Use of zfp217 gene in preparing medicament for treating osteoporosis

By inhibiting the expression of Zfp217 gene and promoting the expression of Zfp521 gene, the problem of side effects of existing drugs for treating osteoporosis has been solved, and the effect of reducing bone marrow fat accumulation and promoting bone formation has been achieved, providing a new mechanism and target for the treatment of osteoporosis.

WO2025112188A1PCT designated stage expired Publication Date: 2025-06-05HUAZHONG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/074389
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-11-28
Filing Date
2024-01-29
Publication Date
2025-06-05

AI Technical Summary

Technical Problem

The existing drugs for treating osteoporosis have side effects, and the molecular mechanism of the transition from osteoblasts to adipocytes to differentiation of bone marrow mesenchymal stem cells is still unclear, and the treatment of osteoporosis remains challenging.

Method used

By inhibiting the expression of Zfp217 gene, promoting the expression of Zfp521 gene, thereby promoting the formation of osteoblasts and reducing the accumulation of bone marrow fat, providing a new mechanism and target for the treatment of osteoporosis.

Benefits of technology

Inhibition of Zfp217 gene expression can alleviate bone loss caused by estrogen deficiency or mechanical stress loss, providing new treatments for osteoporosis and reducing the risk of side effects of drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024074389_05062025_PF_FP_ABST
    Figure CN2024074389_05062025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to the field of biopharmaceutical technology, and in particular, to use of Zfp217 gene in preparing a medicament for treating osteoporosis. The present invention provides use of a reagent for inhibiting the expression of Zfp217 gene in preparing a medicament for treating osteoporosis. The reagent for inhibiting the expression of Zfp217 gene comprises an aptamer for inhibiting the expression of Zfp217 gene in a bone marrow mesenchymal stem cell. The present invention demonstrates by means of experiments for the first time that inhibiting the expression of Zfp217 gene can alleviate the bone loss caused by estrogen deficiency or lack of mechanical stress. The present invention also reveals that the action of Zfp217 to negatively regulate osteoblast differentiation and positively regulate lipogenesis is partially based on its competitive binding to the Zfp521 promoter with ERα, which inhibits the expression of Zfp521, and therefore leads to the differentiation of mesenchymal stem cells into adipose tissue, thereby finally reducing bone formation and promoting lipogenesis. The present invention provides a new mechanism and a new therapeutic target for treating osteoporosis.
Need to check novelty before this filing date? Find Prior Art

Description

Application of Zfp217 gene in the preparation of drugs for treating osteoporosis Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to the application of the Zfp217 gene in preparing a medicine for treating osteoporosis. Background Art

[0002] Bone development is closely related to the health of the body. Bones provide mechanical support for movement, protect vital organs, and regulate calcium and mineral metabolism. When bone formation is poor, a series of bone-related diseases will occur. With the aging of the population and the extension of life expectancy, osteoporosis is becoming increasingly worrying and is considered one of the major global epidemics. Age-related estrogen deficiency is the most common cause of osteoporosis. In addition, the lack of mechanical stress is also a cause of osteoporosis. The disease is characterized by decreased bone density and increased bone marrow fat. The current strategy for treating osteoporosis-related diseases mainly uses bisphosphonates and denosumab to inhibit osteoclast resorption. However, most anti-resorptive drugs used to treat osteoporosis have side effects.

[0003] Bone marrow mesenchymal stem cells (BMSCs) play an important role in bone growth and development and are precisely and complexly regulated by multiple signals. However, many new and critical transcription factors remain undiscovered during bone formation, and the regulatory network for bone formation needs further refinement. BMSCs have the ability to differentiate into multiple cell lineages, including adipocytes and osteoblasts. However, the molecular mechanisms underlying the transition from osteoblast-to-adipocyte differentiation remain unclear. Therefore, further understanding of the mechanisms underlying BMSC fate determination is crucial for exploring new therapeutic approaches for osteoporosis.

[0004] Summary of the Invention

[0005] The present invention aims to address the problems of the prior art by providing the use of the Zfp217 gene in the preparation of a drug for the treatment of osteoporosis. Experiments demonstrate that intramarrow injection of the bone marrow mesenchymal stem cell-targeting aptamer, agomir-503-5p / siZfp217, stimulates bone formation and reduces bone marrow fat accumulation, providing a novel mechanism and therapeutic target for age-related and mechanical stress-induced bone loss.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides use of a reagent for inhibiting Zfp217 gene expression in preparing a medicine for treating osteoporosis.

[0008] Furthermore, the osteoporosis includes osteoporosis caused by estrogen deficiency and osteoporosis caused by mechanical stress deficiency.

[0009] Furthermore, by inhibiting the expression of the Zfp217 gene, the expression of the Zfp521 gene is promoted, thereby promoting the formation of osteoblasts.

[0010] The present invention also provides use of a reagent for inhibiting Zfp217 gene expression in preparing a drug for reducing bone marrow fat.

[0011] The present invention also provides use of a reagent for inhibiting Zfp217 gene expression in preparing a drug for increasing bone mass.

[0012] The present invention also provides the use of a reagent for regulating Zfp217 gene expression in the preparation of a drug for regulating the differentiation of bone marrow mesenchymal stem cells into osteoblasts or adipocytes. When the expression of the Zfp217 gene is inhibited, the bone marrow mesenchymal stem cells differentiate into osteoblasts; when the expression of the Zfp217 gene is promoted, the bone marrow mesenchymal stem cells differentiate into adipocytes.

[0013] The present invention also provides a medicine for treating osteoporosis, which contains an agent for inhibiting the expression of the Zfp217 gene.

[0014] Furthermore, the agent for inhibiting Zfp217 gene expression includes an aptamer that inhibits Zfp217 gene expression in bone marrow mesenchymal stem cells.

[0015] Furthermore, the aptamer for inhibiting Zfp217 gene expression in bone marrow mesenchymal stem cells includes the sequence shown as SEQ ID NO.25.

[0016] Furthermore, the osteoporosis includes osteoporosis caused by estrogen deficiency and osteoporosis caused by mechanical stress deficiency.

[0017] The present invention discloses the following technical effects:

[0018] This study demonstrates, for the first time, that inhibiting Zfp217 gene expression can alleviate bone loss caused by estrogen deficiency or mechanical stress. The study also reveals that Zfp217 negatively regulates osteoblast differentiation and positively regulates adipogenesis, in part by competitively binding to the Zfp521 promoter with ERα. This inhibits Zfp521 expression, leading to the differentiation of mesenchymal stem cells into adipose tissue, ultimately reducing bone formation and increasing adipogenesis. This study provides a novel mechanism and therapeutic target for the treatment of osteoporosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 shows the mRNA expression levels of Zfp217 (A), key osteogenesis genes Runx2, Osx, Ocn, Opn (C), and adipogenesis genes C / EBPα and PPARγ (B) in bone specimens from young (mean age: 23 years) and old (mean age: 67 years) donors detected by qRT-PCR;

[0020] Figure 2 shows the expression pattern and temporal and spatial expression profile of Zfp217 during osteogenic differentiation of mesenchymal stem cells; A shows the tissue expression profile of Zfp217 in one-month-old wild-type mice; B shows the tissue expression profile of Zfp217 in three-month-old wild-type mice; C shows the expression pattern of Zfp217 detected by qPCR in mesenchymal stem cells C3H10T1 / 2 at 0, 3, 7, 10, 14, 18, and 21 days of osteogenic induction;

[0021] Figure 3 shows 3D reconstructed images of cancellous bone at the distal femur of 1-month-old (A) and 3-month-old (B) mice scanned by micro-CT, as well as quantitative analysis of cancellous bone parameters, including bone volume fraction (BV / TV), average cancellous bone thickness (Tb.Th), average number of cancellous bones (Tb.N), and average cancellous bone spacing (Tb.Sp).

[0022] Figure 4 shows 3D reconstructed images of the distal femoral cortical bone of 1-month-old (A) and 3-month-old (B) mice scanned by micro-CT and quantitative analysis of the average cortical bone thickness (Cb.Th);

[0023] Figure 5 shows the vernier caliper measurements of 1-month-old (A) and 3-month-old (B) wild-type mice, Zfp217 + / - Femur length of type mice;

[0024] Figure 6 shows the expression of Zfp217 in wild-type mice at 1 month (A) and 3 months (B). + / - Safranin fast green staining of tibia of type 2 mice;

[0025] FIG7 shows the OCN levels in the serum of 1-month-old (A) and 3-month-old (B) mice detected by ELISA;

[0026] Figure 8 shows the qPCR detection of Zfp217 in 1-month-old and 3-month-old wild-type mice. + / - Key genes for osteogenesis (A) and adipogenesis (B) in WT mice;

[0027] Figure 9 shows that Zfp217 controls the fate determination of mesenchymal stem cells in vitro, wherein A is the effect of Zfp217 on the osteogenic differentiation of C3H10T1 / 2 cells detected by alkaline phosphatase and Alizarin red staining; B is the effect of Zfp217 knockout on the osteogenic differentiation of primary mouse mesenchymal stem cells detected by alkaline phosphatase and Alizarin red staining; C is the mRNA levels of key genes for osteogenic / adipogenic genes in C3H10T1 / 2 cells and mouse BMSCs detected by qPCR; D is the mRNA levels of key genes for osteogenic / adipogenic genes in C3H10T1 / 2 cells and mouse BMSCs after Zfp217 knockout detected by qPCR;

[0028] Figure 10 shows that Zfp217 deficiency stimulates estrogen deficiency-induced osteoporotic bone formation and reduces bone marrow fat accumulation, where A is a representative image of distal femur micro-CT reconstruction; B is a representative image of WT-SHAM, WT-OVX, and Zfp217 + / - -SHAM and Zfp217 + / - Safranin fast green staining of femur of OVX mice, scale bar, 0.5 μm; C is the quantitative analysis of distal femoral epiphyseal region by micro-CT (n=8); D is the ELISA analysis of serum OCN levels; E is the qPCR determination of WT-SHAM, WT-OVX, and Zfp217 + / - -SHAM and Zfp217 + / - -Transcript abundance of key osteogenic / adipogenic genes in OVX mice;

[0029] Figure 11 shows that Zfp217 reverses the effect of estrogen on the fate determination of mesenchymal stem cells, wherein A is the effect of Zfp217 on alkaline phosphatase and calcium nodule formation in C3H10T1 / 2 cells detected by alkaline phosphatase and Alizarin red staining in the presence and absence of estrogen; B is the effect of Zfp217 and ERα on alkaline phosphatase and calcium nodule formation in C3H10T1 / 2 cells detected by alkaline phosphatase and Alizarin red staining; C is the effect of Zfp217 on key osteogenic genes, such as Runx2, Osx, Ocn, Opn and Zfp521, detected by qPCR with and without estrogen (n=3); D is the effect of Zfp217 and ERα on key osteogenic / adipogenic genes detected by qPCR (n=3);

[0030] Figure 12 shows the effect of Zfp217 on inhibiting ERα and promoting Zfp521. A shows the expression of Zfp521 in bone samples from young and old donors. B shows the expression of Zfp521 in 1-month-old and 3-month-old wild-type mice and Zfp217 in vivo after knockout of Zfp217. + / -The expression of Zfp521 in the femur of type 2 mice and the expression of Zfp521 detected by qPCR after interference / overexpression of Zfp217 in C3H10T1 / 2 cells; C is the expression of Zfp521 detected by qPCR after interference / overexpression of ERα in C3H10T1 / 2 cells; D is the expression of Zfp521 and Alp detected by qPCR after overexpression of ERα and Zfp217 in C3H10T1 / 2 cells; E is the protein level of Zfp521 detected by western blot after overexpression of ERα and Zfp217 in C3H10T1 / 2 cells;

[0031] Figure 13 shows that Zfp217 competes with ERα for binding to the Zfp521 promoter and inhibits the expression of Zfp521, wherein A shows that Zfp217 competes with ERα for binding to the Zfp521 promoter and inhibits the expression of Zfp521; B shows the effect of overexpression of Zfp217 and ERα on the activity of the Zfp521 promoter by dual luciferase reporter gene assay in the presence and absence of estrogen; C shows the binding of Zfp217 and ERα to the Zfp521 promoter by ChIP-PCR; D / E shows the expression of Zfp217 with blank (-) or E2 (10 -8 M) C3H10T1 / 2 cells were treated for 48 hours, and the subcellular localization of Zfp217 and ERα was detected by Western blot and immunofluorescence; F) Enrichment of Zfp217 and ERα on the Zfp521 promoter in the presence and absence of estrogen;

[0032] Figure 14 shows the interaction between Zfp217 and Mettl3 to regulate intracellular m 6 A modification level, where A and B are the mRNA mRNA modifications by Zfp217. 6 A shows the effects of Zfp217 and Mettl3 on mRNA expression; C shows the effects of Zfp217 and Mettl3 on mRNA expression 6 A shows the effect of Zfp217; D shows the interaction between Zfp217 and Mettl3 protein detected by CoIP;

[0033] Figure 15 shows that Zfp217 regulates the expression of Zfp521 at the post-transcriptional modification level, wherein A shows the effect of Zfp217 and Mettl3 on the expression of Zfp521; B shows the effect of Zfp217 on Zfp521m6A detected by MeRIP-qPCR; C shows the effect of Zfp217 on the stability of Zfp521 RNA; D shows the effect of Zfp217 on Zfp521 protein detected by Western blot;

[0034] Figure 16 shows that Zfp217 participates in mesenchymal stem cell fate selection by inhibiting the expression of Zfp521. (AB) show the effects of interfering with Zfp521 and Zfp217 on the osteogenesis / adipogenesis of C3H10T1 / 2 mesenchymal stem cells; (CD) show the effects of overexpressing Zfp521 and Zfp217 on the osteogenesis / adipogenesis of C3H10T1 / 2 mesenchymal stem cells.

[0035] Figure 17 shows that bone marrow injection of agomiR-503-5p / siZfp217 can reduce bone loss in estrogen-deficient mice; A is qPCR analysis of Zfp217 expression levels in bone marrow mesenchymal stem cells of aptamer-injected mice; B / C are representative μCT images and quantitative analysis of the microstructure of femoral cancellous and cortical bone in aptamer-treated mice; D is a representative μCT image of the tibia and adipocyte volume; E / F are safranin fast green-stained images of the proximal tibia and quantification of adipocyte area and osteoblast number; G is ELISA analysis of serum Ocn levels; H / I are expression of osteogenic / adipogenic genes. J is the mRNA expression of Zfp521.

[0036] FIG18 shows a 3D reconstructed image of the distal femur of a mouse scanned by micro-CT (A) and a quantitative analysis of bone parameters of cancellous bone and cortical bone (B);

[0037] FIG19 shows the results of safranin fast green staining of the proximal tibia of mice (A) and the effect of conditional knockout of bone marrow mesenchymal stem cell Zfp217 on osteoblasts and adipocytes (B);

[0038] Figure 20 shows the expression of Zfp217, PPARγ, CEBP / α, Osx, Runx2 and Zfp521 in mouse femur detected by ELISA (A) and RT-qPCR (B);

[0039] Figure 21 shows the effects of substrates of different hardness on cell morphology (A), cell aspect ratio (B), and cytoskeleton (C);

[0040] Figure 22 shows the effects of soft and hard matrices on alkaline phosphatase (A) and lipid droplets (C). Figure B shows the effects of soft and hard matrices on the expression of Zfp217, adipogenesis, osteogenesis, and mechanosensitive genes; Figure D shows the effects of soft and hard matrices on the expression of Zfp217, adipogenesis, osteogenesis, and mechanosensitive genes.

[0041] Figure 23 shows the effects of Zfp217 interference on alkaline phosphatase, calcium nodules and lipid droplets (A), key genes for adipogenesis and osteogenesis (B), and key proteins for adipogenesis and osteogenesis (C) on soft and hard substrates;

[0042] Figure 24 shows the effects of soft and hard matrices on integrin (A), intracellular calcium concentration (B), cytoskeleton (C), actin depolymerizing protein (D), nuclear G-actin (E), RNAPII (F), and H3K27me3 (G);

[0043] Figure 25 shows the predicted Zfp217 promoter binding site (A) and the recruitment of Zfp217 promoter by RNAPII and H3K27me3 (B), the effect of interfering with nuclear G-actin export protein on RNAPII under different stresses (C), and the effect of interfering with Xpo6 on RNA polymerase II and the ability of H3K27me3 to recruit Zfp217 under different stresses (D);

[0044] Figure 26 shows stress regulation of Zfp217 through post-transcriptional modification, where A is the effect of different stresses on Zfp217 protein expression; B is the expression of Zfp217 mRNA 6 A is the modification site prediction; C is the effect of different stresses on m 6 A shows the effect of different stresses on the level of methylase / demethylase protein; D shows the effect of different stresses on the level of methylase / demethylase protein; E shows the effect of different stresses on the level of Zfp217 mRNA 6 A shows the effect of different stresses on the level of Zfp217; F shows the effect of different stresses on the stability of Zfp217 mRNA; G shows the effect of different stresses on the recognition of Zfp217 mRNA by YTHDF2. DETAILED DESCRIPTION

[0045] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0046] The main materials for the test in the embodiment of the present invention are as follows:

[0047] 1. Cellular Materials

[0048] Mouse C3H10T1 / 2 mesenchymal stem cells were purchased from the Cell Bank of Type Culture Collection Committee of the Chinese Academy of Sciences; mouse primary bone marrow mesenchymal stem cells.

[0049] 2. Experimental Animals

[0050] The clean-grade C57BL / 6 mice used in the experiment and the pronuclear injection service for producing Zfp217 gene knockout mice were provided by Guangzhou Saiye Biotechnology Co., Ltd.

[0051] Mice were housed in the Experimental Animal Center of Huazhong Agricultural University, and all procedures adhered to the guidelines of the Animal Care and Use Committee of Huazhong Agricultural University.

[0052] 3. Bone specimens

[0053] The bone specimens from young (average age: 23 years) and elderly (average age: 67 years) donors used in the experiment came from patients who underwent bone surgery in the Department of Orthopedics at Tongji Hospital Affiliated to Tongji Medical College of Huazhong University of Science and Technology from 2022 to 2023.

[0054] Example 1

[0055] In this example, the inhibitory effect of Zfp217 on the osteoblast differentiation of mesenchymal stem cells is revealed. The results show that in vivo, global knockdown of the Zfp217 gene can alleviate bone loss and fat deposition caused by estrogen deficiency. In vitro experiments show that Zfp217 promotes the adipogenic differentiation of bone marrow mesenchymal stem cells while inhibiting their osteogenic differentiation. Furthermore, estrogen competes with Zfp217 for binding to the Zfp521 promoter through the estrogen receptor, thereby reducing the inhibitory effect of Zfp217 on Zfp521. In osteoporosis caused by estrogen deficiency, intramarrow injection of the bone marrow mesenchymal stem cell-targeting aptamer - agomir-503-5p / siZfp217 stimulates bone formation and reduces bone marrow fat accumulation. Therefore, this example provides a new mechanism and new therapeutic target for age-related bone loss.

[0056] In this embodiment, real-time fluorescence quantitative PCR was used to detect the expression of each gene, and the gene primer sequences involved are shown in Table 1. -△△Ct The relative expression levels were calculated using the β-actin algorithm, with β-actin as the internal reference.

[0057] Table 1 Primer sequences for different genes

[0058] Test content

[0059] 1. Expression of Zfp217 and osteogenic / adipogenic genes during human bone aging

[0060] To investigate the role of Zfp217 in bone marrow mesenchymal stem cell differentiation, the expression of Zfp217 in bone specimens from young (mean age: 23 years) and old (mean age: 67 years) donors was detected by real-time fluorescence quantitative PCR using β-actin as a reference gene.

[0061] The results showed that the expression of Zfp217 was significantly increased in bone specimens from aged donors (Figure 1A). The expression of bone / adipogenesis-related genes in young and aged donors was then investigated. The results showed that the mRNA levels of adipogenesis-related genes (such as C / EBPα and PPARγ) were significantly upregulated in bone specimens from aged donors compared with those from young donors (Figure 1B). At the same time, the levels of osteogenesis-related genes such as Runx2, Osx, Ocn, and Opn were significantly decreased in bone specimens from aged donors compared with those from young donors (Figure 1C). Taken together, these findings reveal that the expression of Zfp217 in bones increases during human aging, accompanied by decreased osteogenesis and increased adipogenesis.

[0062] 2. Zfp217 expression pattern during mouse bone formation and osteoblast differentiation

[0063] To further investigate the effect of Zfp217 on bone formation, samples of the heart, liver, spleen, lung, kidney, stomach, brain, gastrocnemius muscle, longissimus dorsi muscle, brown fat, interscapular white fat, perirenal fat, gonadal fat, inguinal fat, femur, and tibia were collected from 1- and 3-month-old wild-type mice. The spatiotemporal expression profile of Zfp217 was analyzed by qPCR. The results showed that Zfp217 was highly expressed in the femur and tibia of both 1- and 3-month-old mice, suggesting that Zfp217 may play an important role in bone formation (Figure 2A and B). Subsequently, mesenchymal stem cells (C3H10T1 / 2) were cultured in osteogenic induction medium (DMEM + dexamethasone + vitamin C + β-glycerophosphate), and the mRNA expression pattern of Zfp217 was analyzed by qPCR on days 0, 3, 7, 10, 14, 18, and 21 of culture. The results showed that during osteogenic differentiation, the level of Zfp217 mRNA first increased and then decreased (Figure 2C), suggesting that Zfp217 may play an important role in osteogenic differentiation.

[0064] 3. Zfp217 knockout leads to increased bone mass and decreased bone marrow fat

[0065] In order to detect the effect of Zfp217 knockout on mouse bone formation, Zfp217 whole-body knockout mice were constructed in this example. Since Zfp217 double knockout is lethal, this example uses Zfp217 heterozygous mice (Zfp217 + / - ) to conduct experiments.

[0066] In order to study Zfp217 more intuitively + / - In this study, micro-CT was used to analyze the effects of Zfp217 on bone formation in wild-type mice. + / -The femoral cancellous bone of WT mice (1 month and 3 months old) showed that Zfp217 + / - The cancellous bone parameters of Zfp217 mice were significantly increased. This was manifested by an increase in cancellous bone volume fraction (BV / TV), average cancellous bone thickness (Tb.Th), and average cancellous bone number (Tb.N), but a decrease in the average cancellous bone spacing (Tb.Sp) (Figure 3A and B). Micro-CT analysis of cortical bones showed that compared with wild-type mice, Zfp217 + / - There was no difference in cortical bone thickness (Ct.Th) between the two types of mice (Figure 4A and B), indicating that knockout of Zfp217 promotes cancellous bone formation but has no effect on cortical bone.

[0067] Subsequently, vernier calipers were used to measure the expression of Zfp217 in wild-type mice and + / - Femoral length of Zfp217 mice (1 month and 3 months old) was measured and compared with wild-type mice. + / - The femur length of WT mice was significantly increased (Fig. 5A and B).

[0068] Safranin fast green staining was used to detect Zfp217 in 1-month-old and 3-month-old wild-type mice and + / - The tibia of type mice was found to be downregulated compared with wild-type mice. + / - The number of osteoblasts in the tibia of the WT mice was significantly increased, but the bone marrow fat content did not change significantly (Figure 6A and B).

[0069] ELISA detection showed that compared with wild-type mice, Zfp217 + / - The bone formation marker OCN in the serum of the 1-month-old and 3-month-old mice was significantly increased (Figure 7A and B). Accordingly, total RNA was extracted from the femur to detect the expression of bone and adipogenesis-related genes in 1-month-old and 3-month-old mice. + / - The expression of osteogenesis-related genes Runx2, Osx, Ocn, and Opn in Zfp217 mice was higher than that in wild-type mice, while the expression of adipogenesis-related genes C / EBPα and PPARγ was significantly lower than that in wild-type mice (Figure 8, A and B). These results indicate that during skeletal development, the loss of Zfp217 promotes bone formation and reduces bone marrow fat deposition.

[0070] 4. Zfp217 controls the fate determination of mesenchymal stem cells in vitro

[0071] Next, to investigate the role of Zfp217 in skeletogenesis and adipogenesis, this example investigated the effects of Zfp217 on osteogenic and adipogenic differentiation of C3H10T1 / 2 cells by siRNA- and overexpression plasmid-mediated loss-of-function and gain-of-function.

[0072] The construction process of Zfp217 overexpression plasmid is as follows:

[0073] Primers were designed using Primer 6.0 software based on the CDS sequence of Zfp217 in Gene from the National Center for Biotechnology Information (NCBI) website (http: / / www.ncbi.nlm.nih.gov / ). The primer sequences are as follows:

[0074] Upstream: 5'-CGGGATCCATGCCGACCCAGTCCCTCCTC-3', SEQ ID NO.19;

[0075] Downstream: 5'-GATATCTCAAGGTTTTTTGTCATTTGGTCGGTAATG-3', SEQ ID NO. 20. The sequence was then amplified from mouse tissue cDNA using the high-fidelity enzyme Pfu, recovered by electrophoresis, ligated into the pCMV-N-flag vector, and sequenced. Sequence alignment was performed using BLAST (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to obtain the Zfp217 overexpression plasmid.

[0076] The siRNA target sequence for Zfp217 is:

[0077] Zfp217-1, 5'-CACACTTCCACGGAATCATAC-3', SEQ ID NO. 21;

[0078] Zfp217-2, 5'-TCACATCAGCACCTATCTAAC-3', SEQ ID NO.22;;

[0079] The negative control (NC) is: 5'-TTCTCCGAACGTGTCACGT-3', SEQ ID NO. 23.

[0080] ALP staining, Alizarin red staining and osteoblast marker mRNA expression were used to evaluate osteoblast differentiation. As shown in Figure 9A, interference with Zfp217 significantly increased the number of mineralized nodules stained with alkaline phosphatase (ALP) and Alizarin red; overexpression of Zfp217 led to reduced ALP staining and a decrease in the number of mineralized nodules. At the same time, interference with Zfp217 significantly increased the mRNA levels of Runx2, Osx, Opn and Ocn, while reducing the expression of C / EBPα and PPARγ; on the contrary, overexpression of Zfp217 significantly reduced the mRNA levels of Runx2, Osx, Opn and Ocn in C3H10T1 / 2 cells, and increased the expression of C / EBPα and PPARγ (Figure 9C). Consistent with the results of C3H10T1 / 2 cells, Zfp217 + / - More ALP staining and mineralized nodules were observed in mouse BMSCs compared to wild-type mouse BMSCs (Figure 9B). Furthermore, Zfp217 knockdown increased mRNA expression of osteoblast markers Runx2, Osx, Opn, and Ocn, while simultaneously decreasing C / EBPα and PPARγ expression (Figure 9D). Taken together, these findings suggest that Zfp217 inhibits osteogenic differentiation in C3H10T1 / 2 cells and BMSCs while promoting adipogenic differentiation.

[0081] 5. Zfp217 deficiency stimulates bone formation and reduces bone marrow fat accumulation in estrogen deficiency-induced osteoporosis

[0082] Given the effects of Zfp217 knockout on bone development, this study investigated whether Zfp217 knockout could increase bone mass or reduce adipogenesis to prevent osteoporosis caused by estrogen deficiency. + / - Ovariectomy (OVX) was performed on sham-operated female mice and their wild-type littermates. Ovariectomy mimics the bone loss and bone marrow fat accumulation of osteoporosis caused by postmenopausal estrogen deficiency (Figure 10, AD). MicroCT analysis showed that Zfp217 was significantly downregulated in the sham-operated group compared to wild-type mice. + / - The BV / TV and Tb.Th of Zfp217 mice were significantly increased compared with WT-OVX mice. + / --OVX mice also showed a significant increase in BV / TV and Tb.Th, which was consistent with the results of the sham-operated group. However, in the absence of Zfp217, the changes in Tb.N, Ct.Th, and Tb.Sp were not obvious (Figure 10A and C). Safranin fast green staining clearly showed a decrease in the number of osteoblasts (Ob.N / BS) and an increase in bone marrow fat after ovariectomy, and these changes were improved after Zfp217 knockout (Figure 10B). In addition, compared with WT-OVX mice, Zfp217 + / - Serum Ocn levels in -OVX mice were significantly increased (Figure 10D). qPCR analysis also showed that Zfp217 was upregulated compared with WT-OVX mice. + / - After OVX, mice showed significant upregulation of osteogenic marker genes and significant downregulation of adipogenic marker genes (Figure 10E and F). These results indicate that Zfp217 deficiency alleviates estrogen deficiency-induced osteoporosis by promoting bone formation and reducing bone marrow fat accumulation.

[0083] 6. Zfp217 reverses the effects of estrogen on mesenchymal stem cell fate determination

[0084] Given the rescue effect of Zfp217 knockout on bone mass and bone marrow fat in an ovariectomized model, this example investigated the role of Zfp217 in estrogen signaling. C3H10T1 / 2 cells overexpressing Zfp217 were cultured in osteogenic differentiation medium with or without the addition of estrogen E2 (MCE, USA, HY-B0141) for 7 and 14 days, with the medium changed every 3 days.

[0085] Compared with cells in the control group, E2 treatment significantly increased alkaline phosphatase activity from the 7th day after differentiation and increased more mineralized nodules (Figure 11A). In C3H10T1 / 2 cells, compared with cells treated with E2 alone, E2 treatment and overexpression of Zfp217 led to a decrease in alkaline phosphatase activity and calcium mineralization (Figure 11A). Compared with the control group, E2 treatment led to increased expression of osteogenic differentiation markers such as Runx2, Osx, Opn and Ocn, and significantly reduced expression of adipogenic differentiation genes, a result consistent with differentiation and mineralization experiments. Compared with cells treated with E2 alone, E2 treatment and overexpression of Zfp217 significantly reduced the levels of Runx2, Osx, Opn and Ocn mRNA, while increasing the expression of fat-related genes (Figure 11C).

[0086] This example found that overexpression of ERα significantly increased alkaline phosphatase activity and the number of mineralized nodules. However, overexpression of Zfp217 inhibited the promoting effect of ERα on osteogenesis (Figure 11B). At the same time, overexpression of ERα significantly promoted osteogenic differentiation, such as increased levels of key bone differentiation genes Runx2, Osx, Ocn and Opn mRNA, and inhibited the expression of adipogenic genes. Similarly, overexpression of Zfp217 inhibited the promoting effect of ERα on osteogenesis genes and increased the expression of adipogenic genes (Figure 11D). In summary, these findings indicate that Zfp217 regulates stem cell fate determination in a manner opposite to estrogen.

[0087] 7. Zfp217 inhibits the promotion of Zfp521 by ERα

[0088] This example used bioinformatics methods to predict that Zfp521 is a target gene of Zfp217 and studied the effect of Zfp217 on it. First, the expression of Zfp521 in bone specimens from elderly donors was significantly lower than that in young donors (Figure 12A). In addition, Zfp217 was expressed in bone specimens from 1-month-old and 3-month-old donors. + / - The expression of Zfp521 in the femur of mice was significantly higher than that in wild-type mice. In addition, overexpression of Zfp217 in C3H10T1 / 2 cells significantly inhibited the expression of Zfp521, while knockdown of Zfp217 led to a significant increase in the expression level of Zfp521 (Figure 12B).

[0089] To investigate the role of Zfp217 in the estrogen signaling pathway, we overexpressed Zfp217 and ERα in C3H10T1 / 2 cells to determine their effects on target genes. Consistent with the results in C3H10T1 / 2 cells, loss of Zfp217 promoted the expression of Zfp521 both in vitro and in vivo (Figure 12, B and C). Furthermore, the phosphatase gene (Alp) is an important target of ERα in osteogenic differentiation. Overexpression of Zfp217 inhibited the expression of Zfp521 and Alp, whereas overexpression of ERα increased their expression. Furthermore, overexpression of both ERα and Zfp217 reduced the expression of Zfp521 and Alp compared to overexpression of ERα alone (Figure 12, D). At the same time, Western blotting showed that overexpression of both ERα and Zfp217 reduced the protein level of Zfp521 compared with overexpression of ERα alone (Figure 12E). In summary, Zfp217 can reverse the promoting effect of ERα on Zfp521.

[0090] 8. Zfp217 competes with ERα for binding to the Zfp521 promoter and inhibits the expression of Zfp521

[0091] To investigate the regulatory effects of Zfp217 and estrogen on Zfp521, we first overexpressed Zfp217 in the presence and absence of estrogen and analyzed its effects on Zfp521. Consistent with previous findings, overexpression of Zfp217 significantly inhibited Zfp521 expression. However, this inhibitory effect was effectively alleviated by estrogen administration (Figure 13A).

[0092] To investigate the transcriptional regulation mechanism of Zfp521 by estrogen and Zfp217, a dual-luciferase reporter gene assay was performed to investigate whether Zfp217 and ERα could transcriptionally regulate the Zfp521 promoter in the presence or absence of estrogen. The results showed that ERα significantly promoted the activity of the Zfp521 promoter. At the same time, overexpression of both ERα and Zfp217 reduced the activity of the Zfp521 promoter compared to overexpression of ERα alone, and these effects could be amplified by estrogen (Figure 13B). Furthermore, ChIP-qPCR results demonstrated that both Zfp217 and ERα could bind to the Zfp521 promoter (Figure 13C).

[0093] To further elucidate the mechanism by which Zfp217 and ERα regulate Zfp521 transcription, we investigated the subcellular localization of Zfp217 and ERα in the presence and absence of estrogen. The results showed that under estrogen action, ERα was primarily localized in the nucleus, while Zfp217 was primarily present in the cytoplasm. In contrast, in the absence of estrogen, Zfp217 was primarily concentrated in the nucleus, while ERα was primarily located in the cytoplasm (Figure 13D).

[0094] Furthermore, chromatin immunoprecipitation was used to examine the enrichment of Zfp217 and ERα at the Zfp521 promoter in the presence and absence of estrogen. The results showed that in the absence of estrogen, Zfp21 enriched the Zfp521 promoter more than ERα. Conversely, in the presence of estrogen, ERα enriched the Zfp521 promoter more than Zfp217 (Figure 13E). These results suggest that estrogen competes with Zfp217 through estrogen receptor α for binding to the Zfp521 promoter, thereby promoting bone formation and inhibiting fat deposition.

[0095] 9. Zfp217 interacts with Mettl3 to regulate intracellular m 6 A modification level

[0096] Previous studies have found that Zfp217 can transcriptionally regulate the expression of Zfp521 and thus regulate osteoblast differentiation. 6A modification regulates the expression of Zfp521 and thus affects osteoblast differentiation. First, Zfp217 was interfered with in C3H10T1 / 2 cells, and then the mRNA mRNA was detected by dot blot hybridization and high performance liquid chromatography-mass spectrometry. 6 A modification level. The results showed that when Zfp217 was interfered with, the m 6 The A modification level was significantly increased (Figure 14 A and B). Then, Zfp217 was interfered with and Zfp217 and Mettl3 were interfered with simultaneously. When Zfp217 was interfered with, the mRNA m 6 When Zfp217 and Mettl3 were interfered with simultaneously, the mRNA mRNA expression was significantly increased compared with that when only Zfp217 was interfered with. 6 The A modification level decreased significantly. This suggests that Zfp217 can increase the mRNA mRNA through Mettl3 6 A modification level ( FIG14C ).

[0097] To detect whether Zfp217 interacts with Mettl3 in C3H10T1 / 2 cells, protein interaction between Zfp217 and Mettl3 was detected in C3H10T1 / 2 cells by CoIP ( FIG. 14D ).

[0098] 10. Zfp217 regulates Zfp521 expression through post-transcriptional modification

[0099] To explore whether Zfp217 can regulate the expression of Zfp521 through Mettl3 and thus affect osteogenic differentiation, this example found that when Zfp217 was interfered with, the expression level of Zfp521 increased; when Zfp217 and Mettl3 were interfered with at the same time, the expression level of Zfp521 decreased compared with when only Zfp217 was interfered with (Figure 15A).

[0100] Then, MeRIP-qPCR was used to find that the mRNA expression of Zfp521 mRNA was significantly increased after the interference of Zfp217. 6 A modification increased, and when Zfp217 and Mettl3 were simultaneously interfered with, the m on Zfp521 mRNA 6 A modification decreased compared to when only Zfp217 was disrupted (Figure 15B). mRNA stability analysis showed that Zfp521 stability increased after Zfp217 disruption (Figure 15C). Western blot analysis revealed that Zfp521 protein expression increased after Zfp217 disruption (Figure 15D). In summary, these results indicate that Zfp217 regulates Zfp521 protein expression by modulating Zfp521 mRNA stability.

[0101] 11. Zfp217 regulates mesenchymal stem cell fate selection through Zfp521

[0102] After interfering with Zfp217 in C3H10T1 / 2 cells, osteogenic differentiation was promoted and adipogenic differentiation was inhibited; when Zfp217 and Zfp521 were interfered with simultaneously, osteogenic differentiation was significantly inhibited compared with interfering with Zfp217 alone, while adipogenic differentiation was significantly promoted (Figure 16A and B). After overexpressing Zfp217 in C3H10T1 / 2 cells, osteogenic differentiation was inhibited and adipogenic differentiation was promoted; when Zfp217 and Zfp521 were overexpressed simultaneously, osteogenic differentiation was promoted and adipogenic differentiation was inhibited compared with overexpressing Zfp217 alone (Figure 16C and D). This suggests that Zfp217 regulates mesenchymal stem cell fate determination in part by regulating the expression of Zfp521.

[0103] 12. Bone marrow injection of agomiR-503-5p / siZfp217 reduces bone loss in estrogen-deficient mice

[0104] To investigate the efficacy of targeted inhibition of Zfp217 in bone marrow mesenchymal stem cells for the treatment of estrogen deficiency-induced osteoporosis, ovariectomized mice were injected with an aptamer targeting bone marrow mesenchymal stem cells, agomiR-503-5p / siZfp217, via the bone marrow twice a month for 3 months.

[0105] Among them, the aptamer sequence is:

[0106] 5'-gaattcagtcggacagcgacggtgatatgtcaaggtcgtaggcacgagtcagagggatggacgaatatcgtctccc-3' (SEQ ID NO. 24);

[0107] The sequence of miR-503-5p is:

[0108] sense(5'-3')UAGCCAGCGGGAACAGUACUGCAG(SEQ ID NO.25);

[0109] antisense(5-3')GCAGUACUGUUCCCGCUGCUAUU(SEQ ID NO.26);

[0110] The sequence of siZfp217 is:

[0111] sense(5'-3')TCACATCAGCACCTATCTAAC(SEQ ID NO.27);

[0112] antisense (5-3')GTTAGATAGGTGCTGATGTGA (SEQ ID NO. 28).

[0113] After intramarrow injection of the aptamer agomiR-503-5p / siZfp217 targeting bone marrow mesenchymal stem cells, the level of Zfp217 in bone marrow mesenchymal stem cells was significantly reduced (Figure 17A). Compared with ovariectomized mice, injection of the aptamer agomiR-503-5p / siZfp217 into ovariectomized mice increased the mice's BV / TV Tb.N and Tb.Th and reduced Tb.Sp (Figure 17B and C). In addition, compared with WT-OVX mice, injection of the aptamer agomiR-503-5p / siZfp217 after ovariectomy reduced the area of ​​adipocytes (Figure 17D). In addition, mice treated with the aptamer agomiR-503-5p / siZfp217 had a significant increase in the number of osteoblasts and a decrease in fat volume (Figure 17E, F). Moreover, compared with WT-OVX mice, intramarrow injection of aptamer-agomiR-503-5p / siZfp217 can increase the serum OCN level of OVX mice (Figure 17G). In addition, aptamer-agomiR-503-5p / siZfp217 significantly alleviated the reduction of osteogenic differentiation induced by estrogen deficiency and significantly reduced the increase in fat formation caused by estrogen deficiency (Figure 17H, I). Finally, compared with WT-OVX, the expression of Zfp521 in mice injected with aptamer-agomiR-503-5p / siZfp217 was significantly increased (Figure 17J). These results indicate that intramarrow injection of aptamer-agomiR-503-5p / siZfp217 can prevent bone loss and bone marrow fat accumulation caused by estrogen deficiency.

[0114] Example 2

[0115] This example uses mice with conditional knockout of Zfp217 in bone marrow mesenchymal stem cells to establish a tail suspension model to simulate mechanical stress deprivation. Furthermore, polyacrylamide gels of varying hardness are used to simulate the cellular environment under stress deprivation to investigate the effects of mechanical stress on Zfp217. Finally, the polyacrylamide model is used to investigate the regulatory mechanisms of stress on Zfp217 and the role of Zfp217 in BMSC fate selection, further elucidating the role of Zfp217 in skeletal formation.

[0116] Test content

[0117] 1. Effects of conditional knockout of Zfp217 in bone marrow mesenchymal stem cells on the skeleton of stress-deficient mice

[0118] To study the effect of Zfp217 on secondary osteoporosis caused by stress deficiency, this example used a mouse tail suspension model to transplant 3-month-old wild-type mice (Prx1-Cre; Zfp217 + / + ) and mice with conditional knockout of mesenchymal stem cell Zfp217 (Prx1-Cre; Zfp217 fl / fl ) were tail-suspended for 28 days, and the femoral bone mass of the wild-type group, the wild-type tail-suspended group, the mice group with conditional knockout of mesenchymal stem cell Zfp217, and the mice with conditional knockout of mesenchymal stem cell Zfp217 were examined by micro-CT. The results showed that compared with the wild-type control group (Prx1-Cre; Zfp217 + / + -CTRL), wild-type tail suspension group mice (Prx1-Cre; Zfp217 + / + -TS) showed a significant decrease in bone mass, while mice with conditional knockout of mesenchymal stem cell Zfp217 (Prx1-Cre; Zfp217 fl / fl -CTRL) can reduce bone loss caused by tail suspension, mainly manifested in that compared with wild-type tail suspension mice, the conditional knockout of mesenchymal stem cell Zfp217 in tail suspension mice (Prx1-Cre; Zfp217 fl / fl -TS) significantly increased the cancellous bone volume fraction, cancellous bone thickness, and cortical bone thickness ( Figure 18 ).

[0119] Safranin fast green staining was used to examine the tibiae of the wild-type group, the wild-type tail suspension group, the Zfp217 conditional knockout group, and the Zfp217 conditional knockout group. The results showed that compared with the wild-type control group, the number of osteoblasts in the wild-type tail suspension group was significantly reduced, and the number of adipocytes was significantly increased; however, the Zfp217 conditional knockout group was able to alleviate the decrease in osteoblasts and increase in adipocytes caused by tail suspension (Figure 19).

[0120] ELISA tests found that mice with conditional knockout of mesenchymal stem cell Zfp217 were able to alleviate the decrease in serum bone formation marker OCN caused by tail suspension (Figure 20 A). At the same time, qPCR tests found that tail suspension increased the expression of Zfp217 in the femur, as well as the expression of key adipogenic genes PPARγ and CEBP / α, while reducing the expression of key osteogenic genes Runx2 and Osx, as well as the mechanical sensitive factor TAZ; and mice with conditional knockout of mesenchymal stem cell Zfp217 were able to reverse the above phenotypes (Figure 20 B). The above results indicate that Zfp217 may be involved in the regulation of mechanical stress on bones, and that conditional knockout of bone marrow mesenchymal stem cell Zfp217 can reduce bone loss caused by exercise deficiency.

[0121] 2. Effects of stress on the morphology of mesenchymal stem cells

[0122] 2% bisacrylamide and 8% acrylamide were uniformly mixed and then fully solidified using TEMED and AP catalysts to produce extracellular matrix materials with varying hardnesses (E = 0.2±0.03, 1.10±0.34, 10.61±0.3, 19.66±1.19, 40.40±2.39, and 62-68 kPa). C3H10T1 / 2 cells were seeded onto polyacrylamide gels of varying hardness and cultured for 24 hours, revealing significant changes in cell morphology under a microscope. C3H10T1 / 2 cells cultured on 0.2±0.03 and 1.10±0.34 kPa polyacrylamide gels were round, morphologically similar to adipocytes; C3H10T1 / 2 cells cultured on 10.61±0.3, 19.66±1.19, 40.40±2.39, and 62-68 kPa polyacrylamide gels were long, rod-shaped, morphologically similar to osteoblasts (Figure 21A). Statistical analysis of the aspect ratio of cells cultured for 24 hours on polyacrylamide gels of varying hardness revealed that the aspect ratios of C3H10T1 / 2 cells were higher on 10.61±0.3, 19.66±1.19, 40.40±2.39, and 62-68 kPa polyacrylamide gels than on 0.2±0.03 and 1.10±0.34 kPa polyacrylamide gels (P<0.05) (Figure 21B). Furthermore, under the same culture conditions, C3H10T1 / 2 cells cultured on polyacrylamide gels of varying stiffness exhibited significant changes in actin morphology. The cytoskeletal protein F-actin was more abundant and more directional on stiff polyacrylamide gels than on soft polyacrylamide gels (Figure 21, C). These results suggest that different extracellular matrix stiffnesses can influence cell morphology by influencing the cytoskeleton.

[0123] 3. Effects of stress on adipogenesis and osteogenesis of mesenchymal stem cells

[0124] After one week of adipogenic / osteogenic induction on 1.10±0.34 and 40.40±2.39 kPa polyacrylamide gels, respectively, qPCR was used to detect the expression of Zfp217, osteoblast markers Osx and Runx2, adipogenic markers PPARγ and CEBP / α, and mechanosensitive genes YAP and TAZ (Figure 22, AD). The results showed that, regardless of adipogenic or osteogenic induction, the expression of osteogenic markers Runx2, Osx, and alkaline phosphatase, as well as mechanosensitive genes YAP and TAZ, was higher on 40.40±2.39 kPa polyacrylamide gels compared with the 1.10±0.34 kPa polyacrylamide gel group; while the expression levels of Zfp217, adipogenic marker genes PPARγ and C / EBPα, and lipid droplets on 1.10±0.34 kPa polyacrylamide gels were significantly higher than those on the 40.40±2.39 kPa polyacrylamide gel group. These results indicate that mesenchymal stem cells C3H10T1 / 2 tend to differentiate into osteoblasts when cultured on 40.40±2.39kPa polyacrylamide gels, while tend to differentiate into adipocytes when cultured on 1.10±0.34kPa polyacrylamide gels.

[0125] 4. Effects of Zfp217 on the fate selection of mesenchymal stem cells under different stress conditions

[0126] To investigate the effect of Zfp217 on mesenchymal stem cell fate selection under different stress conditions, C3H10T1 / 2 cells were seeded onto polyacrylamide gels subjected to various stresses while simultaneously disrupting Zfp217 expression. The results showed that mesenchymal stem cells on soft polyacrylamide gels (1 kPa) were more likely to differentiate into adipocytes compared to those on stiff polyacrylamide gels (40 kPa), as evidenced by increased lipid droplet formation and decreased alkaline phosphatase and calcium nodule formation. Furthermore, when Zfp217 was disrupted under various stresses, lipid droplet formation was reduced and alkaline phosphatase and calcium nodule formation were increased compared to the respective control groups (Figure 23A). Furthermore, compared to stiff polyacrylamide gels, soft polyacrylamide gels showed increased expression of PPARγ and CEBP / α, key adipogenic genes, and decreased expression of Zfp521, Runx2, and Osx, key osteogenic genes. On this basis, after interfering with Zfp217, the expression of key adipogenic genes PPARγ and CEBP / α decreased; the expression of key osteogenic genes Zfp521, Runx2, and Osx increased (Figure 23B). In addition, compared with hard polyacrylamide gel, the expression of key adipogenic protein PPARγ in soft polyacrylamide gel increased; the expression of key osteogenic proteins Zfp521 and Runx2 decreased. After interfering with Zfp217, the expression of key adipogenic protein PPARγ decreased; the expression of key osteogenic proteins Zfp521 and Runx2 increased (Figure 23C). The above results indicate that Zfp217 may participate in the fate selection of mesenchymal stem cells by regulating the expression of Zfp521, thereby determining the fate of mesenchymal stem cells under different stress conditions.

[0127] 5. Stress regulates Zfp217 through transcription

[0128] After culturing C3H10T1 / 2 cells on 1 kPa polyacrylamide gels and 40 kPa polyacrylamide gels for 1 day, the cells were collected and the expression levels of integrins α2, α11, and β1 were detected by qPCR. Compared with 40 kPa polyacrylamide gels, the expression levels of integrins α2, α11, and β1 in C3H10T1 / 2 cells cultured on 1 kPa polyacrylamide gels were significantly lower, with statistically significant differences (P < 0.05). At the same time, the calcium ion level of C3H10T1 / 2 cells cultured on 1 kPa polyacrylamide gels was significantly lower than that on 40 kPa polyacrylamide gels (Figure 24A and B).

[0129] To investigate the effects of stress on the cytoskeleton after introduction into cells, immunofluorescence was first used to examine the effects of different stresses on the cytoskeleton's F-actin. The results showed that F-actin polymerization was higher in C3H10T1 / 2 cells cultured on 1 kPa polyacrylamide gels compared to 40 kPa polyacrylamide gels (Figure 24C). To further investigate the effects of stress on the cytoskeleton, Western blotting was used to detect the F-actin disaggregation factors, cofilin / p-cofilin. Compared to hard polyacrylamide gels, the disaggregation factor cofilin was significantly increased on soft polyacrylamide gels, while the polymerization factor p-cofilin was significantly decreased (Figure 24D). The expression of monomeric globular actin G-actin was then examined. Consistent with the above results, G-actin in the nuclei of cells cultured on soft polyacrylamide gels was significantly higher than that on hard polyacrylamide gels (Figure 24E). These results suggest that F-actin on soft polyacrylamide gels dissociates into monomeric G-actin, which is then translocated into the nucleus.

[0130] In addition, this example found that compared with 40kPa polyacrylamide gel, the H3K27me3 level of C3H10T1 / 2 cells cultured on 1kPa polyacrylamide gel was significantly lower and the activity of RNA polymerase II was stronger (Figure 25A). In order to study the mechanism of stress regulation of Zfp217, ChIP-qPCR was used to detect the enrichment of H3K27me3 and RNA polymerase II on the Zfp217 promoter. The results showed that compared with hard polyacrylamide gel, RNA polymerase II on soft polyacrylamide gel was more enriched on the Zfp217 promoter, while H3K27me3 was less enriched on the Zfp217 promoter (Figure 25B). After interfering with nuclear G-actin export, the G-actin level in cells on soft polyacrylamide gel was equivalent to that in cells on hard polyacrylamide gel (Figure 25C). Furthermore, ChIP experiments revealed that after interfering with nuclear G-actin export, there was no significant difference in the enrichment of H3K27me3 and RNA polymerase II at the Zfp217 promoter under different stress conditions (Figure 25D). This result suggests that stress may regulate the activity of RNA polymerase II and H3K27me3 at the Zfp217 promoter by regulating actin depolymerization, thereby regulating Zfp217 expression.

[0131] 6. Stress regulates Zfp217 through post-transcriptional modification

[0132] This example also found that the expression level of Zfp217 protein in C3H10T1 / 2 cells cultured on 1 kPa polyacrylamide gel was significantly higher than that on 40 kPa polyacrylamide gel (Figure 26A). This may suggest that stress regulates post-transcriptional modification and thus regulates the expression of Zfp217 protein. 6 A modification site was found on Zfp2127mRNA, with a total of 20 m 6 The modification sites of A were: 2 very high level modification sites; 4 high level modification sites; 7 medium level modification sites; 7 low level modification sites (B in Figure 26). Therefore, this may suggest that Zfp217 is regulated by post-transcriptional modification. So we used dot blot hybridization and high performance liquid chromatography-mass spectrometry to detect the effects of different stresses on m 6 The results showed that the m of C3H10T1 / 2 cells cultured on 1 kPa polyacrylamide gel was significantly higher than that on 40 kPa polyacrylamide gel. 6 The modification level of A was significantly lower (Figure 26 C). Moreover, Western blot detection showed that the demethylase incubated on 1 kPa polyacrylamide gel increased significantly compared with 40 kPa polyacrylamide gel, while the methylase did not change significantly (Figure 26 D). MeRIP-qPCR detection showed that the Zfp2127 mRNA mRNA of C3H10T1 / 2 cells cultured on 1 kPa polyacrylamide gel increased significantly compared with 40 kPa polyacrylamide gel. 6 The modification level of A was significantly lower (E in FIG26 ). At the same time, the mRNA stability experiment showed that the Zfp2127 mRNA of C3H10T1 / 2 cells cultured on 1 kPa polyacrylamide gel was significantly more stable than that on 40 kPa polyacrylamide gel (F in FIG26 ). RIP detection found that the recognition effect of YTHDF2 on Zfp2127 of C3H10T1 / 2 cells cultured on 1 kPa polyacrylamide gel was significantly lower than that on 40 kPa polyacrylamide gel (G in FIG26 ). The above results show that when stress is lost, the expression of Zfp2127 mRNA is reduced by reducing the expression of Zfp2127 mRNA. 6 The modification level of A is reduced, thereby reducing the recruitment of Zfp2127 by YTHDF2, allowing Zfp217 to be translated into more proteins, thereby causing mesenchymal stem cells to differentiate into adipocytes.

[0133] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art shall fall within the scope of protection defined by the claims of the present invention.

Claims

1. Use of an agent that inhibits Zfp217 gene expression in the preparation of a drug for treating osteoporosis.

2. The use according to claim 1, characterized in that: The osteoporosis includes osteoporosis caused by estrogen deficiency and osteoporosis caused by mechanical stress deficiency.

3. The use according to claim 1, characterized in that: By inhibiting the expression of the Zfp217 gene, the expression of the Zfp521 gene is promoted, thereby promoting the formation of osteoblasts.

4. Use of an agent that inhibits Zfp217 gene expression in the preparation of a drug for reducing bone marrow fat.

5. Use of agents that inhibit Zfp217 gene expression in the preparation of drugs for increasing bone mass.

6. Use of an agent for regulating Zfp217 gene expression in the preparation of a drug for regulating the differentiation of bone marrow mesenchymal stem cells into osteoblasts or adipocytes, characterized in that: When the expression of the Zfp217 gene is inhibited, the bone marrow mesenchymal stem cells differentiate into osteoblasts; when the expression of the Zfp217 gene is promoted, the bone marrow mesenchymal stem cells differentiate into adipocytes.

7. A drug for treating osteoporosis, characterized in that: The drug contains an agent that inhibits the expression of the Zfp217 gene.

8. The drug according to claim 7, characterized in that The agent for inhibiting the expression of Zfp217 gene includes an aptamer for inhibiting the expression of Zfp217 gene in bone marrow mesenchymal stem cells.

9. The drug according to claim 8, characterized in that The aptamer for inhibiting the expression of Zfp217 gene in bone marrow mesenchymal stem cells includes the sequence shown as SEQ ID NO.

25.

10. The drug according to claim 7, characterized in that The osteoporosis includes osteoporosis caused by estrogen deficiency and osteoporosis caused by mechanical stress deficiency.

Citation Information

Patent Citations

  • ZNF217 a new prognostic and predictive biomarker of recurrent, invasive and metastatic phenotypes in breast cancer

    CN102575291A

  • Ovarian cancer individualized treatment detection reagent case and application thereof

    CN103131757A