises a prime editor fusion protein in complex with a PEgRNA. RNPs may be delivered to cells using known methods, such as electroporation, nucleofection, or cationic lipid- mediated methods, or any other approaches known in the art. In some embodiments, delivery'of a prime editing composition or complex to the target cell does not require the delivery of foreign DNA into the cell. In some embodiments, the RNP comprising the prime editing complex is degraded over time in the target cell. Exemplar}' lipids for use in nanoparticle formulations and / or gene transfer are shown in Table C below.

[0173] Table C: Exemplary lipids for nanoparticle formulation or gene transfer

[0174] Exemplary polymers for use in nanoparticle formulations and / or gene transfer are shown in Table D below.

[0175] Table D: Exemplary lipids for nanoparticle formulation or gene transferPharmaceutical compositions

[0176] Disclosed herein are pharmaceutical compositions comprising the modified mRNA, the prime editing system, or the LNP or RNP described herein.

[0177] The term “pharmaceutical composition”, as used herein, refers to a composition formulated for pharmaceutical use. In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition comprises additional agents, e.g., for specific delivery, increasing half-life, or other therapeutic compounds.

[0178] In some embodiments, a pharmaceutically-acceptable carrier comprises any vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the compound from one site (e.g., the delivery site) of the body, to another site (e.g., organ, tissue or portion of the body). A pharmaceutically acceptable carrier is “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the tissue of the subject (e g., physiologically compatible, sterile, physiologic pH, etc.)

[0179] Formulations of the pharmaceutical compositions described herein can be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient(s) into association with an excipient and / or one or more other accessory ingredients, and then, if necessary and / or desirable, shaping and / or packaging the product into a desired single- or multi-dose unit. Pharmaceutical formulations can additionally comprise a pharmaceutically acceptable excipient, which, as used herein, includes any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired.Methods of Editing

[0180] The methods and compositions disclosed herein can be used to edit a target gene of interest by prime editing.

[0181] In some embodiments, the prime editing method comprises contacting a target gene, with the prime editing system or lipid nanoparticle described herein. For example, in a method for editing a gene comprises contacting a PEgRNA and a prime editor (PE) comprising a DNA binding domain and a DNA polymerase domain, wherein the PEgRNA directs the prime editor to incorporate the intended nucleotide edit in the gene, thereby editing the gene.

[0182] In some embodiments, a method for editing a gene comprises contacting the gene with the prime editing system described herein, wherein the PEgRNA directs the prime editor to incorporate the intended nucleotide edit in the gene, thereby editing the gene.

[0183] In some embodiments, the editing efficiency is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% equivalent as compared to editing with an unmodified control PEgRNA.

[0184] In some embodiments, the prime editor synthesizes a single stranded DNA encoded by the editing template, wherein the single stranded DNA replaces the editing target sequence and results in incorporation of the intended nucleotide edit into a region corresponding to the editing target sequence.

[0185] In some embodiments, the subject is a human.

[0186] In some embodiments, the method further comprising administering the cell to the subject after incorporation of the intended nucleotide edit.EXAMPLESEXAMPLE 1 - Chemical Modifications in mRNA poly(A) tail

[0187] Background

[0188] Great progress has been achieved in the development of messenger RNA (mRNA) as a therapeutic agent, especially as vaccines for COVID- 19. Despite the progress and FDA approvals of mRNA vaccines, the s tabi li ty . immunogenicity, translation efficiency, and delivery of mRNAs are still pivotal issues that need to be addressed to extend mRNA therapeutics to multiple therapeutic areas. mRNAs are intrinsically unstable and prone to degradation - some chemical modifications have been reported to improve their stability. To obtain the best mRNA therapeutic efficacy, it is necessary' to optimize the chemistry' of 5’- cap, poly-A tail, and site-specific modifications for reducing immunogenicity' and increasing stability of the coding region, and optimization of UTRs.

[0189] Capping at the 5’-end and addition of poly(A) tail at the 3’ -end of nascent mRNA results in enhanced stability, cytoplasmic export, and translational efficiency. The level of access to the 5' cap and poly(A) tail is important in controlling how soon the mRNA is degraded. The rate of deadenylation may also be regulated by introducing modifications in the poly(A) tail that control deadenylation process and inhibit poly(A) tail removal. Once thepoly(A) tail is removed, the decapping complex removes the 5'-cap, leading to rapid degradation of the mRNA.

[0190] The poly(A) tail is a critical component of a mature mRNA and is usually composed of a stretch of up to 250 adenosine (A) residues at the 3'-end (Eckmann CR et al. Wiley Interdiscip Rev RNA 2: 348-361, 2011; Lima SA et al. Nat Struct Mol Biol. 24: 1057- 1063, 2017). Poly(A) tail of mRNA contributes to the stability of mRNA by forming cytoplasmic ribonucleoprotein (RNP) complexes with poly(A)-binding proteins (PABPs) (Mangus DA et al. Genome Biol. 4: 223, 2003). This interaction is critical for efficient translation and control of mRNA stability (Bernstein P et al. Mol Cell Biol. 9: 659-670, 1989; Wiederhold K and Passmore LA, Biochem Soc Trans. 38: 1531-1536, 2010; Goss DJ and Kleiman FE. Wiley Interdiscip Rev RNA. 4: 167-179, 2013). The poly(A)-PABP RNP complex interacts with the eIF4G scaffold protein stimulating the translation initiation (Gallie DR, Genes Dev. 5: 2108-2116, 1991). Therefore, a poly(A) tail is essential for efficient protein expression.

[0191] Poly(A) tail of an mRNA undergoes gradual shortening through deadenylation steps during protein synthesis (Decker CJ and Parker R, Genes Dev. 7: 1632-1643, 1993). Deadenylation occurs in two major steps, initially by the engagement of Pan2-Pan3 and later by Ccr4-Not (Decker CJ and Parker R, Genes Dev. 7: 1632-1643, 1993; Yamashita A, et al. Nat Struct Mol Biol. 12: 1054-1063, 2005). Structural features of poly(A) tail recognition by the Pan2-Pan3 deadenylase have been described, and the role of PABPs, together with poly (A), in forming a specific binding scaffold for the Pan2-Pan3 heterotrimer has been described in the literature (Schafer IB et al. Cell. 177: 1619-1631, 2019). Many studies have described the possibility of stabilizing mRNA molecules by preventing deadenylation, which has been achieved by modifying the very end of the 3 ’ -mRNA (Astrom J et al. EMBO J. 10: 3067-3071, 1991; Anhauser L et al. Nucleic Acids Res. 47: e42, 2019). Recently, incorporation of synthetically modified short fragments of oligo(A) at the end of the mRNA have been shown to resist deadenylase activity and augment protein production in HeLa cells and primary rat cortical neuronal cultures (Aditham A et al. ACS Chem Biol. 17: 3352-3366, 2022).

[0192] Summary

[0193] In here, the chemical space for modifying mRNA and mRNA poly(A) tails was potentially much wider and it is possible to develop incorporation of chemical modifications at the 3 ’-end of the poly (A) tail of mRNA synthesized by 1VT. The method utilizes synthesis of short oligonucleotides of about 10-120 nucleotides with desired chemicalmodifications (FIG. 1) incorporated on solid support on a DNA / RNA synthesizer with a 5‘- phosphate to ligate to the 3’-end of the poly(A) tail (FIG. 2A-2B). Incorporation of a 3’- deoxy ribose sugar at the end of the synthetic oligo(A) with a 5 ’-phosphate will prevent selfligation and additional 3 ’-exonuclease stability . Post-IVT of mRNA, modified oligo(A) is ligated to the 3’-end of the mRNA containing 0-150 nucleotide or longer poly(A) tail.

[0194] Experimental

[0195] Synthesis of synthetic oligo(A) sequences

[0196] Oligo(A) sequences, polyA-120-idT, sequences were synthesized on solidsupport using beta-cynoethylphosphoramidite chemistry at ChemGenes, BioSpring or internally. Following synthesis, oligos were deprotected, purified on HPLC, characterized, and desalted prior to use.

[0197] Enzymatic ligation protocol

[0198] A direct ligation without addition of a splint was utilized for preparation of mRNAs with poly(A)-tail modifications. Here, the oligo(A) sequences with a 5 ’-phosphate acts as a donor oligo and mRNA, generated through IVT and containing an unmodified 3’- hydroxy, acts as an acceptor oligo. For a successful ligation, a 1 : 30 molar ratio of mRNA to synthetic oligo(A) was used. The ligation reaction was setup by mixing solutions of mRNA, oligo(A), RNase-free T4 RNA Ligase (Promega, Cat. No. Ml 051), T4 RNA Ligase 10X Buffer, SUPERaseHn™ RNase Inhibitor (Invitrogen, Cat. No. AM2694), 50% aq. PEG8000, and RNase-free water to a final mRNA concentration of 0. 1 pM. The reaction mixture was incubated at 37 °C for 15 min. The ligated mRNA product was isolated and concentrated by using RNeasy Micro Kit (Qiagen, Cat. No. 74004) using manufacturer’s protocols and Amicon Ultra - 0.5mL (100K, Millipore Sigma, Cat. No. UFC510096) and then re-diluted to the desired concentration for downstream applications. Aliquots of the final mRNA product sample were collected for determination of ligation efficiency by denaturing-PAGE system and mRNA purity was determined as ‘%Total’ by Agilent Fragment Analyzer.

[0199] Determination of ligation efficiency

[0200] The ligation efficiency wass determined by RNase T1 digestion and analyzing the samples using denaturing-PAGE system. An aliquot of the final mRNA product sample (4-8 pg) was retrieved, diluted by RNase-free water, and mixed with 0.5 M EDTA solution (Promega, Cat. No. V4231) to a final mRNA concentration of 0.4-0.8 pg / pL and EDTA concentration of 50 mM. The resulting solution was heated to 95 °C for 3 min and immediately cooled in ice for 5 min. RNase T1 (Thermo Scientific. Cat. No. EN0541) was added to the ligated mRNA solution to a final amount of 100 U / pg of mRNA. The mixturewas incubated at 37 °C for 30 min. After incubation, the resulting mixture was mixed with 2X RNA Loading Dye (NEB, Cat. No. B0363S) and loaded onto a 10% TBE-Urea gel, along with low range ssRNA Ladder (NEB, Cat. No. N0364S). The gel was run in IX TBE Electrophoresis Buffer at a constant voltage of 180V for 60 min. The gel was then stained with SYBR™ Gold Nucleic Acid Gel Stain (Invitrogen, Cat. No. SI 1494) for 45 min. The gel was visualized using SmartDoc™ 2.0 Gel Visualization system and a gel image was recorded. The ligation efficiency was determined using analysis of the gel image with Fiji / ImageJ software (an exemplary image is shown in FIG. 3).

[0201] Determination of mRNA purity

[0202] The '%Tolal' was recorded and analyzed using Agilent Fragment Analyzer 5300 System. Aliquots of ligated mRNA samples were diluted to a concentration of 100 ng / pL. The data was recorded using manufacturer’s protocols with the ’DNF-471E33 - SS Total RNA 15nt Extended’ method. The raw data was analyzed using Agilent ProSize Data Analysis Software. ‘%Total‘ (and ‘Average Size’) were analyzed through ‘Smear Analysis’ configuration (an exemplary image is shown in FIG. 4).

[0203] In vitro translation assays

[0204] Cell culture and transfection: HEK293T cells were maintained in complete growth medium (MEM+ 10% FBS + 100 unit / ml Pen-Strep). 24 h prior transfection, 50000 cells were seeded on each well of 96 well plate in transfection medium (MEM+ 10% FBS). Transfection of mRNA into HEK293T cells were conducted according to manufacturer’s instructions. Briefly, desired amount of mRNA generated from polyA(tail) ligation and guide RNA w ere added to Opti-MEM. Messenger Max was first diluted in Opti-MEM and then mixed with RNA solution. The Messenger Max volume was controlled consistently at 0.25 pl in each transfection. The complex was incubated at room temperature for 15 min before adding to cells incubated in transfection medium. At certain time points post transfection, transfection medium was removed from each well and the w ell plates w ere frozen at -80 degree Celsius for future use.

[0205] ELISA assay

[0206] Frozen cell plates were first equilibrated to room temperature. Subsequently, 50 pl of cell extraction buffer were added to each w ell to lyse cells for 5 min. 15 pl cell lysate from each well w ere transferred to one ELISA plate w ell with addition of extra 35 pl cell extraction buffer. To make standard curve, prime editor was diluted to a series of concentrations using cell extraction buffer and 50 pl of each concentration was added to each ELISA plate well. Next, 50 pl capture antibody solution was added to each well. The stripplates were sealed and incubated for 1 h at room temperature. After that, wells were washed with 200 pl ELISA wash buffer for 4 times. After each wash, aspirate or decant from wells to remove solution residue. Then 1 0 pL of TMB substrate was added to each well. The plate was sealed by aluminum tape and incubate the plate in the dark for 10 min at 37°C without shaking. Finally, 100 pL of Stop solution was added to each well and the absorbance was read using a plate reader with reading wavelength of 450 nm.

[0207] gDNA extraction and PCR1 NGS preparation

[0208] Frozen cell plates were first equilibrated to room temperature. Once thaw ed.50 pl of Lucigen QucikExtract w as added to each well. After 5 min of incubation, cell lysate in each well was transferred to the PCR plate. The PCR plate was then sealed and set on thermocycler with the following program (heated at 65 °C for 15 min; 98 °C for 20 min; hold at 4 °C) to extract gDNA. Once done, PCR1 master mix were prepared by mixing 1.25 ml of 2X Q5 Hot Start HiFi Master Mix, 12.5 pl of 100 pM forward primer, 12.5 pl of 100 pM reverse primer and 1.025 ml of water. Then, 23 pl of master mix and 2 pl of gDNA solution was added to one well of a new PCR plate. The PCR plate was then sealed and set on thermocycler with the following program (heated at 980C for 30 s; 25 repetitions of 98 °C for 20 s, 63 °C for 15 s, and 72 °C for 1 min; 72 °C for 2 min; hold at 4C) to amplify gDNA. Once done, everything was transferred to each PCR plate well to the corresponding well in ThermoFisher Armadillo full skirted plate and drop off NGS core. PCR2 and next generation sequencing was then performed to evaluate gene editing.

[0209] Results

[0210] We designed a series of 20-120-mer oligo(A) sequences w ith a 5’-phosphate and a 3’-deoxyribose with various modifications to stabilize the poly(A) and thereby improve translation efficiency of mRNA. While a 5’-phosphate facilitates ligation with free 3 -OH at the 3 ’-end of poly (A) tail, a 3 ’-deoxyribose sugar in the oligo(A) sequence prevents selfligation. Post-IVT of mRNA, modified oligonucleotides are ligated to the 3 ’-end of the mRNA containing 0-150 nucleotide long poly(A) tail in the presence or absence of a template (splint) using T4 RNA ligase in the presence of ATP (FIG. 2B).

[0211] Multiple chemically modified poly(A) tails were synthesized using DNA / RNA synthesizer, HPLC purified and characterized for purify and integrity by analytical HPLC and ESI-MS, respectively. All oligonucleotides were > 90% pure by HPLC and had correct mass as determined by MS. The synthesized modified poly(A) tail compounds are listed in Table 1. These compounds are suitable for ligation to mRNA following IVT with or without a regular poly(A) in place.

[0212] Table 1. Modified poly(A) tail compoundsP = phosphate; A or (A) adenosine; 3 ’-dT-5’ = inverted deoxy thy mi dine; 3’-dA-5’ = inverted deoxyadenosine; 3’-dU-5’ = inverted deoxyuracil; * indicates phosphorothioate; mA = 2’0Me adenosine; LNA-A = locked nucleic acid(A); m6A = N6-methyladenosine; moeA = 2’-O-methoxy ethyl ribose(A) (2’MOE-A); araA= arabinose(A); FANA-A = 2’-Fluoro- arabinose(A); 25 A = 2’ -5 ’-adenosine; L-rA = L-ribo adenosine; H-dA = homo-DNA(A); UNA-A = unlocked nucleic acid (A); GNA-A = glycol nucleic acid (A); SpC3 - C3 linker (propyl); TEG - triethylene glycol linker; = stereospecific Sp phosphorothioate linkage; 6’- phosphate A.

[0213] As a proof of concept, the modified poly (A) oligos were ligated to PE mRNA using T4 ligase without a splint. The incorporation of modified poly(A) tail was confirmed as described in FIG. 3 and the purity on a fragment analyzer as shown in FIG. 4.

[0214] Translation of the PE mRNA with and without poly(A) modifications was assessed. Three controls were used in the experiments, mRNAOOl, mRNA137. and Seq-14. The sequence for control mRNAOOl isAGGAAAUAAGAGAGAAA AGAAGAGUAAGAAGAAAUAUAAGAGC C AC C AUGAA ACGGACAGCCGACGGAAGCGAGUUCGAGUCACCAAAGAAGAAGCGGAAAGUC GACAAGAAGUACAGCAUCGGCCUGGACAUCGGCACCAACUCUGUGGGCUGGGCCGUGAUCACCGACGAGUACAAGGUGCCCAGCAAGAAAUUCAAGGUGCUGGGCA ACACCGACCGGCACAGCAUCAAGAAGAACCUGAUCGGAGCCCUGCUGUUCGAC AGCGGCGAAACAGCCGAGGCCACCCGGCUGAAGAGAACCGCCAGAAGAAGAUACACCAGACGGAAGAACCGGAUCUGCUAUCUGCAAGAGAUCUUCAGCAACGAGA UGGCCAAGGUGGACGACAGCUUCUUCCACAGACUGGAAGAGUCCUUCCUGGUG GAAGAGGAUAAGAAGCACGAGCGGCACCCCAUCUUCGGCAACAUCGUGGACGAGGUGGCCUACCACGAGAAGUACCCCACCAUCUACCACCUGAGAAAGAAACUGG UGGACAGCACCGACAAGGCCGACCUGCGGCUGAUCUAUCUGGCCCUGGCCCAC AUGAUCAAGUUCCGGGGCCACUUCCUGAUCGAGGGCGACCUGAACCCCGACAACAGCGACGUGGACAAGCUGUUCAUCCAGCUGGUGCAGACCUACAACCAGCUGU UCGAGGAAAACCCCAUCAACGCCAGCGGCGUGGACGCCAAGGCCAUCCUGUCU GCCAGACUGAGCAAGAGCAGACGGCUGGAAAAUCUGAUCGCCCAGCUGCCCGGCGAGAAGAAGAAUGGCCUGUUCGGAAACCUGAUUGCCCUGAGCCUGGGCCUGA CCCCCAACUUCAAGAGCAACUUCGACCUGGCCGAGGAUGCCAAACUGCAGCUG AGCAAGGACACCUACGACGACGACCUGGACAACCUGCUGGCCCAGAUCGGCGA CCAGUACGCCGACCUGUUUCUGGCCGCCAAGAACCUGUCCGACGCCAUCCUGC UGAGCGACAUCCUGAGAGUGAACACCGAGAUCACCAAGGCCCCCCUGAGCGCC UCUAUGAUCAAGAGAUACGACGAGCACCACCAGGACCUGACCCUGCUGAAAGCUCUCGUGCGGCAGCAGCUGCCUGAGAAGUACAAAGAGAUUUUCUUCGACCAGA GCAAGAACGGCUACGCCGGCUACAUUGACGGCGGAGCCAGCCAGGAAGAGUUC UACAAGUUCAUCAAGCCCAUCCUGGAAAAGAUGGACGGCACCGAGGAACUGCUCGUGAAGCUGAACAGAGAGGACCUGCUGCGGAAGCAGCGGACCUUCGACAACG GCAGCAUCCCCCACCAGAUCCACCUGGGAGAGCUGCACGCCAUUCUGCGGCGG CAGGAAGAUUUUUACCCAUUCCUGAAGGACAACCGGGAAAAGAUCGAGAAGAUCCUGACCUUCCGCAUCCCCUACUACGUGGGCCCUCUGGCCAGGGGAAACAGC AGAUUCGCCUGGAUGACCAGAAAGAGCGAGGAAACCAUCACCCCCUGGAACUU CGAGGAAGUGGUGGACAAGGGCGCUUCCGCCCAGAGCUUCAUCGAGCGGAUGACCAACUUCGAUAAGAACCUGCCCAACGAGAAGGUGCUGCCCAAGCACAGCCUGCUGUACGAGUACUUCACCGUGUAUAACGAGCUGACCAAAGUGAAAUACGUGACCGAGGGAAUGAGAAAGCCCGCCUUCCUGAGCGGCGAGCAGAAAAAGGCCAUCGUGGACCUGCUGUUCAAGACCAACCGGAAAGUGACCGUGAAGCAGCUGAAAGAGGACUACUUCAAGAAAAUCGAGUGCUUCGACUCCGUGGAAAUCUCCGGCGUGGAAGAUCGGUUCAACGCCUCCCUGGGCACAUACCACGAUCUGCUGAAAAUUAUCAAGGACAAGGACUUCCUGGACAAUGAGGAAAACGAGGACAUUCUGGAAGAUAUCGUGCUGACCCUGACACUGUUUGAGGACAGAGAGAUGAUCGAGGAACGGCUGAAAACCUAUGCCCACCUGUUCGACGACAAAGUGAUGAAGCAGCUGAAGCGGCGGAGAUACACCGGCUGGGGCAGGCUGAGCCGGAAGCUGAUCAACGGCAUCCGGGACAAGCAGUCCGGCAAGACAAUCCUGGAUUUCCUGAAGUCCGACGGCUUCGCCAACAGAAACULJCAUGCAGCUGAUCCACGACGACAGCCUGACCUUUAAAGAGGACAUCCAGAAAGCCCAGGUGUCCGGCCAGGGCGAUAGCCUGCACGAGCACAUUGCCAAUCUGGCCGGCAGCCCCGCCAUUAAGAAGGGCAUCCUGCAGACAGUGAAGGUGGUGGACGAGCUCGUGAAAGUGAUGGGCCGGCACAAGCCCGAGAACAUCGUGAUCGAAAUGGCCAGAGAGAACCAGACCACCCAGAAGGGACAGAAGAACAGCCGCGAGAGAAUGAAGCGGAUCGAAGAGGGCAUCAAAGAGCUGGGCAGCCAGAUCCUGAAAGAACACCCCGUGGAAAACACCCAGCUGCAGAACGAGAAGCUGUACCUGUACUACCUGCAGAAUGGGCGGGAUAUGUACGUGGACCAGGAACUGGACAUCAACCGGCUGUCCGACUACGAUGUGGACGCUAUCGUGCCUCAGAGCUUUCUGAAGGACGACUCCAUCGACAACAAGGUGCUGACCAGAAGCGACAAGAACCGGGGCAAGAGCGACAACGUGCCCUCCGAAGAGGUCGUGAAGAAGAUGAAGAACUACUGGCGGCAGCUGCUGAACGCCAAGCUGAUUACCCAGAGAAAGUUCGACAAUCUGACCAAGGCCGAGAGAGGCGGCCUGAGCGAACUGGAUAAGGCCGGCUUCAUCAAGAGACAGCUGGUGGAAACCCGGCAGAUCACAAAGCACGUGGCACAGAUCCUGGACUCCCGGAUGAACACUAAGUACGACGAGAAUGACAAGCUGAUCCGGGAAGUGAAAGUGAUCACCCUGAAGUCCAAGCUGGUGUCCGAUUUCCGGAAGGAUUUCCAGUUUUACAAAGUGCGCGAGAUCAACAACUACCACCACGCCCACGACGCCUACCUGAACGCCGUCGUGGGAACCGCCCUGAUCAAAAAGUACCCUAAGCUGGAAAGCGAGUUCGUGUACGGCGACUACAAGGUGUACGACGUGCGGAAGAUGAUCGCCAAGAGCGAGCAGGAAAUCGGCAAGGCUACCGCCAAGUACUUCUUCUACAGCAACAUCAUGAACUUUUUCAAGACCGAGAUUACCCUGGCCAACGGCGAGAUCCGGAAGCGGCCUCUGAUCGAGACAAACGGCGAAACCGGGGAGAUCGUGUGGGALJAAGGGCCGGGAULJUUGCCACCGLJGCGGAAAGUGCUGAGCAUGCCCCAAGUGAAUAUCGUGAAAAAGACCGAGGUGCAGACAGGCGGCUUCAGCAAAGAGUCUAUCCUGCCCAAGAGGAACAGCGAUAAGCUGAUCGCCAGAAAGAAGGACUGGGACCCUAAGAAGUACGGCGGCUUCGACAGCCCCACCGUGGCCUAUUCUGUGCUGGU GGUGGCCAAAGUGGAAAAGGGCAAGUCCAAGAAACUGAAGAGUGUGAAAGAGCUGCUGGGGAUCACCAUCAUGGAAAGAAGCAGCUUCGAGAAGAAUCCCAUCGACUUUCUGGAAGCCAAGGGCUACAAAGAAGUGAAAAAGGACCUGAUCAUCAAGCUGCCUAAGUACUCCCUGUUCGAGCUGGAAAACGGCCGGAAGAGAAUGCUGGCCUCUGCCGGCGAACUGCAGAAGGGAAACGAACUGGCCCUGCCCUCCAAAUAUGUGAACUUCCUGUACCUGGCCAGCCACUAUGAGAAGCUGAAGGGCUCCCCCGAG GAUAAUGAGCAGAAACAGCUGUUUGUGGAACAGCACAAGCACUACCUGGACGAGAUCAUCGAGCAGAUCAGCGAGUUCUCCAAGAGAGUGAUCCUGGCCGACGCUAAUCUGGACAAAGUGCUGUCCGCCUACAACAAGCACCGGGAUAAGCCCAUCAGAGAGCAGGCCGAGAAUAUCAUCCACCUGUUUACCCUGACCAAUCUGGGAGCCCCUGCCGCCUUCAAGUACUUUGACACCACCAUCGACCGGAAGAGGUACACCAGC ACCAAAGAGGUGCUGGACGCCACCCUGAUCCACCAGAGCAUCACCGGCCUGUACGAGACACGGAUCGACCUGUCUCAGCUGGGAGGUGACUCCGGCGGCUCCUCCG GCGGAAGCAGCGGCGGCAGCAGCGGCGGAAGCAGCGGCGGCAGCAGCGGCGGAAGCUCUGGCGGAUCUAGCGGCGGCUCUACCCUGAACAUCGAGGACGAGUACAGGCUGCACGAGACCAGCAAGGAGCCCGACGUGAGCCUGGGCAGCACCUGGCUGAGCGAUUUCCCUCAGGCUUGGGCCGAGACCGGCGGCAUGGGCCUGGCCGUGCGG CAGGCCCCCCUGAUUAUCCCCCUGAAGGCCACCAGCACCCCCGUGAGCAUCAAGCAGUACCCAAUGUCCCAGGAGGCCAGGCUGGGCAUCAAGCCUCACAUCCAGAGGCUGCUGGACCAGGGCAUCCUGGUGCCAUGCCAGUCCCCCUGGAACACCCCUCUGCUGCCCGUGAAGAAGCCUGGCACCAACGACUACCGGCCCGUGCAGGACCU GAGAGAAGUGAACAAGCGGGUGGAGGACAUCCACCCAACCGUGCCCAACCCUUACAACCUGCUGUCCGGCCUGCCCCCCAGCCACCAGUGGUACACCGUGCUGGACCUGAAGGACGCCUUCUUCUGCCUGAGACUGCACCCCACCUCUCAGCCCCUGUU CGCCUUCGAGUGGCGCGACCCCGAGAUGGGCAUCAGCGGCCAGCUGACCUGGACCAGACUGCCACAGGGCUUUAAGAAUAGCCCAACCCUGUUUAACGAGGCCCUG CACAGGGACCUGGCCGACUUCAGGAUCCAGCACCCCGACCUGAUUCUGCUGCAGUACGUGGACGACCUGCUGCUGGCCGCUACCAGCGAGCUGGACUGCCAGCAGG GC ACC AGAGC CCUGCUGC AGACCCUGGGC AAC CUGGGCUAC AGAGC C AGCGC C AAGAAGGCCCAGAUCUGUCAGAAGCAGGUGAAGUAUCUGGGCUACCUGCUGA AGGAAGGCCAGAGALJGGCUGACCGAGGCCAGAAAGGAGACUGUGAUGGGCCA GCCCACCCCCAAGACCCCCAGGCAGCUGCGGGAGUUCCUGGGCAAGGCCGGCUUUUGCAGACUGUUUAUCCCUGGCUUCGCCGAGAUGGCCGCCCCACUGUACCCUCUGACCAAGCCUGGCACCCUGUUUAACUGGGGCCCCGACCAGCAGAAGGCCUACCAGGAGAUCAAGCAGGCCCUGCUGACCGCCCCCGCCCUGGGCCUGCCCGACCUGACCAAGCCUUUCGAGCUGUUCGUGGACGAGAAGCAGGGAUACGCCAAAGGCGUGCUGACCCAGAAGCUGGGCCCCUGGCGGAGGCCCGUGGCCUACCUGAGCAAAAAACUGGACCCUGUGGCCGCCGGCUGGCCCCCAUGCCUGCGGAUGGUGGCCGCCAUCGCUGUGCUGACCAAGGACGCCGGCAAGCUGACCAUGGGCCAGCCCCUGGUGAUCCUGGCCCCUCACGCCGUGGAGGCUCUGGUGAAGCAGCCUCCAGACAGGUGGCUGUCCAACGCCAGGAUGACCCACUACCAGGCCCUGCUGCUGGACACCGACCGGGUGCAGUUCGGCCCUGUGGUGGCCCUGAACCCCGCCACCCUGCUGCCUCUGCCAGAGGAGGGCCUGCAGCACAACUGCCUGGACAUCCUGGCCGAGGCCCACGGCACCAGGCCCGACCUGACCGACCAGCCCCUGCCUGACGCCGACCACACCUGGUACACCGACGGCAGCUCCCUGCUGCAGGAGGGCCAGAGGAAGGCCGGCGCCGCCGUGACCACCGAGACCGAGGUGAUCUGGGCCAAAGCCCUGCCUGCCGGCACCUCCGCCCAGCGGGCCGAGCUGAUCGCCCUGACCCAGGCCCUGAAGAUGGCUGAGGGCAAGAAGCUGAACGUGUACACCGAUUCCAGAUACGCCUUCGCCACCGCCCACAUCCACGGCGAGAUCUACAGAAGAAGGGGCUGGCUGACCUCCGAGGGCAAGGAGAUCAAGAACAAGGACGAGAUUCUGGCCCUGCUGAAGGCCCUGUUCCUGCCUAAGAGACUGAGCAUCAUCCACUGUCCCGGCCACCAGAAGGGCCACAGCGCCGAGGCCAGAGGCAAUAGAAUGGCCGACCAGGCCGCCAGAAAGGCCGCCAUCACCGAGACCCCCGACACCAGCACCCUGCUGAUCGAGAACAGCAGCCCCAGCGGCGGCUCCAAACGCACCGCCGACGGGAGCGAGUUCGAGCCCAAGAAGAAGAGGAAAGUCUAAUAGUGAGCGGCCGCUUAAUUAAGCUGCCUUCUGCGGGGCUUGCCUUCUGGCCAAGCCCUUCUUCUCUCCCUUGCACCUGUACCUCUUGGUCUUUGAAUAAAGCCUGAGUAGGAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO.: 49).

[0215] The sequence for control mRNA137 isAGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACCAUGAAACGGACAGCCGACGGAAGCGAGUUCGAGUCACCAAAGAAGAAGCGGAAAGUCGACAAGAAGUACAGCAUCGGCCUGGACAUCGGCACCAACUCUGUGGGCUGGGCCGUGAUCACCGACGAGUACAAGGUGCCCAGCAAGAAAUUCAAGGUGCUGGGCAACACCGACCGGCACAGCAUCAAGAAGAACCUGAUCGGAGCCCUGCUGUUCGACAGCGGCGAAACAGCCGAGGCCACCCGGCUGAAGAGAACCGCCAGAAGAAGAUACACCAGACGGAAGAACCGGAUCUGCUAUCUGCAAGAGAUCUUCAGCAACGAGAUGGCCAAGGUGGACGACAGCUUCUUCCACAGACUGGAAGAGUCCUUCCUGGUGGAAGAGGAUAAGAAGCACGAGCGGCACCCCAUCUUCGGCAACAUCGUGGACGAGGUGGCCUACCACGAGAAGUACCCCACCAUCUACCACCUGAGAAAGAAACUGGUGGACAGCACCGACAAGGCCGACCUGCGGCUGAUCUAUCUGGCCCUGGCCCACAUGAUCAAGUUCCGGGGCCACUUCCUGAUCGAGGGCGACCUGAACCCCGACAACAGCGACGUGGACAAGCUGUUCAUCCAGCUGGUGCAGACCUACAACCAGCUGUUCGAGGAAAACCCCAUCAACGCCAGCGGCGUGGACGCCAAGGCCAUCCUGUCUGCCAGACUGAGCAAGAGCAGACGGCUGGAAAAUCUGAUCGCCCAGCUGCCCGGCGAGAAGAAGAAUGGCCUGUUCGGAAACCUGAUUGCCCUGAGCCUGGGCCUGACCCCCAACUUCAAGAGCAACULJCGACCUGGCCGAGGALIGCCAAACUGCAGCUGAGCAAGGACACCUACGACGACGACCUGGACAACCUGCUGGCCCAGAUCGGCGACCAGUACGCCGACCUGUUUCUGGCCGCCAAGAACCUGUCCGACGCCAUCCUGCUGAGCGACAUCCUGAGAGUGAACACCGAGAUCACCAAGGCCCCCCUGAGCGCCUCUAUGAUCAAGAGAUACGACGAGCACCACCAGGACCUGACCCUGCUGAAAGCUCUCGUGCGGCAGCAGCUGCCUGAGAAGUACAAAGAGAUUUUCUUCGACCAGAGCAAGAACGGCUACGCCGGCUACAUUGACGGCGGAGCCAGCCAGGAAGAGUUCUACAAGUUCAUCAAGCCCAUCCUGGAAAAGAUGGACGGCACCGAGGAACUGCUCGUGAAGCUGAACAGAGAGGACCUGCUGCGGAAGCAGCGGACCUUCGACAACGGCAGCAUCCCCCACCAGAUCCACCUGGGAGAGCUGCACGCCAUUCUGCGGCGGCAGGAAGAUUUUUACCCAUUCCUGAAGGACAACCGGGAAAAGAUCGAGAAGAUCCUGACCUUCCGCAUCCCCUACUACGUGGGCCCUCUGGCCAGGGGAAACAGCAGAUUCGCCUGGAUGACCAGAAAGAGCGAGGAAACCAUCACCCCCUGGAACUUCGAGGAAGUGGUGGACAAGGGCGCUUCCGCCCAGAGCUUCAUCGAGCGGAUGACCAACUUCGAUAAGAACCUGCCCAACGAGAAGGUGCUGCCCAAGCACAGCCUGCUGUACGAGUACUUCACCGUGUAUAACGAGCUGACCAAAGUGAAAUACGUGACCGAGGGAAUGAGAAAGCCCGCCUUCCUGAGCGGCGAGCAGAAAAAGGCCAUCGUGGACCUGCUGUUCAAGACCAACCGGAAAGUGACCGUGAAGCAGCUGAAAGAGGACUACUUCAAGAAAAUCGAGUGCUUCGACUCCGUGGAAAUCUCCGGCGUGGAAGAUCGGUUCAACGCCUCCCUGGGCACAUACCACGAUCUGCUGAAAAUUAUCAAGGACAAGGACUUCCUGGACAAUGAGGAAAACGAGGACAUUCUGGAAGAUAUCGUGCUGACCCUGACACUGUUUGAGGACAGAGAGAUGAUCGAGGAACGGCUGAAAACCUAUGCCCACCUGUUCGACGACAAAGUGAUGAAGCAGCUGAAGCGGCGGAGAUACACCGGCUGGGGCAGGCUGAGCCGGAAGCUGAUCAACGGCAUCCGGGACAAGCAGUCCGGCAAGACAAUCCUGGAUUUCCUGAAGUCCGACGGCUUCGCCAACAGAAACUUCAUGCAGCUGAUCCACGACGACAGCCUGACCUUUAAAGAGGACAUCCAGAAAGCCCAGGUGUCCGGCCAGGGCGAUAGCCUGCACGAGCACAUUGCCAAUCUGGCCGGCAGCCCCGCCAUUAAGAAGGGCAUCCUGCAGACAGUGAAGGUGGUGGACGAGCUCGUGAAAGUGAUGGGCCGGCACAAGCCCGAGAACAUCGUGAUCGAAAUGGCCAGAGAGAACCAGACCACCCAGAAGGGACAGAAGAACAGCCGCGAGAGAAUGAAGCGGAUCGAAGAGGGCAUCAAAGAGCUGGGCAGCCAGAUCCUGAAAGAACACCCCGUGGAAAACACCCAGCUGCAGAACGAGAAGCUGUACCUGUACUACCUGCAGAAUGGGCGGGAUAUGUACGUGGACCAGGAACUGGACAUCAACCGGCUGUCCGACUACGAUGUGGACGCUAUCGUGCCUCAGAGCUUUCUGAAGGACGACUCCAUCGACAACAAGGUGCUGACCAGAAGCGACAAGAACCGGGGCAAGAGCGACAACGUGCCCUCCGAAGAGGUCGUGAAGAAGAUGAAGAACUACUGGCGGCAGCUGCUGAACGCCAAGCUGAUUACCCAGAGAAAGUUCGACAAUCUGACCAAGGCCGAGAGAGGCGGCCUGAGCGAACUGGAUAAGGCCGGCUUCAUCAAGAGACAGCUGGUGGAAACCCGGCAGAUCACAAAGCACGUGGCACAGAUCCUGGACUCCCGGAUGAACACUAAGUACGACGAGAAUGACAAGCUGAUCCGGGAAGUGAAAGUGAUCACCCUGAAGUCCAAGCUGGUGUCCGAUUUCCGGAAGGAUUUCCAGUUUUACAAAGUGCGCGAGAUCAACAACUACCACCACGCCCACGACGCCUACCUGAACGCCGUCGUGGGAACCGCCCUGAUCAAAAAGUACCCUAAGCUGGAAAGCGAGUUCGUGUACGGCGACUACAAGGUGUACGACGUGCGGAAGAUGAUCGCCAAGAGCGAGCAGGAAAUCGGCAAGGCUACCGCCAAGUACUUCUUCUACAGCAACAUCAUGAACUUUUUCAAGACCGAGAUUACCCUGGCCAACGGCGAGAUCCGGAAGCGGCCUCUGAUCGAGACAAACGGCGAAACCGGGGAGAUCGUGUGGGAUAAGGGCCGGGAUUUUGCCACCGUGCGGAAAGUGCUGAGCAUGCCCCAAGUGAAUAUCGUGAAAAAGACCGAGGUGCAGACAGGCGGCUUCAGCAAAGAGUCUAUCCUGCCCAAGAGGAACAGCGAUAAGCUGAUCGCCAGAAAGAAGGACUGGGACCCUAAGAAGUACGGCGGCUUCGACAGCCCCACCGUGGCCUAUUCUGUGCUGGUGGUGGCCAAAGUGGAAAAGGGCAAGUCCAAGAAACUGAAGAGUGUGAAAGAGCUGCUGGGGAUCACCAUCAUGGAAAGAAGCAGCUUCGAGAAGAAUCCCAUCGACUUUCUGGAAGCCAAGGGCUACAAAGAAGUGAAAAAGGACCUGAUCAUCAAGCUGCCUAAGUACUCCCUGUUCGAGCUGGAAAACGGCCGGAAGAGAAUGCUGGCCUCUGCCGGCGAACUGCAGAAGGGAAACGAACUGGCCCUGCCCUCCAAAUAUGUGAACLUJCCUGUACCUGGCCAGCCACUAUGAGAAGCUGAAGGGCUCCCCCGAGGAUAAUGAGCAGAAACAGCUGUUUGUGGAACAGCACAAGCACUACCUGGACGAGAUCAUCGAGCAGAUCAGCGAGUUCUCCAAGAGAGUGAUCCUGGCCGACGCUAAUCUGGACAAAGUGCUGUCCGCCUACAACAAGCACCGGGAUAAGCCCAUCAGAGAGCAGGCCGAGAAUAUCAUCCACCUGUUUACCCUGACCAAUCUGGGAGCCCCUGCCGCCUUCAAGUACUUUGACACCACCAUCGACCGGAAGAGGUACACCAGCACCAAAGAGGUGCUGGACGCCACCCUGAUCCACCAGAGCAUCACCGGCCUGUACGAGACACGGAUCGACCUGUCUCAGCUGGGAGGUGACUCCGGCGGCUCCUCCGGCGGAAGCAGCGGCGGCAGCAGCGGCGGAAGCAGCGGCGGCAGCAGCGGCGGAAGCUCUGGCGGAUCUAGCGGCGGCUCUACCCUGAACAUCGAGGACGAGUACAGGCUGCACGAGACCAGCAAGGAGCCCGACGUGAGCCUGGGCAGCACCUGGCUGAGCGAUUUCCCUCAGGCUUGGGCCGAGACCGGCGGCAUGGGCCUGGCCGUGCGGCAGGCCCCCCUGAUUAUCCCCCUGAAGGCCACCAGCACCCCCGUGAGCAUCAAGCAGUACCCAAUGUCCCAGGAGGCCAGGCUGGGCAUCAAGCCUCACAUCCAGAGGCUGCUGGACCAGGGCAUCCUGGUGCCAUGCCAGUCCCCCUGGAACACCCCUCUGCUGCCCGUGAAGAAGCCUGGCACCAACGACUACCGGCCCGUGCAGGACCUGAGAGAAGUGAACAAGCGGGUGGAGGACAUCCACCCAACCGUGCCCAACCCUUACAACCUGCUGUCCGGCCUGCCCCCCAGCCACCAGUGGUACACCGUGCUGGACCUGAAGGACGCCUUCUUCUGCCUGAGACUGCACCCCACCUCUCAGCCCCUGUUCGCCUUCGAGUGGCGCGACCCCGAGAUGGGCAUCAGCGGCCAGCUGACCUGGACCAGACUGCCACAGGGCUUUAAGAAUAGCCCAACCCUGUUUAACGAGGCCCUGCACAGGGACCUGGCCGACUUCAGGAUCCAGCACCCCGACCUGAUUCUGCUGCAGUACGUGGACGACCUGCUGCUGGCCGCUACCAGCGAGCUGGACUGCCAGCAGGGCACCAGAGCCCUGCUGCAGACCCUGGGCAACCUGGGCUACAGAGCCAGCGCCAAGAAGGCCCAGAUCUGUCAGAAGCAGGUGAAGUAUCUGGGCUACCUGCUGAAGGAAGGCCAGAGAUGGCUGACCGAGGCCAGAAAGGAGACUGUGAUGGGCCAGCCCACCCCCAAGACCCCCAGGCAGCUGCGGGAGUUCCUGGGCAAGGCCGGCUUUUGCAGACUGUUUAUCCCUGGCUUCGCCGAGAUGGCCGCCCCACUGUACCCUCUGACCAAGCCUGGCACCCUGUUUAACUGGGGCCCCGACCAGCAGAAGGCCUACCAGGAGAUCAAGCAGGCCCUGCUGACCGCCCCCGCCCUGGGCCUGCCCGACCUGACCAAGCCUUUCGAGCUGUUCGUGGACGAGAAGCAGGGAUACGCCAAAGGCGUGCUGACCCAGAAGCUGGGCCCCUGGCGGAGGCCCGUGGCCUACCUGAGCAAAAAACUGGACCCUGUGGCCGCCGGCUGGCCCCCAUGCCUGCGGAUGGUGGCCGCCAUCGCUGUGCUGACCAAGGACGCCGGCAAGCUGACCAUGGGCCAGCCCCUGGLIGAUCCUGGCCCCUCACGCCGUGGAGGCUCUGGUGAAGCAGCCLJCCAGACAGGUGGCUGUCCAACGCCAGGAUGACCCACUACCAGGCCCUGCUGCUGGACACCGACCGGGUGCAGUUCGGCCCUGUGGUGGCCCUGAACCCCGCCACCCUGCUGCCU CUGCCAGAGGAGGGCCUGCAGCACAACUGCCUGGACAUCCUGGCCGAGGCCCA CGGCACCAGGCCCGACCUGACCGACCAGCCCCUGCCUGACGCCGACCACACCUG GUACACCGACGGCAGCUCCCUGCUGCAGGAGGGCCAGAGGAAGGCCGGCGCCG CCGUGACCACCGAGACCGAGGUGAUCUGGGCCAAAGCCCUGCCUGCCGGCACC UCCGCCCAGCGGGCCGAGCUGAUCGCCCUGACCCAGGCCCUGAAGAUGGCUGA GGGCAAGAAGCUGAACGUGUACACCGAUUCCAGAUACGCCUUCGCCACCGCCC ACAUCCACGGCGAGAUCUACAGAAGAAGGGGCUGGCUGACCUCCGAGGGCAAG GAGAUCAAGAACAAGGACGAGAUUCUGGCCCUGCUGAAGGCCCUGUUCCUGCC UAAGAGACUGAGCAUCAUCCACUGUCCCGGCCACCAGAAGGGCCACAGCGCCG AGGCCAGAGGCAAUAGAAUGGCCGACCAGGCCGCCAGAAAGGCCGCCAUCACC GAGACCCCCGACACCAGCACCCUGCUGAUCGAGAACAGCAGCCCCAGCGGCGG CUCCAAACGCACCGCCGACGGGAGCGAGUUCGAGCCCAAGAAGAAGAGGAAAG UCUAAUAGUGAGCGGCCGCUUAAUUAAGCUGCCUUCUGCGGGGCUUGCCUUCU GGCCAAGCCCUUCUUCUCUCCCUUGCACCUGUACCUCUUGGUCUUUGAAUAAA GCCUGAGUAGGAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO.: 50).

[0216] In vitro translation of the PE mRNA with and without poly (A) modifications was assessed in HEK3 cells as described under experimental. Cellular PE expression was measured at 6 and 24 hr timepoints. The data are presented in FIG. 5. The protein expression was time dependent as expected. Greater levels of protein are observed at 6 hr and the levels came down by 24 hr. As show n FIG. 5 some of the modifications incorporated in PE mRNA increased expression levels while others are showing similar expression compared with control mRNAOOl. Seq 14 is also a control.

[0217] Top performing mRNAs with chemical modifications were studied for duration of protein expression for a prolonged time (6, 24, 48 and 72 hr) (FIG. 6). All mRNAs with a modified poly(A) showed higher expression at 6 and 24 hr timepoints compared with mRNA137. Some of the modifications showed expression up to 48 ad 72 hr.

[0218] Effects of mRNAs with poly(A) modifications were further studied on editing of HEK3 guides. HEK3 cells were transfected with mRNA with or w ithout poly(A) modifications and HEK3 guides and incubated for different timepoints. Dose-dependent editing efficiency was examined as shown in FIG. 7.

[0219] FIG. 8 shows PE retention of various mRNAs with chemical modifications.PE retention was calculated as the ratio of cellular PE expression at 24 h to 6 h. These datademonstrate enhanced protein retention for mRNAs with Seq-3 and Seq-4 poly(A) modification, with 2.0- and 1.8-fold change compared to control mRNAOOl, respectively.

[0220] FIG. 9A-9B shows in vivo protein expression of PE mRNAs containing representative poly(A) modifications. FIG. 9A shows the expression of PE in the whole liver was assessed using Cas9-Cas9 ELISA at various time points following the i.v administration of 1.5 mpk of control mRNAOOl and mRNA containing Seq-1 to mice. FIG. 9B shows a comparison of PE expression between control mRNAOOl and mRNA containing Seq-1. The relative abundance of PE was normalized to the expression level of control mRNAOOl at 3 h timepoint.

[0221] In Vivo Protein Expression Protocol

[0222] Animal, Treatments

[0223] All in vivo procedures were performed in accordance with the Institutional Animal Care and Use Committee approved protocols. After receipt at the animal facility , all animals were acclimated for at least one week prior to study initiation. Briefly, 6-10 week-old female mice were intravenously injected at 10 mL / kg body weight in the lateral tail vein with LNP-encapsulated mRNA at a 1: 1 ratio of Cas9-RT fusion (“Prime Editor") mRNA to pegRNA. A dose of 1.5 mg / kg was used in the study. 7 days after test article administration, mice were euthanized by CO2, whole livers were collected and flash frozen.

[0224] Prime Editor Protein Expression

[0225] A sandwich enzyme-linked immunosorbent assay (ELISA) was used to quantify the concentration of Prime Editor protein (PE Protein) in homogenized liver samples from in-vivo studies using the Fast Scan Cas9 ELISA kit (Cell Signaling Technologies). Briefly, pulverized liver tissue was lysed in cell extraction buffer and loaded onto microtiter plates coated with a Cas9 antibody. A Cas9 capture antibody and HRP-linked antibody cocktail was then added to the wells and incubated for 1 hour at room temperature. Plates were washed and incubated with TMB substrate for 15 min followed by addition of a stop solution. Spectrophotometric measurements were used to quantify Cas9 protein expression.

[0226] FIG. 10 shows in vitro protein expression of modified poly(A) ligated mRNAs and control mRNAs. Each mRNA was mixed with HEK3 guide RNA at 1: 1 mass ratio. 96 ng total RNA of each combination was dosed to one well using Messenger Max. Protein expression at 6 and 24 h was quantified by FastScan Cas9 ELISA kit. Modified mRNAs shown contain sequence numbers corresponding to the modified poly(A) sequences in Table 1. Several mRNAs containing modified poly(A) sequences show enhanced protein expression at 6 h and 24 h compared with either control mRNAOOl or mRNA137.

[0227] FIG. 11 shows PE retention of modified poly(A) ligated mRNAs. PE retention was calculated as the ratio of cellular PE expression at 24 h to 6 h. mRNAs containing modified sequence corresponding to the modified poly(A) sequences shown in Table 1 . The results suggest several mRNAs containing modified poly(A) show comparable PE retention compared with control mRNA137 and mRNA containing Seq-16 is far better than either control.

[0228] FIG. 12 shows in vitro Prime Editing of mRNAs containing modified poly(A) sequences at 72 h after transfection. Each mRNA was mixed with HEK3 guide RNA at 1 : 1 mass ratio and dosed to HEK293T cells using Messenger Max. Next generation sequencing was used to quantify desired edits. mRNAs containing modified sequences corresponding to the modified poly(A) sequences shown in Table 1. Several modifications resulted in comparable editing as that of the control mRNA without chemical modifications.

[0229] FIG. 13 shows in vitro protein expression of modified poly (A) ligated mRNAs. Each mRNA was mixed with HEK3 guide RNA at 1 : 1 mass ratio. 96 ng total RNA of each combination was dosed to one well using Messenger Max. Protein expression at 2. 6, 24, and 48 h was quantified by FastScan Cas9 ELISA kit. Modified mRNAs shown contain sequence numbers corresponding to the modified poly (A) sequences shown in Table 1.

[0230] FIG. 14 shows PE retention of modified poly(A) ligated mRNAs. Data show n in FIG. 13 are used for calculating protein expression retention ratio at 24 h to 6 h. PE retention was calculated as the ratio of cellular PE expression at 24 h to 6 h. Modified mRNAs shown contain sequence numbers corresponding to the modified poly(A) sequences shown in Table 1.

[0231] FIG. 15 shows in vitro protein expression of mRNAs containing modified poly(A) sequences. Each mRNA was mixed with HEK3 guide RNA at 1 : 1 mass ratio. 96 ng total RNA of each combination was dosed to one well using Messenger Max. Protein expression at 2, 6, 24, and 48h was quantified by FastScan Cas9 ELISA kit. mRNAs shown contain modified poly (A) sequence numbers corresponding to the sequences shown in Table 1.

[0232] FIG. 16 shows PE retention of modified poly(A) ligated mRNAs. PE retenttion was calculated as the ratio of cellular PE expression at 24 h to 6 h. Modified mRNAs shown contain sequence numbers corresponding to the modified poly(A) sequences shown in Table 1.

[0233] FIG. 17 shows in vitro Prime Editing of mRNAs containing poly(A) modifications at 72 h after transfection. Each mRNA was mixed with HEK3 guide RNA at1 : 1 mass ratio and dosed to HEK293T cells using Messenger Max. Next generation sequencing was used to quantify desired edits. Modified mRNAs shown contain sequence numbers corresponding to the modified poly(A) sequences shown in Table 1 . Several mRNAs with modified poly(A) tails showed comparable / better editing than the control mRNAs in vitro.OTHER EMBODIMENTS

[0234] The above examples are to be understood as illustrative examples. Further examples are envisaged, which include combinations of features as indicated in the following table, which lists various envisaged claim dependencies for the claims originally filed with this application. Hence, in addition to the description above, this table provides basis for examples having a combination of features of claims filed herewith. Hence, the following table also discloses embodiments of the invention.

[0235] Embodiment 1. A modified mRNA comprising:(i) a 5’ cap region, a 5’ untranslated region (5 ’UTR), an open reading frame encoding a protein, and a 3’ untranslated region (3’ UTR); and(ii) a poly(A) tail sequence located 3’ to the 3’ UTR, wherein the poly (A) tail sequence comprises at least 15 nucleotides and wherein the poly(A) tail sequence comprises at least one modification, wherein the at least one modification is a nucleotide modification, a non-nucleotide modification, or a combination thereof.

[0236] Embodiment 2. A modified mRNA comprising:(i) a 5’ cap region, a 5’ untranslated region (5 ’UTR), an open reading frame encoding a prime editor, and a 3’ untranslated region (3’ UTR); and(ii) a poly(A) tail sequence located 3’ to the 3’ UTR, wherein the poly(A) tail sequence comprises at least 15 nucleotides and wherein the poly(A) tail sequence comprises at least one modification, wherein the at least one modification is a nucleotide modification, a non-nucleotide modification, or a combination thereof.

[0237] Embodiment 3. The modified mRNA of embodiment 1 or 2, wherein the poly (A) tail sequence comprises about 15 nucleotides to about 180 nucleotides.

[0238] Embodiment 4. The modified mRNA of any one of embodiments 1-3, wherein the poly (A) tail sequence comprises about 5 to about 180 unmodified adenosine nucleotides.

[0239] Embodiment 5. The modified mRNA of any one of embodiments 1-3, wherein the poly (A) tail sequence comprises about 5 to about 180 modified adenosine nucleotides.

[0240] Embodiment 6. The modified mRNA of any one of embodiments 1-3, wherein the poly(A) tail sequence comprises from 1 to about 25 modifications.

[0241] Embodiment 7. The modified mRNA of any one of embodiments 1-6, wherein the at least one modification is a nucleotide modification.

[0242] Embodiment 8. The modified mRNA of embodiment 7, wherein the nucleotide modification comprises a phosphate modification, a base modification, a sugar modification, or a combination thereof.

[0243] Embodiment 9. The modified mRNA of any one of embodiments 1-6, wherein the at least one modification is a non-nucleotide modification.

[0244] Embodiment 10. The modified mRNA of any one of embodiments 1-9, wherein the at least one modification is a nucleotide modification, wherein the nucleotide modification comprises the same nucleotide modification.

[0245] Embodiment 11. The modified mRNA of any one of embodiments 1-9, wherein the at least one modification is a nucleotide modification, wherein the nucleotide modification comprises different nucleotide modifications.

[0246] Embodiment 12. The modified mRNA of any one of embodiments 1-9, wherein the at least one modification is a non-nucleotide modification, wherein the non- nucleotide modification comprises the same non-nucleotide modification.

[0247] Embodiment 13. The modified mRNA of any one of embodiments 1-9, wherein the at least one modification is a non-nucleotide modification, wherein the non- nucleotide modification comprises different non-nucleotide modifications.

[0248] Embodiment 14. The modified mRNA of any one of embodiments 1-9, wherein the at least one modification is a combination of nucleotide and non-nucleotide modifications.

[0249] Embodiment 15. The modified mRNA of embodiment 7 or 8, wherein the nucleotide modification comprises a base modification.

[0250] Embodiment 16. The modified mRNA of embodiment 15, wherein the base modification comprises N6-methyladenosine (m6A), N6-methyl-2’-O-methyladenosine (2'0Me-mfiA). xanthine, allyaminouracil, allyaminothymidine, hypoxanthine, digoxigenmated adenine, digoxigeninated cytosine, digoxigenmated guanine, digoxigeninated uracil, 6- chloropurineriboside, N6-methyladenine, methylpseudouracil, 2-thiocytosine, 2-thiouracil, 5- methyluracil. 4-thiothymidine. 4-thiouracil, 5,6-dihydro-5- methyluracil. 5,6-dihydrouracil, 5-[(3- Indolyl)propionamide-N-allyl]uracil, 5- aminoallylcytosine, 5-aminoallyluracil, 5-bromouracil, 5- bromocytosine, 5 -carboxy cytosine, 5-carboxymethylesteruracil, 5-carboxyuracil, 5-fluorouracil, 5- formylcytosine, 5- formyluracil, 5-hydroxycytosine, 5-hydroxymethylcytosine, 5- hydroxymethyluracil. 5- hy dr oxy uracil, 5 -iodocytosine, 5-iodouracil. 5-methoxy cytosine, 5- methoxyuracil. 5- methylcytosine, 5-methyluraciL 5-propargylaminocytosine, 5- propargylaminouracil, 5- propynyl cytosine, 5-propynyluracil, 6-azacytosine, 6-azauracil, 6- chloropurine, 6- thioguanine, 7-deazaadenine, 7-deazaguanine, 7-deaza-7-propargylaminoadenine, 7- deaza-7- propargylaminoguamne, 8-azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8- oxoguanine, araadenine. aracytosine, araguanine, arauracil. biotin- 16-7-deaza-7- propargylaminoguanine, biotin- 16-aminoallylcytosine, biotin- 16-aminoallyluracil, cyanine 3-5- propargylaminocytosine, cyanine 3-6-propargylaminouracil, cyanine 3- aminoallylcytosine, cyanine 3 -aminoallyluracil, cyanine 5-6-propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5 -aminoallylcytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallyluracil, dabcyl-5-3 - aminoallyluracil, desthiobiotin- 16-aminoallyluracil, desthiobiotin-6-aminoallylcytosine, isoguanine, N1-ethylpseudouracil, N1- methoxymethylpseudouracil, N1-methyl adenine, N'-methylpseudouracil. N1- propylpseudouracil, N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine. N6- methyl adenine, O6-methylguanme, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thienouracil, xanthosine, 3 -deazaadenine, 2,6-diaminoadenine, 2,6- daminoguanine, 5 -carboxamide- uracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2- methyl-thio- N6-isopentenyladenine (ms2i6A), 2-methylthio- N6-methyladenine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenine (io6A). 2-methylthio- N6-(cis- hydroxyisopentenyl)adenine (ms2io6A), N6-glycinyl carbamoyl adenine (g6A), N6- threonylcarbamoyladenine (t6A), 2-methylthio- N6-threonyl carbamoyladenine (ms2t6A), N6- methyl- N6-threonylcarbamoyladenine (m6t6A), N6-hy droxynorvalylcarbamoyladenine (hn6A). 2- methylthio- N6-hydroxynorvalyl carbamoyladenine (ms2hn6A), N6, N6- dimethyladenine (m62A), and N6-acetyladenine (ac6A), or a combination thereof.

[0251] Embodiment 17. The modified mRNA of embodiment 7 or 8, wherein the nucleotide modification comprises a sugar modification.

[0252] Embodiment 18. The modified mRNA of embodiment 17, wherein the sugar modification comprises6 -phosphate-A 2?-thioribose, 2’, 3 ‘-dideoxyribose. 2?-amino-2?- deoxyribose, 2’ deoxyribose, 2’-azido-2’- deoxyribose, 2’-fluoro-2:-deoxyribose, 2’-O- methylribose, 2’-O-methyldeoxyribose, 3’-amino-2’,3’- dideoxyribose, 3 ‘-azido-2’, 3 ‘- dideoxyribose, 3 ‘-deoxyribose, 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3’- O-methylribose, 5 ‘-aminoribose, 5’ -thioribose. 5-nitro-l-indolyl-2’-deoxyribose, 5'-biotin-ribose, 2’- O,4’-C- methylene-linked, 2’-O,4’-C-amino-linked ribose, 2’-O,4?-C-thio-linked riboseor a combination thereof.

[0253] Embodiment 19. The modified mRNA of embodiment 7 or 8, wherein the nucleotide modification comprises a phosphate modification.

[0254] Embodiment 20. The modified mRNA of embodiment 19, wherein the phosphate modification comprises phosphorothioate, a stereospecific phosphorothioate, a 6’- phosphate, phosphorodithioate, thiophosphate, 5’-O-methylphosphonate, 3 -O-methylphosphonate, 5'-hydroxyphosphonate, hydroxyphosphanate. phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenyl phosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, guanidinopropyl phosphoramidate, or a combination thereof.

[0255] Embodiment 21. The modified mRNA of embodiment 9. wherein the non-nucleotide modification comprises a hairpin, a C2-C6 linker, an ethylene glycol linker, 2’ -5’ linkages, an abasic deoxyribonucleotide, an abasic ribonucleotide, an abasic 2’- substituted ribonucleotide, or a combination thereof.

[0256] Embodiment 22. The modified mRNA of embodiment 9. wherein the non-nucleotide modification comprises an inverted nucleotide located in the 3 ’terminal nucleotide of the poly(A) tail sequence.

[0257] Embodiment 23. The modified mRNA of embodiment 22, wherein the inverted nucleotide comprises

[0258] Embodiment 24. The modified mRNA of any one of embodiments 1-23, wherein the poly (A) tail sequence further comprises a deoxyribose sugar at the 3’ end.

[0259] Embodiment 25. The modified mRNA of any one of embodiments 2-24. wherein the prime editor comprises a Cas protein and a DNA polymerase.

[0260] Embodiment 26. A modified nucleic acid sequence comprising, 5’ to 3’, a phosphate group, about 5 to about 120 unmodified adenosine nucleotides, and 1 to about 25 modifications, wherein the modifications are a nucleotide modification, a non-nucleotide modification, or a combination thereof, and wherein the total length of the modified nucleic acid sequence is about 15 nucleotides to about 180 nucleotides.

[0261] Embodiment 27. The modified nucleic acid sequence of embodiment 26, wherein the modified nucleic acid sequence further comprises a deoxyribose sugar at the 3’ end.

[0262] Embodiment 28. The modified nucleic acid sequence of embodiment 26, wherein the modifications are nucleotide modifications.

[0263] Embodiment 29. The modified nucleic acid sequence of embodiment 27, wherein the nucleotide modifications comprise a phosphate modification, a base modification, a sugar modification, or a combination thereof.

[0264] Embodiment 30. The modified nucleic acid sequence of embodiment 28, wherein the nucleotide modifications are the same.

[0265] Embodiment 31. The modified nucleic acid sequence of embodiment 28, wherein the nucleotide modifications are different.

[0266] Embodiment 32. The modified nucleic acid sequence of embodiment 26, wherein the modifications are non-nucleotide modifications.

[0267] Embodiment 33. The modified nucleic acid sequence of embodiment 32, wherein the non-nucleotide modifications are the same.

[0268] Embodiment 34. The modified nucleic acid sequence of embodiment 32, wherein the non-nucleotide modifications are different.

[0269] Embodiment 35. The modified nucleic acid sequence of embodiment 26, wherein the modifications are a combination of nucleotide and non-nucleotide modifications.

[0270] Embodiment 36. The modified nucleic acid sequence of embodiment 28 or 29, wherein the nucleotide modifications comprise a base modification.

[0271] Embodiment 37. The modified nucleic acid sequence of embodiment 36, wherein the base modification comprises N6-methyladenosine (tn6A), N6-methyl-2’-O- methyladenosine (2’0Me-m6A), xanthine, allyaminouracil, ally aminothymidine, hypoxanthine, digoxigeninated adenine, digoxigeninated cytosine, digoxigeninated guanine, digoxigeninated uracil, 6- chloropurineriboside. N6-methyladenine, methylpseudouracil. 2- thiocytosine, 2-thiouracil, 5- methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5- methyluracil, 5,6-dihydrouracil, 5-[(3- Indolyl)propionamide-N-allyl]uracil, 5- aminoallylcytosine, 5-aminoallyluracil, 5 -bromouracil, 5- bromocytosine, 5-carboxy cytosine, 5-carboxymethylesteruracil, 5-carboxyuracil, 5-fluorouracil, 5- formylcytosine, 5- formyluracil, 5-hydroxy cytosine, 5-hydroxymethylcytosine, 5- hydroxymethyluracil, 5- hydroxyuracil, 5 -iodocytosine, 5-iodouracil, 5-methoxycytosine, 5- methoxyuracil, 5- methylcytosine, 5-methyluracil, 5-propargylaminocytosine, 5- propargylaminouracil. 5- propynylcytosine, 5-propynyluracil, 6-azacytosine, 6-azauracil, 6- chloropurine, 6- thioguanine, 7-deazaadenine, 7 -deazaguanine. 7-deaza-7-propargylaminoadenine, 7- deaza-7- propargylaminoguamne, 8-azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine, aracytosine, araguanine, arauracil, biotin- 16-7-deaza-7- propargylaminoguanine. biotin- 16-aminoallylcytosine. biotin- 16-aminoallyluracil, cyanine 3-5- propargylaminocytosine, cyanine 3-6-propargylaminouracil, cyanine 3- aminoallylcytosine, cyanine 3 -aminoallyluracil, cyanine 5-6-propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5 -aminoallylcytosine, cyanine 5 -aminoallyluracil, cyanine 7-aminoallyluracil, dabcyl-5-3 - aminoallyluracil, desthiobiotin- 16-aminoallyluracil, desthiobi otin-6-aminoallylcytosine, isoguanine, N1-ethylpseudouracil, N1- methoxymethylpseudouracil, N1-methyl adenine, N'-methylpseudouracil. N1- propylpseudouracil, N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6- methyladenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine. thienouracil, xanthosine. 3 -deazaadenine, 2.6-diaminoadenine, 2,6- daminoguanine, 5 -carboxamide- uracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2- methyl-thio- N6-isopentenyladenine (ms2i6A), 2-methylthio- N6-methyladenine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenine (io6A). 2-methylthio- N6-(cis- hydroxyisopentenyl)adenine (ms2io6A). N6-glycinylcarbamoyladenine (g6A), N6- threonylcarbamoyladenine (t6A), 2-methylthio- N6-threonyl carbamoyladenine (ms2t6A), N6- methyl- N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2- methylthio- N6-hydroxynorvalyl carbamoyladenine (ms2hn6A), N6, N6- dimethyladenine (m62A), and N6-acetyladenine (ac6A), or a combination thereof.

[0272] Embodiment 38. The modified nucleic acid sequence of embodiment 28 or 29, wherein the nucleotide modifications comprise a sugar modification.

[0273] Embodiment 39. The modified nucleic acid sequence of embodiment 38, wherein the sugar modification comprises6 -phosphate-A 2’-thioribose, 2’. 3 ‘-di deoxy ribose, 2’-amino-2’- deoxyribose, 2’ deoxyribose, 2’-azido-2’- deoxyribose, 2’-fluoro-2’-deoxyribose, 2’-O- methylribose, 2’-O-methyldeoxyribose, 3’-amino-2’,3’- dideoxyribose, 3 ‘-azido-2’, 3 dideoxyribose, 3 ‘-deoxyribose, 3’-O-(2-nitrobenzyl)-2’-deoxyribose, 3’- O-methylribose, 5 ‘-aminoribose, 5’-thioribose, 5-nitro-l-indolyl-2’-deoxyribose, 5’-biotin-ribose, 2’- O,4’-C- methylene-linked, 2‘-O,4’-C-amino-linked ribose, 2’-O,4’-C-thio-linked riboseor a combination thereof.

[0274] Embodiment 40. The modified nucleic acid sequence of any one of embodiment 28 or 29, wherein the nucleotide modifications comprise a phosphate modification.

[0275] Embodiment 41. The modified nucleic acid sequence of embodiment 40, wherein the phosphate modification comprises phosphorothioate, a stereospecific phosphorothioate, a 6’ -phosphate, phosphorodithioate, thiophosphate, 5’-O- methylphosphonate, 3‘-O-methylphosphonate, 5 ’-hydroxyphosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, guanidinopropyl phosphoramidate, or a combination thereofor a combination thereof.

[0276] Embodiment 42. The modified nucleic acid sequence of embodiment 32, wherein the non-nucleotide modifications comprise a hairpin, a C2-C6 linker, an ethylene glycol linker, 2’-5’ linkages, an abasic deoxyribonucleotide, an abasic ribonucleotide, an abasic 2 ’-substituted ribonucleotide, or a combination thereof.

[0277] Embodiment 43. The modified nucleic acid sequence of embodiment 32, wherein the non-nucleotide modifications comprise an inverted nucleotide located in the 3 ’terminal nucleotide of the poly (A) tail sequence.

[0278] Embodiment 44. The modified nucleic acid sequence of embodiment 43, wherein the inverted nucleotide comprises

[0279] Embodiment 45. A modified nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-13 and 15-48.

[0280] Embodiment 46. A method for producing a modified mRNA, the method comprising ligating at least an open reading frame encoding a protein with the modified nucleic acid sequence of any one of embodiments 26-45.

[0281] Embodiment 47. A method for producing a modified mRNA, the method comprising ligating at least an open reading frame encoding a prime editor with the modified nucleic acid sequence of any one of embodiments 26-45.

[0282] Embodiment 48. The method of embodiment 47, wherein the ligation comprises a self-templated enzymatic ligation.

[0283] Embodiment 49. The method of embodiment 48, wherein the ligation comprises a templated enzymatic ligation.

[0284] Embodiment 50. The method of embodiment 48 or 49, wherein the enzymatic ligation is catalyzed by a nucleic acid ligase to generate a natural phosphodiester linkage between the open reading frame encoding a protein and the modified nucleic acid sequence of any one of embodiments 26-45. or between the open reading frame encoding a prime editor with the modified nucleic acid sequence of any one of embodiments 26-45.

[0285] Embodiment 51. The method of embodiment 50, wherein the nucleic acid ligase is T4 RNA Ligase I, T4 RNA Ligase II, or T4 DNA Ligase.

[0286] Embodiment 52. A prime editing system comprising (a) a prime editing guide RNA (PEgRNA) or one or more polynucleotides encoding the PEgRNA; and (b) the modified mRNA of any one of embodiments 1-25 or the modified mRNA produced by the method of any one of embodiments 47-51.

[0287] Embodiment 53. A lipid nanoparticle comprising the prime editing system of embodiment 52.

[0288] Embodiment 54. A method for editing a gene, the method comprising contacting the gene with the prime editing system of embodiment 50 or the lipid nanoparticle of embodiment 53.

[0289] Embodiment 55. A modified mRNA comprising:(i) at least an open reading frame encoding a protein; and(ii) a poly(A) tail sequence located downstream of the open reading frame encoding the protein, wherein the poly (A) tail sequence comprises at least 15 nucleotides and wherein the poly(A) tail sequence comprises at least one modification, wherein the at least one modification is a nucleotide modification, a nonnucleotide modification, or a combination thereof.

[0290] Embodiment 56. A modified mRNA comprising:(i) at least an open reading frame encoding a prime editor; and(ii) a poly(A) tail sequence located downstream of the open reading frame encoding the prime editor, wherein the poly (A) tail sequence comprises at least 15 nucleotides and wherein the poly(A) tail sequence comprises at least one modification, wherein the at least one modification is a nucleotide modification, a nonnucleotide modification, or a combination thereof.

[0291] Embodiment 57. The modified mRNA of embodiment 55 or 56, wherein the poly(A) tail sequence is as defined in any one of embodiments 3-6.

[0292] Embodiment 58. The modified mRNA of embodiment 55 or 56, wherein the at least one modification is as defined in any one of embodiments 7-23.

[0293] Embodiment 59. The modified mRNA of any one of embodiments 55-58, wherein the poly (A) tail sequence further comprises a deoxyribose sugar at the 3’ end.

[0294] Embodiment 60. The modified mRNA of embodiment 56, wherein the prime editor comprises a Cas protein and a DNA polymerase.

[0295] Embodiment 61. The modified mRNA of any one of embodiments 55-60, wherein the modified mRNA further comprises a 5’ untranslated region (5‘ UTR) and a 3’ untranslated region (3‘ UTR), wherein the open reading frame is between the 5’ UTR and the 3‘ UTR, wherein the 3‘ UTR is between the open reading frame and the poly (A) tail.

[0296] Embodiment 62. The modified mRNA of any one of embodiments 55-60, wherein the modified mRNA further comprises a 5 ’ cap region.

[0297] It is to be understood that while the disclosure has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the disclosure, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

WHAT IS CLAIMED IS:

1. A modified mRNA comprising:(i) a 5' cap region, a 5’ untranslated region (5’UTR), an open reading frame encoding a protein, and a 3’ untranslated region (3’ UTR); and(ii) a poly(A) tail sequence located 3’ to the 3’ UTR, wherein the poly(A) tail sequence comprises at least 15 nucleotides and wherein the poly(A) tail sequence comprises at least one modification, wherein the at least one modification is a nucleotide modification, a nonnucleotide modification, or a combination thereof.

2. A modified mRNA comprising:(i) a 5‘ cap region, a 5’ untranslated region (5’UTR), an open reading frame encoding a prime editor, and a 3’ untranslated region (3’ UTR); and(ii) a poly(A) tail sequence located 3’ to the 3’ UTR, wherein the poly (A) tail sequence comprises at least 15 nucleotides and wherein the poly(A) tail sequence comprises at least one modification, wherein the at least one modification is a nucleotide modification, a nonnucleotide modification, or a combination thereof.

3. The modified mRNA of claim 1 or 2, wherein the poly (A) tail sequence comprises about 15 nucleotides to about 180 nucleotides.

4. The modified mRNA of any one of claims 1-3, wherein the poly(A) tail sequence comprises about 5 to about 180 unmodified adenosine nucleotides.

5. The modified mRNA of any one of claims 1-3, wherein the poly(A) tail sequence comprises about 5 to about 180 modified adenosine nucleotides.

6. The modified mRNA of any one of claims 1-3, wherein the poly (A) tail sequence comprises from 1 to about 25 modifications.

7. The modified mRNA of any one of claims 1-6, wherein the at least one modification is a nucleotide modification.

8. The modified mRNA of claim 7. wherein the nucleotide modification comprises a phosphate modification, a base modification, a sugar modification, or a combination thereof.

9. The modified mRNA of any one of claims 1-6, wherein the at least one modification is a non-nucleotide modification.

10. The modified mRNA of any one of claims 1-9, wherein the at least one modification is a nucleotide modification, wherein the nucleotide modification comprises the same nucleotide modification.

11. The modified mRNA of any one of claims 1-9, wherein the at least one modification is a nucleotide modification, wherein the nucleotide modification comprises different nucleotide modifications.

12. The modified mRNA of any one of claims 1-9, wherein the at least one modification is a non-nucleotide modification, wherein the non-nucleotide modification comprises the same non-nucleotide modification.

13. The modified mRNA of any one of claims 1-9, wherein the at least one modification is a non-nucleotide modification, wherein the non-nucleotide modification comprises different non-nucleotide modifications.

14. The modified mRNA of any one of claims 1-9, wherein the at least one modification is a combination of nucleotide and non-nucleotide modifications.

15. The modified mRNA of claim 7 or 8, wherein the nucleotide modification comprises a base modification.

16. The modified mRNA of claim 15, wherein the base modification comprises N6- methyladenosine (m6A), N6-methyl-2'-O-methyladenosine (2’0Me-m6A), xanthine, allyaminouracil, allyaminothymidine, hypoxanthine, digoxigeninated adenine, digoxigeninated cytosine, digoxigeninated guanine, digoxigeninated uracil, 6- chloropurineriboside, N6-methyladenine, methylpseudouracil, 2-thiocytosine, 2-thiouracil, 5- methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6-dihydrouracil, 5- [(3- Indolyl)propionamide-N-allyl] uracil, 5-aminoallylcytosine. 5-aminoallyluracil, 5- bromouracil. 5- bromocytosine, 5-carboxycytosine, 5-carboxymethylesteruracil, 5-carboxyuracil, 5 -fluorouracil, 5- formylcytosine, 5-formyluracil, 5-hydroxycytosine, 5- hydroxymethylcytosine, 5- hydroxymethyluracil, 5-hydroxyuracil, 5 -iodocytosine. 5- iodouracil, 5-methoxy cytosine, 5- methoxyuracil, 5 -methyl cytosine, 5-methyluracil, 5- propargylaminocytosine, 5- propargylaminouracil. 5-propynylcytosine, 5-propynyluracil, 6- azacytosine, 6-azauracil, 6- chloropurine, 6-thioguanine, 7-deazaadenine, 7-deazaguanine, 7- deaza-7-propargylaminoadenine, 7- deaza-7-propargylaminoguamne. 8-azaadenine, 8- azidoadenine, 8-chloroadenine, 8-oxoadenine, 8- oxoguanine, araadenine, aracytosine, araguanine, arauracil, biotin- 16-7-deaza-7- propargylaminoguanine, biotin- 16- aminoallylcytosine, biotin- 16-aminoallyluracil, cyanine 3-5- propargylaminocytosine, cyanine 3-6-propargylaminouracil, cyanine 3-aminoallylcytosine, cyanine 3-aminoallyluracil, cyanine 5-6-propargylaminocytosine, cyanine 5-6-propargylaminouracil. cyanine 5- aminoallylcytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallyluracil, dabcyl-5-3 - aminoallyluracil, desthiobiotin- 16-aminoallyl-uracil, desthiobiotin-6-aminoallylcy tosine, isoguanine, N1-ethylpseudouracil. N'-methoxymethylpseudouracil, N1-methyl adenine, N1- methylpseudouracil, N1-propyl pseudouraci I. N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6- methyladenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thienouracil, xanthosine, 3-deazaadenine, 2,6-diaminoadenine, 2,6-daminoguanine, 5 -carboxamide- uracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2- methyl-thio- N6-isopentenyladenine (ms2i6A), 2-methylthio- N6-methyladenine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio- N6-(cis- hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyladenine (g6A), N6- threonylcarbamoyladenine (t6A), 2-methylthio- N6-threonyl carbamoyladenine (ms2t6A), N6- methyl- N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A). 2- methylthio- N6-hydroxynorvalyl carbamoyladenine (ms2hn6A), N6, N6- dimethyl adenine (m62A), and N6-acetyl adenine (ac6A), or a combination thereof.

17. The modified mRNA of claim 7 or 8, wherein the nucleotide modification comprises a sugar modification.

18. The modified mRNA of claim 17, wherein the sugar modification comprises6-phosphate-A 2’-thioribose, 2’. 3 ‘-dideoxyribose. 2’-amino-2’- deoxyribose, 2’ deoxyribose, 2’-azido-2’- deoxyribose, 2’-fluoro-2’-deoxyribose, 2’-O- methylribose, 2’-O-methyldeoxyribose, 3’-amino-2’,3’- dideoxyribose, 3 ‘-azido-2’, 3 ‘- dideoxyribose, 3 ‘-deoxyribose, 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3’- O-methylribose, 5 ‘-aminoribose, 5 ’-thioribose. 5-nitro-l-indolyl-2’-deoxyribose, 5’-biotin-ribose, 2’- O,4’-C- methylene-linked, 2’-O,4’-C-amino-linked ribose, 2’-O,4’-C-thio-linked ribose, abasic nucleotides, abasic nucleosides, abasic 2’ substituted nucleotides, or a combination thereof.

19. The modified mRNA of claim 7 or 8, wherein the nucleotide modification comprises a phosphate modification.

20. The modified mRNA of claim 19, wherein the phosphate modification comprises phosphorothioate, a stereospecific phosphorothioate, a 6’ -phosphate, phosphorodithioate, thiophosphate, 5’-O-methylphosphonate, 3’-O-methylphosphonate, 5’-hydroxyphosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate. H- phosphonate. guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, guanidinopropyl phosphoramidate, or a combination thereof.

21. The modified mRNA of claim 9, wherein the non-nucleotide modification comprises a hairpin, a C2-C6 linker, an ethylene glycol linker, 2'-5’ linkages, or a combination thereof.

22. The modified mRNA of claim 9. wherein the non-nucleotide modification comprises an inverted nucleotide located in the 3 Terminal nucleotide of the poly(A) tail sequence.

23. The modified mRNA of claim 22, wherein the inverted nucleotide comprises24. The modified mRNA of any one of claims 1-23, wherein the poly(A) tail sequence further comprises a deoxyribose sugar at the 3?end.

25. The modified mRNA of any one of claims 2-24, wherein the prime editor comprises a Cas protein and a DNA polymerase.

26. A modified nucleic acid sequence comprising. 5’ to 3’, a phosphate group, about 5 to about 120 unmodified adenosine nucleotides, and 1 to about 25 modifications, wherein the modifications are a nucleotide modification, a non-nucleotide modification, or a combination thereof, and wherein the total length of the modified nucleic acid sequence is about 15 nucleotides to about 180 nucleotides.

27. The modified nucleic acid sequence of claim 26, wherein the modified nucleic acid sequence further comprises a deoxyribose sugar at the 3’ end.

28. The modified nucleic acid sequence of claim 26, wherein the modifications are nucleotide modifications.

29. The modified nucleic acid sequence of claim 27, wherein the nucleotide modifications comprise a phosphate modification, a base modification, a sugar modification, or a combination thereof.

30. The modified nucleic acid sequence of claim 28, wherein the nucleotide modifications are the same.

31. The modified nucleic acid sequence of claim 28, wherein the nucleotide modifications are different.

32. The modified nucleic acid sequence of claim 26, wherein the modifications are nonnucleotide modifications.

33. The modified nucleic acid sequence of claim 32, wherein the non-nucleotide modifications are the same.

34. The modified nucleic acid sequence of claim 32, wherein the non-nucleotide modifications are different.

35. The modified nucleic acid sequence of claim 26, wherein the modifications are a combination of nucleotide and non-nucleotide modifications.

36. The modified nucleic acid sequence of claim 28 or 29, wherein the nucleotide modifications comprise a base modification.

37. The modified nucleic acid sequence of claim 36, wherein the base modification comprises N6-methyladenosine (m6A), N6-methyl-2’-O-methyladenosine (2’0Me-m6A), xanthine, allyaminouracil, allyaminothymidine, hypoxanthine, digoxigeninated adenine, digoxigenmated cytosine, digoxigeninated guanine, digoxigeninated uracil. 6- chloropurineriboside, N6-methyladenine, methylpseudouracil, 2-thiocytosine, 2-thiouracil, 5-methyluracil. 4-thiothymidine. 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6-dihydrouracil. 5- [(3- Indolyl)propionamide-N-allyl]uracil, 5-aminoallylcytosine. 5-aminoallyluracil, 5- bromouracil, 5- bromocytosine, 5-carboxycytosine, 5-carboxymethylesteruracil, 5- carboxyuracil, 5 -fluorouracil, 5- formylcytosine, 5-formyluracil, 5-hydroxycytosine, 5- hydroxymethylcytosine, 5- hydroxymethyluracil, 5-hydroxyuracil, 5 -iodocytosine, 5- iodouracil, 5-methoxy cytosine, 5- methoxyuracil, 5 -methylcytosine, 5 -methyluracil, 5- propargylaminocytosine, 5- propargylaminouracil, 5-propynylcytosine, 5-propynyluracil, 6- azacytosine, 6-azauracil, 6- chloropurine, 6-thioguanine, 7-deazaadenine, 7-deazaguanine, 7- deaza-7-propargylaminoadenine, 7- deaza-7-propargylaminoguamne, 8-azaadenine, 8- azidoadenine, 8-chloroadenine, 8-oxoadenine. 8- oxoguanine, araadenine, aracytosine, araguamne, arauracil, biotin- 16-7-deaza-7- propargylaminoguanine, biotin- 16- aminoallylcytosine, biotin- 16-aminoallyluracil, cyanine 3-5- propargylaminocytosine, cyanine 3-6-propargylaminouracil, cyanine 3 -aminoallylcytosine, cyanine 3-aminoallyluracil, cyanine 5-6-propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5- aminoallylcytosine, cyanine 5-aminoallyluracil. cyanine 7-aminoallyluracil, dabcyl-5-3 - aminoallyluracil, desthiobiotin- 16-aminoallyl-uracil, desthiobiotin-6-aminoallylcytosine, isoguanine, N1-ethylpseudouracil, N'-methoxymethylpseudouracil. N1-methyl adenine, N1- methylpseudouracil, N'-propylpseudouracil. N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6- methyladenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thi enouracil, xanthosine, 3-deazaadenine, 2,6-diaminoadenine, 2,6-daminoguanine, 5 -carboxamide- uracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2- methyl-thio- N6-isopentenyladenine (ms2i6A), 2-methylthio- N6-methyladenine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenine (io6A). 2-methylthio- N6-(cis- hydroxyisopentenyl)adenine (ms2io6A). N6-glycinylcarbamoyladenine (g6A), N6- threonylcarbamoyladenine (t6A), 2-methylthio- N6-threonyl carbamoyl adenine (ms2t6A), N6- methyl- N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2- methylthio- N6-hydroxynorvalyl carbamoyladenine (ms2hn6A), N6, N6- dimethyladenine (m62A), and N6-acetyladenine (ac6A), or a combination thereof.

38. The modified nucleic acid sequence of claim 28 or 29, wherein the nucleotide modifications comprise a sugar modification.

39. The modified nucleic acid sequence of claim 38, wherein the sugar modification comprises6-phosphate-A > 2’-thioribose, 2', 3 ‘-di deoxy ribose, 2’ -amino-2’- deoxyribose. 2’ deoxyribose, 2’-azido-2’- deoxyribose, 2’-fluoro-2’-deoxyribose, 2’-O- methylribose, 2’-O-methyldeoxyribose, 3’-amino-2’,3’- dideoxyribose, 3 ‘-azido-2’, 3 ‘- dideoxyribose, 3 ‘-deoxyribose, 3’-O-(2-nitrobenzyl)-2‘-deoxyribose, 3’- O-methylribose, 5 ‘-aminoribose, 5 ’-thioribose. 5-nitro-l-indolyl-2’-deoxyribose, 5’-biotin-ribose, 2’- O,4’-C- methylene-linked, 2’-O,4’-C-amino-linked ribose, 2’-O,4’-C-thio-linked ribose, abasic nucleotides, abasic nucleosides, abasic 2’ substituted nucleotides, or a combination thereof.

40. The modified nucleic acid sequence of any one of claim 28 or 29, wherein the nucleotide modifications comprise a phosphate modification.

41. The modified nucleic acid sequence of claim 40, wherein the phosphate modification comprises phosphorothioate. a stereospecific phosphorothioate. a 6’-phosphate, phosphorodithioate, thiophosphate, 5’-O-methylphosphonate, 3’-O-methylphosphonate, 5’- hydroxyphosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, guanidinopropyl phosphoramidate, or a combination thereofor a combination thereof.

42. The modified nucleic acid sequence of claim 32, wherein the non-nucleotide modifications comprise a hairpin, a C2-C6 linker, an ethylene glycol linker. 2’-5’ linkages, or a combination thereof.

43. The modified nucleic acid sequence of claim 32, wherein the non-nucleotide modifications comprise an inverted nucleotide located in the 3 ’terminal nucleotide of the poly(A) tail sequence.

44. The modified nucleic acid sequence of claim 43, wherein the inverted nucleotide comprises45. A modified nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-13 and 15-48.

46. A method for producing a modified mRNA. the method comprising ligating at least an open reading frame encoding a protein with the modified nucleic acid sequence of any one of claims 26-45.

47. A method for producing a modified mRNA, the method comprising ligating at least an open reading frame encoding a prime editor with the modified nucleic acid sequence of any one of claims 26-45.

48. The method of claim 47. wherein the ligation comprises a self-templated enzymatic ligation.

49. The method of claim 48, wherein the ligation comprises a templated enzymatic ligation.

50. The method of claim 48 or 49, wherein the enzymatic ligation is catalyzed by a nucleic acid ligase to generate a natural phosphodiester linkage between the open reading frame encoding a protein and the modified nucleic acid sequence of any one of claims 26-45, or between the open reading frame encoding a prime editor with the modified nucleic acid sequence of any one of claims 26-45.51 . The method of claim 50, wherein the nucleic acid ligase is T4 RNA Ligase I, T4 RNA Ligase II, or T4 DNA Ligase.

52. A prime editing system comprising (a) a prime editing guide RNA (PEgRNA) or one or more polynucleotides encoding the PEgRNA; and (b) the modified mRNA of any one of claims 1-25 or the modified mRNA produced by the method of any one of claims 47-51.

53. A lipid nanoparticle comprising the prime editing system of claim 52.

54. A method for editing a gene, the method comprising contacting the gene with the prime editing system of claim 50 or the lipid nanoparticle of claim 53.

55. A modified mRNA comprising:(i) at least an open reading frame encoding a protein; and(ii) a poly(A) tail sequence located downstream of the open reading frame encoding the protein, wherein the poly(A) tail sequence comprises at least 15 nucleotides and wherein the poly(A) tail sequence comprises at least one modification, wherein the at least one modification is a nucleotide modification, a nonnucleotide modification, or a combination thereof.

56. A modified mRNA comprising:(i) at least an open reading frameencoding a prime editor; and(ii) a poly(A) tail sequence located downstream of the open reading frame encoding the prime editor, wherein the poly (A) tail sequence comprises at least 15 nucleotides and wherein the poly(A) tail sequence comprises at least one modification, wherein the at least one modification is a nucleotide modification, a nonnucleotide modification, or a combination thereof.

57. The modified mRNA of claim 55 or 56, wherein the poly(A) tail sequence is as defined in any one of claims 3-6.

58. The modified mRNA of claim 55 or 56, wherein the at least one modification is as defined in any one of claims 7-23.

59. The modified mRNA of any one of claims 55-58, wherein the poly(A) tail sequence further comprises a deoxyribose sugar at the 3?end.

60. The modified mRNA of claim 56, wherein the prime editor comprises a Cas protein and a DNA polymerase.

61. The modified mRNA of any one of claims 55-60, wherein the modified mRNA further comprises a 5’ untranslated region (5’ UTR) and a 3’ untranslated region (3’ UTR), wherein the open reading frame is between the 5’ UTR and the 3' UTR, wherein the 3' UTR is between the open reading frame and the poly(A) tail.

62. The modified mRNA of any one of claims 55-60, wherein the modified mRNA further comprises a 5’ cap region.

Citation Information

Patent Citations

  • Modified MRNA, modified non-coding RNA, and uses thereof

    WO2022241045A1

  • Poly-tailed and poly-capped mRNA and uses thereof

    WO2023141474A1

  • Polynucleotide and medicinal composition

    WO2023277168A1

Cited By

  • Polynucleotides, 3' chain terminating tails, ligation and uses thereof

    WO2025217126A1

  • RNA ligation methods and products

    WO2025217135A1