Optimized QBE base editing system and use thereof
By designing a base editing fusion protein containing deaminase and DNA binding protein domains, the editing window is expanded, the problem of limited editing window in the existing technology is solved, more efficient base editing is achieved, and the scope of application is expanded.
Patent Information
- Application Number
- PCT/CN2024/137281
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-04
- Filing Date
- 2024-12-06
- Publication Date
- 2025-06-12
AI Technical Summary
The editing window of the existing base editing system is limited, which makes some bases in the genome unable to be edited, limiting the scope of application of base editing technology.
A base editing fusion protein was designed, including a deaminase domain and a pair of DNA binding protein domains with DNA single-strand cleavage functions, expanding the editing window so that more bases can be edited.
It achieves higher editing efficiency and low indel frequency, expanding the application scope of base editing technology, especially in the fields of basic research in life sciences, agriculture and biomedicine.
Smart Images

Figure CN2024137281_12062025_PF_FP_ABST
Abstract
Description
Optimized QBE base editing system and its applications
[0001] Priority and related applications
[0002] This application claims priority to Chinese patent applications 202311662136.4, 202410044584.6 and 202410718712.0, filed on December 6, 2023, January 11, 2024 and June 4, 2024, entitled “Optimized base editing system and its application”, the entire contents of which, including the appendix, are incorporated herein by reference. Technical Field
[0003] The present invention belongs to the field of genetic engineering. Specifically, the present invention relates to a system, tools and methods for modifying or editing target nucleotide bases. More specifically, the present invention relates to an optimized QBE base editing system and its applications. Background Art
[0004] Base editing refers to the process of replacing nucleotides at specific DNA sites through genetic engineering. Base editing is a type of genome editing technology. In plants, many excellent agronomic traits are produced by single nucleotide variations (SNVs); in humans and animals, many genetic diseases are caused by point mutations in functional genes. Base editing technology can be used to modify and transform the genomic DNA of animals, plants, and microorganisms to create new genotypes and obtain target traits that are beneficial to production applications. It can also be used to correct some serious congenital genetic variations in the treatment of genetic diseases. Therefore, base editing has important application prospects in the creation of excellent germplasm and disease treatment.
[0005] Base editing is achieved with the help of a base editor system. Based on the type of bases affected by the base editor system, base editing systems can be divided into two categories: 1) cytosine base editor system (CBE) and 2) adenine base editor system (ABE). Among them, CBE can act on the cytidine base on the cytosine deoxyribonucleotide (abbreviated as cytidine, C), while ABE can act on the adenine base on the adenine deoxyribonucleotide (abbreviated as adenosine, A). CBE editing can convert CG base pairs on double-stranded DNA to TA base pairs; ABE editing can convert AT base pairs on double-stranded DNA to GC base pairs.
[0006] Because the DNA-binding proteins used in base editing systems typically target only single-stranded DNA, the untargeted DNA strands are not encapsulated by the proteins. Free-standing single-stranded DNA forms an editing window with multiple bases. For example, CBEs have an editing window of 4-5 bases, and ABEs have an editing window of 3-4 bases. All cytidine or adenosine residues within the editing window have a chance of being edited.
[0007] Regulating the editing window size of base editing systems has practical applications. Because Cas protein targeting relies on PAM sequences, some bases in the genome are restricted by PAMs and cannot be edited. For example, in the human genome, only approximately 20% of cytidines or guanines can be edited. Therefore, widening the base editing window and increasing the probability of editing bases within the PAM-distal editing window can help expand the editable range in the genome.
[0008] Therefore, expanding the editing window while maintaining the efficiency and Indel frequency of gene editing tools is of great value in expanding the application scenarios of base editing technology in basic research in life sciences, agriculture, biomedicine and other fields. Summary of the Invention
[0009] Problems to be solved by the invention
[0010] In order to enrich the toolbox of base editing systems and broaden the application scenarios of base editing systems, the present invention provides a series of new base editing systems, which can achieve cytosine base editing or adenine base editing.
[0011] Solutions for solving problems
[0012] In a first aspect of the present invention, a base editing fusion protein is provided, wherein the base editing fusion protein comprises a deaminase domain and a paired DNA binding protein domain having a DNA single-strand cleavage function;
[0013] The paired DNA binding protein domains with DNA single-strand cleavage function include a deaminase N-terminal connecting domain and a deaminase C-terminal connecting domain, and the deaminase N-terminal connecting domain and the deaminase C-terminal connecting domain are respectively connected to the N-terminus and C-terminus of the deaminase domain through optional linkers.
[0014] In some embodiments, the base editing fusion protein comprises the structure: [deaminase N-terminal connecting domain]-[deaminase]-[deaminase C-terminal connecting domain], where "-" is an optional linker.
[0015] In some embodiments, the deaminase N-terminal connecting domain and the deaminase C-terminal connecting domain are independently composed of 1-2 single domains.
[0016] In some optional embodiments, the base editing fusion protein comprises the structure: [X1]-[X2]-[deaminase]-[X3]-[X4], wherein X 1-4 represents a single domain, and “-” represents an optional linker.
[0017] In some optional embodiments, the X 1-4 The single domain is selected from the following combinations:
[0018] (1) X1 is SEQ ID NO: 158, X2 is SEQ ID NO: 159, X3 is SEQ ID NO: 160, and X4 is absent;
[0019] (2) X1 is none, X2 is SEQ ID NO: 161, X3 is SEQ ID NO: 162, and X4 is SEQ ID NO: 163;
[0020] (3) X1 is none, X2 is SEQ ID NO: 164, X3 is SEQ ID NO: 165, and X4 is SEQ ID NO: 166;
[0021] (4) X1 is SEQ ID NO: 181, X2 is SEQ ID NO: 182, X3 is sequence Q, and X4 is absent;
[0022] (5) X1 is none, X2 is SEQ ID NO: 183, X3 is SEQ ID NO: 184, and X4 is SEQ ID NO: 185;
[0023] (6) X1 is none, X2 is SEQ ID NO: 186, X3 is SEQ ID NO: 187, and X4 is SEQ ID NO: 188;
[0024] (7) X1 is SEQ ID NO: 189, X2 is SEQ ID NO: 190, X3 is SEQ ID NO: 191, and X4 is absent;
[0025] (8) X1 is SEQ ID NO: 192, X2 is SEQ ID NO: 193, X3 is SEQ ID NO: 194, and X4 is absent;
[0026] (9) X1 is SEQ ID NO: 195, X2 is SEQ ID NO: 196, X3 is SEQ ID NO: 197, and X4 is absent;
[0027] (10) X1 is SEQ ID NO: 198, X2 is SEQ ID NO: 199, X3 is SEQ ID NO: 200, and X4 is absent.
[0028] In some embodiments, the deaminase is cytidine deaminase or adenosine deaminase.
[0029] In some embodiments, the cytidine deaminase is selected from an APOBEC family deaminase, an SCP1.201 family deaminase, or a homolog thereof.
[0030] In some preferred embodiments, the APOBEC family deaminase is selected from AID deaminase, APOBEC1 deaminase, APOBEC2 deaminase, APOBEC3A deaminase, APOBEC3B deaminase, APOBEC3C deaminase, APOBEC3D deaminase, APOBEC3F deaminase, APOBEC3G deaminase, APOBEC3H deaminase, or variants thereof.
[0031] In some preferred embodiments, the SCP1.201 family deaminase is selected from Sdd2, Sdd3, Sdd4 deaminase, Sdd6 deaminase, Sdd7 deaminase, Sdd9 deaminase, Sdd10 deaminase, Sdd59 deaminase, mini-Sdd3 deaminase, mini-Sdd6 deaminase, mini-Sdd7 deaminase, mini-Sdd9 deaminase, or variants thereof.
[0032] In some embodiments, the adenosine deaminase is selected from QB34, TadA8e, TadA7.10, a TadA dimer, or a variant thereof.
[0033] In some optional embodiments, the TadA dimer comprises TadA7.10 and wild-type TadA.
[0034] In some embodiments, the base editing fusion protein further comprises a uracil DNA glycosylase inhibitor (UGI) domain and / or a nuclear localization sequence (NLS).
[0035] In some embodiments, the linker is 0-100 amino acids in length.
[0036] In some preferred embodiments, the linker is 12-100 amino acids long.
[0037] In some optional embodiments, the linker comprises the amino acid sequence (GGGS)n (SEQ ID NO:47), (GGGGS)n (SEQ ID NO:48), (G)n, (EAAAK)n (SEQ ID NO:49), (GGS)n, (SGGS)n (SEQ ID NO:51), SGSETPGTSESATPES (SEQ ID NO:52), or (XP)n motif, or a combination thereof, wherein n is independently an integer from 1 to 32, and wherein X is any amino group.
[0038] In some embodiments, the base editing fusion protein comprises one or more of the following sequences:
[0039] (i) an amino acid sequence as shown in any one of SEQ ID NOs: 89-92, 94, 96, 99, 101, 103, 105-115, 118, 179, 201-206;
[0040] (ii) an amino acid sequence that has at least 80%, 82%, 85%, 87%, 90%, 92%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence set forth in any one of SEQ ID NOs: 89-92, 94, 96, 99, 101, 103, 105-115, 118, 179, 201-206;
[0041] (iii) an amino acid sequence in which one or more amino acid residues are added, substituted, deleted or inserted into the amino acid sequence of any one of SEQ ID NOs: 89-92, 94, 96, 99, 101, 103, 105-115, 118, 179, 201-206; or
[0042] (iv) an amino acid sequence encoded by a nucleotide sequence that hybridizes to a polynucleotide sequence encoding the amino acid sequence shown in any one of SEQ ID NOs: 89-92, 94, 96, 99, 101, 103, 105-115, 118, 179, 201-206 under stringent conditions, which are medium stringency conditions, medium-high stringency conditions, high stringency conditions or very high stringency conditions.
[0043] In some embodiments, the base editing fusion protein forms a complex with the guide RNA and binds to the target DNA.
[0044] In a second aspect of the present invention, a base editing system is provided, wherein the base editing system comprises at least one of the following components i) to v):
[0045] i) base editing fusion protein and guide RNA;
[0046] ii) an expression construct comprising a nucleotide sequence encoding a base editor fusion protein, and a guide RNA;
[0047] iii) a base editing fusion protein, and an expression construct comprising a nucleotide sequence encoding a guide RNA;
[0048] iv) an expression construct comprising a nucleotide sequence encoding a base editor fusion protein, and an expression construct comprising a nucleotide sequence encoding a guide RNA;
[0049] v) an expression construct comprising a nucleotide sequence encoding a base editing fusion protein and a nucleotide sequence encoding a guide RNA;
[0050] The base editing fusion protein comprises a deaminase domain and a paired DNA binding protein domain with DNA single-strand cleavage function;
[0051] The paired DNA binding protein domains with DNA single-strand cleavage function include a deaminase N-terminal connecting domain and a deaminase C-terminal connecting domain, and the deaminase N-terminal connecting domain and the deaminase C-terminal connecting domain are respectively connected to the N-terminus and C-terminus of the deaminase domain through optional linkers.
[0052] In some embodiments, the base editing fusion protein comprises the structure: [deaminase N-terminal connecting domain]-[deaminase]-[deaminase C-terminal connecting domain], where "-" is an optional linker.
[0053] In some embodiments, the deaminase N-terminal connecting domain and the deaminase C-terminal connecting domain are independently composed of 1-2 single domains.
[0054] In some optional embodiments, the base editing fusion protein comprises the structure: [X1]-[X2]-[deaminase]-[X3]-[X4], wherein X 1-4 represents a single domain, and “-” represents an optional linker.
[0055] In some embodiments, the X 1-4 The single domain is selected from the following combinations:
[0056] (1) X1 is SEQ ID NO: 158, X2 is SEQ ID NO: 159, X3 is SEQ ID NO: 160, and X4 is absent;
[0057] (2) X1 is none, X2 is SEQ ID NO: 161, X3 is SEQ ID NO: 162, and X4 is SEQ ID NO: 163;
[0058] (3) X1 is none, X2 is SEQ ID NO: 164, X3 is SEQ ID NO: 165, and X4 is SEQ ID NO: 166;
[0059] (4) X1 is SEQ ID NO: 181, X2 is SEQ ID NO: 182, X3 is sequence Q, and X4 is absent;
[0060] (5) X1 is none, X2 is SEQ ID NO: 183, X3 is SEQ ID NO: 184, and X4 is SEQ ID NO: 185;
[0061] (6) X1 is none, X2 is SEQ ID NO: 186, X3 is SEQ ID NO: 187, and X4 is SEQ ID NO: 188;
[0062] (7) X1 is SEQ ID NO: 189, X2 is SEQ ID NO: 190, X3 is SEQ ID NO: 191, and X4 is absent;
[0063] (8) X1 is SEQ ID NO: 192, X2 is SEQ ID NO: 193, X3 is SEQ ID NO: 194, and X4 is absent;
[0064] (9) X1 is SEQ ID NO: 195, X2 is SEQ ID NO: 196, X3 is SEQ ID NO: 197, and X4 is absent;
[0065] (10) X1 is SEQ ID NO: 198, X2 is SEQ ID NO: 199, X3 is SEQ ID NO: 200, and X4 is absent.
[0066] In some embodiments, the deaminase is cytidine deaminase or adenosine deaminase.
[0067] In some embodiments, the cytidine deaminase is selected from an APOBEC family deaminase, an SCP1.201 family deaminase, or a homolog thereof.
[0068] In some preferred embodiments, the APOBEC family deaminase is selected from AID deaminase, APOBEC1 deaminase, APOBEC2 deaminase, APOBEC3A deaminase, APOBEC3B deaminase, APOBEC3C deaminase, APOBEC3D deaminase, APOBEC3F deaminase, APOBEC3G deaminase, APOBEC3H deaminase, or variants thereof.
[0069] In some preferred embodiments, the SCP1.201 family deaminase is selected from Sdd2, Sdd3, Sdd4 deaminase, Sdd6 deaminase, Sdd7 deaminase, Sdd9 deaminase, Sdd10 deaminase, Sdd59 deaminase, mini-Sdd3 deaminase, mini-Sdd6 deaminase, mini-Sdd7 deaminase, mini-Sdd9 deaminase, or variants thereof.
[0070] In some embodiments, the adenosine deaminase is selected from QB34, TadA8e, TadA7.10, a TadA dimer or a variant thereof, and optionally, the TadA dimer comprises TadA7.10 and wild-type TadA.
[0071] In some embodiments, the base editing fusion protein further comprises a uracil DNA glycosylase inhibitor (UGI) domain and / or a nuclear localization sequence (NLS).
[0072] In some embodiments, the linker is 0-100 amino acids in length.
[0073] In some preferred embodiments, the linker is 12-100 amino acids long.
[0074] In some optional embodiments, the linker comprises the amino acid sequence (GGGS)n (SEQ ID NO:47), (GGGGS)n (SEQ ID NO:48), (G)n, (EAAAK)n (SEQ ID NO:49), (GGS)n, (SGGS)n (SEQ ID NO:51), SGSETPGTSESATPES (SEQ ID NO:52), or (XP)n motif, or a combination thereof, wherein n is independently an integer from 1 to 32, and wherein X is any amino group.
[0075] In some embodiments, the base editing fusion protein comprises one or more of the following sequences:
[0076] (i) an amino acid sequence as shown in any one of SEQ ID NOs: 89-92, 94, 96, 99, 101, 103, 105-115, 118, 179, 201-206;
[0077] (ii) an amino acid sequence that has at least 80%, 82%, 85%, 87%, 90%, 92%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence set forth in any one of SEQ ID NOs: 89-92, 94, 96, 99, 101, 103, 105-115, 118, 179, 201-206;
[0078] (iii) an amino acid sequence in which one or more amino acid residues are added, substituted, deleted or inserted into the amino acid sequence of any one of SEQ ID NOs: 89-92, 94, 96, 99, 101, 103, 105-115, 118, 179, 201-206; or
[0079] (iv) an amino acid sequence encoded by a nucleotide sequence that hybridizes to a polynucleotide sequence encoding the amino acid sequence shown in any one of SEQ ID NOs: 89-92, 94, 96, 99, 101, 103, 105-115, 118, 179, 201-206 under stringent conditions, which are medium stringency conditions, medium-high stringency conditions, high stringency conditions or very high stringency conditions.
[0080] In some embodiments, the base editing fusion protein forms a complex with the guide RNA and binds to the target DNA.
[0081] In a third aspect of the present invention, a polynucleotide is provided, wherein the polynucleotide encodes:
[0082] (a) the base editing fusion protein described in the first aspect of the present invention;
[0083] (b) The base editing system described in the second aspect of the present invention.
[0084] In the fourth aspect of the present invention, an expression construct is provided, wherein the expression construct comprises the polynucleotide described in the third aspect of the present invention.
[0085] In some embodiments, the expression construct is selected from the group consisting of viral, bacterial, yeast, plant, and mammalian cell expression constructs.
[0086] In the fifth aspect of the present invention, a host cell is provided, wherein the host cell contains the base editing fusion protein described in the first aspect of the present invention, the base editing system described in the second aspect of the present invention, the polynucleotide described in the third aspect of the present invention, or the expression construct described in the fourth aspect of the present invention.
[0087] In the sixth aspect of the present invention, a method for producing at least one genetically modified cell is provided, comprising introducing the base editing fusion protein described in the first aspect of the invention, the base editing system described in the second aspect of the invention, the polynucleotide described in the third aspect of the invention, or the expression construct described in the fourth aspect of the invention into at least one of the cells, thereby causing base substitution in the nucleic acid sequence within the target nucleotide region in the at least one cell.
[0088] In some embodiments, the base editing system is introduced into the cell by a method selected from the following: calcium phosphate transfection, protoplast fusion, electroporation, liposome transfection, microinjection, viral infection (such as baculovirus, vaccinia virus, adenovirus, adeno-associated virus, lentivirus or other virus), N-acetylgalactosamine (GalNAc)-mediated, gene gun method, PEG-mediated protoplast transformation and / or Agrobacterium-mediated transformation.
[0089] In some embodiments, the cell is a cell from a prokaryotic organism such as a bacterium; a eukaryotic organism such as a plant, a fungus, or a vertebrate.
[0090] In some embodiments, the vertebrate is a mammal such as a human, mouse, rat, monkey, dog, pig, sheep, cow, cat; and the plant is a crop plant such as wheat, rice, corn, soybean, sunflower, sorghum, rapeseed, alfalfa, cotton, barley, millet, sugarcane, tomato, tobacco, cassava, or potato.
[0091] In the seventh aspect of the present invention, a pharmaceutical composition is provided, wherein the pharmaceutical composition comprises the base editing fusion protein described in the first aspect of the present invention, the base editing system described in the second aspect of the present invention, the polynucleotide described in the third aspect of the present invention, the expression construct described in the fourth aspect of the present invention, or the host cell described in the fifth aspect of the present invention.
[0092] In some optional embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.
[0093] In the eighth aspect of the present invention, a kit is provided, wherein the kit comprises the base editing fusion protein described in the first aspect of the present invention, the base editing system described in the second aspect of the present invention, the polynucleotide described in the third aspect of the present invention, the expression construct described in the fourth aspect of the present invention, or the host cell described in the fifth aspect of the present invention.
[0094] In the ninth aspect of the present invention, a method for modifying a target nucleic acid is provided, wherein the method comprises the step of contacting the target nucleic acid with the base editing fusion protein described in the first aspect of the present invention, the base editing system described in the second aspect of the present invention, the polynucleotide described in the third aspect of the present invention, the expression construct described in the fourth aspect of the present invention, the pharmaceutical composition described in the seventh aspect of the present invention, or the kit described in the eighth aspect of the present invention.
[0095] In the tenth aspect of the present invention, provided is the use of the base editing fusion protein described in the first aspect of the present invention, the base editing system described in the second aspect of the present invention, the polynucleotide described in the third aspect of the present invention, the expression construct described in the fourth aspect of the present invention, the host cell described in the fifth aspect of the present invention, or the pharmaceutical composition described in the seventh aspect of the present invention in the preparation of a reagent for modifying a target nucleic acid.
[0096] In the eleventh aspect of the present invention, provided is the use of the base editing fusion protein described in the first aspect of the present invention, the base editing system described in the second aspect of the present invention, the polynucleotide described in the third aspect of the present invention, the expression construct described in the fourth aspect of the present invention, or the host cell described in the fifth aspect of the present invention in the preparation of a medicament for preventing and / or treating diseases related to or caused by gene mutations.
[0097] Effects of the Invention
[0098] (1) Compared with the prior art BE base editing system, the novel QBE base editing system provided by the present invention has comparable or higher editing efficiency and low indel frequency;
[0099] (2) Compared with the prior art BE base editing system, the novel QBE base editing system provided by the present invention has higher product purity;
[0100] (3) The novel QBE base editing system provided by the present invention has an editing window that is different from that of conventional BE editing systems. Its editing window is reflected in the base editing system having an expanded base editing window, which can achieve base editing in more editing windows;
[0101] (4) The novel QBE base editing system provided by the present invention has lower off-target effects than the conventional BE base editing system. BRIEF DESCRIPTION OF THE DRAWINGS
[0102] Figure 1 is a schematic diagram of the structure of QBE connected to deaminase. The linker and NLS are selected according to the techniques known in the art.
[0103] Figure 2. Schematic diagram of the base editing system fusion protein structure composed of QBE1-4. The promoter, NLS, and UGI are selected according to the well-known technology in the art. When the base editing system is an adenosine deaminase base editing system, UGI is not contained.
[0104] Figure 3. Base editing efficiency of the base editing system connected to different deaminases.
[0105] Figure 4. Indel efficiency of the base editing system connecting different deaminases.
[0106] Figure 5. Editing efficiency / indel of the base editing system connected to different deaminases.
[0107] Figure 6. Editing efficiency and editing products of the base editing system at endogenous targets, where the black portion of the site sequence represents the original spacer sequence and the blue portion represents the PAM sequence.
[0108] Figure 7. Editing efficiency of the adenosine base editing system at each site in the base editing window.
[0109] Figure 8. Editing efficiency of the cytidine base editing system at each site in the base editing window.
[0110] Figure 9. Grayscale image of each point in the editing window of the cytidine base editing system.
[0111] Figure 10. AlphaFold3 predicts the structure of the ternary complex of base editors (BE4max and QBEmax), sgRNA, and DNA.
[0112] Figure 11. Editing effects of BE4max, QBEmax, CBE-CP1031, and CBE-Inlaid1244.
[0113] Figure 12. The effect of replacing the QBEmax base editing system with different linker lengths on editing efficiency.
[0114] Figure 13. Base editing effects of BE4max and QBEmax in rice plant cells. The black portion of the site sequence represents the protospacer sequence, and the red portion represents the PAM sequence.
[0115] Figure 14. Base editing effect of QBE84-QBE90. DETAILED DESCRIPTION
[0116] 1. Definition
[0117] In the present invention, unless otherwise indicated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the terms and laboratory procedures related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology used herein are terms and routine procedures widely used in the corresponding fields. For example, the standard recombinant DNA and molecular cloning techniques used in the present invention are well known to those skilled in the art and are more fully described in the following literature: Sambrook, Joseph Frank et al. "Molecular Cloning: A Laboratory Manual." (2001). (hereinafter referred to as "Sambrook"). At the same time, in order to better understand the present invention, the definitions and explanations of the relevant terms are provided below.
[0118] As used herein, the term "and / or" encompasses all combinations of items connected by the term, and should be treated as if each combination had been individually listed herein. For example, "A and / or B" encompasses "A," "A and B," and "B." For example, "A, B, and / or C" encompasses "A," "B," "C," "A and B," "A and C," "B and C," and "A and B and C."
[0119] When the word "comprising" is used herein to describe a sequence of a protein or nucleic acid, the protein or nucleic acid may be composed of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, but still have the activity described in the present invention. In addition, it is clear to those skilled in the art that the methionine encoded by the start codon at the N-terminus of the polypeptide may be retained in certain practical situations (for example, when expressed in a specific expression system), but it does not substantially affect the function of the polypeptide. Therefore, when describing a specific polypeptide amino acid sequence in the specification and claims of this application, although it may not contain a methionine encoded by a start codon at the N-terminus, a sequence containing the methionine is also covered, and accordingly, its encoding nucleotide sequence may also contain a start codon; and vice versa.
[0120] "Gene" and "genome" as used herein encompass not only the chromosomal DNA present in the cell nucleus, but also the organelle DNA present in subcellular components of the cell (eg, mitochondria, plastids).
[0121] As used herein, "organism" includes any organism suitable for genome editing, preferably a eukaryotic organism. Examples of organisms include, but are not limited to, mammals such as humans, mice, rats, monkeys, dogs, pigs, sheep, cattle, and cats; poultry such as chickens, ducks, and geese; and plants, including monocots and dicots, such as rice, corn, wheat, sorghum, barley, soybeans, peanuts, and Arabidopsis.
[0122] "Genetically modified organism" or "genetically modified cell" refers to an organism or cell that contains an exogenous polynucleotide or a modified gene or expression control sequence within its genome. For example, the exogenous polynucleotide is capable of stably integrating into the genome of the organism or cell and being inherited through successive generations. The exogenous polynucleotide can be integrated into the genome alone or as part of a recombinant DNA construct. A modified gene or expression control sequence is one that contains single or multiple deoxynucleotide substitutions, deletions, and additions within the genome of the organism or cell.
[0123] "Polynucleotide," "nucleic acid sequence," "nucleotide sequence," or "nucleic acid fragment" are used interchangeably and are single-stranded or double-stranded polymers of RNA or DNA that optionally contain synthetic, non-natural, or altered nucleotide bases. Nucleotides are referred to by their single-letter names as follows: "A" is adenosine or deoxyadenosine (RNA or DNA, respectively), "C" is cytidine or deoxycytidine, "G" is guanosine or deoxyguanosine, "U" is uridine, "T" is deoxythymidine, "R" is a purine (A or G), "Y" is a pyrimidine (C or T), "K" is G or T, "H" is A or C or T, "I" is inosine, and "N" is any nucleotide.
[0124] In this specification, "target nucleic acid", "target DNA", "target nucleotide", "target nucleotide region", and "target nucleic acid region" are used interchangeably to refer to the nucleic acid sequence in the genome to which the DNA binding protein specifically binds under the guidance of the guide nucleic acid.
[0125] In this specification, "target sequence" or "target DNA sequence" refers to a sequence to which a guide nucleic acid will hybridize.
[0126] In this specification, "protospacer sequence", "protospacer", and "editing window sequence" are used interchangeably and refer to a nucleic acid sequence in the genome that is complementary to the target sequence. In the natural state, the protospacer sequence is adjacent to the protospacer adjacent motif (PAM). During the base editing process, the nucleotides in this sequence can undergo deamination and nucleotide substitution under the action of the base editing system.
[0127] "Polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residues is an artificial chemical analog of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. The terms "polypeptide," "peptide," "amino acid sequence," and "protein" may also include modified forms including, but not limited to, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation, and ADP-ribosylation.
[0128] Sequence "identity" has a meaning recognized in the art, and the percentage of sequence identity between two nucleic acid or polypeptide molecules or regions can be calculated using published techniques. Sequence identity can be measured along the entire length of a polynucleotide or polypeptide or along a region of the molecule. (See, for example: Lesk, AM, ed., "Computational Molecular Biology", (1988); Smith, DW, ed., "Biocomputing: Informatics and Genome Projects", (1993); Griffin, AM, and Griffin, HG, eds., "Computer Analysis of Sequence Data", Part I, (1994); von Heinje, G., "Sequence Analysis in Molecular Biology", (1987); Gribskov, M. and Devereux, J., eds., "Sequence Analysis Primer", (1991)). While there are many methods to measure the identity between two polynucleotides or polypeptides, the term "identity" is well known to those of skill in the art (Carrillo, H. & Lipman, D., "The multiple sequence alignment problem in biology", SIAM J Applied Math 48: 1073 (1988)).
[0129] In peptides or proteins, suitable conservative amino acid substitutions are known to those skilled in the art and can generally be made without altering the biological activity of the resulting molecule. Generally, those skilled in the art recognize that single amino acid substitutions in non-essential regions of a polypeptide do not substantially alter biological activity (see, e.g., Watson et al., "Molecular Biology of the Gene", 4th Edition, Development 1 August 1988; 103(4): 619–623.).
[0130] "Base editing system", "base editor", "Base Editor (BE)" is a system or preparation that binds to a polynucleotide and has nuclear base editing and activity. In some embodiments, it includes a nuclear base editing polypeptide (such as a deaminase) and a DNA binding protein domain (such as a nucleic acid programmable domain), which forms a complex with a guide polynucleotide (such as a gRNA). In some embodiments, the nuclear base editing polypeptide is fused to the DNA binding protein domain by fusion, linking or embedding to form a fusion protein. In some embodiments, the base editing system is a cytidine base editing system (CBE), which can deaminate cytosine (C) in a DNA molecule. In some embodiments, the base editing system is an adenosine base editing system (ABE), which can deaminate adenine (A) in a DNA molecule.
[0131] As used herein, "expression construct" or "construct" refers to a vector, such as a recombinant vector, suitable for expressing a nucleotide sequence of interest in an organism. "Expression" refers to the production of a functional product. For example, expression of a nucleotide sequence can refer to the transcription of the nucleotide sequence (e.g., transcription to produce mRNA or functional RNA) and / or translation of RNA into a precursor or mature protein.
[0132] The "expression construct" of the present invention can be a linear nucleic acid fragment, a circular plasmid, a viral vector, or, in some embodiments, can be an RNA (such as mRNA) that can be translated.
[0133] An "expression construct" of the present invention may comprise regulatory sequences and a nucleotide sequence of interest from different sources, or regulatory sequences and a nucleotide sequence of interest from the same source but arranged in a manner different from that normally found in nature.
[0134] The term "mutation" refers to the substitution of a residue within a sequence (e.g., a nucleic acid or amino acid sequence) with another residue or the deletion or insertion of one or more residues within the sequence. Mutations are typically described herein by identifying the original residue, followed by the position of the residue within the sequence and the identity of the newly substituted residue.
[0135] "Promoter" refers to a nucleic acid fragment that is capable of controlling the transcription of another nucleic acid fragment. In some embodiments of the present invention, a promoter is a promoter that is capable of controlling the transcription of a gene in a cell, whether or not it is derived from the cell. A promoter can be a constitutive promoter, a tissue-specific promoter, a developmentally regulated promoter, or an inducible promoter.
[0136] As used herein, the term "operably linked" refers to the connection of a regulatory element (e.g., but not limited to, a promoter sequence, a transcription termination sequence, etc.) to a nucleic acid sequence (e.g., a coding sequence or an open reading frame) such that transcription of the nucleotide sequence is controlled and regulated by the transcriptional regulatory element. Techniques for operably linking regulatory element regions to nucleic acid molecules are known in the art.
[0137] "Introducing" a nucleic acid molecule (e.g., a plasmid, a linear nucleic acid fragment, RNA, etc.) or a protein into an organism refers to transforming an organism cell with the nucleic acid or protein so that the nucleic acid or protein can function in the cell. "Transformation" as used herein includes stable transformation and transient transformation.
[0138] "Transient transformation" refers to the introduction of a nucleic acid molecule or protein into a cell where it functions without the exogenous nucleotide sequence being stably inherited. In transient transformation, the exogenous nucleic acid sequence does not integrate into the genome.
[0139] "Trait" refers to a physiological, morphological, biochemical, or physical characteristic of a cell or organism.
[0140] "Agronomic traits" specifically refer to measurable indicator parameters of crop plants, including but not limited to: leaf greenness, grain yield, growth rate, total biomass or accumulation rate, fresh weight at maturity, dry weight at maturity, fruit yield, seed yield, plant total nitrogen content, fruit nitrogen content, seed nitrogen content, plant vegetative tissue nitrogen content, plant total free amino acid content, fruit free amino acid content, seed free amino acid content, plant vegetative tissue free amino acid content, plant total protein content, fruit protein content, seed protein content, plant vegetative tissue protein content, herbicide resistance and drought resistance, nitrogen absorption, root lodging, harvest index, stem lodging, plant height, ear height, ear length, disease resistance, cold resistance, salt resistance and tiller number, etc.
[0141] Organisms that can be genomic modified using the base editing system of the present invention include any organism suitable for base editing, preferably eukaryotic organisms. Examples of organisms include, but are not limited to, mammals such as humans, mice, rats, monkeys, dogs, pigs, sheep, cattle, and cats; poultry such as chickens, ducks, and geese; and plants, including monocots and dicots, such as crop plants, including but not limited to wheat, rice, corn, soybeans, sunflowers, sorghum, rapeseed, alfalfa, cotton, barley, millet, sugarcane, tomatoes, tobacco, cassava, and potatoes.
[0142] 2. Base Editing Fusion Proteins
[0143] In one aspect of the present invention, a base editing fusion protein is provided, wherein the base editing fusion protein comprises a deaminase domain and a paired DNA-binding protein domain having a DNA single-strand cleavage function; the paired DNA-binding protein domains having a DNA single-strand cleavage function include a deaminase N-terminal connecting domain and a deaminase C-terminal connecting domain, and the deaminase N-terminal connecting domain and the deaminase C-terminal connecting domain are respectively connected to the N-terminus and C-terminus of the deaminase domain through optional linkers.
[0144] Herein, "DNA binding protein" is a protein that binds to the target DNA, such as a protein that binds to a guide nucleic acid (DNA or RNA), which guides the DNA binding protein to the target DNA sequence. For example, a guide RNA guides the DNA binding protein to a target DNA sequence that is complementary to the guide RNA. In some embodiments, the DNA binding protein can be a binding domain of a protein associated with a Class II or Class V CRISPR system. For example, a Cas9 protein, an inactivated or partially inactivated Cas9 protein with a DNA cleavage domain. The Cas9, CRISPR RNA (crRNA), and transcoded small RNA (tracrRNA) complex recognizes a short protospacer adjacent motif (PAM) and cuts the target DNA in an endonucleolytic manner. "Guide RNA" or "sgRNA" or "gRNA" can be a single RNA obtained by integrating crRNA and tracrRNA (see Jinek M., et al., Science 337:816-821 (2012)). The sequence, structure, and mechanism of action of CRISPR-related proteins are known to those skilled in the art (see, for example, Ferretti, JJ et al. "Complete genome sequence of an M1 strain of Streptococcus pyogenes." Proceedings of the National Academy of Sciences of the United States of America vol. 98, 8 (2001): 4658-63.; Deltcheva E. et al. "CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III." Nature 471: 602-607 (2011); and Jinek, Martin et al. "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity." Science (New York, NY) vol. 337, 6096 (2012): 816-21.).In some embodiments, sgRNA can also be an RNA with a guide function based on structure prediction (see, for example, Nguyen E, Poli M, Durrant MG, Kang B, Katrekar D, Li DB, Bartie LJ, Thomas AW, King SH, Brixi G, Sullivan J, Ng MY, Lewis A, Lou A, Ermon S, Baccus SA, Hernandez-Boussard T, Ré C, Hsu PD, Hie BL. Sequence modeling and design from molecular to genome scale with Evo. Science. 2024 Nov 15; 386(6723)).
[0145] In some embodiments, the backbone sequence of the sgRNA is shown in SEQ ID NO: 151, 220, or 221.
[0146] In some embodiments, the DNA binding protein herein has a cutting activity on a target DNA single strand, for example, after the DNA binding protein is bound to the target DNA sequence under the guidance of a guide nucleic acid, only single-stranded DNA is cut. In some embodiments of the present invention, the DNA binding protein with single-stranded DNA cutting activity is two paired DNA binding protein domains, and the paired DNA binding protein domains are respectively connected to the N-terminus and C-terminus of the deaminase domain by a joint of 0-500 (preferably 0-100) amino acids in length. In some embodiments of the present invention, the paired DNA binding protein domains can be obtained in the following manner: by carrying out a circular transformation of the DNA binding protein amino acid sequence with single-stranded cutting function, a circular transformation sequence is obtained (for example, see Oakes, Benjamin L et al. "CRISPR-Cas9 Circular Permutants as Programmable Scaffolds for Genome Modification." Cell vol.176, 1-2 (2019): 254-267.e16.). The two sites of the circular conversion sequence are split to obtain a pair of separated polypeptides, which are the paired DNA binding protein domains.
[0147] In some exemplary embodiments, the amino acid sequence of the paired DNA binding protein domains of the present invention is selected from:
[0148] The amino acid sequences shown in SEQ ID NO: 1 and sequence Q;
[0149] The amino acid sequences shown in SEQ ID NO:3 and SEQ ID NO:4;
[0150] The amino acid sequences shown in SEQ ID NO:5 and SEQ ID NO:6;
[0151] The amino acid sequences shown in SEQ ID NO:7 and SEQ ID NO:8;
[0152] The amino acid sequences shown in SEQ ID NO:9 and SEQ ID NO:10;
[0153] The amino acid sequences shown in SEQ ID NO: 11 and SEQ ID NO: 12;
[0154] The amino acid sequences shown in SEQ ID NO: 13 and SEQ ID NO: 14;
[0155] The amino acid sequences shown in SEQ ID NO: 15 and SEQ ID NO: 16;
[0156] The amino acid sequences shown in SEQ ID NO: 17 and SEQ ID NO: 18;
[0157] The amino acid sequences shown in SEQ ID NO: 19 and SEQ ID NO: 20;
[0158] The amino acid sequences shown in SEQ ID NO:21 and SEQ ID NO:22;
[0159] The amino acid sequences shown in SEQ ID NO:23 and SEQ ID NO:24;
[0160] The amino acid sequences shown in SEQ ID NO:25 and SEQ ID NO:26;
[0161] The amino acid sequences shown in SEQ ID NO:27 and SEQ ID NO:28;
[0162] The amino acid sequences shown in SEQ ID NO: 207 and SEQ ID NO: 208;
[0163] The amino acid sequences shown in SEQ ID NO: 209 and SEQ ID NO: 210;
[0164] The amino acid sequences shown in SEQ ID NO:211 and SEQ ID NO:212;
[0165] The amino acid sequences shown in SEQ ID NO: 213 and SEQ ID NO: 214;
[0166] The amino acid sequences shown in SEQ ID NO: 215 and SEQ ID NO: 216; or
[0167] The amino acid sequences shown in SEQ ID NO:217 and SEQ ID NO:218.
[0168] In some exemplary embodiments, the amino acid sequence of the N-terminal connecting domain of the deaminase of the present invention is selected from SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 207, 209, 211, 213, 215, 217; the amino acid sequence of the C-terminal connecting domain of the deaminase is selected from sequence Q, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 208, 210, 212, 214, 216, 218.
[0169] In some embodiments, the base editing fusion protein comprises the structure: [deaminase N-terminal connecting domain]-[deaminase]-[deaminase C-terminal connecting domain], wherein "-" is an optional linker, that is, the domains can be connected by an optional linker.
[0170] In some embodiments, the deaminase N-terminal connecting domain and the deaminase C-terminal connecting domain are independently composed of 1-2 single domains; the base editing fusion protein comprises the structure: [X1]-[X2]-[deaminase]-[X3]-[X4], wherein X 1-4 represents a single domain, and “-” represents an optional linker, that is, the domains can be connected by an optional linker.
[0171] In this article, a "single domain" is a portion of a DNA-binding protein domain. All single domains are combined to form a complete DNA-binding protein domain. A single domain does not contain a linker internally, but has linkers at both ends to connect to other single domains or functional domains (such as deaminases, NLSs, or UGIs).
[0172] In some specific embodiments, the X 1-4 The single domain is selected from the following combinations:
[0173] (1) X1 is SEQ ID NO: 158, X2 is SEQ ID NO: 159, X3 is SEQ ID NO: 160, and X4 is absent;
[0174] (2) X1 is none, X2 is SEQ ID NO: 161, X3 is SEQ ID NO: 162, and X4 is SEQ ID NO: 163;
[0175] (3) X1 is none, X2 is SEQ ID NO: 164, X3 is SEQ ID NO: 165, and X4 is SEQ ID NO: 166;
[0176] (4) X1 is SEQ ID NO: 181, X2 is SEQ ID NO: 182, X3 is sequence Q, and X4 is absent;
[0177] (5) X1 is none, X2 is SEQ ID NO: 183, X3 is SEQ ID NO: 184, and X4 is SEQ ID NO: 185;
[0178] (6) X1 is none, X2 is SEQ ID NO: 186, X3 is SEQ ID NO: 187, and X4 is SEQ ID NO: 188;
[0179] (7) X1 is SEQ ID NO: 189, X2 is SEQ ID NO: 190, X3 is SEQ ID NO: 191, and X4 is absent;
[0180] (8) X1 is SEQ ID NO: 192, X2 is SEQ ID NO: 193, X3 is SEQ ID NO: 194, and X4 is absent;
[0181] (9) X1 is SEQ ID NO: 195, X2 is SEQ ID NO: 196, X3 is SEQ ID NO: 197, and X4 is absent;
[0182] (10) X1 is SEQ ID NO: 198, X2 is SEQ ID NO: 199, X3 is SEQ ID NO: 200, and X4 is absent.
[0183] As used herein, "deaminase" refers to an enzyme that catalyzes a deamination reaction. In some embodiments, the deaminase is a cytidine deaminase or an adenosine deaminase, ie, an enzyme that can remove the amino group of a cytidine molecule or an adenosine molecule.
[0184] In some embodiments, the cytidine deaminase is selected from an APOBEC family deaminase, an SCP1.201 family deaminase, or a homolog thereof; preferably, the APOBEC family deaminase is selected from an AID deaminase, an APOBEC1 deaminase, an APOBEC2 deaminase, an APOBEC3A deaminase, an APOBEC3B deaminase, an APOBEC3C deaminase, an APOBEC3D deaminase, an APOBEC3F deaminase, an APOBEC3G deaminase, an APOBEC3H deaminase, or a variant thereof. The SCP1.201 family deaminase is selected from an Sdd2, Sdd3, Sdd4 deaminase, an Sdd6 deaminase, an Sdd7 deaminase, an Sdd9 deaminase, an Sdd10 deaminase, an Sdd59 deaminase, a mini-Sdd3 deaminase, a mini-Sdd6 deaminase, a mini-Sdd7 deaminase, a mini-Sdd9 deaminase, or a variant thereof. In some embodiments, the cytidine deaminase domain comprises the amino acid sequence of SEQ ID NOs: 54-82, 127, 128.
[0185] In some embodiments, the adenosine deaminase is selected from QB34, TadA8e, TadA7.10, a TadA dimer or a variant thereof, and optionally, the TadA dimer comprises TadA7.10 and wild-type TadA.
[0186] In some specific embodiments, the adenosine deaminase of the present invention is TadA8e, TadA7.10 or their respective mutants, for example, the adenosine deaminase comprises the amino acid sequence of SEQ ID NO: 83-88, or other adenosine deaminases that can be used in the base editing system described in detail below.
[0187] In some embodiments, the fusion protein further comprises a uracil DNA glycosylase inhibitor (UGI) domain and / or a nuclear localization sequence (NLS).
[0188] As used herein, "uracil DNA glycosylase inhibitor" or "UGI" refers to a protein that inhibits the uracil-DNA glycosylase base excision repair enzyme. In some embodiments, the UGI domain comprises the amino acid sequence shown in SEQ ID NO: 124.
[0189] Herein, "nuclear localization sequence (NLS)" or "nuclear localization signal" are used interchangeably and refer to a domain of a protein, usually a short amino acid sequence, which can interact with a nuclear import carrier so that the protein can be transported into the cell nucleus. In general, the one or more NLSs in the fusion protein should have sufficient strength to drive the fusion protein to accumulate in the nucleus of the cell in an amount that can achieve its base editing function. In general, the intensity of nuclear localization activity is determined by the number, position, one or more specific NLSs used, or a combination of these factors in the fusion protein. In some embodiments of the present invention, the NLS of the fusion protein of the present invention may be located at the N-terminus and / or the C-terminus. In some embodiments of the present invention, the NLS of the fusion protein of the present invention may be located between the adenosine deaminase domain, the cytidine deaminase domain, the DNA binding protein domain and / or the UGI. In some embodiments, the fusion protein comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLSs. In some embodiments, the fusion protein is included in or close to about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLSs at the N-terminus. In some embodiments, the fusion protein is included in or close to about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLSs at the C-terminus. In some embodiments, the polypeptide comprises a combination of these, such as one or more NLSs included at the N-terminus and one or more NLSs at the C-terminus. When there is more than one NLS, each can be selected to be independent of the other NLSs. Generally speaking, NLS consists of one or more short sequences of positively charged lysine or arginine exposed on the protein surface, but other types of NLSs are also known. Non-limiting examples of NLSs include amino acid sequences SEQ ID NO: 30-46.
[0190] As used herein, a "linker" or "linker" or "connector peptide" refers to a linker that connects two molecules or moieties, such as two domains of a fusion protein. Typically, a linker is located between or flanking two groups, molecules, or other moieties and is covalently linked to each, thereby connecting the two. In some embodiments, a linker can connect different components of a base editing system or different parts of a component. In some embodiments, a linker can connect a DNA-specific binding component and a deamination component in a base editing fusion protein or base editing system. In some embodiments, a linker is an organic molecule, group, polymer, or chemical moiety. In some embodiments, a linker can be a polynucleotide. In some embodiments, a linker can be a DNA molecule. In some embodiments, a linker can be an RNA molecule. In some embodiments, a linker can include an aptamer capable of binding a ligand. The aptamer-derived riboswitch can be selected from the group consisting of theophylline riboswitch, thiamine pyrophosphate (TPP) riboswitch, adenosylcobalamin (AdoCbl) riboswitch, S-adenosylmethionine (SAM) riboswitch, SAH riboswitch, flavin mononucleotide (FMN) riboswitch, tetrahydrofolate riboswitch, lysine riboswitch, glycine riboswitch, purine riboswitch, GlmS riboswitch, or Q riboswitch (pre-queosine 1, PreQ1) riboswitch. In some embodiments, the linker can include an aptamer that binds to a polypeptide or protein domain, such as a polypeptide ligand. In some embodiments, the polypeptide ligand can be a K homology (KH) domain, an MS2 coat protein domain, a PP7 coat protein domain, an SfMu Com coat protein domain, a sterile alpha motif, a telomerase Ku binding motif and Ku protein, a telomerase Sm7 binding motif and Sm7 protein, or an RNA recognition motif. In some embodiments, the polypeptide ligand can be part of a base editing fusion protein or a base editor system component. For example, a nucleobase editing component may include a deaminase domain and an RNA recognition motif. In some embodiments, the linker is an amino acid or multiple amino acids (e.g., a peptide or protein). In some embodiments, the linker of the present invention is none, or the linker comprises an amino acid sequence (GGGS)n(SEQ ID NO:47), (GGGGS)n(SEQ ID NO:48), (G)n, (EAAAK)n(SEQ ID NO:49), (GGS)n, (SGGS)n(SEQ ID NO:51), SGSETPGTSESATPES(SEQ ID NO:52), or (XP)n motif or a combination thereof, wherein n is independently an integer from 1 to 32, and wherein X is any amino acid.
[0191] In some embodiments, the linker comprises:
[0192] In some embodiments, the domains of the base editing fusion protein are connected by an optional linker. In some embodiments, the linker is absent or the linker length is 0, indicating that the domains of the fusion protein are directly connected. In some embodiments, the length of the linker is 0-500 or 1-500 amino acids. In some embodiments, the length of the linker is 0-100 amino acids. In some embodiments, the length of the linker is 1-100 amino acids. In some embodiments, the length of the linker is 3-100 amino acids, for example, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100 amino acids in length. In some embodiments, the linker is no less than 12 amino acids in length, e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 24, 32, 64, 92, 100.
[0193] In other embodiments, the linker is 0-100 amino acids in length.
[0194] In some specific embodiments, the linker comprises the amino acid sequence (GGGS)n (SEQ ID NO:47), (GGGGS)n (SEQ ID NO:48), (G)n, (EAAAK)n (SEQ ID NO:49), (GGS)n, (SGGS)n (SEQ ID NO:51), SGSETPGTSESATPES (SEQ ID NO:52), or (XP)n motif or a combination thereof, wherein n is independently an integer from 1 to 32, and wherein X is any amino group.
[0195] In some preferred embodiments, the linker is 12-100 amino acids long.
[0196] In some embodiments, the fusion protein can form a complex with the guide RNA and bind to the target DNA.
[0197] In some embodiments, the base editing fusion protein structure of the present invention can be selected from:
[0198] NH2-[deaminase N-terminal linking domain]-[deaminase]-[deaminase C-terminal linking domain]-COOH;
[0199] NH2-[deaminase N-terminal linking domain]-[deaminase]-[deaminase C-terminal linking domain]-[NLS]-COOH;
[0200] NH2-[NLS]-[deaminase N-terminal linking domain]-[deaminase]-[deaminase C-terminal linking domain]-[NLS]-COOH;
[0201] NH2-[deaminase N-terminal linking domain]-[cytidine deaminase]-[deaminase C-terminal linking domain]-[UGI]-COOH;
[0202] NH2-[deaminase N-terminal linking domain]-[cytidine deaminase]-[deaminase C-terminal linking domain]-[UGI]-[NLS]-COOH;
[0203] NH2-[NLS]-[deaminase N-terminal linking domain]-[cytidine deaminase]-[deaminase C-terminal linking domain]-[UGI]-[NLS]-COOH;
[0204] NH2-[deaminase N-terminal linking domain]-[cytidine deaminase]-[deaminase C-terminal linking domain]-[UGI]-[UGI]-COOH;
[0205] NH2-[deaminase N-terminal linking domain]-[cytidine deaminase]-[deaminase C-terminal linking domain]-[UGI]-[UGI]-[NLS]-COOH;
[0206] NH2-[NLS]-[Deaminase N-terminal linking domain]-[Cytidine deaminase]-[Deaminase C-terminal linking domain]-[UGI]-[UGI]-[NLS]-COOH.
[0207] In some embodiments, the base editing fusion protein structure of the present invention can be selected from:
[0208] NH2-[X1]-[X2]-[deaminase]-[X3]-[X4]-COOH;
[0209] NH2-[X1]-[X2]-[deaminase]-[X3]-[X4]-[NLS]-COOH;
[0210] NH2-[NLS]-[X1]-[X2]-[deaminase]-[X3]-[X4]-[NLS]-COOH;
[0211] NH2-[X1]-[X2]-[cytidine deaminase]-[X3]-[X4]-[UGI]-COOH;
[0212] NH2-[X1]-[X2]-[cytidine deaminase]-[X3]-[X4]-[UGI]-[NLS]-COOH;
[0213] NH2-[NLS]-[X1]-[X2]-[cytidine deaminase]-[X3]-[X4]-[UGI]-[NLS]-COOH;
[0214] NH2-[X1]-[X2]-[cytidine deaminase]-[X3]-[X4]-[UGI]-[UGI]-COOH;
[0215] NH2-[X1]-[X2]-[cytidine deaminase]-[X3]-[X4]-[UGI]-[UGI]-[NLS]-COOH;
[0216] NH2-[NLS]-[X1]-[X2]-[Cytidine deaminase]-[X3]-[X4]-[UGI]-[UGI]-[NLS]-COOH.
[0217] In some embodiments, the base editing fusion protein comprises one or more of the following sequences:
[0218] (i) an amino acid sequence as shown in any one of SEQ ID NOs: 89-92, 94, 96, 99, 101, 103, 105-115, 118, 179, 201-206;
[0219] (ii) an amino acid sequence that has at least 80%, 82%, 85%, 87%, 90%, 92%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence set forth in any one of SEQ ID NOs: 89-92, 94, 96, 99, 101, 103, 105-115, 118, 179, 201-206;
[0220] (iii) an amino acid sequence in which one or more amino acid residues are added, substituted, deleted or inserted into the amino acid sequence of any one of SEQ ID NOs: 89-92, 94, 96, 99, 101, 103, 105-115, 118, 179, 201-206; or
[0221] (iv) an amino acid sequence encoded by a nucleotide sequence that hybridizes to a polynucleotide sequence encoding the amino acid sequence shown in any one of SEQ ID NOs: 89-92, 94, 96, 99, 101, 103, 105-115, 118, 179, 201-206 under stringent conditions, which are medium stringency conditions, medium-high stringency conditions, high stringency conditions or very high stringency conditions.
[0222] In some exemplary embodiments, the fusion protein comprises the following structure: [X1]-[X2]-[deaminase]-[X3]-[X4], wherein X1 is absent, X2 is SEQ ID NO: 164, X3 is SEQ ID NO: 165, and X4 is SEQ ID NO: 166. In some embodiments, the deaminase is mini-Sdd9 or a variant thereof.
[0223] In some exemplary embodiments, the base editing fusion protein comprises one or more of the following sequences:
[0224] (i) the amino acid sequence shown in SEQ ID NO: 111;
[0225] (ii) an amino acid sequence that has at least 80%, 82%, 85%, 87%, 90%, 92%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 111;
[0226] (iii) an amino acid sequence in which one or more amino acid residues are added, substituted, deleted or inserted into the amino acid sequence of SEQ ID NO: 111; or
[0227] (iv) an amino acid sequence encoded by a nucleotide sequence that hybridizes to a polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 111 under stringent conditions, wherein the stringent conditions are medium stringency conditions, medium-high stringency conditions, high stringency conditions or very high stringency conditions.
[0228] As used herein, "moderately stringent conditions," "medium-high stringency conditions," "high stringency conditions," or "very high stringency conditions" describe conditions for nucleic acid hybridization and washing. Guidance for conducting hybridization reactions can be found in John Wiley & Sons, "Current Protocols in Molecular Biology," NY (1989), 6.3.1-6.3.6, which is incorporated herein by reference. Both aqueous and nonaqueous methods are described in this document, and either method can be used. For example, specific hybridization conditions are as follows: (1) low stringency hybridization conditions are in 6× sodium chloride / sodium citrate (SSC) at about 45°C, followed by two washes in 0.2×SSC, 0.1% SDS at at least 50°C (the wash temperature can be increased to 55°C for low stringency conditions); (2) moderate stringency hybridization conditions are in 6×SSC at about 45°C, followed by one or more washes in 0.2×SSC, 0.1% SDS at 60°C; (3) high stringency hybridization conditions are in 6×SSC at about 45°C, followed by one or more washes in 0.2×SSC, 0.1% SDS at 65°C, and preferably; (4) very high stringency hybridization conditions are 0.5 M sodium phosphate, 7% SDS at 65°C, followed by one or more washes in 0.2×SSC, 1% SDS at 65°C.
[0229] 3. Base Editing System
[0230] In another aspect of the present invention, a base editing system is provided, wherein the base editing system comprises at least one of the following components i) to v):
[0231] i) base editing fusion protein and guide RNA;
[0232] ii) an expression construct comprising a nucleotide sequence encoding a base editor fusion protein, and a guide RNA;
[0233] iii) a base editing fusion protein, and an expression construct comprising a nucleotide sequence encoding a guide RNA;
[0234] iv) an expression construct comprising a nucleotide sequence encoding a base editor fusion protein, and an expression construct comprising a nucleotide sequence encoding a guide RNA;
[0235] v) an expression construct comprising a nucleotide sequence encoding a base editing fusion protein and a nucleotide sequence encoding a guide RNA;
[0236] The base editing fusion protein comprises a deaminase domain and a paired DNA binding protein domain with DNA single-strand cleavage function;
[0237] The paired DNA binding protein domains with DNA single-strand cleavage function include a deaminase N-terminal connecting domain and a deaminase C-terminal connecting domain, and the deaminase N-terminal connecting domain and the deaminase C-terminal connecting domain are respectively connected to the N-terminus and C-terminus of the deaminase domain through optional linkers.
[0238] In some embodiments, the base editing fusion protein, as well as the deaminase, DNA binding protein, single domain, linker, UGI and nuclear localization sequence, are as described in the above "II. Base editing fusion protein".
[0239] In some embodiments, the deaminase N-terminal connecting domain and the deaminase C-terminal connecting domain are independently composed of 1-2 single domains, and the single domains are connected by an optional linker.
[0240] In some embodiments, the base editing fusion protein comprises the following structure: [X1]-[X2]-[deaminase]-[X3]-[X4], wherein X 1-4 represents a single domain, and “-” represents an optional linker.
[0241] In some specific embodiments, the X 1-4 The single domain is selected from the following combinations:
[0242] (1) X1 is SEQ ID NO: 158, X2 is SEQ ID NO: 159, X3 is SEQ ID NO: 160, and X4 is absent;
[0243] (2) X1 is none, X2 is SEQ ID NO: 161, X3 is SEQ ID NO: 162, and X4 is SEQ ID NO: 163;
[0244] (3) X1 is none, X2 is SEQ ID NO: 164, X3 is SEQ ID NO: 165, and X4 is SEQ ID NO: 166.
[0245] (4) X1 is SEQ ID NO: 181, X2 is SEQ ID NO: 182, X3 is sequence Q, and X4 is absent.
[0246] (5) X1 is none, X2 is SEQ ID NO: 183, X3 is SEQ ID NO: 184, and X4 is SEQ ID NO: 185;
[0247] (6) X1 is none, X2 is SEQ ID NO: 186, X3 is SEQ ID NO: 187, and X4 is SEQ ID NO: 188;
[0248] (7) X1 is SEQ ID NO: 189, X2 is SEQ ID NO: 190, X3 is SEQ ID NO: 191, and X4 is absent;
[0249] (8) X1 is SEQ ID NO: 192, X2 is SEQ ID NO: 193, X3 is SEQ ID NO: 194, and X4 is absent;
[0250] (9) X1 is SEQ ID NO: 195, X2 is SEQ ID NO: 196, X3 is SEQ ID NO: 197, and X4 is absent;
[0251] (10) X1 is SEQ ID NO: 198, X2 is SEQ ID NO: 199, X3 is SEQ ID NO: 200, and X4 is absent.
[0252] In some embodiments, the deaminase is cytidine deaminase or adenosine deaminase.
[0253] In some embodiments, the cytidine deaminase is selected from an APOBEC family deaminase, an SCP1.201 family deaminase, or a homolog thereof; preferably, the APOBEC family deaminase is selected from an AID deaminase, an APOBEC1 deaminase, an APOBEC2 deaminase, an APOBEC3A deaminase, an APOBEC3B deaminase, an APOBEC3C deaminase, an APOBEC3D deaminase, an APOBEC3F deaminase, an APOBEC3G deaminase, an APOBEC3H deaminase, or a variant thereof. The SCP1.201 family deaminase is selected from an Sdd2, Sdd3, Sdd4 deaminase, an Sdd6 deaminase, an Sdd7 deaminase, an Sdd9 deaminase, an Sdd10 deaminase, an Sdd59 deaminase, a mini-Sdd3 deaminase, a mini-Sdd6 deaminase, a mini-Sdd7 deaminase, a mini-Sdd9 deaminase, or a variant thereof.
[0254] In some embodiments, the adenosine deaminase is selected from QB34, TadA8e, TadA7.10, a TadA dimer or a variant thereof, and optionally, the TadA dimer comprises TadA7.10 and wild-type TadA.
[0255] In some specific embodiments, the homolog of the APOBEC family deaminase is cytidine deaminase 1 (pmCDA1) TadA8e, TadA7.10 or mutants thereof from sea lamprey (Petromyzon marinus).
[0256] In some embodiments, the linker is 0-100 amino acids in length.
[0257] In some embodiments, the linker comprises the amino acid sequence (GGGS)n (SEQ ID NO:47), (GGGGS)n (SEQ ID NO:48), (G)n, (EAAAK)n (SEQ ID NO:49), (GGS)n, (SGGS)n (SEQ ID NO:51), SGSETPGTSESATPES (SEQ ID NO:52), or (XP)n motif, or a combination thereof, wherein n is independently an integer from 1-32, and wherein X is any amino acid.
[0258] In some preferred embodiments, the linker is 12-100 amino acids long.
[0259] In some embodiments, the fusion protein can form a complex with the guide RNA and bind to the target DNA.
[0260] In some embodiments, the base editing system of the present invention further contains a uracil DNA glycosylase inhibitor (UGI) or an expression construct expressing a uracil DNA glycosylase inhibitor (UGI). The uracil DNA glycosylase inhibitor / expression construct expressing a uracil DNA glycosylase inhibitor exists alone or constitutes at least one fusion protein or fusion protein expression construct with other base editing system components. In some embodiments, the fusion protein comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more UGIs.
[0261] In some embodiments, the base editing system fusion protein of the present invention further comprises a nuclear localization sequence.
[0262] 4. Polynucleotides
[0263] In another aspect of the present invention, a polynucleotide is provided, which encodes:
[0264] (a) the aforementioned base editing fusion protein; or
[0265] (b) The aforementioned base editing system.
[0266] The polynucleotides of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA may be single-stranded or double-stranded. DNA may be a coding strand or a non-coding strand.
[0267] The polynucleotides encoding the base editing fusion protein or base editing system of the present invention include: a coding sequence encoding only the base editing fusion protein or base editing system; a coding sequence of the base editing fusion protein or base editing system and various additional coding sequences; a coding sequence of the base editing fusion protein or base editing system (and optional additional coding sequences) and a non-coding sequence.
[0268] A "polynucleotide encoding a base editing fusion protein or a base editing system" may include a polynucleotide encoding the base editing fusion protein or the base editing system, or may also include additional coding and / or non-coding sequences.
[0269] 5. Expression Constructs
[0270] In another aspect of the present invention, an expression construct is provided, comprising the aforementioned polynucleotide.
[0271] In some embodiments, the expression construct is selected from the group consisting of viral, bacterial, yeast, plant, and mammalian cell expression constructs.
[0272] 6. Host Cells
[0273] In another aspect of the present invention, a host cell is provided, which comprises the aforementioned base editing fusion protein, the aforementioned base editing system, the aforementioned polynucleotide, or the aforementioned expression construct.
[0274] 7. Test Kit
[0275] In another aspect of the present invention, a kit is provided, comprising the aforementioned base editing fusion protein, the aforementioned base editing system, the aforementioned polynucleotide, the aforementioned expression construct, or the aforementioned host cell.
[0276] 8. Pharmaceutical Composition
[0277] In another aspect of the present invention, a pharmaceutical composition is provided, which comprises the aforementioned base editing fusion protein, the aforementioned base editing system, the aforementioned polynucleotide, the aforementioned expression construct, or the aforementioned host cell, and, optionally, a pharmaceutically acceptable carrier.
[0278] The term "pharmaceutically acceptable carrier" refers to any inactive substance suitable for use in a formulation for delivering base editing fusion proteins, base editing systems, polynucleotides, expression constructs, or host cells. The carrier can be an anti-adhesive, adhesive, coating, disintegrant, filler or diluent, preservative (such as an antioxidant, antibacterial or antifungal agent), sweetener, absorption delay agent, wetting agent, emulsifier, buffer, etc. Examples of suitable pharmaceutically acceptable carriers include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, etc.), dextrose, vegetable oils (such as olive oil), saline, buffer, buffered saline, and isotonic agents such as sugars, polyols, sorbitol, and sodium chloride.
[0279] IX. Methods for Producing at Least One Genetically Modified Cell
[0280] In another aspect of the present invention, a method for producing at least one genetically modified cell is provided, comprising introducing the base editing system of the present invention into at least one of the cells, thereby causing substitution or insertion of a nucleic acid sequence within a target nucleotide region in the at least one cell.
[0281] In some embodiments, the nucleic acid sequence within the target nucleotide region is in the genome of an organism. In some embodiments, the organism is a prokaryotic organism. In some embodiments, the prokaryotic organism is a bacterium. In some embodiments, the organism is a eukaryotic organism. In some embodiments, the organism is a plant or a fungus. In some embodiments, the organism is a vertebrate. In some embodiments, the vertebrate is a mammal. In some embodiments, the mammal is a mouse, a rat, or a human. In some embodiments, the organism is a cell. In some embodiments, the cell is a mouse cell, a rat cell, or a human cell. In some embodiments, the cell is a HEK-293 cell. In some embodiments, the cell is a HEK293T cell.
[0282] In some embodiments, the cell is from a prokaryotic organism such as a bacterium; a eukaryotic organism such as a plant, fungus, or a vertebrate. In some embodiments, the vertebrate is a mammal such as a human, mouse, rat, monkey, dog, pig, sheep, cow, or cat; and the plant is a crop plant such as wheat, rice, corn, soybean, sunflower, sorghum, rapeseed, alfalfa, cotton, barley, millet, sugarcane, tomato, tobacco, cassava, or potato.
[0283] 10. Method for producing at least one genetically modified plant
[0284] In another aspect, the present invention provides a method for producing a genetically modified plant, comprising introducing the base editing system of the present invention into at least one of the plants, thereby causing one or more nucleotide substitutions in a nucleic acid sequence within a target nucleotide region in the genome of the at least one plant.
[0285] In some embodiments, the method further comprises screening the at least one plant for plants having the desired one or more nucleotide substitutions.
[0286] In the methods of the present invention, the base editing system can be introduced into plants using various methods well known to those skilled in the art. Methods that can be used to introduce the base editing system of the present invention into plants include, but are not limited to, biolistic methods, PEG-mediated protoplast transformation, Agrobacterium-mediated transformation, plant virus-mediated transformation, pollen tube access, and ovary injection.
[0287] In the method of the present invention, modification of the nucleic acid sequence within the target nucleotide region can be achieved by simply introducing or producing a complex of the base editing fusion protein and the guide RNA in plant cells, and the modification can be stably inherited without the need to stably transform the exogenous polynucleotides encoding the components of the base editing system into the plant. This avoids the potential off-target effects of the stably existing (continuously produced) base editing system and also avoids the integration of exogenous nucleotide sequences into the plant genome, thereby having higher biosafety.
[0288] In some preferred embodiments, the introduction is performed in the absence of selection pressure, thereby avoiding integration of the exogenous nucleotide sequence into the plant genome.
[0289] In some embodiments, the introduction comprises transforming the base editing system of the present invention into isolated plant cells or tissues, and then regenerating the transformed plant cells or tissues into complete plants. Preferably, the regeneration is carried out in the absence of selection pressure, that is, no selection agent for the selection gene carried on the expression vector is used during the tissue culture process. Not using a selection agent can improve the regeneration efficiency of the plant and obtain a modified plant that does not contain exogenous nucleotide sequences.
[0290] In other embodiments, the base editing system of the present invention can be transformed into specific parts of the whole plant, such as leaves, stem tips, pollen tubes, young ears or hypocotyls. This is particularly suitable for the transformation of plants that are difficult to regenerate through tissue culture.
[0291] In some embodiments of the present invention, in vitro expressed proteins and / or in vitro transcribed RNA molecules (e.g., the expression construct is an in vitro transcribed RNA molecule) are directly transformed into the plant. The protein and / or RNA molecule can be base edited in plant cells and then degraded by the cells, thereby avoiding the integration of exogenous nucleotide sequences in the plant genome.
[0292] Therefore, in some embodiments, genetic modification and breeding of plants using the methods of the present invention can obtain plants whose genomes have no exogenous polynucleotides integrated therein, ie, non-transgenic (transgene-free) modified plants.
[0293] In some embodiments of the present invention, the target nucleotide region to be modified is associated with a plant trait such as an agronomic trait, whereby the one or more nucleotide substitutions result in the plant having an altered (preferably improved) trait, such as an agronomic trait, relative to a wild-type plant.
[0294] In some embodiments, the method further comprises the step of screening plants for a desired nucleotide substitution(s) and / or a desired trait, such as an agronomic trait.
[0295] In some embodiments of the present invention, the method further comprises obtaining offspring of the genetically modified plant.Preferably, the genetically modified plant or its offspring has a desired one or more nucleotide substitutions and / or a desired trait such as an agronomic trait.
[0296] 11. Genetically modified plants, their descendants or parts thereof
[0297] In another aspect, the present invention also provides a genetically modified plant, or a progeny thereof, or a part thereof, wherein the plant is obtained by the aforementioned method of producing at least one genetically modified plant. In some embodiments, the genetically modified plant, or a progeny thereof, or a part thereof is non-transgenic. Preferably, the genetically modified plant, or a progeny thereof, has a desired genetic modification and / or a desired trait, such as an agronomic trait.
[0298] In another aspect, the present invention also provides a plant breeding method, comprising crossing a first genetically modified plant obtained by the method of the present invention, comprising one or more nucleotide substitutions in a target nucleotide region, with a second plant that does not contain the one or more nucleotide substitutions, thereby introducing the one or more nucleotide substitutions into the second plant. Preferably, the genetically modified first plant has a desired trait, such as an agronomic trait.
[0299] 12. Application in Disease Treatment
[0300] The present invention also covers the use of the base editing system of the present invention in disease treatment.
[0301] By modifying the disease-related genes through the base editing system of the present invention, it is possible to achieve upregulation, downregulation, inactivation, activation or mutation correction of the disease-related genes, thereby achieving the prevention and / or treatment of the disease. For example, the target nucleotide region described in the present invention can be located in the protein coding region of the disease-related gene, or, for example, can be located in a gene expression regulatory region such as a promoter region or an enhancer region, so as to achieve functional modification of the disease-related gene or modification of the expression of the disease-related gene. Therefore, the modified disease-related genes described herein include modification of the disease-related gene itself (e.g., protein coding region), and also include modification of its expression regulatory region (e.g., promoter, enhancer, intron, etc.).
[0302] "Disease-associated" gene refers to any gene that produces a transcription or translation product at an abnormal level or in an abnormal form in cells derived from tissues affected by the disease, compared to tissues or cells of non-disease controls. In the case where the altered expression is related to the appearance and / or progression of the disease, it can be a gene expressed at an abnormally high level; it can be a gene expressed at an abnormally low level. Disease-associated genes also refer to genes with one or more mutations or genetic variations that are directly responsible for or disequilibrium with one or more genes responsible for the etiology of the disease. The mutation or genetic variation is, for example, a single nucleotide variation (SNV). The transcribed or translated product can be known or unknown and can be at normal or abnormal levels.
[0303] Therefore, the present invention also provides a method for treating a disease in a subject in need thereof, comprising delivering an effective amount of a base editing system of the present invention to the subject to modify a gene associated with the disease (e.g., deaminating mitochondrial DNA by a fusion protein or multiple fusion proteins). Use of a base editing system in the preparation of a pharmaceutical composition for treating a disease in a subject in need thereof, wherein the base editing system is used to modify a gene associated with the disease. The present invention also provides a drug for treating a disease in a subject in need thereof, comprising a base editing system of the present invention, and an optional pharmaceutically acceptable carrier, wherein the base editing system is used to modify a gene associated with the disease.
[0304] In some embodiments, the fusion protein or base editing system described in the present invention is used to introduce point mutations into the target nucleic acid by deaminating the target core base (e.g., C residues, or A residues) in the target nucleic acid. In some embodiments, the deamination of the target core base leads to the correction of genetic defects, such as in point mutations that cause loss of function in gene products during correction. In some embodiments, the genetic defect is associated with a disease or condition (e.g., lysosomal storage disease or metabolic disease, such as type I diabetes). In some embodiments, the methods provided herein can be used to introduce inactivating point mutations into genes or alleles encoding gene products associated with a disease or condition.
[0305] In some embodiments, the goal of the approaches described herein is to restore the function of dysfunctional genes through genome editing. Base editing fusion proteins provided herein are useful for in vitro gene editing of human cells, such as correcting disease-associated mutations in human cell culture.
[0306] In some embodiments, the purpose of the scheme described in the present invention is to treat diseases associated with or caused by point mutations, which can be corrected by the DNA base editing fusion proteins provided herein. In some embodiments, the disease is a proliferative disease. In some embodiments, the disease is a genetic disease. In some embodiments, the disease is a neoplastic disease. In some embodiments, the disease is a metabolic disease. In some embodiments, the disease is a lysosomal storage disease.
[0307] In some embodiments, the methods described herein are intended to be used to treat mitochondrial diseases or disorders. As used herein, "mitochondrial diseases" refer to diseases caused by abnormal mitochondria, such as mutations in mitochondrial genes, enzyme pathways, etc. Examples of diseases include, but are not limited to, neurological diseases, loss of motor control, muscle weakness and pain, gastrointestinal diseases and difficulty swallowing, poor growth, heart disease, liver disease, diabetes, respiratory complications, epilepsy, vision / hearing problems, lactic acidosis, developmental delays, and susceptibility to infection.
[0308] Examples of diseases described herein include, but are not limited to, genetic diseases, circulatory system diseases, muscle diseases, brain, central nervous and immune system diseases, Alzheimer's disease, secretase disorders, amyotrophic lateral sclerosis (ALS), autism, trinucleotide repeat expansion disorders, hearing diseases, gene-targeted therapy of non-dividing cells (neurons, muscles), liver and kidney diseases, epithelial cell and lung diseases, cancer, Usher syndrome or retinitis pigmentosa-39, cystic fibrosis, HIV and AIDS, beta thalassemia, sickle cell disease, herpes simplex virus, autism, drug addiction, age-related macular degeneration, schizophrenia. Other diseases that can be treated by correcting point mutations or introducing inactivating mutations into disease-related genes are known to those skilled in the art, and therefore the present disclosure is not limited in this regard. In addition to the diseases exemplarily described herein, other related diseases can also be treated using the strategies and fusion proteins provided by the present invention, and this application will be apparent to those skilled in the art. The diseases or targets to which the present invention can be applied refer to WO2015089465A1 (PCT / US2014 / 070135), WO2016205711A1 (PCT / US2016 / 038181), WO2018141835A1 (PCT / EP2018 / 052491), WO2020191234A1 (PCT / US2020 / 023713), WO2020191233A1 (PCT / US2020 / 023712), WO2019079347A1 (PCT / US2018 / 056146), and WO2021155065A1 (PCT / US2021 / 015580) for the related diseases to which the base editing systems are applicable.
[0309] Example
[0310] Example 1: Construction of the QBE base editing system
[0311] 1.1 DNA binding protein domain design
[0312] In this example, the DNA binding protein amino acid sequence was circularly permuted. Circular permutation arrangements of DNA binding proteins are known in the art (see Oakes, Benjamin L et al. "CRISPR-Cas9 Circular Permutants as Programmable Scaffolds for Genome Modification." Cell vol. 176, 1-2 (2019): 254-267.e16). The linker selected for the circular permutation was GGSGGSGGSGGSGGSGGSGG (SEQ ID NO: 2), resulting in a circular permutation sequence of 1388 amino acids, SEQ ID NO: 29 (wherein the amino acid position of the circular permutation sequence has the methionine M encoded by the start codon as the first amino acid, and the glycine G directly connected to the first amino acid in the linker as the 1388th amino acid).
[0313] The two sites of the circularly transformed DNA binding protein are split to obtain a pair of separated polypeptides, which are the paired DNA binding protein domains with DNA single-strand cleavage function of the present invention. The above-mentioned paired DNA binding protein domains with DNA single-strand cleavage function are fused or linked to the N-terminus and C-terminus of the deaminase domain respectively. According to the fusion position with the deaminase, the domains connected to the N-terminus or C-terminus of the deaminase are respectively defined as the deaminase N-terminal connecting domain (QBE-N) and the deaminase C-terminal connecting domain (QBE-C). As the paired deaminase terminal connecting domains of this embodiment, their amino acid sequences are shown in Table 2. In Table 2, the first split site is defined as the deaminase connecting site, wherein the lower-coded amino acid is connected to the deaminase N-terminus and the higher-coded amino acid is connected to the amino acid C-terminus; the second split site is defined as the non-deaminase connecting site, wherein the lower-coded amino acid is the C-terminus of the QBE-C domain and the higher-coded amino acid is the N-terminus of the QBE-N domain.
[0314] Table 1: Exemplary pairs of deaminase terminal linker domains
[0315] The base editing system fusion protein formed by linking or fusing QBE-N and QBE-C with the deaminase domain includes the following structure: [deaminase N-terminal linking domain]-[deaminase]-[deaminase C-terminal linking domain], where the domains can be directly connected or connected through a linker, which is a linker sequence with a length of 0-32 amino acids. Optionally, the fusion protein may also contain a nuclear localization sequence (NLS), a uracil DNA glycosylase inhibitor (UGI), etc. Figure 1 is a schematic diagram of a base editing system fusion protein.
[0316] In addition, due to the presence of a circular conversion linker of a DNA binding protein in QBE-N or QBE-C, the domain containing the circular conversion linker can also be represented as two single domains connected by a circular conversion linker (as shown in Figure 2). Therefore, the structure of the base editing system fusion protein can also be represented as follows: 1) When the circular conversion linker is connected to the domain at the N-terminus of the deaminase, the structure of the fusion protein formed includes: [X1]-[X2]-[deaminase]-[X3]; 2) When the circular conversion linker is connected to the domain at the C-terminus of the deaminase, the structure of the fusion protein formed includes: [X2]-[deaminase]-[X3]-[X4]. Where "[Xn]" represents a single domain that does not contain a linker, and "-" represents a linker. Therefore, based on the single domain, the paired deaminase terminal domains are shown in Table 2:
[0317] Table 2: Exemplary pairs of deaminase terminal linker domains
[0318] 1.2 Construction of cytidine base editing system and adenosine base editing system
[0319] Deaminases that can be used as exemplary base editing systems of the present invention include, but are not limited to, the following deaminases as shown in SEQ ID NOs: 54-88. In this example, cytidine deaminase rAPOBEC1, hAPOBEC3A (A3A), mini-Sdd3, mini-Sdd6, Sdd7, mini-Sdd9, and adenosine deaminase TadA-8e are exemplarily integrated into paired QBE deaminase terminal linking domain sequences to obtain a series of novel cytidine base editors and adenosine base editors. Exemplary base editing system fusion proteins include, but are not limited to, those shown in Table 3, where the base editing system is named in the form of "deaminase-deaminase terminal linking domain" (e.g., A3A-QBE1 is a base editing system composed of A3A deaminase and paired QBE1 deaminase terminal linking domains).
[0320] Table 3: Exemplary base editing system fusion proteins
[0321] Example 2 Editing efficiency of the QBE base editing system
[0322] To test the editing effect of the QBE base editing system of the present invention, this example designed an sgRNA, in which the backbone sequence was selected as:
[0323] guuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggug c (SEQ ID NO: 151). The spacer of this sgRNA corresponds to the original spacer site 1 (GACAAACCAGAAGCCGCTCC; SEQ ID NO: 129) of the target site of the CTNNB1 gene in the HEK293T cell genome and the original spacer site 3 (GAACACAAAGCATAGACTGC; SEQ ID NO: 131) of the VISTA enhancer hs267. The fourth-generation base editing system BE4max fused with the deaminase in Table 3 (refer to Komor, Alexis C et al. "Improved base excision repair inhibition and bacteriophage Mu Gam protein yields C:G-to-T:A base editors with higher efficiency and product purity." Science advances vol.3, 8eaao4774.30Aug(2017)) was selected as a control (SEQ ID NO: 125-126, SEQ ID NO: 152-153, SEQ ID NO: 155-156, SEQ ID NO: 180). The schematic diagram of the base editing system fusion protein structure used in this example is shown in Figure 2. The encoding plasmids encoding the base editing system fusion protein and sgRNA were co-transfected into HEK293T cells. After 72 hours of transfection, the cell genomic DNA was extracted, the target fragment was amplified by two rounds of PCR and the product was purified. The base editing effect of the target was detected by second-generation detection technology (NGS).
[0324] Figure 3 shows a statistical analysis of the target editing capabilities and editing efficiencies of different base editing systems. As shown in Figure 3, when QBE1 is linked to mini-Sdd3, mini-Sdd6, mini-Sdd9, and TadA-8e deaminases, it can produce specific base edits at both target sites 1 and 3. When it is linked to the mini-Sdd9 cytosine deaminase, the editing efficiency of this base editing system is slightly higher than that of the control mini-Sdd9-BE4max, reaching 74% at site 3. The base editing system formed by QBE2 linked to all six deaminases can produce specific base edits at both target sites 1 and 3. It achieves the highest editing efficiency of 37% when linked to the mini-Sdd9 cytosine deaminase. The base editing systems formed by QBE3 linked to various deaminases all exhibit good base editing capabilities, with editing efficiencies comparable to or slightly higher than those of the control BE4max. The highest efficiency is achieved when it is linked to the Sdd7 cytosine deaminase, reaching 70%.
[0325] When performing targeted mutagenesis on specific bases (such as AT, CG), it is undesirable to generate indels because it will reduce the accuracy of base editing. This example analyzes the random insertion / deletion (indel) efficiency of each base editing system, where Figure 4 shows the indel efficiency of each base editing system, and Figure 5 shows the editing efficiency / indel ratio. A higher value of this ratio indicates that the base editing system has higher editing efficiency and lower indels, that is, it has a better base editing effect. The results of the indel efficiency in Figure 4 show that the indel efficiency of the QBE base editing system is generally lower than that of the BE4max system. As shown in Figure 5, the editing efficiency / indel ratio of BE4max is approximately 10-60, and the editing efficiency / indel ratio of the QBE base editing system is significantly improved compared with the BE4max control group.
[0326] In summary, the QBE base editing system, linked to different deaminases, is capable of producing specific base edits (C-to-T; A-to-G). The base editing efficiency is similar to or significantly improved compared to the control BE4max system, such as mini-Sdd9-QBE1 and mini-Sdd3-QBE3. The base editing system significantly reduces indels and significantly improves the editing efficiency / indel ratio, indicating a significant improvement in editing accuracy and overall base editing system efficacy. Among them, the QBE3 deaminase terminal linker domain exhibited excellent editing efficacy. A base editing system fusion protein with a QBE3 fusion protein structure was selected as a representative for comparison and analysis, designated QBEmax.
[0327] Example 3 Base Editing Product Purity
[0328] Studies have shown that the purity of the products edited by the base editing system is not high. For example, in addition to C-to-T (target editing type), CBE also has the probability of C-to-R (impure non-target editing type, including C-to-A and C-to-G), which leads to the production of gene editing byproducts. The BE4 system developed by the researchers not only has a high editing efficiency, but also can reduce the occurrence of C-to-R, which is 2.3 times lower than BE3 (reference Komor, Alexis C et al. "Improved base excision repair inhibition and bacteriophage Mu Gam protein yields C:G-to-T:A base editors with higher efficiency and product purity." Science advances vol.3,8eaao4774.30Aug(2017).). To verify the purity of the cytosine base editing products of the QBE base editing system of the present invention, this example statistically analyzed the base editing results of mini-Sdd9-QBEmax and mini-Sdd9-BE4max in the editing windows of eight target sites. The proportions of C-to-T, C-to-A, and C-to-G in each editing window were calculated, thereby calculating the product purity of the base editing system. As shown in Figure 6, mini-Sdd9-QBEmax exhibited an editing purity of 99.4±0.4% at the cytosine base position within each editing window, significantly higher than the 95.5±2.8% editing purity of mini-Sdd9-BE4max.
[0329] It can be seen that the QBE base editing system of the present invention can effectively improve the purity of gene editing products and reduce the production of gene editing by-products.
[0330] Example 4 Base Editing Window
[0331] Different types of base editing systems have slightly different editing windows. A wider editing window can cover more potential editing sites, thereby expanding the application of base editing. This example analyzes the editing windows of different types of QBE base editing systems.
[0332] 4.1 Editing Window of the Adenosine Base Editing System
[0333] In this example, sgRNAs were designed to target adenosine- and cytidine-rich editing sites in the HEK293T cell genome, site 1 and site 3 (protospacer sequences are shown in SEQ ID NOs: 129-131). ABE8e fused to Cas9 and TadA-8e was selected for comparison (SEQ ID NO: 123). Plasmids encoding TadA8e-QBE1, TadA8e-QBE2, TadA8e-QBE3, and TadA8e-QBE4, novel base editing systems using TadA-8e as a deaminase, were constructed according to the method of Example 2.
[0334] The editing windows of different adenosine base editing systems were analyzed, and the first base on the target sequence farthest from the PAM was defined as 1. The results showed that for the site 1 target, the editing windows of ABE8e, TadA8e-QBE4, TadA8e-QBE1, or TadA8e-QBE3 all included A2, A4, A5, A6, and A9, and the base editing systems of the present invention also showed editing ability for A11 and A12 far from the PAM. For the site3 target, the editing windows of ABE8e, TadA8e-QBE4, and TadA8e-QBE1 include A2, A3, A5, A7, A8, A9, A12, and A14, and the position with the highest editing efficiency is located at A5; it is worth noting that TadA8e-QBE4, TadA8e-QBE1, or TadA8e-QBE3 has higher editing efficiency at the A12 and A14 sites away from PAM, and TadA8e-QBE3 can still detect the occurrence of editing at the A16 site (as shown in Figure 7). It can be seen that the base editing system of the present invention further expands the base editing window of the adenosine base editing system.
[0335] 4.2 Editing Window of Cytidine Base Editing System (CBE)
[0336] This example exemplifies the use of mini-Sdd9 cytidine deaminase connected to QBEmax to form a mini-Sdd9-QBEmax cytosine base editor. Mini-Sdd9-QBEmax was targeted to 17 endogenous targets of the HEK293T cell line (the original spacer sequence corresponding to the sgRNA is shown in SEQ ID NO: 129-145), and mini-Sdd9-BE4max was used as a control for comparison of the editing window. Figures 6 and 8 are comparisons of the editing windows of some endogenous targets, and Figure 9 is a grayscale map of the editing window distribution positions of all 17 endogenous targets. The darker the grayscale, the higher the frequency of editing at that position.
[0337] Taking the editing results of the four endogenous targets shown in Figure 8 as an example, for the site13 target, the editing efficiency of mini-Sdd9-BE4max gradually decreases at positions C10, C12, and C13, proving that these sites are already at the edge of the mini-Sdd9-BE4max editing window, while mini-Sdd9-QBEmax has a high editing level at positions C6-C13; for the site22 target, it can be seen more clearly that mini-Sdd9-BE4max shows a high editing efficiency at C1-C5, but at positions C5-C13 far away from PAM, mini-Sdd9-QBEmax shows a stable high level of editing efficiency, while the editing efficiency of mini-Sdd9-BE4max at these positions gradually decreases, and even the editing efficiency at positions C12 and C13 drops to about 10%. Figure 9 shows the editing window and editing position distribution of 17 endogenous sites. It can be clearly seen that mini-Sdd9-BE4max has better editing ability at C3-C8, that is, its editing window is between C3-C8. In contrast, mini-Sdd9-QBEmax has better editing ability at C6-C15, and its editing window has shifted toward the distal region of PAM. At the same time, the editing window has expanded, and more sites have been edited.
[0338] In summary, the editing window of mini-Sdd9-QBEmax is expanded and shifted toward the distal region of the PAM, which not only increases the editing range but also makes the editing window more flexible, breaking away from the limitation that existing cytosine editors can only edit cytosine near the PAM.
[0339] Example 5: Mechanistic Analysis Based on Structure
[0340] In this example, AlphaFold3 was used to predict the structure of the ternary complex of base editors (BE4max and QBEmax), sgRNA, and DNA (Abramson, Josh et al. "Accurate structure prediction of biomolecular interactions with AlphaFold 3." Nature vol. 630, 8016 (2024): 493-500.). The structural prediction results (Figure 10) show that the deaminase domain of QBEmax of the present invention has a closer binding effect with the nucleotides proximal to the PAM incision, while the deaminase domain of BE4max is more inclined to be close to the nucleotides distal to the PAM incision. The conclusion of this structural prediction is consistent with the experimental verification results.
[0341] Example 6 Effects of Circular Transformation and Deaminase Fusion on the QBE Base Editing System
[0342] To verify the effects of circular transformation of DNA-binding proteins and the fusion of paired DNA-binding protein domains at both ends of the deaminase on the editing effect of the final base editing system, two control groups were designed in this example: Control group 1) an embedded base editing system in which the deaminase is directly embedded into the DNA-binding protein without circular transformation. Specifically, in the above-mentioned embedded base editing system fusion protein, the deaminase domain is directly embedded into the DNA-binding protein without circular transformation, and the embedded position is 1244 / 1245 of the DNA-binding protein, wherein the amino acid at position 1244 is connected to the N-terminus of the deaminase and the amino acid at position 1245 is connected to the C-terminus of the deaminase. The fusion protein is named CBE-Inlaid1244.
[0343] Control group 2) The peptide following circular transformation and single-point cleavage was used as a new DNA-binding protein domain and fused to the deaminase terminus. Specifically, the DNA-binding protein was circularly transformed according to the method of Example 1. The circular transformation sequence was split at position 1030 / 1031, with amino acid position 1031 serving as the N-terminus of the transformed DNA-binding protein domain and amino acid position 1030 serving as the C-terminus. This transformed DNA-binding protein domain was used to replace the DNA-binding protein domain of BE4max, resulting in a new fusion protein named CBE-CP1031.
[0344] In this example, mini-Sdd9 was selected as the deaminase to determine the editing effects of mini-Sdd9-BE4max, mini-Sdd9-QBEmax, mini-Sdd9-CBE-CP1031, and mini-Sdd9-CBE-Inlaid1244 at site 1 and site 3. The experimental and detection methods were the same as in Example 2.
[0345] Figure 11 shows the ratio of C-to-T (target editing type) to C-to-R (impure non-target editing type, including C-to-A and C-to-G), as well as the ratio of C-to-T to Indel of the four base editors. The results show that the C-to-T / C-to-R ratio and C-to-T / Indel ratio of QBEmax are higher than those of the other three base editors.
[0346] These results demonstrate that QBEmax achieves efficient targeted base editing while producing fewer Indel byproducts and higher C-to-T product purity. This results in greater accuracy and safety, and is of significant value in base editing applications.
[0347] Example 7 Effect of Circular Linkers on Base Editing Effects
[0348] To verify the effect of linker length on the QBE base editing system. This example uses circular change linkers (CP linkers) of different lengths to replace the circular change linker GGSGGSGGSGGSGGSGGSGG (SEQ ID NO: 2) in QBE for experimentation. This example uses the same sites as Example 2 for testing, the editing system is selected as QBEmax, and the deaminase used is mini-Sdd9. The replaced CP linker sequences are shown in the following table:
[0349] Table 4:
[0350] The results show that, as shown in Figure 12, the effects of different CP linker lengths on QBEmax were tested at two endogenous target sites, site 1 and site 3. The results show that the editing efficiency of the QBE base editing system increases with the length of the CP linker in an S-shaped curve. When the CP linker length is not less than 12 aa, high editing efficiency is demonstrated. When its length is between 15 aa and 64 aa, there is no significant change in editing efficiency, purity of the editing product, or indel frequency compared to the QBEmax of the original 20 aa CP linker.
[0351] In summary, when the length of the circular transformation linker is less than 6aa, the stability of the QBE fusion protein may be low, and the efficiency of the base editor composed of it may be low; when the linker length is not less than 12aa, the stability of the fusion protein is less affected, and the editing efficiency of the base editor composed of it can be maintained at a relatively high level.
[0352] Example 8 Application of QBE base editor in plant cells
[0353] To test the editing effect of the QBE base editing system of the present invention in plant cells, this example designed sgRNAs targeting rice site 1 (GACCTCCACGCCGCCGGCAATGG; SEQ ID NO: 148, wherein the underlined portion is the PAM sequence and the rest is the protospacer sequence) of the OsEPSPS promoter in rice protoplasts, rice site 2 (GAGTGCGCGGCCATGGCGAGAGG; SEQ ID NO: 149, wherein the underlined portion is the PAM sequence and the rest is the protospacer sequence) of the OsTKL promoter, and rice site 3 (TCAGCAGGAATCTACCTTTGTGG; SEQ ID NO: 150, wherein the underlined portion is the PAM sequence and the rest is the protospacer sequence) of the OsEPSPS promoter. The fourth-generation base editing system BE4max was used as a control. 5 μg of QBEmax or BE4max and the corresponding sgRNA were mixed with the plasmids and transformed into rice protoplast cells using PEG4000. 48 hours after transformation, the cell genomic DNA was extracted and the base editing effect of the target was detected using the second-generation detection technology (NGS).
[0354] The experimental results in Figure 13 show that the QBEmax system also has a good gene editing effect in rice protoplasts. Compared with BE4max, it has a wider editing window, improved product purity and lower indel rate.
[0355] Example 9: Other QBE base editing systems
[0356] To further expand the variety of QBE editing systems, this example constructed and validated multiple QBE base editing systems. The construction of the deaminase terminal linker domains of the base editing systems and their individual domain sequences are shown in Table 5. BE4max and QBEmax served as controls, and mini-Sdd9 was selected as an exemplary deaminase to form a cytosine base editing system (SEQ ID NOs: 201-206). The editing effects of these base editing systems at site 1 and site 3 were tested. The specific experimental methods and detection methods were the same as those in Examples 2-4.
[0357] Table 5:
[0358] The experimental results, shown in Figure 14, show that compared to BE4max, some of the new QBE base editing systems achieved significantly improved product purity. QBE84 and QBE85, in particular, maintained efficient editing while improving product purity and reducing indels. Regarding the editing window, QBE84's window was similar to that of BE4max, while that of QBE85, QBE87, and QBE88 was wider. This example thus yielded a series of new QBE base editing systems, broadening the range and application scenarios of base editing tools.
[0359] Although the present invention has been described with reference to specific embodiments thereof, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the true spirit and scope of the invention. In addition, many modifications may be made to adapt specific circumstances, materials, compositions of matter, processes, process steps or steps to the purpose, spirit and scope of the present invention. All such modifications are intended to be within the scope of the appended claims.
[0360] The nucleotide or amino acid sequence involved in the present invention is:
Claims
1. A base editing fusion protein, characterized in that The base editing fusion protein comprises a deaminase domain and a paired DNA binding protein domain having a DNA single-strand cleavage function; The paired DNA binding protein domains with DNA single-strand cleavage function include a deaminase N-terminal connecting domain and a deaminase C-terminal connecting domain, and the deaminase N-terminal connecting domain and the deaminase C-terminal connecting domain are respectively connected to the N-terminus and C-terminus of the deaminase domain through optional linkers.
2. The base editing fusion protein according to claim 1, characterized in that The base editing fusion protein comprises the structure: [deaminase N-terminal connecting domain]-[deaminase]-[deaminase C-terminal connecting domain], wherein "-" is an optional linker.
3. The base editing fusion protein according to claim 2, characterized in that The deaminase N-terminal connecting domain and the deaminase C-terminal connecting domain are independently composed of 1-2 single domains; Optionally, the base editing fusion protein comprises the structure: [X1]-[X2]-[deaminase]-[X3]-[X4], wherein X 1-4 is a single domain, and "-" is an optional linker.
4. The base editing fusion protein according to claim 3, characterized in that The X 1-4 The single domain is selected from the following combinations: (1) X1 is SEQ ID NO: 158, X2 is SEQ ID NO: 159, X3 is SEQ ID NO: 160, and X4 is none; (2) X1 is none, X2 is SEQ ID NO: 161, X3 is SEQ ID NO: 162, and X4 is SEQ ID NO: 163; (3) X1 is none, X2 is SEQ ID NO: 164, X3 is SEQ ID NO: 165, and X4 is SEQ ID NO: 166; (4) X1 is SEQ ID NO: 181, X2 is SEQ ID NO: 182, X3 is sequence Q, and X4 is none; (5) X1 is none, X2 is SEQ ID NO: 183, X3 is SEQ ID NO: 184, and X4 is SEQ ID NO: 185; (6) X1 is none, X2 is SEQ ID NO: 186, X3 is SEQ ID NO: 187, and X4 is SEQ ID NO: 188; (7) X1 is SEQ ID NO: 189, X2 is SEQ ID NO: 190, X3 is SEQ ID NO: 191, and X4 is none; (8) X1 is SEQ ID NO: 192, X2 is SEQ ID NO: 193, X3 is SEQ ID NO: 194, and X4 is none; (9) X1 is SEQ ID NO: 195, X2 is SEQ ID NO: 196, X3 is SEQ ID NO: 197, and X4 is none; (10) X1 is SEQ ID NO: 198, X2 is SEQ ID NO: 199, X3 is SEQ ID NO: 200, and X4 is none.
5. The base editing fusion protein according to any one of claims 1 to 4, characterized in that The deaminase is cytidine deaminase or adenosine deaminase.
6. The base editing fusion protein according to claim 5, characterized in that The cytidine deaminase is selected from the group consisting of APOBEC family deaminase, SCP1.201 family deaminase or homologs thereof; Preferably, the APOBEC family deaminase is selected from AID deaminase, APOBEC1 deaminase, APOBEC2 deaminase, APOBEC3A deaminase, APOBEC3B deaminase, APOBEC3C deaminase, APOBEC3D deaminase, APOBEC3F deaminase, APOBEC3G deaminase, APOBEC3H deaminase, or variants thereof; Preferably, the SCP1.201 family deaminase is selected from Sdd2, Sdd3, Sdd4 deaminase, Sdd6 deaminase, Sdd7 deaminase, Sdd9 deaminase, Sdd10 deaminase, Sdd59 deaminase, mini-Sdd3 deaminase, mini-Sdd6 deaminase, mini-Sdd7 deaminase, mini-Sdd9 deaminase, or variants thereof.
7. The base editing fusion protein according to claim 5, characterized in that The adenosine deaminase is selected from QB34, TadA8e, TadA7.10, TadA dimer or variants thereof, and optionally, the TadA dimer comprises TadA7.10 and wild-type TadA.
8. The base editing fusion protein according to any one of claims 1 to 7, characterized in that The base editing fusion protein also includes a uracil DNA glycosylase inhibitor (UGI) domain and / or a nuclear localization sequence (NLS).
9. The base editing fusion protein according to any one of claims 1 to 8, characterized in that The linker length is 0-100 amino acids; Preferably, the linker is 12-100 amino acids long; Optionally, the linker comprises an amino acid sequence (GGGS)n (SEQ ID NO:47), (GGGGS)n (SEQ ID NO:48), (G)n, (EAAAK)n (SEQ ID NO:49), (GGS)n, (SGGS)n (SEQ ID NO:51), SGSETPGTSESATPES (SEQ ID NO:52), or (XP)n motif or a combination thereof, wherein n is independently an integer from 1 to 32, and wherein X is any amino group.
10. The base editing fusion protein according to any one of claims 1 to 9, characterized in that The base editing fusion protein comprises one or more of the following sequences: (i) an amino acid sequence as shown in any one of SEQ ID NOs: 89-92, 94, 96, 99, 101, 103, 105-115, 118, 179, 201-206; (ii) an amino acid sequence that has at least 80%, 82%, 85%, 87%, 90%, 92%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 89-92, 94, 96, 99, 101, 103, 105-115, 118, 179, 201-206; (iii) an amino acid sequence in which one or more amino acid residues are added, substituted, deleted or inserted into the amino acid sequence of any one of SEQ ID NOs: 89-92, 94, 96, 99, 101, 103, 105-115, 118, 179, 201-206; or (iv) an amino acid sequence encoded by a nucleotide sequence that hybridizes with a polynucleotide sequence encoding an amino acid sequence as shown in any one of SEQ ID NOs: 89-92, 94, 96, 99, 101, 103, 105-115, 118, 179, 201-206 under stringent conditions, wherein the stringent conditions are medium stringency conditions, medium-high stringency conditions, high stringency conditions or very high stringency conditions.
11. The base editing fusion protein according to any one of claims 1 to 10, characterized in that The base editing fusion protein forms a complex with the guide RNA and binds to the target DNA.
12. A base editing system, characterized in that: The base editing system comprises at least one of the following components i) to v): i) base editing fusion protein, and guide RNA; ii) an expression construct comprising a nucleotide sequence encoding a base editor fusion protein, and a guide RNA; iii) a base editing fusion protein, and an expression construct comprising a nucleotide sequence encoding a guide RNA; iv) an expression construct comprising a nucleotide sequence encoding a base editing fusion protein, and an expression construct comprising a nucleotide sequence encoding a guide RNA; v) an expression construct comprising a nucleotide sequence encoding a base editing fusion protein and a nucleotide sequence encoding a guide RNA; The base editing fusion protein comprises a deaminase domain and a paired DNA binding protein domain having a DNA single-strand cleavage function; The paired DNA binding protein domains with DNA single-strand cleavage function include a deaminase N-terminal connecting domain and a deaminase C-terminal connecting domain, and the deaminase N-terminal connecting domain and the deaminase C-terminal connecting domain are respectively connected to the N-terminus and C-terminus of the deaminase domain through optional linkers.
13. The base editing system according to claim 12, characterized in that The base editing fusion protein comprises the structure: [deaminase N-terminal connecting domain]-[deaminase]-[deaminase C-terminal connecting domain], wherein "-" is an optional linker.
14. The base editing system according to claim 13, characterized in that The deaminase N-terminal connecting domain and the deaminase C-terminal connecting domain are independently composed of 1-2 single domains; Optionally, the base editing fusion protein comprises the structure: [X1]-[X2]-[deaminase]-[X3]-[X4], wherein X 1-4 is a single domain, and "-" is an optional linker.
15. The base editing system according to claim 14, characterized in that The X 1-4 The single domain is selected from the following combinations: (1) X1 is SEQ ID NO: 158, X2 is SEQ ID NO: 159, X3 is SEQ ID NO: 160, and X4 is none; (2) X1 is none, X2 is SEQ ID NO: 161, X3 is SEQ ID NO: 162, and X4 is SEQ ID NO: 163; (3) X1 is none, X2 is SEQ ID NO: 164, X3 is SEQ ID NO: 165, and X4 is SEQ ID NO: 166; (4) X1 is SEQ ID NO: 181, X2 is SEQ ID NO: 182, X3 is sequence Q, and X4 is none; (5) X1 is none, X2 is SEQ ID NO: 183, X3 is SEQ ID NO: 184, and X4 is SEQ ID NO: 185; (6) X1 is none, X2 is SEQ ID NO: 186, X3 is SEQ ID NO: 187, and X4 is SEQ ID NO: 188; (7) X1 is SEQ ID NO: 189, X2 is SEQ ID NO: 190, X3 is SEQ ID NO: 191, and X4 is none; (8) X1 is SEQ ID NO: 192, X2 is SEQ ID NO: 193, X3 is SEQ ID NO: 194, and X4 is none; (9) X1 is SEQ ID NO: 195, X2 is SEQ ID NO: 196, X3 is SEQ ID NO: 197, and X4 is none; (10) X1 is SEQ ID NO: 198, X2 is SEQ ID NO: 199, X3 is SEQ ID NO: 200, and X4 is none.
16. The base editing system according to any one of claims 12 to 15, characterized in that The deaminase is cytidine deaminase or adenosine deaminase.
17. The base editing system according to claim 16, characterized in that The cytidine deaminase is selected from the group consisting of APOBEC family deaminase, SCP1.201 family deaminase or homologs thereof; Preferably, the APOBEC family deaminase is selected from AID deaminase, APOBEC1 deaminase, APOBEC2 deaminase, APOBEC3A deaminase, APOBEC3B deaminase, APOBEC3C deaminase, APOBEC3D deaminase, APOBEC3F deaminase, APOBEC3G deaminase, APOBEC3H deaminase, or variants thereof; Preferably, the SCP1.201 family deaminase is selected from Sdd2, Sdd3, Sdd4 deaminase, Sdd6 deaminase, Sdd7 deaminase, Sdd9 deaminase, Sdd10 deaminase, Sdd59 deaminase, mini-Sdd3 deaminase, mini-Sdd6 deaminase, mini-Sdd7 deaminase, mini-Sdd9 deaminase, or variants thereof.
18. The base editing system according to claim 16, characterized in that The adenosine deaminase is selected from QB34, TadA8e, TadA7.10, TadA dimer or variants thereof, and optionally, the TadA dimer comprises TadA7.10 and wild-type TadA.
19. The base editing system according to any one of claims 12 to 18, characterized in that The base editing fusion protein also includes a uracil DNA glycosylase inhibitor (UGI) domain and / or a nuclear localization sequence (NLS).
20. The base editing system according to any one of claims 12 to 19, characterized in that The linker length is 0-100 amino acids; Preferably, the linker is 12-100 amino acids long; Optionally, the linker comprises an amino acid sequence (GGGS)n (SEQ ID NO:47), (GGGGS)n (SEQ ID NO:48), (G)n, (EAAAK)n (SEQ ID NO:49), (GGS)n, (SGGS)n (SEQ ID NO:51), SGSETPGTSESATPES (SEQ ID NO:52), or (XP)n motif or a combination thereof, wherein n is independently an integer from 1 to 32, and wherein X is any amino group.
21. The base editing system according to any one of claims 12 to 20, characterized in that The base editing fusion protein comprises one or more of the following sequences: (i) an amino acid sequence as shown in any one of SEQ ID NOs: 89-92, 94, 96, 99, 101, 103, 105-115, 118, 179, 201-206; (ii) an amino acid sequence that has at least 80%, 82%, 85%, 87%, 90%, 92%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 89-92, 94, 96, 99, 101, 103, 105-115, 118, 179, 201-206; (iii) an amino acid sequence in which one or more amino acid residues are added, substituted, deleted or inserted into the amino acid sequence of any one of SEQ ID NOs: 89-92, 94, 96, 99, 101, 103, 105-115, 118, 179, 201-206; or (iv) an amino acid sequence encoded by a nucleotide sequence that hybridizes with a polynucleotide sequence encoding an amino acid sequence as shown in any one of SEQ ID NOs: 89-92, 94, 96, 99, 101, 103, 105-115, 118, 179, 201-206 under stringent conditions, wherein the stringent conditions are medium stringency conditions, medium-high stringency conditions, high stringency conditions or very high stringency conditions.
22. The base editing system according to any one of claims 12 to 21, characterized in that The base editing fusion protein forms a complex with the guide RNA and binds to the target DNA.
23. A polynucleotide, characterized in that The polynucleotide encodes: (a) the base editing fusion protein of any one of claims 1 to 11; (b) The base editing system of any one of claims 12-22.
24. An expression construct, characterized in that The expression construct comprises the polynucleotide of claim 23.
25. The expression construct according to claim 24, characterized in that The expression construct is selected from the group consisting of expression constructs of viruses, bacteria, yeast, plants, and mammalian cells.
26. A host cell, characterized in that The host cell contains the base editing fusion protein of any one of claims 1-11, the base editing system of any one of claims 12-22, the polynucleotide of claim 23, or the expression construct of claim 24 or 25.
27. A method for producing at least one genetically modified cell, comprising introducing the base editing fusion protein of any one of claims 1-11, the base editing system of any one of claims 12-22, the polynucleotide of claim 23, or the expression construct of claim 24 or 25 into at least one of the cells, thereby causing base substitution in the nucleic acid sequence within the target nucleotide region in the at least one cell.
28. The method according to claim 27, characterized in that The base editing system is introduced into cells by a method selected from the following: calcium phosphate transfection, protoplast fusion, electroporation, liposome transfection, microinjection, viral infection (such as baculovirus, vaccinia virus, adenovirus, adeno-associated virus, lentivirus or other virus), N-acetylgalactosamine (GalNAc) mediation, gene gun method, PEG-mediated protoplast transformation and / or soil Agrobacterium-mediated transformation.
29. The method according to claim 27 or 28, characterized in that The cell is a cell from a prokaryotic organism such as bacteria; a eukaryotic organism such as a plant, a fungus or a vertebrate.
30. The method according to claim 29, characterized in that The vertebrate is a mammal such as a human, mouse, rat, monkey, dog, pig, sheep, cow, cat; the plant is a crop plant, such as wheat, rice, corn, soybean, sunflower, sorghum, rapeseed, alfalfa, cotton, barley, millet, sugarcane, tomato, tobacco, cassava or potato.
31. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the base editing fusion protein of any one of claims 1 to 11, the base editing system of any one of claims 12 to 22, the polynucleotide of claim 23, the expression construct of claim 24 or 25, or the host cell of claim 26; Optionally, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.
32. A kit, characterized in that The kit comprises the base editing fusion protein of any one of claims 1-11, the base editing system of any one of claims 12-22, the polynucleotide of claim 23, the expression construct of claim 24 or 25, or the host cell of claim 26.
33. A method for modifying a target nucleic acid, characterized in that: The method comprises the step of contacting the target nucleic acid with a base editing fusion protein as described in any one of claims 1-11, a base editing system as described in any one of claims 12-22, a polynucleotide as described in claim 23, an expression construct as described in claim 24 or 25, a pharmaceutical composition as described in claim 31, or a kit as described in claim 32.
34. Use of the base editing fusion protein of any one of claims 1-11, the base editing system of any one of claims 12-22, the polynucleotide of claim 23, the expression construct of claim 24 or 25, the host cell of claim 26, or the pharmaceutical composition of claim 31 in the preparation of a reagent for modifying a target nucleic acid.
35. Use of the base editing fusion protein of any one of claims 1-11, the base editing system of any one of claims 12-22, the polynucleotide of claim 23, the expression construct of claim 24 or 25, or the host cell of claim 26 in the preparation of a medicament for preventing and / or treating diseases related to or caused by gene mutations.
Citation Information
Patent Citations
Delivery, use and therapeutic applications of the crispr-CAS systems and compositions for HBV and viral diseases and disorders
WO2015089465A1
Novel crispr enzymes and systems
WO2016205711A1
Compounds, compositions and methods for cancer treatment
WO2018141835A1
Uses of adenosine base editors
WO2019079347A1
Methods and compositions for editing nucleotide sequences
WO2020191233A1