SNP molecular marker related to tomato fruit calyx length and use of SNP molecular marker

Abstract

Provided are an SNP molecular marker related to a tomato fruit calyx length and a use of the SNP molecular marker, relating to the technical field of molecular breeding. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO. 1; there is an SNP locus at a base at the 29bp position of the SNP molecular marker, which is an A / T mutation. The SNP molecular marker co-segregates with the tomato fruit calyx length phenotype. By detecting the polymorphism at the SNP locus of the molecular marker, the identification of tomato fruit calyx length differences can be achieved. Compared with a visual observation method in the prior art, use of the SNP molecular marker for molecular marker-assisted selective breeding allows for early-stage prediction of the tomato fruit calyx length, thereby reducing the field cultivation costs, shortening the breeding cycle, and improving the breeding efficiency of long-calyx tomato varieties.

Description

A SNP molecular marker associated with tomato fruit sepal length and its application Technical Field

[0001] The present invention relates to the technical field of molecular breeding, and in particular to a SNP molecular marker related to tomato fruit sepal length and an application thereof. Background Art

[0002] Tomato (Solanum lycopersicum) is one of the world's most important vegetable and cash crops, playing a significant role in promoting agricultural development and increasing farmers' incomes. With the development of greenhouses and solar greenhouses, the area of ​​tomato cultivation has continued to expand. However, with improving living standards, consumers are increasingly concerned about the freshness of tomatoes, in addition to their attractive appearance and palatable quality. The simplest criterion for consumers is whether the sepals wilt. Seals are closely related to fruit appearance. Long, thick sepals not only reflect fruit freshness, but tomatoes with flat-based sepals also enhance their appearance, attracting consumers. Furthermore, flat sepals reduce mechanical damage during transportation, ensuring a good appearance and quality, making them a key commodity quality. Therefore, cultivating tomato varieties with long sepals holds great market potential.

[0003] In tomato breeding, selection of long-sepal varieties is primarily based on visual inspection of sepal length after the fruit has fully expanded, which is time-consuming. Molecular marker-assisted selection can effectively shorten the breeding cycle, but currently there are no molecular markers linked to this trait for use in the selection of long-sepal varieties. Therefore, the development of molecular markers linked to the tomato sepal length trait is urgently needed.

[0004] Summary of the Invention

[0005] The purpose of the present invention is to provide a SNP molecular marker related to the sepal length of tomato fruit and its application to solve the problems existing in the above-mentioned prior art. The SNP molecular marker is co-segregated with the tomato fruit sepal length phenotype. By detecting the polymorphism at the SNP site of the molecular marker, the difference in tomato fruit sepal length can be identified, thereby predicting the sepal length of tomato fruit at an early stage, shortening the breeding cycle, and improving the breeding efficiency of long sepal tomato varieties.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a SNP molecular marker associated with tomato fruit sepal length, wherein the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1; a SNP site exists at the base 29bp of the SNP molecular marker, which is an A / T mutation.

[0008] The present invention also provides a PARMS primer combination for amplifying the above-mentioned SNP molecular marker, comprising two specific upstream primers with a nucleotide sequence as shown in SEQ ID NO.2 and a universal downstream primer with a nucleotide sequence as shown in SEQ ID NO.4.

[0009] The present invention also provides use of the PARMS primer combination in preparing a kit for predicting the length of tomato fruit sepals.

[0010] The present invention also provides a kit for predicting the length of tomato fruit sepals, comprising the above-mentioned PARMS primer combination.

[0011] The present invention also provides the use of the above-mentioned SNP molecular marker in predicting the length of tomato fruit sepals.

[0012] The present invention also provides application of the PARMS primer combination in predicting the sepal length of tomato fruits.

[0013] The present invention also provides a method for predicting the length of tomato fruit sepals, comprising the following steps:

[0014] Extracting genomic DNA from the tomato plants to be tested;

[0015] Using the genomic DNA as a template, PCR amplification and sequencing are performed to obtain the genotype of the SNP site of the above-mentioned SNP molecular marker. The fruit sepal length of the tomato plant to be tested is predicted based on the genotype. The fruit sepal length of the TT genotype is greater than that of the AA genotype.

[0016] Furthermore, the PARMS primer combination is used to perform PCR amplification and sequencing to obtain the genotype of the SNP site of the SNP molecular marker.

[0017] Furthermore, the PCR amplification reaction system is: 5 μL of 2×PARMS master mix, 0.15 μL of each of two 10 μM specific upstream primers, 0.4 μL of a 10 μM universal downstream primer, and 100 ng of a DNA template, and ddH2O is added to make up to 10 μL.

[0018] Furthermore, the reaction program of the PCR amplification is: 94°C for 15 min; 94°C for 20 s, 65-57°C for 1 min, 10 cycles; 94°C for 20 s, 57°C for 1 min, 32 cycles.

[0019] The present invention discloses the following technical effects:

[0020] The present invention discloses a single-nucleotide polymorphism (SNP) molecular marker associated with tomato fruit sepal length. This SNP molecular marker co-segregates with the tomato fruit sepal length phenotype. By detecting the polymorphism at the SNP site of this molecular marker, it is possible to identify differences in tomato fruit sepal length. Compared with the existing naked eye observation method, molecular marker-assisted selection breeding using this SNP molecular marker can predict tomato fruit sepal length at an early stage, thereby reducing field planting costs, shortening the breeding cycle, and improving the efficiency of breeding long-sepal tomato varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0022] Figure 1 shows the results of the GWAS analysis of tomato fruit sepal length. The orange origin in the figure indicates the SNP significantly associated with tomato fruit sepal length detected at position 64383448 on chromosome 1;

[0023] Figure 2 shows the sepal length values ​​of 32 short sepal materials and 32 long sepal materials, wherein the sepal length values ​​of the 32 short sepal materials are between 5.51-15.42 mm, and the sepal length values ​​of the 32 long sepal materials are between 35.92-48.75 mm. DETAILED DESCRIPTION

[0024] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0025] It should be understood that the terms used herein are intended solely to describe particular embodiments and are not intended to limit the present invention. Furthermore, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also encompassed by the present invention. The upper and lower limits of these smaller ranges may independently be included or excluded within the range.

[0026] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0027] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0028] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0029] Example 1

[0030] Mining of SNPs associated with tomato fruit sepal length: Genome-wide association studies (GWAS) were performed on the genomic data of 294 germplasm resources (shown in Table 1, donated by Professor Huang Sanwen's team) and fruit sepal length. A SNP significantly associated with tomato sepal length was detected at position 64383448 on chromosome 1, as shown in Figure 1.

[0031] Method for measuring the sepal length of tomato fruit: Use a vernier caliper to measure, and measure 5 fruits of the same maturity for each individual plant. When measuring, flatten the sepals and measure from the connection between the sepals and the fruit stalk.

[0032] Table 1 294 germplasm resources Note: “ / ” represents deletion, “BIG” represents big-fruited tomato, “CER” represents cherry tomato, and “PIM” represents currant tomato.

[0033] Example 2

[0034] 1. Screening of test materials

[0035] In addition, 32 short sepal materials and 32 long sepal materials were selected (all varieties other than the 294 germplasm resources in Example 1). The sepal length values ​​of the 32 short sepal materials were between 5.51-15.42 mm, and the sepal length values ​​of the 32 long sepal materials were between 35.92-48.75 mm (Figure 2).

[0036] 2. Material handling

[0037] Take a 1 cm long and wide leaf and place it in a deep-well plate (96 wells, 1.2 mL); add 100 μL of 0.3 M sodium hydroxide and grind the sample at 50 Hz for 2 min (until the sample is completely ground) (Shanghai Jingxin Tissue Grinder); after grinding, centrifuge at 3000 rpm for 1 min and boil in water for 2 min; then add 200 μL of 0.2 M Tris-HCl (pH 6.8-7.0) and mix well, and boil in water again for 2 min; after the water bath is completed, centrifuge at 3000 rpm for 1 min, take the supernatant and dilute it 20 times, freeze it at -20°C, and use it as a template for subsequent PCR amplification.

[0038] 3. Design of primer combinations for PARMS detection of SNP molecular markers

[0039] Based on the SNP site obtained from the GWAS analysis results of Example 1, position 64383448 on chromosome 1 was searched. One locus-specific primer and two SNP allele-specific primers (Allele T primer and Allele A primer) were designed. The Allele T primer was connected to a FAM blue fluorescent linker sequence, and the Allele A primer was connected to a HEX green fluorescent linker sequence. The primer sequences are shown in Table 2:

[0040] Table 2 Primer sequences Note: The underlined sequence is the fluorescent tag sequence.

[0041] The nucleotide sequence of the PCR amplification product (SEQ ID NO.1) is as follows:

[0042] ACTACAATCCTTAACATGTACTTCATACWTCCAAACAAGTCCTTTATCATATAGTC, where W is A or T.

[0043] 4. PCR reaction system and amplification procedure

[0044] The PCR reaction system is shown in Table 3:

[0045] Table 3 PCR reaction system

[0046] The PCR reaction program is shown in Table 4 (dual-head 384 PCR instrument ABI Gene Amp 9700):

[0047] Table 4 PCR reaction procedure

[0048] 5. Genotyping results

[0049] After PCR, fluorescence signals were read using a TECAN infinite M1000 microplate reader. The signals were then analyzed and converted using the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ), resulting in clear and intuitive genotyping plots. Genotyping results were output based on color coding (see Table 5). PARMS genotyping results for 32 short-sepal accessions revealed that 29 accessions were assigned the HEX genotype, consistent with the accession's native genotype A. Two accessions had deletions at this locus and were assigned the HEX genotype, while one accession showed no results. PARMS genotyping results for 32 long-sepal accessions revealed that 30 accessions were assigned the FAM genotype, consistent with the accession's genotype T. Two accessions had deletions at this locus and were assigned the HEX genotype. Comprehensive analysis of the PARMS results for the 64 accessions revealed that the PCR genotyping results for 59 accessions were consistent with the accession's genotype, demonstrating the high accuracy of this molecular marker.

[0050] Table 5 Comparison of genotypes and SNP typing results of PARMS detection in 64 test materials

[0051] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. An SNP molecular marker related to the sepal length of tomato fruits, Characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1; there is an SNP site at the 29th bp of the SNP molecular marker, which is an A / T mutation.

2. A PARMS primer combination for amplifying the SNP molecular marker according to claim 1, Characterized in that, It includes two specific upstream primers with nucleotide sequences shown in SEQ ID NO.2-3 and a common downstream primer with a nucleotide sequence shown in SEQ ID NO.

4.

3. Use of the PARMS primer combination according to claim 2 in the preparation of a kit for predicting the sepal length of tomato fruits.

4. A kit for predicting the sepal length of tomato fruits, Characterized in that, It includes the PARMS primer combination according to claim 2.

5. Use of the SNP molecular marker according to claim 1 in predicting the sepal length of tomato fruits.

6. Use of the PARMS primer combination according to claim 2 in predicting the sepal length of tomato fruits.

7. A method for predicting the sepal length of tomato fruits, Characterized in that, It includes the following steps: Extract the genomic DNA of the tomato plant to be tested; Using the genomic DNA as a template, PCR amplify and sequence to obtain the genotype of the SNP site of the SNP molecular marker according to claim 1, and predict the fruit sepal length of the tomato plant to be tested according to the genotype. The fruit sepal length of the TT genotype is greater than that of the AA genotype.

8. According to the method of claim 7, Characterized in that, Use the PARMS primer combination according to claim 2 for PCR amplification and sequencing to obtain the genotype of the SNP site of the SNP molecular marker according to claim 1.

9. According to the method of claim 8, Characterized in that, The reaction system for the PCR amplification is as follows: 5 μL of 2×PARMS master mix, 0.15 μL each of two 10 μM specific upstream primers, 0.4 μL of 10 μM universal downstream primer, and 100 ng of DNA template, supplemented with ddH 2 O to 10 μL.

10. According to the method of claim 8, Characterized in that, The reaction program of the PCR amplification is: 94°C for 15 min; 94°C for 20 s, 65 - 57°C for 1 min, 10 cycles; 94°C for 20 s, 57°C for 1 min, 32 cycles.

Images