Diagnostic aptamer

Abstract

The present disclosure relates to the field of aptamers. More particularly, the present disclosure relates to aptamers for the specific binding of Group B Streptococcal (GBS) bacteria, such as Streptococcus agalactiae. Additionally, this disclosure relates to methods of using such aptamers in diagnosing, monitoring or treating diseases, disorders or conditions associated with GBS in patients.

Description

[0001] Diagnostic Aptamer

[0002] Cross-reference to related applications

[0003] The present application claims priority from Australian Provisional Patent Application No. 2023904008 filed on 11 December 2023, the contents of which are incorporated herein by reference in their entirety.

[0004] Sequence Listing

[0005] The present application is filed with a Sequence Listing, which has been submitted in electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on 4 December 2024, is named “Diagnostic Aptamer” and is 24,272 bytes in size.

[0006] Technical field

[0007] The present disclosure relates to the field of aptamers. More particularly, the present disclosure relates to aptamers for the specific binding of Group B Streptococcal (GBS) bacteria, such as Streptococcus agalactiae. Additionally, this disclosure relates to methods of using such aptamers in diagnosing or monitoring diseases, disorders or conditions associated with GBS in patients.

[0008] Background

[0009] Streptococcus agalactiae (S. agalactiae) is a Group B Streptococcus (GBS) that belongs to the Gram-positive bacterial class. These bacteria can be found in different parts of the body and cause a variety of illnesses. In particular, pregnant women carrying these bacteria during the late stage of pregnancy, may pass the bacteria onto the newly born babies. GBS infection in newly born babies can bring life-threatening complications, including sepsis, pneumonia, and meningitis. Therefore, early detection of GBS can pave the way for the appropriate medical intervention to save the lives of neonates. Current methods available to detect GBS include enriched culture medium, polymerase chain reaction (PCR), nucleic acid amplification tests or chromogenic mediabased detection that are either expensive, require technical expertise, or require a long wait time.

[0010] Therefore, there is a need to develop molecular recognition elements that can bind to GBS with high sensitivity and high selectivity. High sensitivity is needed to detect a low number of bacteria, and high selectivity is needed to precisely identify the GBS strain. Summary

[0011] The present disclosure is based on the design and development of a series of singlestranded DNA (ssDNA) aptamers that bind to pathogenic GBS bacteria with high specificity and high sensitivity. The developed aptamers also demonstrate high affinity to GBS bacteria. Hence, the aptamers of the invention can be used to identify or monitor a GBS infection in patients, and more particularly, pregnant women and newly born babies, within point-of-care clinical settings.

[0012] In a first aspect, the present disclosure provides an aptamer for binding a Group B Streptococcus (GBS) bacteria, wherein the aptamer comprises, consists of or consists essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 10 or a fragment, variant or derivative thereof.

[0013] In a related aspect, the present disclosure provides an aptamer for binding a GBS bacteria, wherein the aptamer comprises, consists of or consists essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 14 to 29 or a fragment, variant or derivative thereof.

[0014] Suitably, the aptamer has a dissociation constant (KD) for the GBS bacteria of 500 nM or less.

[0015] Suitably, the GBS bacteria is Streptococcus agalactiae .

[0016] Suitably, the aptamer is or comprises a DNA molecule.

[0017] In some examples, the aptamer is single stranded. For example, the aptamer is or comprises a single stranded DNA molecule.

[0018] In one example, the aptamer forms a secondary or tertiary structure comprising a hairpin loop.

[0019] In some examples, the aptamer comprises at least one chemical modification.

[0020] Suitably, the modification is one or more of: a chemical substitution at a sugar position, a chemical substitution at an internucleotide linkage, a chemical substitution at a base position, and a chemical addition at a base position.

[0021] In a second aspect, the present disclosure provides a sensor for detecting GBS bacteria, comprising the aptamer of the first aspect.

[0022] Suitably, the aptamer is coupled, bound, affixed or otherwise linked to a substrate.

[0023] Suitably, the substrate comprises one or more of a bead, a matrix, a cross-linked polymer, a gel, a particle, a surface, a plate, a paper, a membrane, a well or other solid or semi- solid substrate.

[0024] In some examples, the substrate comprises one or more of a sensor chip surface, an ELISA / ELLBA plate, a sepharose, an agarose, Protein A, Protein G, a magnetic bead, a paramagnetic particle or a nanoparticle. In a third aspect, the present disclosure provides a method of detecting GBS bacteria in a sample, said method including the steps of:

[0025] (a) contacting the sample with the aptamer of the first aspect or the sensor of the second aspect; and

[0026] (b) detecting the presence or absence of or measuring a level of a GBS bacteria: aptamer complex, to thereby detect GBS bacteria in the sample.

[0027] In a fourth aspect, the present disclosure provides a method of detecting a GBS bacterial infection in a subject, said method including the steps:

[0028] (a) contacting a biological sample obtained from the subject with the aptamer of any one of the first aspect or the sensor of the second aspect; and

[0029] (b) detecting the presence or absence of or measuring a level of a GBS bacteria: aptamer complex, to thereby detect the GBS bacterial infection in the subject.

[0030] In a fifth aspect, the present disclosure provides a method of isolating or purifying GBS bacteria from a sample, said method including the steps of:

[0031] (a) contacting the sample with the aptamer of the first aspect or the sensor of the second aspect; and

[0032] (b) isolating a GBS bacteria: aptamer complex from the sample, to thereby isolate or purify GBS bacteria from the sample.

[0033] In a sixth aspect, the present disclosure provides a method of monitoring a GBS bacterial infection in a subject, said method including the steps of:

[0034] (a) contacting a biological sample obtained from the subject with the aptamer of any one of the first aspect or the sensor of the second aspect; and

[0035] (b) detecting the presence or absence of or measuring a level of a GBS bacteria: aptamer complex; to thereby monitor the GBS bacterial infection in the subject.

[0036] Suitably, the subject is a pregnant female or a newborn.

[0037] In a seventh aspect, the present disclosure provides a method of preventing, ameliorating or treating a GBS bacterial infection in a subject, said method including the step of administering a therapeutically effective amount of a treatment for the GBS bacterial infection to the subject in which the presence of a GBS bacteria: aptamer complex has been determined in one or more biological samples of the subject.

[0038] In an eighth aspect, the present disclosure provides a method of producing a sensor for detecting GBS bacteria, said method including the steps of: (a) providing a substrate; and

[0039] (b) coupling, binding, affixing or otherwise linking the aptamer of the first aspect to the substrate, to thereby produce the sensor.

[0040] Referring to any one of the first to the eighth aspects, the GBS bacteria is suitably Streptococcus agalactiae or the GBS bacterial infection is suitably at least partly mediated or associated with Streptococcus agalactiae .

[0041] Suitably, the sensor is that of the second aspect.

[0042] In a ninth aspect, the present disclosure provides a sensor produced according to the method of the eighth aspect.

[0043] In a tenth aspect, the present disclosure provides a kit comprising the aptamer of the first aspect or the sensor of the second aspect, and optionally instructions for use.

[0044] In an eleventh aspect, the present disclosure provides a test reagent comprising the aptamer of the first aspect, and optionally one or more acceptable excipients, diluents or carriers.

[0045] Suitably, the kit of the ninth aspect or the test reagent of the tenth aspect are suitable for use in the method of any one of third to seventh aspects.

[0046] Brief description of the drawings

[0047] The following figures form part of the present specification and are included to further demonstrate certain aspects of the present disclosure. The disclosure may be better understood by reference to one or more of these figures in combination with the detailed description of specific embodiments presented herein. It will be appreciated by persons skilled in the art that numerous variations and / or modifications may be made to the above-described embodiments, without departing from the broad general scope of the present disclosure. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.

[0048] Figure 1: Components of the ssDNA random library used for the SELEX process. N44 corresponds to variable region (44 bases), with 5' and 3' fixed regions. The forward and reverse primers used during PCR amplification are also indicated.

[0049] Figure 2: SELEX scheme for the development of ssDNA-based anti-GBS aptamer. GBS bacteria were incubated with a single-stranded DNA random library (80 nucleotides long) for 90 minutes at room temperature. The unbound ssDNA aptamers were removed through centrifugation and the aptamers bound on GBS were eluted in the elution buffer. The ssDNA aptamers were then enriched through PCR. The PCR amplicons were digested using lambda exonuclease to make single- stranded DNA for the next round of SELEX. Figure 3: Agarose gel electrophoresis image showing the products of anti-GBS aptamer obtained through the SELEX discovery process. The ssDNA aptamer (after 5thand 10throunds of SELEX process) as well as the corresponding dsDNA aptamer products were loaded into 3% agarose gel and stained with lx SYBR™ Gold. The gel was run at 90V using lx TAE buffer. The lowest band in the 100 bp ladder corresponds to 100 base pairs.

[0050] Figure 4: Secondary structure of ssDNA-based anti-GBS aptamers for Ranks #1-10 identified in Table 1. (A) Rank#l; truncated aptamer with KD value of 0.1 nM, (B) Rank#2; truncated aptamer with KD value of 2 nM, (C) Rank#3; aptamer with KD value of 3.7 nM, (D) Rank#4; aptamer with KD value of 37 nM, (E) Rank#5; aptamer with KD value of 65 nM. (F) Rank#6; aptamer with KD value of 115 nM, (G) Rank#7; truncated aptamer with KD value of 125 nM. (H) Rank#8; truncated aptamer with KD value of 250 nM. (I) Rank#9; truncated aptamer with KD value of 290 nM. (J) Rank#10; truncated aptamer with KD value of 455 nM.

[0051] Key to the Sequence Listing

[0052] SEQ ID NO: 1 Nucleotide sequence of Aptamer Rank No. 1

[0053] SEQ ID NO: 2 Nucleotide sequence of Aptamer Rank No. 2

[0054] SEQ ID NO: 3 Nucleotide sequence of Aptamer Rank No. 3

[0055] SEQ ID NO: 4 Nucleotide sequence of Aptamer Rank No. 4

[0056] SEQ ID NO: 5 Nucleotide sequence of Aptamer Rank No. 5

[0057] SEQ ID NO: 6 Nucleotide sequence of Aptamer Rank No. 6

[0058] SEQ ID NO: 7 Nucleotide sequence of Aptamer Rank No. 7

[0059] SEQ ID NO: 8 Nucleotide sequence of Aptamer Rank No. 8

[0060] SEQ ID NO: 9 Nucleotide sequence of Aptamer Rank No. 9

[0061] SEQ ID NO: 10 Nucleotide sequence of Aptamer Rank No. 10

[0062] SEQ ID NO: 11 Nucleotide sequence used for aptamer selection in ssDNA library preparation

[0063] SEQ ID NO: 12 Nucleotide sequence of forward primer

[0064] SEQ ID NO: 13 Nucleotide sequence of reverse primer

[0065] SEQ ID NO: 14 Nucleotide sequence of core sequence 1

[0066] SEQ ID NO: 15 Nucleotide sequence of core sequence 2

[0067] SEQ ID NO: 16 Nucleotide sequence of core sequence 3

[0068] SEQ ID NO: 17 Nucleotide sequence of core sequence 4

[0069] SEQ ID NO: 18 Nucleotide sequence of core sequence 5

[0070] SEQ ID NO: 19 Nucleotide sequence of core sequence 6

[0071] SEQ ID NO: 20 Nucleotide sequence of hairpin structure Aptamer Rank No. 1 SEQ ID NO: 21 Nucleotide sequence of hairpin structure Aptamer Rank No. 2

[0072] SEQ ID NO: 22 Nucleotide sequence of hairpin structure Aptamer Rank No. 3

[0073] SEQ ID NO: 23 Nucleotide sequence of hairpin structure Aptamer Rank No. 4

[0074] SEQ ID NO: 24 Nucleotide sequence of hairpin structure Aptamer Rank No. 5

[0075] SEQ ID NO: 25 Nucleotide sequence of hairpin structure Aptamer Rank No. 6

[0076] SEQ ID NO: 26 Nucleotide sequence of hairpin structure Aptamer Rank No. 7

[0077] SEQ ID NO: 27 Nucleotide sequence of hairpin structure Aptamer Rank No. 8

[0078] SEQ ID NO: 28 Nucleotide sequence of hairpin structure Aptamer Rank No. 9

[0079] SEQ ID NO: 29 Nucleotide sequence of hairpin structure Aptamer Rank No. 10

[0080] Detailed description

[0081] General Techniques and Definitions

[0082] Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in genomics, immunology, molecular biology, immunohistochemistry, biochemistry, microbiology, oncology, and pharmacology).

[0083] The present disclosure is performed without undue experimentation using, unless otherwise indicated, conventional techniques of molecular biology, microbiology, recombinant DNA technology and immunology. Such procedures are described, for example in Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Fourth Edition (2012), whole of Vols I, II, and III; DNA Cloning: A Practical Approach, Vols. I and II (D. N. Glover, Second Edition., 1995), IRL Press, Oxford, whole of text; Oligonucleotide Synthesis: A Practical Approach (M. J. Gait, ed, 1984) IRL Press, Oxford, whole of text, and particularly the papers therein by Gait, ppl-22; Atkinson et al, pp35-81; Sproat et al, pp 83-115; and Wu et al, pp 135-151; 4. Nucleic Acid Hybridization: A Practical Approach (B. D. Hames & S. J. Higgins, eds., 1985) IRL Press, Oxford, whole of text; Immobilized Cells and Enzymes: A Practical Approach (1986) IRL Press, Oxford, whole of text; Perbal, B., A Practical Guide to Molecular Cloning (1984) and Methods In Enzymology (S. Colowick and N. Kaplan, eds., Academic Press, Inc.), whole of series.

[0084] Those skilled in the art will appreciate that the present disclosure is susceptible to variations and modifications other than those specifically described. It is to be understood that the disclosure includes all such variations and modifications. The disclosure also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.

[0085] The present disclosure is not to be limited in scope by the specific embodiments described herein, which are intended for the purpose of exemplification only. Functionally equivalent products, compositions and methods are clearly within the scope of the disclosure, as described herein.

[0086] Each feature of any particular aspect or embodiment or embodiment of the present disclosure may be applied mutatis mutandis to any other aspect or embodiment or embodiment of the present disclosure.

[0087] Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e., one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter.

[0088] As used herein, the singular forms of “a”, “and” and “the” include plural forms of these words, unless the context clearly dictates otherwise. For example, a reference to “a bacterium” includes a plurality of such bacteria, and a reference to “an allergen” is a reference to one or more allergens.

[0089] The term “and / or”, e.g., “X and / or Y” shall be understood to mean either “X and Y” or “X or Y” and shall be taken to provide explicit support for both meanings or for either meaning.

[0090] As used herein, the term about, unless stated to the contrary, refers to + / - 10%, more preferably + / -5%, even more preferably + / -1%, of the designated value.

[0091] Throughout the present specification, various aspects and components of the disclosure can be presented in a range format. The range format is included for convenience and should not be interpreted as an inflexible limitation on the scope of the present disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range, unless specifically indicated. For example, description of a range such as from 1 to 5 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 5, from 3 to 5 etc., as well as individual and partial numbers within the recited range, for example, 1, 2, 3, 4, 5, 5.5 and 6, unless where integers are required or implicit from context. This applies regardless of the breadth of the disclosed range. Where specific values are required, these will be indicated in the specification.

[0092] Throughout this specification, the word “comprise’ or variations such as “comprises” or “comprising” will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

[0093] By “consisting essentially of’, in the context of: (a) an amino acid sequence, is meant the recited amino acid sequence together with an additional one, two or three amino acids at the N- and / or C-terminus thereof; or (b) a nucleic acid sequence, is meant the recited nucleic acid sequence together with an additional one, two or three nucleic acids at the 5' and / or 3' thereof.

[0094] All computer programs, algorithms, patent and scientific literature referred to herein is incorporated herein by reference.

[0095] For the present disclosure, the database accession number or unique identifier provided herein for a gene or protein, as well as the gene and / or protein sequence or sequences associated therewith, are incorporated by reference herein.

[0096] Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present disclosure as it existed before the priority date of each of the appended claims.

[0097] Diagnostic aptamers

[0098] The inventors have surprisingly found aptamers with low dissociation constants (KD) that can be utilised to specifically bind a GBS bacteria strain with a high selectivity and thereby quickly and precisely identify the presence or absence of a GBS bacteria and / or to measure the level of a GBS bacteria in a sample.

[0099] In one broad form, the present disclosure provides an aptamer for binding a Group B Streptococcus (GBS) bacteria, wherein the aptamer comprises, consists of or consists essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 10 and 14 to 29, or a fragment, variant or derivative thereof.

[0100] Accordingly, in one form, provided herein is an aptamer for binding a Group B Streptococcus (GBS) bacteria, wherein the aptamer comprises, consists of or consists essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 10, or a fragment, variant or derivative thereof.

[0101] In a related form, provided herein is an aptamer for binding a GBS bacteria, wherein the aptamer comprises, consists of or consists essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 14 to 29 or a fragment, variant or derivative thereof.

[0102] In the context of this disclosure, the term “aptamer” or “aptamers” refers to non-naturally occurring nucleic acid or peptide structures which are folded into a three dimensional structure and demonstrate a high affinity for a target antigen, such as GBS bacteria. An aptamer may refer to an oligomer or polymer of ribonucleic acid (RNA), deoxyribonucleic acid (DNA) or RNA-DNA hybrid, wherein the polymer or oligomer of nucleotide monomers contains any combination of nucleobases (referred to in the art and herein as simply as “base”), modified nucleobases, sugars, modified sugars, phosphate bridges, or modified phosphorus atom bridges (also referred to herein as “intemucleotide linkage”).

[0103] The term “nucleic acid” as used herein designates single- or double- stranded DNA and RNA. DNA includes genomic DNA and cDNA. RNA includes mRNA, RNA, RNAi, siRNA, cRNA and autocatalytic RNA. Nucleic acids may also be DNA-RNA hybrids. A nucleic acid comprises a nucleotide sequence which typically includes nucleotides that comprise an A, G, C, T or U base. However, nucleotide sequences may include other bases such as modified purines (for example inosine, methylinosine and methyladenosine) and modified pyrimidines (for example thiouridine and methylcytosine).

[0104] Aptamers can be single stranded (ss), double stranded (ds) or a combination thereof. A single- stranded aptamer can have double- stranded regions and a double- stranded aptamer can have single- stranded regions (such as a microRNA or shRNA). Aptamers for use in the sensors and methods of the present disclosure are suitably DNA aptamers. The term “DNA aptamer”, as used herein, refers to an aptamer comprising DNA or comprising modified backbone nucleic acids, such as PNA, that are derived from the DNA base sequence. For example, the aptamer may be a single stranded DNA aptamer. The aptamer may comprise chemically modified nucleic acids, for example in which the sugar and / or phosphate and / or base thereof is chemically modified. Such modifications may improve the stability of the aptamer and / or make the aptamer more resistant to degradation and may include modification at the 2' position of ribose.

[0105] Aptamers have a number of advantages over antibodies, such as, a tolerance to wide ranges of pH and salt concentrations, heat stability, ease of synthesis, and cost efficiency. The specificity and affinity of aptamers are comparable to, if not higher than, antibodies. Aptamers are also capable of being reversibly denatured for the release of target compounds, which makes the aptamers especially useful receptors for biosensing applications.

[0106] Aptamers to a given target, including those of the present disclosure, may be identified and / or produced by the method of Systematic Evolution of Ligands by Exponential enrichment (SELEX™). Aptamers and SELEX are described in Tuerk and Gold (Science, 1990, 249:505-10) and in WO 91 / 19813.

[0107] The present disclosure provides an aptamer for binding a GBS bacteria, wherein the aptamer comprises, consists of or consists essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 10 and 14 to 29 or a fragment, variant or derivative thereof.

[0108] The aptamers described herein may comprise a nucleotide sequence of 5'-ACACCAAC-3' (SEQ ID NO: 14), or a variant or derivative thereof. Alternatively, or in addition, the aptamers described herein may comprise a nucleotide sequence of 5'-ACACCAACA-3' (SEQ ID NO: 15), or a variant or derivative thereof. Alternatively, or in addition the aptamers described herein may comprise a nucleotide sequence of 5'-ACACCAACT-3' (SEQ ID NO: 16), or a variant or derivative thereof. Alternatively, or in addition the aptamers described herein may comprise a nucleotide sequence of 5'-GATGGCTACTTCGCTACTGG-3' (SEQ ID NO: 17), or a variant or derivative thereof. Alternatively, or in addition the aptamers described herein may comprise a nucleotide sequence of 5'-CACCAGTCAGACACCAACAC-3' (SEQ ID NO: 18), or a variant or derivative thereof. Alternatively, or in addition the aptamers described herein may comprise a nucleotide sequence of 5'-CACCAGTCAGACACCAACT-3' (SEQ ID NO: 19), or a variant or derivative thereof. For such examples, the nucleotide sequence is suitably at a 5’ end of the aptamer.

[0109] An aptamer described herein may comprise, consist of or consist essentially of a nucleotide sequence of ACACCAACAGGATAGATAGGTTAATTGGTT (SEQ ID NO: 1), or a fragment, variant or derivative thereof. In some examples, the aptamer of the present disclosure comprises, consists of or consists essentially of a nucleotide sequence that is complementary to that of SEQ ID NO: 1, or a fragment, variant or derivative thereof. It is envisaged that one or more of the thymine residues of SEQ ID NO: 1, or a nucleotide sequence complementary thereto, can be a uracil residue. In certain examples, the aptamer described herein comprises a nucleotide sequence that demonstrates at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 1 or a nucleotide sequence complementary thereto.

[0110] Alternatively, an aptamer described herein may comprise, consist of or consist essentially of a nucleotide sequence of

[0111] ACACCAACACGCGGTTGAGATGTGAAGTACTTGTATTTAACTCAGTATATGATGGCT ACTTCGCTACTGG (SEQ ID NO: 2), or a fragment, variant or derivative thereof. In some examples, the aptamer of the present disclosure comprises, consists of or consists essentially of a nucleotide sequence that is complementary to that of SEQ ID NO: 2, or a fragment, variant or derivative thereof. It is envisaged that one or more of the thymine residues of SEQ ID NO: 2, or a nucleotide sequence complementary thereto, can be a uracil residue. In certain examples, the aptamer described herein comprises a nucleotide sequence that demonstrates at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 2 or a nucleotide sequence complementary thereto.

[0112] Alternatively, an aptamer described herein may comprise, consist of or consist essentially of a nucleotide sequence of

[0113] CACCAGTCAGACACCAACACGCGGTTGAGATGTGAAGTACTTGTATTTAACTCAGTA TATGATGGCTACTTCGCTACTGG (SEQ ID NO: 3), or a fragment, variant or derivative thereof. In some examples, the aptamer of the present disclosure comprises, consists of or consists essentially of a nucleotide sequence that is complementary to that of SEQ ID NO: 3, or a fragment, variant or derivative thereof. It is envisaged that one or more of the thymine residues of SEQ ID NO: 3, or a nucleotide sequence complementary thereto, can be a uracil residue. In certain examples, the aptamer described herein comprises a nucleotide sequence that demonstrates at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 3 or a nucleotide sequence complementary thereto.

[0114] Alternatively, an aptamer described herein may comprise, consist of or consist essentially of a nucleotide sequence of

[0115] CACCAGTCAGACACCAACACACACTCACGGTATCATCAATTGTATTCTTCTGTGATA ATGCTGGCTACTTCGCTACTGG (SEQ ID NO: 4), or a fragment, variant or derivative thereof. In some examples, the aptamer of the present disclosure comprises, consists of or consists essentially of a nucleotide sequence that is complementary to that of SEQ ID NO: 4, or a fragment, variant or derivative thereof. It is envisaged that one or more of the thymine residues of SEQ ID NO: 4, or a nucleotide sequence complementary thereto, can be a uracil residue. In certain examples, the aptamer described herein comprises a nucleotide sequence that demonstrates at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 4 or a nucleotide sequence complementary thereto.

[0116] Alternatively, an aptamer described herein may comprise, consist of or consist essentially of a nucleotide sequence of

[0117] CACCAGTCAGACACCAACTGCGGACCGACTTTCTTTAATATTTTATTAGACTTTGATT TCCCTGGCTACTTCGCTACTGG (SEQ ID NO: 5), or a fragment, variant or derivative thereof. In some examples, the aptamer of the present disclosure comprises, consists of or consists essentially of a nucleotide sequence that is complementary to that of SEQ ID NO: 5, or a fragment, variant or derivative thereof. It is envisaged that one or more of the thymine residues of SEQ ID NO: 5, or a nucleotide sequence complementary thereto, can be a uracil residue. In certain examples, the aptamer described herein comprises a nucleotide sequence that demonstrates at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 5 or a nucleotide sequence complementary thereto.

[0118] Alternatively, an aptamer described herein may comprise, consist of or consist essentially of a nucleotide sequence of

[0119] CACCAGTCAGACACCAACTCCTTTCCTCATCATTTTTCGTTTATTCGTCATCTTACCT ACGGTGGCTACTTCGCTACTGG (SEQ ID NO: 6), or a fragment, variant or derivative thereof. In some examples, the aptamer of the present disclosure comprises, consists of or consists essentially of a nucleotide sequence that is complementary to that of SEQ ID NO: 6, or a fragment, variant or derivative thereof. It is envisaged that one or more of the thymine residues of SEQ ID NO: 6, or a nucleotide sequence complementary thereto, can be a uracil residue. In certain examples, the aptamer described herein comprises a nucleotide sequence that demonstrates at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 6 or a nucleotide sequence complementary thereto.

[0120] Alternatively, an aptamer described herein may comprise, consist of or consist essentially of a nucleotide sequence of ACACCAACACGCGGTTGAGATGTGA (SEQ ID NO: 7), or a fragment, variant or derivative thereof. In some examples, the aptamer of the present disclosure comprises, consists of or consists essentially of a nucleotide sequence that is complementary to that of SEQ ID NO: 7, or a fragment, variant or derivative thereof. It is envisaged that one or more of the thymine residues of SEQ ID NO: 7, or a nucleotide sequence complementary thereto, can be a uracil residue. In certain examples, the aptamer described herein comprises a nucleotide sequence that demonstrates at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 7 or a nucleotide sequence complementary thereto.

[0121] Alternatively, an aptamer described herein may comprise, consist of or consist essentially of a nucleotide sequence of

[0122] ACACCAACAGGATAGATAGGTTAATTGGTTTCCTTAAGTGGTTGTTAGAGTGTGGCT ACTTCGCTACTGG (SEQ ID NO: 8), or a fragment, variant or derivative thereof. In some examples, the aptamer of the present disclosure comprises, consists of or consists essentially of a nucleotide sequence that is complementary to that of SEQ ID NO: 8, or a fragment, variant or derivative thereof. It is envisaged that one or more of the thymine residues of SEQ ID NO: 8, or a nucleotide sequence complementary thereto, can be a uracil residue. In certain examples, the aptamer described herein comprises a nucleotide sequence that demonstrates at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 8 or a nucleotide sequence complementary thereto.

[0123] Alternatively, an aptamer described herein may comprise, consist of or consist essentially of a nucleotide sequence of

[0124] ACACCAACGTGCTGTCAATAAGGTATCCCTGTTAAAGACTTATTTCTTCGCATGGCT ACTTCGCTACTGG (SEQ ID NO: 9), or a fragment, variant or derivative thereof. In some examples, the aptamer of the present disclosure comprises, consists of or consists essentially of a nucleotide sequence that is complementary to that of SEQ ID NO: 9, or a fragment, variant or derivative thereof. It is envisaged that one or more of the thymine residues of SEQ ID NO: 9, or a nucleotide sequence complementary thereto, can be a uracil residue. In certain examples, the aptamer described herein comprises a nucleotide sequence that demonstrates at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 9 or a nucleotide sequence complementary thereto.

[0125] Alternatively, an aptamer described herein may comprise, consist of or consist essentially of a nucleotide sequence of CAATAAGGTATCCCTGTTAAAGACTTATTTCTTCG (SEQ ID NO: 10), or a fragment, variant or derivative thereof. In some examples, the aptamer of the present disclosure comprises, consists of or consists essentially of a nucleotide sequence that is complementary to that of SEQ ID NO: 10, or a fragment, variant or derivative thereof. It is envisaged that one or more of the thymine residues of SEQ ID NO: 10, or a nucleotide sequence complementary thereto, can be a uracil residue. In certain examples, the aptamer described herein comprises a nucleotide sequence that demonstrates at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 10 or a nucleotide sequence complementary thereto.

[0126] Suitably, an aptamer of the present disclosure includes a secondary structure and / or a tertiary structure, such as a hairpin loop, as provided herein (e.g., one or more of those secondary and / or tertiary structures illustrated in Figure 4).

[0127] As such, an aptamer described herein may comprise, consist of or consist essentially of a nucleotide sequence of SEQ ID NO: 20 (i.e., ACCAACAGGATAGATAGGTTAATTGGT), or a fragment, variant or derivative thereof. In some examples, the aptamer of the present disclosure comprises, consists of or consists essentially of a nucleotide sequence that is complementary to that of SEQ ID NO: 20, or a fragment, variant or derivative thereof. It is envisaged that one or more of the thymine residues of SEQ ID NO: 20, or a nucleotide sequence complementary thereto, can be a uracil residue. In certain examples, the aptamer described herein comprises a nucleotide sequence that demonstrates at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 20 or a nucleotide sequence complementary thereto.

[0128] Alternatively, an aptamer described herein may comprise, consist of or consist essentially of a nucleotide sequence of SEQ ID NO: 21 (i.e.,

[0129] CAACACGCGGTTGAGATGTGAAGTACTTGTATTTAACTCAGTATATGATGGCTACTT CGC), or a fragment, variant or derivative thereof. In some examples, the aptamer of the present disclosure comprises, consists of or consists essentially of a nucleotide sequence that is complementary to that of SEQ ID NO: 21, or a fragment, variant or derivative thereof. It is envisaged that one or more of the thymine residues of SEQ ID NO: 21, or a nucleotide sequence complementary thereto, can be a uracil residue. In certain examples, the aptamer described herein comprises a nucleotide sequence that demonstrates at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 21 or a nucleotide sequence complementary thereto.

[0130] Alternatively, an aptamer described herein may comprise, consist of or consist essentially of a nucleotide sequence of SEQ ID NO: 22 (i.e.,

[0131] CAACACGCGGTTGAGATGTGAAGTACTTGTATTTAACTCAGTATATGATGGCTACTT CGC), or a fragment, variant or derivative thereof. In some examples, the aptamer of the present disclosure comprises, consists of or consists essentially of a nucleotide sequence that is complementary to that of SEQ ID NO: 22, or a fragment, variant or derivative thereof. It is envisaged that one or more of the thymine residues of SEQ ID NO: 22, or a nucleotide sequence complementary thereto, can be a uracil residue. In certain examples, the aptamer described herein comprises a nucleotide sequence that demonstrates at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 22 or a nucleotide sequence complementary thereto.

[0132] Alternatively, an aptamer described herein may comprise, consist of or consist essentially of a nucleotide sequence of SEQ ID NO: 23 (i.e.,

[0133] CACGGTATCATCAATTGTATTCTTCTGTGATAATGCTGGCTACTTCG), or a fragment, variant or derivative thereof. In some examples, the aptamer of the present disclosure comprises, consists of or consists essentially of a nucleotide sequence that is complementary to that of SEQ ID NO: 23, or a fragment, variant or derivative thereof. It is envisaged that one or more of the thymine residues of SEQ ID NO: 23, or a nucleotide sequence complementary thereto, can be a uracil residue. In certain examples, the aptamer described herein comprises a nucleotide sequence that demonstrates at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 23 or a nucleotide sequence complementary thereto.

[0134] Alternatively, an aptamer described herein may comprise, consist of or consist essentially of a nucleotide sequence of SEQ ID NO: 24 (i.e.,

[0135] CAGTCAGACACCAACTGCGGACCGACTTTCTTTAATATTTTATTAGACTTTGATTTCC CTGGCTACTTCGC), or a fragment, variant or derivative thereof. In some examples, the aptamer of the present disclosure comprises, consists of or consists essentially of a nucleotide sequence that is complementary to that of SEQ ID NO: 24, or a fragment, variant or derivative thereof. It is envisaged that one or more of the thymine residues of SEQ ID NO: 24, or a nucleotide sequence complementary thereto, can be a uracil residue. In certain examples, the aptamer described herein comprises a nucleotide sequence that demonstrates at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 24 or a nucleotide sequence complementary thereto.

[0136] Alternatively, an aptamer described herein may comprise, consist of or consist essentially of a nucleotide sequence of SEQ ID NO: 25 (i.e.,

[0137] CGTTTATTCGTCATCTTACCTACGGTGGCTACTTCGCTACTG), or a fragment, variant or derivative thereof. In some examples, the aptamer of the present disclosure comprises, consists of or consists essentially of a nucleotide sequence that is complementary to that of SEQ ID NO: 25, or a fragment, variant or derivative thereof. It is envisaged that one or more of the thymine residues of SEQ ID NO: 25, or a nucleotide sequence complementary thereto, can be a uracil residue. In certain examples, the aptamer described herein comprises a nucleotide sequence that demonstrates at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 25 or a nucleotide sequence complementary thereto.

[0138] Alternatively, an aptamer described herein may comprise, consist of or consist essentially of a nucleotide sequence of SEQ ID NO: 26 (i.e., CAACACGCGGTTG), or a fragment, variant or derivative thereof. In some examples, the aptamer of the present disclosure comprises, consists of or consists essentially of a nucleotide sequence that is complementary to that of SEQ ID NO: 26, or a fragment, variant or derivative thereof. It is envisaged that one or more of the thymine residues of SEQ ID NO: 26, or a nucleotide sequence complementary thereto, can be a uracil residue. In certain examples, the aptamer described herein comprises a nucleotide sequence that demonstrates at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 26 or a nucleotide sequence complementary thereto.

[0139] Alternatively, an aptamer described herein may comprise, consist of or consist essentially of a nucleotide sequence of SEQ ID NO: 27 (i.e.,

[0140] ACCAACAGGATAGATAGGTTAATTGGTTTCCTTAAGTGGTTGTTAGAGTGTGGCTAC TTCGCTAC), or a fragment, variant or derivative thereof. In some examples, the aptamer of the present disclosure comprises, consists of or consists essentially of a nucleotide sequence that is complementary to that of SEQ ID NO: 27, or a fragment, variant or derivative thereof. It is envisaged that one or more of the thymine residues of SEQ ID NO: 27, or a nucleotide sequence complementary thereto, can be a uracil residue. In certain examples, the aptamer described herein comprises a nucleotide sequence that demonstrates at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 27 or a nucleotide sequence complementary thereto.

[0141] Alternatively, an aptamer described herein may comprise, consist of or consist essentially of a nucleotide sequence of SEQ ID NO: 28 (i.e.,

[0142] CACCAACGTGCTGTCAATAAGGTATCCCTGTTAAAGACTTATTTCTTCGCATGGCTA CTTCGC), or a fragment, variant or derivative thereof. In some examples, the aptamer of the present disclosure comprises, consists of or consists essentially of a nucleotide sequence that is complementary to that of SEQ ID NO: 28, or a fragment, variant or derivative thereof. It is envisaged that one or more of the thymine residues of SEQ ID NO: 28, or a nucleotide sequence complementary thereto, can be a uracil residue. In certain examples, the aptamer described herein comprises a nucleotide sequence that demonstrates at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 28 or a nucleotide sequence complementary thereto.

[0143] Alternatively, an aptamer described herein may comprise, consist of or consist essentially of a nucleotide sequence of SEQ ID NO: 29 (i.e., AATAAGGTATCCCTGTTAAAGACTTATT), or a fragment, variant or derivative thereof. In some examples, the aptamer of the present disclosure comprises, consists of or consists essentially of a nucleotide sequence that is complementary to that of SEQ ID NO: 29, or a fragment, variant or derivative thereof. It is envisaged that one or more of the thymine residues of SEQ ID NO: 29, or a nucleotide sequence complementary thereto, can be a uracil residue. In certain examples, the aptamer described herein comprises a nucleotide sequence that demonstrates at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 29 or a nucleotide sequence complementary thereto.

[0144] The aptamers described herein may contain at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 45, 50, 60, 70, 80, 90, 100 nucleotides in length as a single stranded molecule, or any range therein. More particularly, the aptamer is suitably about 25 to about 80 nucleotides (e.g., about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleotides, or any range therein) in length as a single stranded molecule. In other examples, the aptamer is about 25 to about 35 nucleotides in length as a single stranded molecule. In other examples, the aptamer is about 40 to about 50 nucleotides in length as a single stranded molecule. In certain examples, the aptamer is about 50 to about 60 nucleotides in length as a single stranded molecule. In other examples, the aptamer is about 60 to about 70 nucleotides in length as a single stranded molecule. In particular examples, the aptamer is about 70 to about 80 nucleotides in length as a single stranded molecule. In some examples, the aptamer is about 25 nucleotides in length as a single stranded molecule. In one example, the aptamer is about 30 nucleotides in length as a single stranded molecule. In another example, the aptamer is about 35 nucleotides in length as a single stranded molecule. In some examples, the aptamer is about 70 nucleotides in length as a single stranded molecule. In one example, the aptamer is about 79 nucleotides in length as a single stranded molecule. In one example, the aptamer is about 80 nucleotides in length as a single stranded molecule.

[0145] The aptamers described herein may have discrete nucleic acid structures that facilitate preferential binding to GBS bacteria. The primary sequence of a DNA or an RNA is a specific string of nucleotides (e.g., A, C, G, T or U) in one dimension. The primary sequence dictates the three-dimensional configuration (e.g., secondary and / or tertiary structure) of the aptamer.

[0146] The secondary structure of a section of DNA or RNA is represented by contact in two dimensions between specific nucleotides. Secondary structures can comprise Watson / Crick base pairs (A:T and C:G) and other base pairs of lower stability (e.g., G:T, A:C, G:A, and T:T). Secondary structures include stem or hairpin loops, symmetric and asymmetric bulges, pseudoknots, and combinations of the same. In some cases, such structures can be formed in a nucleic acid sequence of no more than about 30 nucleotides. When nucleotides that are distant in the primary sequence and not thought to interact through Watson / Crick and non-Watson / Crick base pairs are in fact interacting, these interactions (which are often depicted in two dimensions) are also part of the secondary structure. For example, the aptamer may form a secondary structure comprising a hairpin loop.

[0147] The tertiary structure of a DNA or RNA molecule, such as an aptamer, is the description in space of the atoms of the DNA or RNA. Primary sequences of aptamers limit the possible tertiary structures, as do the fixed secondary structures. The aptamers described herein can have structures in three dimensions that are comprised of a collection of DNA motifs and secondary structures, which impart the ability to bind GBS bacteria on the aptamer. DNA secondary and tertiary structures include all the ways in which it is possible to describe in general terms the most stable groups of conformations that a nucleic acid compound can form. For example, the aptamer may form a tertiary structure comprising a hairpin loop.

[0148] Suitably, the aptamers described herein include one or more (e.g., 1, 2, 3, 4, 5 etc) stem regions and / or loop regions.

[0149] The term “stem region” refers to a double- stranded linear region (also known as a “duplex” region) having segments that are complementary to each other in the same molecule.

[0150] The terms “hairpin loop” or “loop region” are used interchangeably and refer to a singlestranded region of more than one nucleotide or modified nucleotide that is not hybridised or basepaired. Suitably, the loop region is of length sufficient to enable formation of the hairpin structure and base pairing of the stem region.

[0151] It is contemplated that the loop region may at least in part facilitate binding of an aptamer described herein to a GBS bacteria. In this regard, the loop region may include a portion, such as a 5' end or a 3' end, of the binding site in question. In other examples, the loop region together with the stem region forms a secondary structure that is capable of binding or interacting with the GBS bacteria.

[0152] A hairpin structure suitably comprises a single- stranded loop region that is positioned between a first self-complementary region (e.g., a sense strand) and a second self-complementary region (e.g., an antisense strand) that define, at least in part, the stem region.

[0153] Without wishing to be bound by theory, it is considered that the aptamers bind to the GBS bacteria by association with the hairpin structure(s) thereof. As such, modifications to the flanking portions or sequence at the 5' and / or 3' end of the hairpin structure may not materially affect the binding of the aptamer to the GBS bacteria. Such modifications may include extension of the portion at the 5' and / or 3' end, nucleotide deletion(s) in the portion at the 5' and / or 3' end, nucleotide substitution(s) in the portion at the 5' and / or 3' end, and / or nucleotide insertion(s) in the portion at the 5' and / or 3' end.

[0154] The aptamers described herein may include single- and / or double- stranded DNA and / or RNA. In some examples, the aptamers described herein (e.g., the aptamer of any one of SEQ ID NOs: 1-10) include single- stranded and double- stranded DNA. In various examples, the aptamers described herein (e.g., the aptamer of any one of SEQ ID NOs: 1-10) include single- stranded DNA. In particular examples, the aptamers described herein (e.g., the aptamer of any one of SEQ ID NOs: 1-10) include double- stranded DNA. In other examples, the aptamers described herein (e.g., the aptamer of any one of SEQ ID NOs: 1-10) include single- stranded and double-stranded RNA. In some examples, the aptamers described herein (e.g., the aptamer of any one of SEQ ID NOs: 1- 10) include single- stranded RNA. In particular examples, the aptamers described herein (e.g., the aptamer of any one of SEQ ID NOs: 1-10) include double- stranded RNA. In other examples, the aptamers described herein (e.g., the aptamer of any one of SEQ ID NOs: 1-10) includes singlestranded DNA and single- stranded RNA.

[0155] DNA may refer to genomic DNA and cDNA. RNA may refer to mRNA, RNA, RNAi, siRNA, cRNA and autocatalytic RNA. In this regard, the aptamer may be a DNA-RNA hybrid. In those examples in which the aptamer is or comprises RNA or a DNA-RNA hybrid, one or more of the thymine residues, such as those of SEQ ID NOs: 1 to 10, can be replaced or substituted with a uracil residue, inclusive of chemically modified uracil residues. In those examples in which the aptamer is or comprises RNA or a DNA-RNA hybrid, one or more of the thymine residues, such as those of SEQ ID NOs: 14 to 29, can be replaced or substituted with a uracil residue, inclusive of chemically modified uracil residues.

[0156] An aptamer of the present disclosure comprises a nucleotide sequence which typically includes nucleotides that comprise an A, G, C, T or U base. However, nucleotide sequences may include other bases such as inosine, methyly cytosine, methylinosine, methyladenosine and / or thiouridine, although without limitation thereto. As would be understood by the skilled person, T and U bases in the sequences disclosed herein can be utilised interchangeably.

[0157] Contemplated herein are “variant” aptamers. As used herein, a nucleic acid “variant” shares a definable nucleotide sequence relationship with a reference nucleic acid sequence (e.g., an aptamer or nucleotide sequence of any one of SEQ ID NOs: 1-10 and 14-29). The “variant” nucleic acid may have one or a plurality of nucleic acids of the reference nucleic acid sequence deleted or substituted by different nucleic acids. It is well understood in the art that some nucleic acids of a DNA / RNA-based binding or recognition site may be substituted or deleted without changing (or only having minimal change to) their affinity to a GBS bacteria or a component or molecule derived therefrom. Suitably, nucleic acid variants share at least 60% or 65%, 66%, 67%, 68%, 69%, preferably at least 70%, 71%, 72%, 73%, 74% or 75%, more particularly at least 80%, 81%, 82%, 83%, 84%, or 85%, and even more particularly at least 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99% or 99.5% nucleotide sequence identity with an isolated nucleic acid of the invention (e.g., SEQ ID NOs: 1-10 and 14-29). Percent sequence identity may be determined by any method known in the art, such as that described herein.

[0158] Terms used generally herein to describe sequence relationships between respective proteins and nucleic acids include “comparison window”, “sequence identity”, “percentage of sequence identity” and “substantial identity”. Because respective nucleic acids / proteins may each comprise (1) only one or more portions of a complete nucleic acid / protein sequence that are shared by the nucleic acids / proteins, and (2) one or more portions which are divergent between the nucleic acids / proteins, sequence comparisons are typically performed by comparing sequences over a “comparison window” to identify and compare local regions of sequence similarity. A “comparison window” refers to a conceptual segment of typically 6, 9 or 12 contiguous residues that is compared to a reference sequence. The comparison window may comprise additions or deletions (i.e., gaps) of about 20% or less as compared to the reference sequence for optimal alignment of the respective sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by computerised implementations of algorithms (Geneworks program by Intelligenetics; GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, WI, USA, incorporated herein by reference) or by inspection and the best alignment (i.e., resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected. Reference also may be made to the BLAST family of programs as for example disclosed by Altschul et al., 1997, Nucl. Acids Res. 25 3389, which is incorporated herein by reference. A detailed discussion of sequence analysis can be found in Unit 19.3 of CURRENT PROTOCOLS IN MOLECULAR BIOLOGY Eds. Ausubel et al. (John Wiley & Sons Inc NY, 1995-1999).

[0159] The term “sequence identity” is used herein in its broadest sense to include the number of exact nucleotide or amino acid matches having regard to an appropriate alignment using a standard algorithm, having regard to the extent that sequences are identical over a window of comparison. Thus, a “percentage of sequence identity” is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U) or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. For example, “sequence identity” may be understood to mean the “match percentage” calculated by the DNASIS computer program (Version 2.5 for windows; available from Hitachi Software engineering Co., Ltd., South San Francisco, California, USA).

[0160] Also contemplated herein are nucleic acid fragments, such as aptamer fragments. A “fragment” is a segment, domain, portion or region of a nucleic acid, which respectively constitutes less than 100% of the nucleotide sequence. A non-limiting example is an amplification product or a primer or probe. In particular examples, a nucleic acid fragment may comprise, for example, at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 (inclusive of any range therein) contiguous nucleotides of said nucleic acid. Further contemplated herein are nucleic acid derivatives, inclusive of aptamer derivatives. Such aptamer derivatives may include, for example, one or more modifications and / or conjugates as described herein.

[0161] Suitably, the aptamers described herein are isolated. For the purposes of this disclosure, by “isolated” is meant material that has been removed from its natural state or otherwise been subjected to human manipulation. Isolated material, such as the aptamers, may be substantially or essentially free from components that normally accompany it in its natural state, or may be manipulated so as to be in an artificial state together with components that normally accompany it in its natural state. Isolated material may be in native, chemical synthetic or recombinant form.

[0162] As used herein, the term “binds” refers to the interaction of the aptamer with a GBS bacteria (e.g., Streptococcus agalactiae, such as ATCC strain no. BAA- 1138), or a component or molecule, such as secretory molecules, derived therefrom, and means that the interaction is dependent upon the presence of a particular structure (e.g., a binding site having a particular nucleic acid sequence), or combination of structures, on the aptamer that is recognised by the GBS bacteria. For example, and by virtue of the binding site, the aptamer recognises and binds to the GBS bacteria (inclusive of components or molecules derived therefrom) rather than to molecules or proteins generally.

[0163] As used herein, the term “specifically binds” shall be taken to mean that the binding interaction between an aptamer described herein and a GBS bacteria described herein (e.g., Streptococcus agalactiae, such as ATCC strain no. BAA- 1138) is dependent on detection of the GBS bacteria by the aptamer. Accordingly, the aptamer preferentially binds or recognizes a GBS bacteria even when present in a mixture of other molecules, proteins, nucleic acids or organisms (such as other bacteria). For example, the aptamer may bind to GBS bacteria with higher affinity than it binds to another different molecule, protein, nucleic acid or organism (e.g., a bacteria other than a GBS bacteria).

[0164] As used herein, the term “binding affinity” describes the measure of the strength of the binding or affinity of molecules to each other. Binding affinity of an aptamer described herein with respect to GBS bacteria is defined in terms of dissociation constant (KD). The dissociation constant can be determined by methods known in the art and can be computed even for complex mixtures by methods such as those, for example, set forth in Caceci, M., et al., Byte (1984) 9:340-362.

[0165] Examples of measuring dissociation constants are described for example in U.S. Pat. No. 7,602,495 which describes surface plasmon resonance analysis, U.S. Pat. No. 6,562,627, U.S. Pat. No. 6,562,627, and US 2012 / 00445849. The dissociation constant may also be established using a double-filter nitrocellulose filter binding assay such as that disclosed by Wong and Lohman, (1993). Proc. Natl. Acad. Sci. USA 90, 5428-5432. As used herein, the terms “high affinity” and “relatively high affinity” are used interchangeably herein and refer to a binding affinity between an aptamer and a GBS bacteria (e.g., Streptococcus agalactiae, such as ATCC strain no. BAA- 1138) of interest with a KD of less than about 500 nM (e.g., less than about 500, 450, 400, 350, 300, 250, 200, 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, 5, 2.5, 1, 0.5, 0.1 nM and any range therein), more particularly less than about 130 nM, more particularly less than about 70 nM, more particularly less than about 40 nM, even more particularly less than about 2 nM and yet even more particularly less than about 0.5 nM. For example, the binding affinity between an aptamer and a GBS bacteria may be a KD of between about 500 nM to about 0.1 nM. More particularly, the binding affinity between an aptamer and a GBS bacteria may be a KD of between about 100 nM to about 0.5 nM. Even more particularly, the binding affinity between an aptamer and a GBS bacteria may be a KD of between about 50 nM to about 1 nM. Still even more particularly, the binding affinity between an aptamer and a GBS bacteria may be a KD of between about 50 nM to about 0.1 nM. Still even more particularly, the binding affinity between an aptamer and a GBS bacteria may be a KD of between about 10 nM to about 0.1 nM.

[0166] As used interchangeably herein, the terms “specifically binds” and “selectively binds” in reference to an aptamer, describe the discriminatory binding of an aptamer to a target molecule (e.g., a GBS bacteria), such that the aptamer does not substantially cross react with non-target molecules (e.g., other bacterial species). Accordingly, the aptamers of the present disclosure suitably do not appreciably bind or have a low affinity for bacterial species other than GBS bacteria, such as Streptococcus pneumoniae, Bacillus subtilis, Enterococcus faecalis, Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Staphylococcus epidermidis, Bacillus cereus, Actinobacter baumannii, and Streptococcus pyogenes.

[0167] As used herein, the terms “low affinity” and “relatively low affinity” are used interchangeably herein and refer to a binding affinity between an aptamer and a non-GBS bacteria, such as those hereinbefore provided, with a KD of greater than about 1 pM, more particularly greater than about 10 pM, more particularly greater than about 20 pM, more particularly greater than about 50 pM, even more particularly greater than about 100 pM and yet even more particularly greater than about 200 pM.

[0168] Generally, aptamer binding to the target molecule does not involve the formation of nucleotide base pairs between the aptamer and the target molecule. The skilled person would recognize it is well-known in the art that the polynucleotide sequence of an aptamer may include base pairs that are not required for specific binding of the aptamer to a given target molecule, and that smaller fragments of an aptamer, even fragments having below 50% sequence identity may still be capable of effectively binding to a target molecule (Alsager et al., Analytical Chemistry 87.8 (2015): 4201-4209).

[0169] The determination of affinity may be conducted under standard competitive binding immunoassay procedures, as are known in the art, such as electrophoretic shift assay (EMSA), enzyme-linked immunosorbent assay (ELISA) and surface plasmon resonance (SPR). Flow cytometry methods as described in U.S. Patent No. 5,853,984 may be used.

[0170] Microarrays, BIAcore assays, differential centrifugation, chromatography, electrophoresis, immunoprecipitation, optical biosensors, and other SPR assays can be used as described in WO 2011 / 061351. Other assays that can be used are calorimetric analysis and dot blot assays. Moreover, just as the ELISA was adapted for aptamers in the ELASA assay, any other assays involving GBS bacteria can be adapted for use with the aptamers described herein in place of the antibodies. Such assays may include immunometric assays such as radioimmunoassays, flow cytometry assays, blotting applications, anisotropy, membrane assays, biosensors, and the like. Any other assays known in the art, such as quartz crystal microbalance can also be used or adapted to detect or measure binding of aptamers to GBS bacteria. Exemplary methods for detecting binding of aptamers to GBS bacteria are described herein.

[0171] Modified Bases

[0172] Aptamers of the present disclosure may have nucleobase (“base”) modifications, substitutions or additions. Such modifications can advantageously increase the binding specificity and / or selectivity of the aptamer for the GBS bacteria.

[0173] It is envisaged that the modification may be one or more of: a chemical substitution at a sugar position, a chemical substitution at an internucleotide linkage, a chemical substitution at a base position, a chemical modification at a base position, and a chemical addition at a base position. The modifications, substitutions or additions may be incorporated at 5' end or 3' end or internally anywhere in the aptamer sequence.

[0174] In particular examples, one or more bases (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 etc bases inclusive of any range therein) of the aptamer described herein are modified. One or more nucleotides (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 etc nucleotides) at a 5' end of the aptamer may be modified. Alternatively, or in addition, one or more nucleotides (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 etc nucleotides) at a 3' end of the aptamer may be modified. For example, all bases of the aptamer described herein may be modified. Alternatively, no bases of the aptamer described herein may be modified. At least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or any range therein of the bases of the aptamer may be modified. Examples of modified bases include an aptamer comprising one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted Cl to CIO alkyl or C2 to CIO alkenyl and alkynyl. In one example, the aptamer comprises one of the following at the 2' position: O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON[(CH2)nCH3]2, where n and m are from 1 to about 10.

[0175] Additional examples of modified bases may include any one or more of the following: alkyne or azide modification, thiol modification, amino modification, 5' phosphorylation, and 3' phosphorylation.

[0176] Further examples of modified bases include one or more nucleotides comprising one of the following at the 2' position: Cl to CIO lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an aptamer, or a group for improving the pharmacodynamic properties of an aptamer, and other substituents having similar properties.

[0177] The modification may be selected from the group consisting of a 2'-O-methyl, 2'-O- methoxy ethoxy, 2'-fluoro, 2'-allyl, 2'-O-[2-(methylamino)-2-oxoethyl], 4'-thio, 4'-CH2-O-2'- bridge, 4'-(CH2)2-O-2'-bridge, 2'-ENA, 2'-amino, fluoroarabinonucleotide, threose nucleic acid or 2'-O— (N-methlycarbamate). The modified base may comprise a 2'-O-methyl, 2'-fluoro, 2'-allyl, 2'- O-[2-(methylamino)-2-oxoethyl], 4'-thio, 4'-CH2-O-2'-bridge, 4'-(CH2)2-O-2'-bridge, 2'-amino, fluoroarabinonucleotide, threose nucleic acid, 2'-O— (N-methlycarbamate) and any combination thereof.

[0178] Suitably, the modification includes 2'-methoxy (2'-O-CH3or 2'0Me), that is, an alkoxyalkoxy group. The aptamer may include one or more nucleotides (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 etc nucleotides) at a 5' end and / or a 3' thereof that are 2'0Me modified. The aptamer may include at least one nucleotide at a 5' end and a 3' thereof that are 2'0Me modified. The aptamer may include at least one nucleotide at a 5' end thereof that is 2'0Me modified. The aptamer may include at least one nucleotide at a 3' end thereof that is 2'0Me modified.

[0179] The modification may include 2'-methoxyethoxy (2'-O-CH2CH2OCH3 (also known as 2'- O-(2-methoxy ethyl) or 2'-M0E) (Martin et al., 1995). The modification may include 2'- dimethylaminooxy ethoxy, that is, a O(CH2)2ON(CH3)2group (also known as 2'-DMA0E), or 2'- dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethyl-amino-ethoxy-ethyl or 2'- DMAEOE), that is, 2'-O-CH2-O-CH2-N(CH3)2. Other modifications include 2'-aminopropoxy (2'- OCH2CH2CH2NH2), 2'-allyl (2'-CH2-CH=CH2), 2'-O-allyl (2'-O-CH2-CH=CH2) and 2'-fluoro (2'- F). The 2'-modification may be in the arabino (up) position or ribo (down) position. For example, a 2'-arabino modification is 2'-F.

[0180] Similar modifications may also be made at other positions on the aptamer, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked aptamers and the 5' position of the 5' terminal nucleotide. Aptamers may also have sugar mimetics, such as cyclobutyl moieties in place of the pentofuranosyl sugar. Aptamers may also have ribose or deoxyribose components (e.g., a l’2’-dideoxyribose modification).

[0181] Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, US 4,981,957, US 5,118,800, US 5,319,080, US

[0182] 5,359,044, US 5,393,878, US 5,446,137, US 5,466,786, US 5,514,785, US 5,519,134, US

[0183] 5,567,811, US 5,576,427, US 5,591,722, US 5,597,909, US 5,610,300, US 5,627,053, US

[0184] 5,639,873, US 5,646,265, US 5,658,873, US 5,670,633, US 5,792,747, and US 5,700,920.

[0185] A further modification of the sugar may include Locked Nucleic Acids (LNAs) in which the 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety. The linkage may be a methylene (-CH2-)n group bridging the 2' oxygen atom and the 4' carbon atom, wherein n is 1 or 2. LNAs and preparation thereof are described in WO 98 / 39352 and WO 99 / 14226.

[0186] Modified nucleobases may include other synthetic and natural nucleobases such as, for example, 5 -methylcytosine (5-me-C), 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5- halouracil and cytosine, 5-propynyl (-CC-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8- halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5- halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7- methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8- azaadenine, 7-deazaguanine and 7-deazaadenine and 3 -deazaguanine and 3 -deazaadenine, m1A(l- methyladenosine); m2A(2-methyladenosine); Am (2’-O-methyladenosine); ms2m6A(2- methylthio-N6-methyladenosine); i6A (N6-isopentenyladenosine); ms2i6A(2-methylthio- N6isopentenyladenosine); io6A(N6-(cis-hydroxyisopentenyl)adenosine); ms2io6A(2-methylthio- N6-(cis-hydroxyisopentenyl)adenosine); g6A(N6-glycinylcarbamoyladenosine); t6A(N6- threonylcarbamoyladenosine); ms2t6A(2-methylthio-N6-threonyl carbamoyladenosine); m6t6A(N6-methyl-N6-threonylcarbamoyladenosine); hn6A(N6- hydroxynorvalylcarbamoyladenosine); ms2hn6A(2-methylthio-N6-hydroxynorvalyl carbamoyladenosine); Ar(p)(2’-O-ribosyladenosine(phosphate)); I (inosine); m1^!- methylinosine); m1Im(l,2’-O-dimethylinosine); m3C(3-methylcytidine); Cm(2’-0- methylcytidine); s2C(2-thiocytidine); ac4C(N4-acetylcytidine); f5C (5-formylcytidine); m5Cm(5,2’-O-dimethylcytidine); ac4Cm(N4-acetyl-2’-O-methylcytidine); k2C(lysidine); m'Gl l - methylguanosine); m2G(N2-methylguanosine); m7G(7 -methylguanosine); Gm(2’-0- methylguanosine); m22G(N2,N2-dimethylguanosine); m2Gm(N2, 2’-O-dimethylguanosine); m22Gm(N2,N22’-O-trimethylguanosine); Gr(p)(2’-O-ribosylguanosine (phosphate)); yW (wybutosine); o2yW (peroxywybutosine); OHyW (hydroxywybutosine); OHyW* (undermodified hydroxywybutosine); imG (wyosine); mimG (methylwyosine); Q (queuosine); oQ (epoxyqueuosine); galQ (galactosyl-queuosine); manQ (mannosyl-queuosine); preQo (7-cyano-7- deazaguanosine); preQi (7-aminomethyl-7-deazaguanosine); G+(archaeosine); D (dihydrouridine); m5Um(5,2’-O-dimethyluridine); s4U(4-thiouridine); m5s2U(5-methyl-2- thiouridine); s2Um(2-thio-2’-O-methyluridine); acp3U(3-(3-amino-3-carboxypropyl)uridine); ho5U(5-hydroxyuridine); mo5U(5-methoxyuridine); cmo5U(uridine 5-oxy acetic acid); mcmo5U (uridine 5-oxyacetic acid methyl ester); chm5U(5-(carboxyhydroxymethyl)uridine)); mchm5U(5-(carboxyhydroxymethyl)uridine methyl ester); mcm5U(5- methoxycarbonylmethyluridine); mcm5Um(5-methoxycarbonylmethyl-2’-O-methyluridine); mcm5s2U(5-methoxycarbonylmethyl-2-thiouridine); nm5s2U(5-aminomethyl-2-thiouridine); mnm5U(5-methylaminomethyluridine) ; mnm5s2U (5-methylaminomethyl-2-thiouridine) ; mnm5se2U(5-methylaminomethyl-2-selenouridine) ; ncm5U(5-carbamoylmethyluridine) ; ncm5Um(5-carbamoylmethyl-2 ’ -O-methyluridine) ; cmnm5U(5- carboxy methylaminomethyluridine); cmnm5Um(5-carboxymethylaminomethyl-2’-O- methyluridine) ; cmnm5s2U(5-carboxymethylaminomethyl-2-thiouridine) ; m62A(N6,N6- dimethyladenosine); Im(2’-O-methylinosine); m4C(N4-methylcytidine); m4Cm(N4,2’-O- dimethylcytidine); hm5C(5-hydroxymethylcytidine); m3U(3 -methyluridine); cm5U(5- carboxymethyluridine); m6Am(N6,2’-O-dimethyladenosine); n Am (N6,N6,O-2’- trimethyladenosine); m2,7G(N2,7-dimethylguanosine); m2,2’7G(N2,N2,7-trimethylguanosine); m3Um(3,2’-O-dimethyluridine); m5D(5-methyldihydrouridine); f5Cm (5-formyl-2’-O- methylcytidine); m'Gm (l,2’-O-dimethylguanosine); m1Am(l,2’-O-dimethyladenosine); rm5U(5-taurinomethyluridine); Tm5s2U(5-taurinomethyl-2-thiouridine)); imG- 14 (4- demethylwyosine); imG2(isowyosine); or ac6A(N6- acetyladenosine).

[0187] Further modified nucleobases include tricyclic pyrimidines, such as phenoxazine cytidine (lH-pyrimido[5,4-b][l,4]benzoxazin-2(3H)-one), and phenothiazine cytidine (lH-pyrimido[5,4- b][l,4]benzothiazin-2(3H)-one), G-clamps such as, for example, a substituted phenoxazine cytidine (e.g., 9-(2-aminoethoxy)-H-pyrimido[5,4-b][l,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), and pyridoindole cytidine (H- pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one).

[0188] Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example, 7-deaza-adenine, 7-deazaguanosine, 2- aminopyridine and 2-pyridone. Further nucleobases include those disclosed in US 3,687,808, those disclosed in J. I. Kroschwitz (editor), The Concise Encyclopedia of Polymer Science and Engineering, pages 858-859, John Wiley and Sons (1990), those disclosed by Englisch et al. (1991), and those disclosed by Y.S. Sanghvi, Chapter 15: Antisense Research and Applications, pages 289-302, S.T. Crooke, B. Lebleu (editors), CRC Press, 1993.

[0189] Certain nucleobases are particularly useful for increasing the binding affinity of the aptamer. These may include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions that have been shown to increase nucleic acid duplex stability by 0.6-1.2°C. These nucleobase substitutions may be combined with 2'-O-methoxyethyl sugar modifications.

[0190] Representative United States patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, US

[0191] 3,687,808, US 4,845,205, US 5,130,302, US 5,134,066, US 5,175,273, US 5,367,066, US

[0192] 5,432,272, US 5,457,187, US 5,459,255, US 5,484,908, US 5,502,177, US 5,525,711, US

[0193] 5,552,540, US 5,587,469, US 5,594,121, US 5,596,091, US 5,614,617, US 5,645,985, US

[0194] 5,830,653, US 5,763,588, US 6,005,096, US 5,681,941 and US 5,750,692.

[0195] Further examples of suitable chemical modifications of the aptamers described herein may be found at ‘Integrated DNA Technologies Catalog’ (https: / / sg.idtdna.com / site / Cataiog / Modifications), which is incorporated herein by reference.

[0196] The aptamer may also comprise a variety of spacers at either the 5' or 3' end. Spacers may be hexanediol spacer capable of blocking extension by DNA polymerase, a photocleavable spacer that can be placed either between the 5' modified group and the aptamer, or in between the aptamer sequence to control the assembly and disassembly of aptamer molecules, a variety of ethyleneglycol based spacers, or any other spacer known in the art.

[0197] Unless stated to the contrary, reference to an A, T, G, U or C base herein can either mean a naturally occurring base or a modified version thereof.

[0198] Backbones

[0199] Aptamers of the present disclosure include those having modified backbones or nonnatural internucleotide linkages. Aptamers having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. Such modifications, inclusive of a phosphorothioate backbone, may advantageously protect the aptamers from digestion by nucleases and / or increase the affinity of the aptamers to the GBS bacteria. This increased affinity may be due, at least in part, to additional electrostatic and London forces.

[0200] Modified aptamer backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phospho triesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage. Aptamers having inverted polarity comprise a single 3' to 3' linkage at the 3'-most internucleotide linkage, that is, a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts, mixed salts and free acid forms are also included.

[0201] Representative United States patents that teach the preparation of the above phosphorus containing linkages include, but are not limited to, US 3,687,808, US 4,469,863, US 4,476,301, US 5,023,243, US 5,177,196, US 5,188,897, US 5,264,423, US 5,276,019, US 5,278,302, US

[0202] 5,286,717, US 5,321,131, US 5,399,676, US 5,405,939, US 5,453,496, US 5,455,233, US

[0203] 5,466,677, US 5,476,925, US 5,519,126, US 5,536,821, US 5,541,306, US 5,550,111, US

[0204] 5,563,253, US 5,571,799, US 5,587,361, US 5,194,599, US 5,565,555, US 5,527,899, US

[0205] 5,721,218, US 5,672,697 and US 5,625,050.

[0206] Modified aptamer backbones that do not include a phosphorus atom therein include, for example, backbones formed by short chain alkyl or cycloalkyl intemucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.

[0207] Representative United States patents that teach the preparation of the such backbones include, but are not limited to, US 5,034,506, US 5,166,315, US 5,185,444, US 5,214,134, US 5,216,141, US 5,235,033, US 5,264,562, US 5,264,564, US 5,405,938, US 5,434,257, US

[0208] 5,466,677, US 5,470,967, US 5,489,677, US 5,541,307, US 5,561,225, US 5,596,086, US

[0209] 5,602,240, US 5,610,289, US 5,602,240, US 5,608,046, US 5,610,289, US 5,618,704, US

[0210] 5,623,070, US 5,663,312, US 5,633,360, US 5,677,437, US 5,792,608, US 5,646,269 and US

[0211] 5,677,439.

[0212] Suitably, the aptamer described herein at least partly comprises a modified backbone. Exemplary modified backbones useful for the invention can include those which comprise a phosphorothioate, a non-bridging oxygen atom substituting a sulfur atom, a phosphonate such as a methylphosphonate, a phosphodiester, a phosphoromorpholidate, a phosphoropiperazidate, amides, methylene(methylamino), fromacetal, thioformacetal, a peptide nucleic acid or a phosphoroamidate such as a morpholino phosphorodiamidate (PMO), N3'-P5' phosphoramidite or thiophosphoroamidite. In particular examples, the aptamer comprises a 5' region comprising one or more bases which are modified and / or which have a modified backbone and a 3' region comprising one or more bases which are modified and / or which have a modified backbone. In some examples, all intemucleotide linkages of the aptamer described herein are modified or comprise a modification, such as a phosphorothioate modification. In alternative examples, no internucleotide linkages of the aptamer described herein are modified or comprise a modification. In particular examples, the aptamer comprises one or a plurality of phosphorothioate internucleotide linkages. More particularly, all internucleotide linkages of the aptamer comprise a phosphorothioate modification. In certain examples, at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or any range therein of the internucleotide linkages of the aptamers are modified or non-natural.

[0213] In particular examples, at least a portion of the aptamer has / is a ribonucleic acid, deoxyribonucleic acid, a DNA phosphorothioate, an RNA phosphorothioate, 2'-O-methyl- oligonucleotide, 2'-O-methyl-oligodeoxyribonucleotide, 2'-O-hydrocarbyl ribonucleic acid, 2'-O- hydrocarbyl DNA, 2'-O-hydrocarbyl RNA phosphorothioate, 2'-O-hydrocarbyl DNA phosphorothioate, 2'-F-phosphorothioate, 2'-F-phosphodiester, 2'-methoxyethyl phosphorothioate, 2-methoxyethyl phosphodiester, deoxy methylene(methylimino) (deoxy MMI), 2'-O-hydrocarby MMI, deoxy-methylphos-phonate, 2'-O-hydrocarbyl methylphosphonate, morpholino, 4'-thio DNA, 4'-thio RNA, peptide nucleic acid, 3'-amidate, deoxy 3'-amidate, 2'-O-hydrocarbyl 3'- amidate, locked nucleic acid, cyclohexane nucleic acid, tricycle-DNA, 2'fluoro-arabino nucleic acid, N3'-P5' phosphoroamidate, carbamate linked, phosphotriester linked, a nylon backbone modification and any combination thereof.

[0214] Group B Streptococcus (GBS) bacteria As used herein the terms “group B streptococcus”, “group B Strep”, “GBS” are used interchangeably and refer to streptococcal bacteria which are gram positive, catalase-negative bacteria. The group B specific cell wall carbohydrate antigen is common to all strains of GBS, and a surface capsular polysaccharide allows classification into types la, lb, II, III, IV, V, VI, VII, VIII, and IX (Lancefield classification scheme). A surface protein antigen, C protein, with alpha and beta components, is common to all lb strains, to 30% of type la strains, to 60% of type II strains, and to some type IV, V, and VI strains. For example, the GBS bacteria may be Streptococcus agalactiae .

[0215] As used herein, the term “GBS bacterial infection” refers to any disease, disorder or condition at least partly mediated or associated with a GBS bacteria. For example, a GBS bacterial infection may result in a urinary tract infection, a blood infection (e.g., bacteraemia), pneumonia, inflammation of the membranes and fluid surrounding the brain and spinal cord (e.g., meningitis), infection of the placenta and amniotic fluid (e.g., chorioamnionitis), infection of the membrane lining the uterus (e.g., endometritis), infection of the heart valves (e.g., endocarditis), a skin infection, a soft-tissue infection, a bone infection, a joint infection, and / or body’s uncontrollable immune response to infection (sepsis). Symptoms of a GBS bacterial infection in a newborn will be apparent to the skilled person and can include, for example, fever, low body temperature, difficulty feeding, sluggishness, limpness or weak muscle tone, difficulty breathing, irritability, jitteriness, seizures, rash or jaundice. Symptoms of a GBS bacterial infection in an adult will be apparent to the skilled person and can include, for example, a strong, persistent urge to urinate, a burning sensation or pain when urinating, passing frequent, small amounts of urine, blood in the urine, pelvic pain, fever, chills, confusion or lack of alertness, cough, shortness of breath, chest pain, swelling, warmth or redness in the area of the infection, pain in the area of the infection, lesions with pus or drainage, or stiffness or inability to use a limb or joint.

[0216] In particular examples, the GBS bacterial infection is or comprises a neonatal infection, or more particularly neonatal sepsis. Based on the age of presentation, neonatal sepsis is typically divided into early-onset (e.g., onset of infection within the first six days of life, and typically within the first 24 hours), late-onset (e.g., onset of infection within day 7 to day 89 of life), and late-late onset (e.g., onset of infection in children 3 months of age or older).

[0217] Referring to other examples, the GBS bacterial infection is or comprises an invasive GBS disease. Invasive GBS disease can be of morbidity and mortality in adults older than 65, Black individuals, adults with diabetes and pregnant females.

[0218] For example, the GBS bacterial infection is at least partly mediated or associated with Streptococcus agalactiae. Sensors and methods for detecting GBS bacteria

[0219] The aptamers described herein may be used for specifically, qualitatively, and / or quantitatively detecting GBS bacteria in the context of clinical diagnosis, treatment, and / or research based on the binding of the aptamer to the GBS bacteria. For example, the aptamers described herein can be used for detecting GBS bacteria in a test sample as an indication that the test sample contains GBS bacteria. It is envisaged that methods of detecting GBS bacteria in a biological sample disclosed herein can be used to quantitatively determine the number of GBS bacteria in the biological sample and / or determine whether a subject has a GBS bacterial infection.

[0220] Accordingly, in one form, provided herein is a sensor for detecting GBS bacteria, comprising an aptamer described herein.

[0221] The term “sensor” as used herein indicates a device that measures a physical quantity and converts it into a signal which can be read by an observer or by an instrument. As is understood by the skilled person, a sensor can be calibrated against known standards. Accordingly, a sensor can be used to capture a GBS bacteria: aptamer complex by exploiting the affinity of an aptamer to the GBS bacteria, and can be detected using techniques identifiable by a skilled person upon reading of the present disclosure.

[0222] Referring to particular examples, the sensor described herein comprises a single aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence selected from those set forth in SEQ ID NOs: 1 to 10 and 14 to 29, or a fragment, variant or derivative thereof. In alternative examples, the sensor described herein comprises two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, or nine or more aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from those set forth in SEQ ID NOs: 1 to 10 and 14 to 29, or a fragment, variant or derivative thereof.

[0223] For some examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 1, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 2 to 10 and 14 to 29. In other examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 2, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1, 3 to 10 and 14 to 29. In certain examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 3, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1, 2, 4 to 10 and 14 to 29. In other examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 4, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 3, 5 to 10 and 14 to 29. In particular examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 5, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 4, 6 to 10 and 14 to 29. In other examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 6, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 5, 7 to 10 and 14 to 29. In various examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 7, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 6, 8 to 10 and 14 to 29. In other examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 8, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 7, 9, 10 and 14 to 29. In some examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 9, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 8, 10 and 14 to 29. In other examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 10, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 9 and 14 to 29. In certain examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 14, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 10 and 15 to 29. In certain examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 15, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 10, 14 and 16 to 29. In certain examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 16, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 10, 14, 15 and 17 to 29. In particular examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 17, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 10, 14 to 16 and 18 to 29. For various examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 18, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 10, 14 to 17 and 19 to 29. For other examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 19, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 10, 14 to 18 and 20 to 29. Referring to certain examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 20, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 10, 14 to 19 and 21 to 29. Referring to other examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 21, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 10, 14 to 20 and 22 to 29. In certain examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 22, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 10, 14 to 21 and 23 to 29. In some examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 23, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 10, 14 to 22 and 24 to 29. In other examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 24, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 10, 14 to 23 and 25 to 29. In particular examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 25, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 10, 14 to 24 and 26 to 29. For various examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 26, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 10, 14 to 25 and 27 to 29. For other examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 27, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 10, 14 to 26 and 28 to 29. For particular examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 28, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 10, 14 to 27 and 29. For certain examples, the sensor comprises a first aptamer comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in SEQ ID NO: 29, or a fragment, variant or derivative thereof, and one or more further aptamers comprising, consisting of or consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 10 and 14 to 28.

[0224] The sensor may further comprise a substrate. The substrate may facilitate detection of the GBS bacteria or a GBS bacteria: aptamer complex. The substrate may be any surface to which an aptamer may be attached, directly or indirectly, through either covalent or non-covalent bonds. The substrate materials may be naturally occurring, synthetic, or a modification of a naturally occurring material. The substrate may be a bead, a matrix, a cross-linked polymer, a gel, a particle, a surface, a plate, a paper, a membrane, a well or other solid or semi-solid substrate, or any combination thereof.

[0225] The substrate may be a sensor chip surface (e.g., for BIACore or surface plasmon resonance), an ELISA / ELLBA plate, a sepharose, an agarose, Protein A, Protein G, a magnetic bead, a paramagnetic particle, nanomaterials, such as, a nanoparticle, an atomic cluster, a dot (e.g., quantum dots or carbon dots) or any other substrate known to those skilled in the art.

[0226] As used herein, the term “nanoparticles” refers to particles having a diameter of less than 1000 nm. As would be understood by a person skilled in the art, nanoparticles can be categorised as 0D (e.g., nanoparticles and quantum dots), ID (e.g., nanorods, nanofibers, nanopillars, and nanowires), 2D (e.g., nanosheets and nanoplates) and 3D (e.g., nanocomposites and complex hierarchical structures). The nanoparticles may have any suitable shape, including, but not limited to, spherical or semi-spherical, cubic, rod like, polyhedral, sheet-like, rounded or semi-rounded, angular, irregular, and so forth.

[0227] The nanoparticle may be of any suitable material known to those skilled in the art. For example, noble metal nanoparticles can be used where a colorimetric signal is desired. Thus, in some examples, the nanoparticles are noble metal nanoparticles. Noble metals include gold (Au), silver (Ag), ruthenium (Ru), rhodium (Rh), palladium (Pd), osmium (Os), iridium (Ir), platinum (Pt), mercury (Hg), rhenium (Re), iron (Fe) and copper (Cu). The nanoparticle may be a gold nanoparticle or a silver nanoparticle. The nanoparticle may be a bimetallic, a trimetallic or a multimetallic nanoparticle. For example, the nanoparticle may be a hybrid of gold and silver. Alternatively, the nanoparticle may be a hybrid of gold, silver and platinum. A bimetallic gold and silver nanoparticle may be in the form of a core-shell nanoparticle or an alloy nanoparticle.

[0228] The sensor may be a quantum sensor. For example, a quantum sensor may utilise quantum states to measure any quantity.

[0229] The aptamer may be coupled, bound, affixed or otherwise linked to a substrate. For example, the aptamer may be coupled, bound, affixed or otherwise linked to a substrate that facilitates detection, isolation or purification of the GBS bacteria: aptamer complex from the biological sample. In this regard, the substrate may be suitable for chromatography (e.g., affinity chromatography), magnetic bead depletion or other techniques that facilitate detection, isolation or purification of the GBS bacteria: aptamer complex from the sample. It is further contemplated that the aptamer may be conjugated or linked directly or indirectly, such as by way of a linker, to a substrate.

[0230] In another form, provided herein is a method of producing a sensor for detecting GBS bacteria, said method including the steps of:

[0231] (a) providing a substrate; and

[0232] (b) coupling, binding, affixing or otherwise linking the aptamer described herein to the substrate, to thereby produce the sensor. In yet another form, provided herein is a method of detecting GBS bacteria in a sample, said method including the steps of:

[0233] (a) contacting the sample with the aptamer described herein or the sensor described herein; and

[0234] (b) detecting the presence or absence of or measuring the level of a GBS bacteria:aptamer complex, to thereby detect GBS bacteria in the sample.

[0235] In a further form, provided herein is a method of detecting a GBS bacterial infection in a subject, said method including the steps:

[0236] (a) contacting a biological sample obtained from the subject with the aptamer described herein or the sensor described herein; and

[0237] (b) detecting the presence or absence of or measuring the level of a GBS bacteria: aptamer complex, to thereby detect the GBS bacterial infection in the subject.

[0238] Methods of “detecting” or “determining a level of’ or “measuring the level of’ binding are not particularly limited so long as they can detect binding between the aptamer described herein and the GBS bacteria present in the sample. Examples include surface plasmon resonance, high resolution microscopy, such as electron microscopy or confocal microscopy and immunosorbent assays, in which the GBS bacteria and / or GBS bacteria: aptamer complex can be detected, and optionally quantified. It is contemplated that such levels of binding of the aptamer to the GBS bacteria (e.g., levels of GBS bacteria:aptamer complexes) can be directly correlated to a level or concentration of GBS bacteria in the sample, as per standard methods known in the art.

[0239] As used herein, the term “sample” or “biological sample” includes, but is not limited to, a fluid, which may comprise GBS bacteria, a solution, which may comprise GBS bacteria, and a biological sample obtained from a human or animal subject. Biological samples may include but are not limited to vaginal swabs, saliva, mouth or nasal swabs, serum, blood, urine, skin, cerebrospinal fluid (CSF) or tissues and fluids obtained via biopsy and autopsy. For example, the vaginal swab may comprise vaginal fluids. In another example, the biological sample may be from a rectal swab comprising rectal fluids. In other examples, the biological sample is or comprises CSF, such as that obtained by way of a lumbar puncture. The sample may be fresh. It will be appreciated that a fresh sample includes, but is not limited to, a sample obtained from a subject and that is subjected to the methods described herein within several minutes (e.g., less than about 5 to about 30 minutes) after the sample is obtained.

[0240] The sample may be a stored sample. It will be appreciated that a stored sample may have been prepared and / or obtained from a subject and subjected to storage, for example in a refrigerator or freezer prior to subjecting the sample to the methods described herein. A sample may be used wherein the sample is not subjected to any processing (e.g., dilution, filtration, concentration) prior to use in the methods described herein. The sample may be processed. Processing of the sample may involve one or more of filtration, dilution, centrifugation, distillation, extraction, concentration, fixation, inactivation of components, and the like. The sample may be diluted, concentrated, filtered, or centrifuged before use.

[0241] With respect to the aspects described herein, the term “subject”, “patient” and “individual” includes, but is not limited to, mammals, inclusive of humans, performance animals (such as horses, camels, greyhounds), livestock (such as cows, sheep, horses) and companion animals (such as cats and dogs). Suitably, the subject is a human. The subject may be any person, for example, a pregnant female, a child (e.g., about 1 day old to about 16 years old), such as a newborn child (e.g., about 1, 2, 3, 4, 5, 6, 7, 14, 21, 28, 35, 40, 50, 60, 70, 80, 90 or 100 days old or any range therein), an elderly person (e.g., >65 years), or an immunocompromised person.

[0242] It is considered that terms such as “contacting”, “exposing” or “applying” are terms that can, in context, be used interchangeably in the present disclosure. The term contacting requires that the aptamers be brought into contact with a sample so as to form detectable complexes (e.g., a GBS bacteria: aptamer complex). Such binding may be detected using various techniques known in the art. For example, a surface plasmon resonance sensor chip or device including the aptamer described herein may be used. An immunoassay may also be used incorporating the aptamer described herein.

[0243] It is envisaged that determining conditions that enable binding of an aptamer described herein to a GBS bacteria would be well within the purview of those skilled in the art. In general, an aptamer of the disclosure can be provided in a suitable solution and concentration so that they may recognise and bind to the GBS bacteria in a sample.

[0244] Some methods of detecting GBS bacteria comprise contacting a sample with an aptamer described herein, and detecting the presence or absence of or measuring a level of the GBS bacteria and / or GBS bacteria: aptamer complex in the sample. Detection of the GBS bacteria: aptamer complex may indicate the presence of GBS bacteria. No detection of the GBS bacteria: aptamer complex may indicate the absence of GBS bacteria. Measuring the level of the GBS bacteria and / or the GBS bacteria: aptamer complex in the sample can provide a quantitative determination or indication of the number or concentration of GBS bacteria in a sample.

[0245] A sample may be contacted with an aptamer described herein under conditions and for an amount of time sufficient to permit the aptamer to bind to a GBS bacteria and form a GBS bacteria: aptamer complex. For example, a sample can be incubated with an aptamer. The incubation may be performed at room temperature (e.g., 25°C). Alternatively, the incubation may be performed at 4°C. Alternatively, the incubation may be performed at higher temperature (e.g., including up to and at the melting temperature of the aptamer). Alternatively, the incubation may be performed at a temperature higher than the melting temperature of the aptamer (e.g., up to 90°C). The incubation may be performed overnight. Alternatively, the incubation may be performed for at least about 1 minute (e.g., at least about 1, 2, 5, 10, 20, 30, 40, 50, 60 minutes or any range therein), at least about 5 minutes, at least about 10 minutes, at least about 20 minutes, at least about 30 minutes, at least about 45 minutes, at least about 1 hour (e.g., at least about 1, 2, 3, 4, 5, 6, 8, 10, 12, 14, 16, 18, 20, 24 hours or any range therein), at least about 2 hours, at least about 3 hours, at least about 4 hours, at least about 5 hours, at least about 6 hours, at least about 12 hours, or at least about 24 hours. Alternatively, the incubation may be performed for no more than 1 hour, no more than 45 minutes, no more than 30 minutes, no more than 15 minutes, or no more than 10 minutes. A precise incubation time may not be required, and GBS detection may be performed immediately after contacting the aptamer with the GBS bacteria.

[0246] Detection may include methods comprising direct labelling of an aptamer (e.g., with a modified nucleotide, labelled nucleotide or tag incorporated into the aptamer) or merely by binding of the aptamer with the GBS bacteria thereby forming a GBS bacteria: aptamer complex.

[0247] For example, the aptamer may be detectably labelled, such as at a 5' end and / or 3' end thereof, or capable of binding a detectable label. The aptamer may be linked to an enzyme, enzyme substrate, a fluorescent or fluorescent substrate, chemiluminescent molecule, chemiluminescent substrate, purification tag and / or a solid support. In one example, the GBS bacteria: aptamer complex may be directly or indirectly detected.

[0248] Alternatively, or in addition, it is envisaged that the methods described herein may comprise the addition of an oligonucleotide complementary to an aptamer set forth in any one of SEQ ID NOs: 1-10. Alternatively, or in addition, it is envisaged that the methods described herein may comprise the addition of an oligonucleotide complementary to an aptamer set forth in any one of SEQ ID NOs: 14-29.

[0249] In addition to the aptamers of the present disclosure, the sensor described herein may further include one or more binding agents (e.g., antibodies, antibody fragments, nanobodies, aptamers etc) that specifically bind a further analyte, such as a further bacterial species other than a GBS bacteria or Streptococcus agalactiae. In this regard, the sensor may form a part of a multiplexed sensor or detection system, in which multiple analytes or bacterial types are tested for or detected simultaneously in a single sample, and more particularly a single biological sample.

[0250] In another form, the present disclosure provides a method of isolating or purifying GBS bacteria from a sample, said method including the steps of: (a) contacting the sample with the aptamer described herein or the sensor described herein; and

[0251] (b) isolating a GBS bacteria: aptamer complex from the sample, to thereby isolate or purify GBS bacteria from the sample.

[0252] Methods for isolating or purifying GBS bacteria and / or a GBS bacteria: aptamer complex from a sample will be apparent to the skilled person and / or are described herein.

[0253] In this context, the term “isolating” suitably refers to at least partly purifying, concentrating or removing the GBS bacteria from the sample. Affinity based separation methods may be used. A tag or label on an aptamer described herein may also be used so that the GBS bacteria can be filtered or sorted from a sample, such as by a fluorescence based sorting system.

[0254] It is envisaged that the aptamer may comprise, for example, an additional nucleotide sequence at the 5’- and / or 3 ’-terminus thereof. The aptamer may comprise a tag sequence, and optionally one or more spacer nucleotide bases at the 5’- and / or 3 ’-terminus thereof to facilitate isolation or purification of the GBS bacteria. Alternatively, or additionally, the aptamer may comprise a linker sequence, and optionally one or more spacer nucleotide bases at the 5’- and / or 3 ’-terminus thereof to facilitate conjugation or linking to the substrate.

[0255] The methods described herein may be performed in an enzyme-linked immunosorbent assays (ELISA). As used herein, the term “ELISA” or “sandwich ELISA” or “capture ELISA” or “El A” refers to immobilising an aptamer described herein onto a solid support followed by addition of an amount of sample. The GBS bacteria:aptamer complex can then be detected by a detection molecule which recognises the GBS bacteria: aptamer complex. The GBS bacteria: aptamer complex can be detected by the detection molecule which can be covalently linked to an enzyme, or can itself be detected by addition of a secondary detection molecule or nanoparticle which is linked to an enzyme.

[0256] Alternatively, the methods described herein may be performed in a lateral flow assay (LFA) format. LFAs, also known as “immunochromatographic strip tests”, have been a popular platform for rapid immunoassays since their introduction in the mid-1980s.

[0257] LFAs are particularly suitable where a rapid test is required or where specialized laboratory equipment is not available. In hospitals, clinics, physician offices, and clinical laboratories, LF- based tests are used for the qualitative and quantitative detection of the presence of a specific analyte in a liquid sample.

[0258] LFAs operate on the same principles as ELISA. In essence, these tests run a liquid sample along the surface of a membrane or filter paper with reactive molecules that show a visual positive or negative result depending on the presence of a particular analyte. A LFA device, is a device configured to receive a sample at a sample region and to provide for the sample to move laterally, via, e.g., wicking, by capillary action from the sample region to a detection region.

[0259] A lateral flow assay device typically has a solid support onto which an optional sample region, an optional conjugate region, a detection region, and an optional absorbent region are mounted. The solid support (“backing card”) provides support for the pads and membranes of the actual assay but are otherwise not involved in the reaction or flow of the sample and analyte. Backing cards are, for example, made of polyvinylchloride (PVC). The assembly of pads and membranes on the backing card will typically be in a plastic housing although this is not required. The housing may have at least one opening (“sample port”) over the sample pad for application of the sample. The control and test zones are visible (e.g., via an opening or window) to detect or measure the bound label. The housing prevents the user from applying the sample anywhere except the sample pad. The housing also serves to protect the strip from inadvertent splash onto the membrane. External labelling on the housing can also be used to indicate the position of test and control lines and provide other information. Housings can be obtained as off-the-shelf cassettes or custom-designed to fit around the strip. Internal pins and bars can be used to hold the strip in place relative to the sample port and viewing window. They may hold the materials in fluid communication with one another while the test strip is running.

[0260] Suitable materials for a sample region, conjugation region, or a detection region that may be comprised in a lateral flow assay device described herein include, but are not limited to organic or inorganic polymers, and natural and synthetic polymers, including glass fiber, cellulose, nylon, cross-linked dextran, various chromatographic papers and nitrocellulose. It will be appreciated that suitable materials will enable a sample to flow laterally, via capillary action, along a device described herein. In certain examples, the detection region is a nitrocellulose membrane. In certain examples, a sample region and a conjugation region may be composed of the same material. In certain examples, a lateral flow assay device comprises a sample region in capillary contact with a detection region. Suitable commercially available materials will be known to the skilled person. Commercially available materials may be used for a sample region, conjugation region, and / or detection region that may be comprised in a lateral flow assay device described herein.

[0261] Methods of monitoring a GBS bacterial infection

[0262] It is envisaged that methods of detecting a GBS bacteria: aptamer complex in a biological sample described herein can be used to monitor a GBS bacterial infection in a subject and inform clinicians as to treatment decisions and a patient’s response to treatment.

[0263] Accordingly, in one form, the present disclosure provides a method of monitoring a GBS bacterial infection in a subject, said method including the steps of: (a) contacting a biological sample obtained from the subject with the aptamer described herein or the sensor described herein; and

[0264] (b) detecting the presence or absence of or measuring a level of a GBS bacteria: aptamer complex; to thereby monitor the GBS bacterial infection in the subject.

[0265] The present methods may include comparing the level of the GBS bacteria: aptamer complex in the subject’s biological sample to that of a control sample or level or reference sample or level. The terms “control sample” or “reference sample” typically refers to a biological sample from a (healthy) non-diseased individual not having a GBS bacterial infection. Alternatively, the control sample may include a biological sample from an individual or population of individuals having the same GBS bacterial infection and / or receiving the same treatment as the subject in question. The control sample may include a biological sample from the individual having the same GBS bacterial infection taken from a different tissue or fluid that is expected to be free of a GBS bacterial infection. The control sample may be from a subject known to be free of a GBS bacterial infection or a sample that was obtained from the subject at an earlier time point (e.g., a time point prior to the commencement of the treatment in the subject or a time point at which the subject in question was known to be free of a GBS bacterial infection). The control sample may be a pooled, average or an individual sample. An internal control is a marker from the same biological sample being tested.

[0266] The level of the GBS bacteria: aptamer complex may be compared to a threshold or reference level. A threshold or reference level is generally a quantified level of the target molecule (i.e., the GBS bacteria: aptamer complex) of the present disclosure. Typically, a level of the GBS bacteria: aptamer complex in a biological sample that exceeds or falls below the threshold or reference level of expression is predictive of a particular disease state or outcome (e.g., having or not having a GBS bacterial infection). The nature and numerical value (if any) of the threshold or reference level will typically vary based on the method chosen to determine the level of the GBS bacteria: aptamer complex in the sample, used in determining, for example, a diagnosis of and / or monitoring of a GBS bacterial infection, in the subject.

[0267] A person of skill in the art will be capable of determining a threshold or reference level of the GBS bacteria: aptamer complex in a biological sample that may be used in determining, for example, a diagnosis and / or monitoring of a GBS bacterial infection, using any method of measuring the level of the GBS bacteria: aptamer complex known in the art, such as those described herein. The concept of a threshold level should not be limited to a single value or result. In this regard, a threshold level may encompass multiple threshold levels that could signify, for example, a high, medium, or low probability of, for example, diagnosis of a GBS bacterial infection in the subject.

[0268] As will be understood by the skilled person, the level of the GBS bacteria: aptamer complex provided herein may be relatively: (i) higher, increased or greater; or (ii) lower, decreased or reduced when compared to a level in a control or reference sample, or to a threshold level. For example, a level of the GBS bacteria: aptamer complex may be classified as higher, increased or greater if it exceeds a mean and / or median level of the GBS bacteria: aptamer complex in a reference population. A level of the GBS bacteria:aptamer complex may be classified as lower, decreased or reduced if it is less than the mean and / or median level of a reference population. In this regard, a reference population may be a group of subjects not having a GBS bacterial infection or who have the same GBS bacterial infection as said subject for which the level of the GBS bacteria: aptamer complex is determined.

[0269] Terms such as “higher”, “increased” and “greater” as used herein refer to an elevated level of the GBS bacteria: aptamer complex, such as in a sample, when compared to a control or reference level or amount. The level of the GBS bacteria: aptamer complex may be relative or absolute. The level of the GBS bacteria: aptamer complex may be higher, increased or greater if its level is more than about 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 300%, 400% or at least about 500% above the level of the GBS bacteria: aptamer complex in a control or reference level or amount.

[0270] The terms, “lower”, “reduced” and “decreased”, as used herein refer to a lower amount or level of the GBS bacteria: aptamer complex, such as in a sample, when compared to a control or reference level or amount thereof. The level of the GBS bacteria: aptamer complex provided herein may be relative or absolute. The level of the GBS bacteria:aptamer complex may be lower, reduced or decreased if its level is less than about 95%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20% or 10%, or even less than about 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.01%, 0.001% or 0.0001% of the level or amount of the GBS bacteria: aptamer complex in a control or reference level or amount.

[0271] Monitoring a GBS bacterial infection in a subject may include the step of taking multiple samples over a period of time (e.g., 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks etc.). A lower amount or level of the GBS bacteria:aptamer complex, or an absence of the GBS bacteria: aptamer complex, in subsequent samples may indicate, for example, a favourable response to treatment. A higher amount or level of the GBS bacteria: aptamer complex, or the presence of the GBS bacteria: aptamer complex, in subsequent samples may indicate, for example, an unfavourable or no response to treatment. Suitably, the present methods include the step of administering a treatment for a GBS infection to the subject. The treatment may be any known in the art, such as an anti-bacterial agent or antibiotic agent to which the GBS bacteria is at least partly sensitive. Exemplary treatments for a GBS infection, such as neonatal sepsis, include an anti-microbial agent (e.g., an antibiotic agent or an antiviral agent), an intravenous fluid, an anti-inflammatory agent (e.g., a corticosteroid, a NSAID), a vasopressor agent (e.g., vasopressin, a catecholamine, like phenylephrine, norepinephrine, epinephrine, isoproterenol, dobutamine, and dopamine), insulin or an insulin analogue, an analgesic agent, a sedative, a positive inotrope (e.g., a cardiac glycoside, like digoxin; a beta agonist, like dobutamine; and a phosphodiesterase inhibitor, like milrinone), an immune enhancing agent and any combination thereof.

[0272] Exemplary antibacterials or antibiotics include aminoglycoside, ansamycin, carbacephem, carbapenems, cephalosporins, glycopeptides, lincosamides, lipopeptides, macrolides, monobactams, nitrofurans, oxazolidinones, penicillins, antimicrobial polypeptides, sulfonamides, tetracylcines, and any combination thereof. Specific nonlimiting examples of broad- spectrum antibiotics that may be utilized in the treatment of sepsis include vancomycin, ceftriaxone, piperacillin-tazobactam, cefepime, tobramycin, imipenem-cilastatin, gentamicin and any combination thereof. In particular examples, the antibacterial agent is or comprises a beta-lactam antibiotic, such as penicillin, ampicillin and cefazolin, and optionally an aminoglycoside, such as gentamycin.

[0273] Methods of treating a GBS bacterial infection

[0274] The present disclosure also provides a method of preventing, ameliorating or treating a GBS bacterial infection in a subject, said method including the step of administering a therapeutically effective amount of a treatment for the GBS bacterial infection to the subject in which a biological sample of the subject has been contacted with an aptamer and / or a sensor provided herein and the presence or level of a GBS bacteria:aptamer complex has been determined therein. In this regard, the presence or level of the GBS bacteria:aptamer complex is suitably diagnostic of the subject having the GBS bacterial infection.

[0275] As used herein, the terms “treating”, “treat” or “treatment” and variations thereof, refer to clinical intervention designed to alter the natural course of the individual, tissue, organ or cell being treated during the course of clinical pathology. More particularly, these terms refer to a therapeutic intervention, course of action or protocol that at least ameliorates a symptom, complication, sequela and / or consequence of such a disease, disorder or condition after said disease, disorder or condition and / or its symptoms, complications, sequelae and / or consequences have at least started to develop. Desirable effects of treatment include decreasing the rate of disease progression, ameliorating or palliating the disease state, and remission or improved prognosis. As used herein, the term “improved” shall be understood to mean decreased mortality, increased magnitude of response, decreased timing of treatment, decreased disease progression, and / or decrease of pathological symptoms for the patient.

[0276] As used herein, “preventing”, “prevent” or “prevention” refers to therapeutic intervention, course of action or protocol initiated prior to the onset of a GBS bacterial infection and / or a symptom, complication, sequela and / or consequence thereof so as to prevent, inhibit or delay the development or progression of the GBS bacterial infection or a symptom, complication, sequela and / or consequence thereof.

[0277] As used herein, the term “therapeutically effective amount” describes a quantity of a specified agent sufficient to achieve a desired effect in a subject being treated with that agent. For example, this can be the amount of a composition comprising one or more agents that are necessary to reduce, alleviate and / or prevent a GBS bacterial infection. In some embodiments, a “therapeutically effective amount” is sufficient to reduce or eliminate a symptom of a GBS bacterial infection. In other embodiments, a “therapeutically effective amount” is an amount sufficient to achieve a desired biological effect, for example an amount that is effective to decrease or prevent GBS bacterial infection and / or overcome resistance to.

[0278] Ideally, a therapeutically effective amount of an agent is an amount sufficient to induce the desired result without causing a substantial cytotoxic effect in the subject. The effective amount of an agent useful for reducing, alleviating and / or preventing a GBS bacterial infection will be dependent on the subject being treated, the type and severity of any associated disease, disorder and / or condition, and the manner of administration of the therapeutic composition.

[0279] The methods described herein can further include the initial steps of contacting the one ore more biological samples obtained from the subject with an aptamer and / or a sensor described herein and / or determining the presence or absence of or measuring the level of a GBS bacteria: aptamer complex in one or more biological samples of the subject, such as by those methods described herein.

[0280] Suitably, the treatment for the GBS infection may be any treatment known in the art, such as those hereinbefore described.

[0281] Kits and Test Reagents

[0282] The present disclosure also provides kits comprising the aptamer described herein or the sensor described herein and optionally instructions for use. Such kits can be used for, e.g., performing the detection and diagnostic methods described above. A kit can also include a label. Kits also typically contain directions for use of the kit. Labelling generally refers to any written or recorded material that is attached to, or otherwise accompanies, a kit at any time during its manufacture, transport, sale or use. For example, the term “labelling” encompasses advertising leaflets and brochures, packaging materials, instructions, audio or video cassettes, computer discs, as well as writing imprinted directly on kits. Such kits may also provide a positive control, for example, a purified GBS bacteria solution or a solution containing biomolecules isolated from GBS bacteria. The kit may also comprise a negative control, such as a solution comprising the aptamer described herein but which is not contacted with a sample. A kit may further provide a solid support on to which the aptamer is placed, such as a material comprising glass fibers, polyester, cellulose, or rayon.

[0283] The present disclosure further provides test reagents comprising the aptamer described herein and optionally one or more acceptable excipients, diluents or carriers. Such test reagents can be used for, e.g., performing the detection and diagnostic methods described above.

[0284] Test reagents for particular types of assays may also be provided in the kits. Thus, the kits may include a population of nanoparticles, beads (e.g., suitable for an agglutination assay or a lateral flow assay), or a plate (e.g., a plate suitable for an ELISA assay). The kits may comprise a device, such as a sensor described herein, a lateral flow assay device, an analytical rotor, or an electrochemical, optical, or opto-electronic sensor. The population of nanoparticles, beads, the plate, and the devices may be useful for performing an immunoassay. In examples in which the kit comprises a lateral flow assay device, the aptamer of the disclosure may be contained within the kit separate to the device, or it may be comprised within the device itself, for example it may be dried on to a conjugate region within the device.

[0285] In addition, the kits may include various diluents and buffers, labeled conjugates or other agents for performing the methods described above, and other signal-generating reagents, such as enzyme substrates, cofactors, chromogens, and fluorogens. Other components of the kit can easily be determined by one of skill in the art. Such components may include coating reagents, indicator charts for colorimetric and fluorometric comparisons, disposable gloves, decontamination instructions, applicator sticks or containers, a sample preparatory cup, etc. A kit may comprise buffers or other reagents appropriate for constituting a reaction medium in which the aptamer described herein is contacted with the sample.

[0286] The kits may comprise an instruction indicating how to use the kit to detect GBS bacteria. The kits may comprise an instruction indicating how to prepare a sample. The kits may provide instructions for contacting the sample with the aptamer described herein in any order prior to analyzing the sample for the presence of GBS bacteria. The kits may also provide instructions for optimization of buffers, optimization of the ratios of the various components, optimization of dilution of the sample, and optimization of the order of the mixture and application steps (e.g., mix all components prior to application, mix only certain components and apply others separately).

[0287] The kits may further comprise components for obtaining, containing, preparing, measuring, and / or mixing the sample. For example, the kit may comprise a pipette for transferring a particular volume of sample, or other solution in the kit. Alternatively, or in addition, the kit may comprise a device that processes the biological sample and delivers a particular volume of sample, or other solution in the kit.

[0288] The methods, kits and test reagents of the disclosure offer a number of advantages. For example, they can allow for simple, inexpensive, rapid, sensitive and accurate detection of GBS bacteria, without significant false positive or background signals. This allows for an accurate and sensitive diagnosis in a point of care setting.

[0289] So that preferred embodiments of the present disclosure may be fully understood and put into practical effect, reference is made to the following non-limiting examples.

[0290] Examples

[0291] Example 1: SELEX Protocol for anti-GBS aptamer selection

[0292] Preparation of Random ssDNA Library

[0293] To prepare the ssDNA library pool of 80 nucleotide random sequences (5'- GTCTTGACTAGTTACGCC-(N44)-TCATTCAGTTGGCGCCTC-3') (SEQ ID NO: 11), asymmetric polymerase chain reaction (PCR) was performed with a forward primer, 5'-Phosphate- GTCTTGACTAGTTACGCC-3' (SEQ ID NO: 12), and a reverse primer, 5'- GAGGCGCCAACTGAATGA-3' (SEQ ID NO: 13) (Figure 1). Template DNA was amplified using PCR to obtain ssDNA.

[0294] Preparation of GBS Bacteria

[0295] The GBS strain was acquired from ATCC (strain no. BAA- 1138) and grown on BHI medium to an OD value of 0.6, which is equivalent to 0.5 xlO8cells / ml and corresponds to the mid-log growth phase of the GBS bacteria.

[0296] Systemic evolution of ligands by exponential enrichment (SELEX)

[0297] Briefly, two nanomoles of the ssDNA random library was incubated with 0.5 xlO8cells / ml of Group B Streptococcus in 500 pl of lx binding buffer (i.e., 50mM Tris-HCl (pH 7.4), 5mM KC1, lOmM NaCl, ImM MgCh and 0.1% yeast tRNA) for 1.5 hours at room temperature with gentle mixing. To remove the unbound or poorly bound ssDNA, the cells were washed twice with 1ml of washing buffer (i.e., 50mM Tris-HCl (pH 7.4), 5mM KC1, lOmM NaCl, and ImM MgCh).

[0298] Aptamers bound on the cells were collected in 100 pl DNase free water by heating at 94°C for 10 min followed by incubating on ice for 10 min. The cells, free of aptamers, were then centrifuged at 6000xg for 10 min. The supernatant containing the eluted DNA aptamers was used as the template for PCR amplification to obtain the aptamer pool for the next round of selections. PCR products of each step were purified by ethanol precipitation and digested with lambda exonuclease to generate ssDNA before completing the next round of SELEX.

[0299] The stringency of the selection reactions was increased by increasing the washing frequency from 2 to 5 times, decreasing the incubation time from 90 min to 15 min and decreasing the volume of the binding buffer from 500 pl to 200 pl. To eliminate nonspecific aptamers from the random library pool and direct selection towards the target, three rounds of counter-SELEX were carried out.

[0300] Optimisation of Aptamers

[0301] The third, fifth and ninth rounds of ssDNA aptamer pools were incubated with 0.5 x 108CFU / ml nontarget bacterial cocktail. The preparation of the bacterial cocktail for counter SELEXs was similar to that of the target cells. One ml aliquot (0.5 x 108CFU / ml) from each of Streptococcus pneumoniae, Bacillus subtilis, Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Staphylococcus epidermidis, Bacillus cereus, Actinobacter baumannii, and Group A Streptococcus (ATCC10403, and 19615) were pooled together and washed twice with wash buffer before suspending in 10 ml PBS and used as a bacterial cocktail. One ml of this bacterial cocktail was used in counter-SELEX process. The ssDNA pools were incubated with the bacterial cocktail. The supernatant was collected after 1 hour for the next round of selection.

[0302] Characterisation of Aptamers

[0303] Finally, the enriched pools were sequenced through next generation sequencing (NGS) using an Illumina NGS platform (Australian Genome Research Facility). The top- 10 ssDNA sequences with the highest frequencies observed during NGS were chosen for the subsequent characterizations including the determination of their KD values (dissociation constants). The KD values of aptamers were determined by custom-synthesis of 5’-FAM-labelled aptamers, followed by exposure of different known concentrations of these aptamers to a fixed concentration of bacteria (e.g., 0.5 xlO8cells / ml). The degree of aptamer binding to bacteria was evaluated by fluorescent spectroscopy to determine the KD values of different aptamers (Table 1).

[0304] Table 1: Sequence of ssDNA anti-GBS aptamers obtained from the SELEX process after nextgeneration sequencing along with their KD values in nanomolar.

Claims

CLAIMS:

1. An aptamer for binding a Group B Streptococcus (GBS) bacteria, wherein the aptamer comprises, consists of or consists essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 10 and 14 to 29 or a fragment, variant or derivative thereof.

2. The aptamer of Claim 1, wherein the aptamer has a dissociation constant (KD) for the GBS bacteria of 500 nM or less.

3. The aptamer of Claim 1 or Claim 2, wherein the GBS bacteria is Streptococcus agalactiae.

4. The aptamer of any one of Claims 1 to 3, which is or comprises a DNA molecule.

5. The aptamer of any one of Claims 1 to 4, wherein the aptamer is single stranded.

6. The aptamer of Claim 5, wherein the aptamer is or comprises a single stranded DNA molecule.

7. The aptamer of any one of Claims 1 to 6, wherein the aptamer forms a secondary or tertiary structure comprising a hairpin loop.

8. The aptamer of any one of Claims 1 to 7, wherein the aptamer comprises at least one chemical modification.

9. The aptamer of Claim 8, wherein the modification is one or more of: a chemical substitution at a sugar position, a chemical substitution at an intemucleotide linkage, a chemical substitution at a base position, and a chemical addition at a base position.

10. A sensor for detecting GBS bacteria, comprising the aptamer of any one of Claims 1 to 9.

11. The sensor of Claim 10, wherein the aptamer is coupled, bound, affixed or otherwise linked to a substrate.

12. The sensor of Claim 11, wherein the substrate comprises one or more of a bead, a matrix, a cross-linked polymer, a gel, a particle, a surface, a plate, a paper, a membrane, a well or other solid or semi-solid substrate.

13. The sensor of Claim 11 or Claim 12, wherein the substrate comprises one or more of a sensor chip surface, an ELISA / ELLBA plate, a sepharose, an agarose, Protein A, Protein G, a magnetic bead, a paramagnetic particle or a nanoparticle.

14. A method of detecting GBS bacteria in a sample, said method including the steps of:(a) contacting the sample with the aptamer of any one of Claims 1 to 9 or the sensor of any one of Claims 10 to 13; and(b) detecting the presence or absence of or measuring a level of a GBS bacteria: aptamer complex, to thereby detect GBS bacteria in the sample.

15. A method of detecting a GBS bacterial infection in a subject, said method including the steps:(a) contacting a biological sample obtained from the subject with the aptamer of any one of Claims 1 to 9 or the sensor of any one of Claims 10 to 13; and(b) detecting the presence of absence of or measuring a level of a GBS bacteria: aptamer complex, to thereby detect the GBS bacterial infection in the subject.

16. A method of isolating or purifying GBS bacteria from a sample, said method including the steps of:(a) contacting the sample with the aptamer of any one of Claims 1 to 9 or the sensor of any one of Claims 10 to 13; and(b) isolating a GBS bacteria: aptamer complex from the sample, to thereby isolate or purify GBS bacteria from the sample.

17. A method of monitoring a GBS bacterial infection in a subject, said method including the steps of:(a) contacting a biological sample obtained from the subject with the aptamer of any one of Claims 1 to 9 or the sensor of any one of Claims 10 to 13; and(b) detecting the presence or absence of or measuring a level of a GBS bacteria: aptamer complex; to thereby monitor the GBS bacterial infection in the subject.

18. The method of any one of Claims 14 to 17, wherein the subject is a pregnant female or a newborn.

19. The method of any one of Claims 14 to 18, wherein the GBS bacteria is Streptococcus agalactiae or the GBS bacterial infection is at least partly mediated or associated with Streptococcus agalactiae.

20. A method of preventing, ameliorating or treating a GBS bacterial infection in a subject, said method including the step of administering a therapeutically effective amount of a treatment for the GBS bacterial infection to the subject in which a biological sample of the subject has been contacted with the aptamer of any one of Claims 1 to 9 or the sensor of any one of Claims 10 to 13 and the presence or level of a GBS bacteria:aptamer complex has been determined therein.

21. A method of producing a sensor for detecting GBS bacteria, said method including the steps of:(a) providing a substrate; and(b) coupling, binding, affixing or otherwise linking the aptamer of any one of Claims 1 to 9 to the substrate, to thereby produce the sensor.

22. The method of Claim 21, wherein the sensor is that of any one of Claims 10 to 13.

23. A sensor produced according to the method of Claim 21 or Claim 22.

24. A kit comprising the aptamer of any one of Claims 1 to 9 or the sensor of any one of Claims 10 to 13, and optionally instructions for use.

25. A test reagent comprising the aptamer of any one of Claims 1 to 9, and optionally one or more acceptable excipients, diluents or carriers.

26. The kit of Claim 24 or the test reagent of Claim 25, for use in the method of any one of Claims 14 to 20.

Images