Skin moisturizing or Anti-inflammatory composition for companion animals, comprising oat extract and barley extract

Abstract

The present invention relates to a composition comprising a mixture of an oat extract and a barley extract, and a use thereof for improving the skin condition of companion animals. The mixture has skin moisturizing, skin barrier strengthening, anti-inflammatory, anti-allergic, and skin soothing effects on companion animals, and thus can be effectively used in cosmetics, medicines and the like.

Description

Composition for moisturizing or anti-inflammatory skin of pets containing oat extract and barley extract

[0001] It relates to a composition for improving the skin condition of pets.

[0002] Unlike humans, pet skin has a very thin layer, weakening the skin barrier and leaving it dry. Therefore, human cosmetics are not suitable for use in enhancing pet skin's moisture retention. Therefore, the development of pet-specific skin products is essential to maintain healthy skin.

[0003] Oats were selected as one of Time magazine's top 10 superfoods and are richer in protein, essential amino acids, and soluble fiber than other grains. Oats are often added to rice or made into oatmeal, a processed oat product.

[0004] Barley is one of the world's four major crops, and in Korea, it is one of the five grains (rice, barley, millet, soybeans, and foxtail millet), making it the second most important staple food after rice.

[0005] The inventors of the present invention have made great efforts to develop a skin product exclusively for pets, and have confirmed that a mixture of oat extract and barley extract has a synergistic effect in improving the skin condition of pets, thereby completing the present invention.

[0006] One aspect is to provide a composition comprising a mixture of oat extract and barley extract as an active ingredient.

[0007] Specifically, the composition according to the above aspect may be a composition for moisturizing pet skin, strengthening the skin barrier, anti-inflammation, anti-allergy, and skin soothing; or a composition for preventing or treating pet skin inflammatory diseases or skin allergy diseases. In addition, the composition according to the above aspect may be a cosmetic composition, a composition for external skin application, a pharmaceutical composition, or a food composition.

[0008] Another aspect provides a method for preventing, improving, or treating a skin condition in a companion animal, comprising administering to the companion animal an effective amount of the composition described above.

[0009] Another aspect provides the use of a mixture of the above oat extract and barley extract for preparing a composition for improving the skin condition of a pet.

[0010] Another aspect provides a use of a mixture of the above oat extract and barley extract for preparing a medicament for preventing or treating a skin inflammatory disease or skin allergic disease in companion animals.

[0011] One aspect provides a composition comprising a mixture of oat extract and barley extract as an active ingredient.

[0012] The above-mentioned "oat (Avena sativa, Oat)" extraction part may be any one part selected from the group consisting of whole plant, sprout, kernel, flower, leaf, stem, seed, stalk, straw, bran, and root, but is not limited to a specific part. In one specific example, the oat extract may be an oat whole plant, sprout, kernel, flower, leaf, stem, seed, stalk, straw, bran, or root extract.

[0013] The above-mentioned "barley (Hordeum vulgare, Barley)" extraction part may be any one part selected from the group consisting of whole plant, root, seed, leaf, sprout, stem, and flower, but is not limited to a specific part. In one specific example, the barley extract may be an extract of barley whole plant, root, seed, leaf, sprout, stem, or flower.

[0014] The term "extract" includes all substances obtained by extracting a component of a natural product, regardless of the extraction method, extraction solvent, extraction conditions, or the form of the extracted component or extract, and also includes substances that can be obtained by processing or treating the component of a natural product by another method after extraction. For example, the processing or treatment may include dilution, concentration, drying, purification, fractionation, filtration, fermentation, enzyme treatment, etc. Accordingly, the extract may include an extract, a diluted or concentrated extract, a dried product obtained by drying the extract, or a adjusted or purified product thereof, or a fraction obtained by fractionating the same.

[0015] The above extraction method may use known natural product extraction methods such as hot water extraction, ethanol extraction, heating extraction, cold extraction, reflux extraction, reflux cooling extraction, ultrasonic extraction, and subcritical extraction, but is not limited thereto.

[0016] In one specific embodiment, the extract may be an ultrasonic extract. Ultrasonic extraction may use general ultrasonic extraction conditions. For example, the ultrasonic extraction may be performed at 10 to 100 KHz, 10 to 90 KHz, 10 to 80 KHz, 10 to 70 KHz, 10 to 60 KHz, 10 to 50 KHz, 10 to 40 KHz, 10 to 30 KHz, 20 to 100 KHz, 20 to 90 KHz, 20 to 80 KHz, 20 to 70 KHz, 20 to 60 KHz, 20 to 50 KHz, 20 to 40 KHz, or 20 to 30 KHz.

[0017] The above extraction solvent may be selected from water, an organic solvent, or a mixture thereof. The water may be distilled water or purified water. The organic solvent may include, but is not limited to, one or more of C1 to C6 alcohols, acetone, ether, ethyl acetate, diethyl ether, ethyl methyl ketone, and chloroform.

[0018] In one embodiment, the extraction solvent of the extract may be water, a C1 to C6 alcohol, or a mixture thereof. In another embodiment, the extraction solvent of the extract may be water. In another embodiment, the extraction solvent of the extract may be a mixture of water and a C1 to C6 alcohol. In another embodiment, the extraction solvent of the extract may be a mixture of water and ethanol. In another specific example, the extraction solvent of the extract is 1% (v / v) to 100% (v / v) ethanol, 1% (v / v) to 90% (v / v) ethanol, 1% (v / v) to 80% (v / v) ethanol, 1% (v / v) to 70% (v / v) ethanol, 1% (v / v) to 60% (v / v) ethanol, 1% (v / v) to 50% (v / v) ethanol, 1% (v / v) to 40% (v / v) ethanol, 10% (v / v) to 100% (v / v) ethanol, 10% (v / v) to 90% (v / v) ethanol, 10% (v / v) to 80% (v / v) ethanol, 10% (v / v) to 70% (v / v) ethanol. It may be 10% (v / v) to 60% (v / v) ethanol, 10% (v / v) to 50% (v / v) ethanol, 10% (v / v) to 40% (v / v) ethanol, 20% (v / v) to 100% (v / v) ethanol, 20% (v / v) to 90% (v / v) ethanol, 20% (v / v) to 80% (v / v) ethanol, 20% (v / v) to 70% (v / v) ethanol, 20% (v / v) to 60% (v / v) ethanol, 20% (v / v) to 50% (v / v) ethanol, or 20% (v / v) to 40% (v / v) ethanol.

[0019] The above extraction conditions refer to conditions for extracting components of natural products, such as extraction time and extraction temperature. The above extraction time is 30 minutes to 168 hours, 30 minutes to 120 hours, 30 minutes to 100 hours, 30 minutes to 80 hours, 30 minutes to 60 hours, 30 minutes to 40 hours, 30 minutes to 20 hours, 30 minutes to 10 hours, 30 minutes to 5 hours, 1 hour to 168 hours, 1 hour to 120 hours, 1 hour to 100 hours, 1 hour to 80 hours, 1 hour to 60 hours, 1 hour to 40 hours, 1 hour to 20 hours, 1 hour to 10 hours, 10 hours to 168 hours, 10 hours to 120 hours, 10 hours to 100 hours, 10 hours to 80 hours, 10 hours to 60 hours, 10 hours to 40 hours, 10 hours to 30 hours, It may be 20 hours to 168 hours, 20 hours to 120 hours, 20 hours to 100 hours, 20 hours to 80 hours, 20 hours to 60 hours, 20 hours to 40 hours, 40 hours to 168 hours, 40 hours to 120 hours, 40 hours to 100 hours, 40 hours to 80 hours, or 40 hours to 60 hours, but may be appropriately selected depending on other conditions such as the extraction solvent and extraction temperature.

[0020] The above extraction temperature may be 10 to 150°C, 10 to 100°C, 10 to 80°C, 10 to 60°C, 10 to 40°C, 30 to 150°C, 30 to 100°C, 30 to 80°C, 30 to 60°C, 50 to 150°C, 50 to 100°C, 50 to 80°C, 50 to 60°C, 80 to 150°C, or 80 to 120°C, but may be appropriately selected depending on other conditions such as the extraction solvent and extraction time.

[0021] The mixing weight ratio (or concentration ratio) of the above oat extract and barley extract can be any value or any range selected from the range of more than 1:0.25 to less than 4, for example, 1:0.5 to 2, 1:0.6 to 1.8, 1:0.7 to 1.6, 1:0.8 to 1.4, 1:0.9 to 1.2, or about 1:1.

[0022] The term "about" may be interpreted to mean a value or range that is within 10%, 5%, 4%, 3%, 2%, or 1% above or below a given value or range.

[0023] In one embodiment, it was confirmed that when the mixing ratio of oat extract and barley extract was 1:0.5 to 2, it exhibited a significantly superior effect of increasing filaggrin expression and decreasing TNF-α expression compared to using oat extract alone or barley extract alone. In particular, it was confirmed that when the mixing ratio of oat extract and barley extract was 1:1, there was a synergistic effect of increasing filaggrin expression and decreasing TNF-α expression.

[0024] The extract may have effects that improve skin condition, improve skin beauty, or prevent, improve, or treat skin diseases in companion animals. For example, the extract may have effects that moisturize the skin, strengthen the skin barrier, and have anti-inflammatory, anti-allergy, or soothing effects. Furthermore, the extract may have effects that prevent, improve, or treat diseases caused by impaired skin barrier function, skin inflammation, or skin allergies in companion animals.

[0025] The above companion animal is not limited to a specific species, but may be, for example, a dog or a cat. In one specific example, the companion animal may be a companion dog.

[0026] The above “skin moisturizing” may mean any action that maintains skin moisture or prevents moisture loss.

[0027] The above “strengthening the skin barrier” may refer to any action that enhances the function of the skin barrier, which is located at the outermost part of the skin and prevents moisture and nutrient loss.

[0028] The above “anti-inflammation” may be used interchangeably with “improving inflammation” and “suppressing inflammation”, and may include, for example, any action that suppresses the expression of inflammatory cytokines.

[0029] The above “anti-allergy” may be used interchangeably with “allergy improvement” and “allergy suppression”, and may include, for example, all actions of removing or suppressing allergens (antigens that cause allergic diseases) or alleviating allergic reactions caused by allergens.

[0030] The above “skin soothing” may include all actions that calm and stabilize symptoms of damaged or irritated skin (e.g., fever, pain, redness, itchiness, etc.) or restore the skin.

[0031] The above “skin disease” may be a disease caused by damage to the skin barrier function, a skin inflammatory disease, or a skin allergic disease.

[0032] The above-mentioned skin barrier function impairment can refer to any change that appears on the skin due to a decline or damage to the skin barrier function. Examples include increased wrinkles, dryness, dermatitis, atopic dermatitis, allergic dermatitis, itching, and acne.

[0033] The above skin inflammatory disease may be any one selected from the group consisting of skin wounds, dermatitis, atopic dermatitis, pruritus, eczematous skin disease, dry eczema, erythema, urticaria, psoriasis, rash, and acne.

[0034] The above skin allergic diseases may include atopic dermatitis, allergic dermatitis, urticaria, itching, rash, etc.

[0035] The above skin inflammatory disease or skin allergic disease may be caused by an increase in TNF-α.

[0036] The term "prevention" encompasses suppressing the onset of a disease. The term "treatment" encompasses suppressing, alleviating, or eliminating the development of a disease. The term "improvement" can refer to any action that at least reduces the severity of symptoms, such as parameters associated with alleviating or curing a condition.

[0037] In one specific example, the mixture may increase the expression of filaggrin. Accordingly, the extract may exhibit a skin moisturizing or skin barrier improvement effect in companion animals.

[0038] In one specific example, the mixture may reduce or inhibit the expression of TNF-α. Accordingly, the extract may exhibit anti-inflammatory, anti-allergic, antipruritic, or skin-soothing effects in companion animals.

[0039] The above “included as an active ingredient” means that the ingredient is added to an extent that it can exhibit the effect mentioned in this specification, and includes formulating in various forms by adding various ingredients as auxiliary ingredients for drug delivery and stabilization.

[0040] The mixture is present in an amount of 0.0001 wt% to 99.9999 wt%, for example, 0.001 wt% to 80 wt%, 0.01 wt% to 60 wt%, 0.01 wt% to 40 wt%, 0.01 wt% to 30 wt%, 0.01 wt% to 20 wt%, 0.01 wt% to 10 wt%, 0.01 wt% to 5 wt%, 0.05 wt% to 60 wt%, 0.05 wt% to 40 wt%, 0.05 wt% to 30 wt%, 0.05 wt% to 20 wt%, 0.05 wt% to 10 wt%, 0.05 wt% to 5 wt%, 0.1 wt% to 60 wt%, 0.1 wt% to 40 wt%, 0.1 It may be included in an amount of 0.1 wt% to 30 wt%, 0.1 wt% to 20 wt%, 0.1 wt% to 10 wt%, or 0.1 wt% to 5 wt%, but is not particularly limited thereto. The content of the effective ingredient may be selected as an appropriate content that can be formulated within the content range that can exhibit the effects mentioned herein by a person skilled in the art.

[0041] The mixture is present in the composition at a concentration of 0.01 to 200 ppm, for example, 0.01 to 200 ppm, 0.01 to 100 ppm, 0.01 to 50 ppm, 0.01 to 20 ppm, 0.01 to 10 ppm, 0.01 to 5 ppm, 0.01 to 2 ppm, 0.01 to 1 ppm, 0.1 to 200 ppm, 0.1 to 100 ppm, 0.1 to 50 ppm, 0.1 to 20 ppm, 0.1 to 10 ppm, 0.1 to 5 ppm, 0.1 to 2 ppm, 0.1 to 1 ppm, 1 to 200 ppm, 1 to 100 ppm, 1 to 50 ppm, 1 to 20 ppm, It may be included in a concentration of 1 to 10 ppm, 10 to 200 ppm, 10 to 100 ppm, 10 to 50 ppm, 10 to 40 ppm, 10 to 30 ppm, or 10 to 20 ppm.

[0042] In one embodiment, it was confirmed that the mixture exhibited a significantly superior TNF-α expression reduction effect when the concentration was 1 ppm or higher. In addition, it was confirmed that the mixture exhibited a significantly superior filaggrin expression increase effect when the concentration was 10 ppm or higher.

[0043] The composition may be in a liquid or dry state. In one embodiment, the composition may be in the form of a dry powder.

[0044] The drying method for preparing the above composition in a dry state may be any method commonly used in the art and is not particularly limited. Non-limiting examples of the drying method include air drying, natural drying, spray drying, and freeze drying. These methods may be used alone or in combination of at least two methods.

[0045] The composition may include an effective amount of an additive sufficient to reduce deterioration of the extract. The additive may be, but is not limited to, a binder.

[0046] The composition may further comprise a cosmetically, pharmaceutically, or food additive acceptable carrier. The composition may be formulated with the carrier and provided as a cosmetic, pharmaceutical, or food additive.

[0047] In one specific example, the composition may be a cosmetic composition. Specifically, it may be a cosmetic composition for pets.

[0048] The above cosmetic composition may additionally include, in addition to the effective ingredients disclosed herein, components commonly used in cosmetic compositions, functional additives, etc., and may include, for example, conventional auxiliary agents such as antioxidants, stabilizers, solubilizers, surfactants, dispersants, emulsifiers, preservatives, vitamins, pigments, fragrances, etc., and carriers.

[0049] The above cosmetic composition is not particularly limited to a specific formulation, and the formulation can be appropriately selected depending on the purpose. The cosmetic composition may have, for example, a solubilized formulation, an emulsified formulation, or a dispersion formulation. The cosmetic composition may have, for example, a toner, a cream, an essence, a cleansing foam, cleansing water, a pack, an ampoule, a body lotion, a body oil, a body gel, a shampoo, a rinse, a hair conditioner, a hair gel, a foundation, a lipstick, a mascara, a makeup base, or a cosmetic formulation of a skin-adhesive type. The cosmetic formulation of a skin-adhesive type may be, for example, a mask pack, but is not limited thereto.

[0050] In one specific example, the composition may be a composition for external skin application. Specifically, it may be a composition for external skin application for companion animals.

[0051] The above-mentioned external preparation for skin may be a cream, gel, ointment, skin emulsifier, skin suspension, transdermal patch, drug-containing bandage, lotion, or a combination thereof. The above-mentioned external preparation for skin may be appropriately mixed with ingredients commonly used in external preparations for skin such as cosmetics or medicines, such as aqueous ingredients, oily ingredients, powder ingredients, alcohols, moisturizers, thickeners, UV absorbers, whitening agents, preservatives, antioxidants, surfactants, fragrances, colorants, various skin nutrients, metal ion sequestrants, sugars, or a combination thereof, as needed.

[0052] In one specific embodiment, the composition may be a pharmaceutical composition. Specifically, it may be a pharmaceutical composition for companion animals.

[0053] The pharmaceutical composition may additionally comprise a pharmaceutically acceptable diluent or carrier. The diluent may be lactose, corn starch, soybean oil, microcrystalline cellulose, mannitol, or a combination thereof. The carrier may be an excipient, a disintegrant, a binder, a glidant, or a combination thereof. The excipient may be microcrystalline cellulose, lactose, low-substituted hydroxycellulose, or a combination thereof. The disintegrant may be calcium carboxymethylcellulose, sodium starch glycolate, calcium dihydrogen phosphate anhydrous, or a combination thereof. The binder may be polyvinylpyrrolidone, low-substituted hydroxypropyl cellulose, hydroxypropyl cellulose, or a combination thereof. The glidant may be magnesium stearate, silicon dioxide, talc, or a combination thereof.

[0054] The above pharmaceutical composition may be formulated as an oral or parenteral dosage form. Oral dosage forms may include granules, powders, liquids, tablets, capsules, dry syrups, etc. Parenteral dosage forms may include injections, ointments, etc.

[0055] In one specific example, the composition may be a food composition. The composition may be a food composition for companion animals. The composition may be a health functional food composition. In this case, the composition may be formulated into a conventional health functional food formulation known in the art.

[0056] The above food composition may be used alone or in combination with other foods or food ingredients, and may be used appropriately according to a conventional method. There is no particular limitation on the type of the health functional food. Among the types of health functional foods, the beverage composition may contain various flavoring agents or natural carbohydrates as additional ingredients, like conventional beverages. The natural carbohydrates include monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; and polysaccharides such as dextrin and cyclodextrin; and sugar alcohols such as xylitol, sorbitol, and erythritol. As a sweetener, a natural sweetener such as thaumatin and stevia extract, or a synthetic sweetener such as saccharin and aspartame, may be used. The food composition may also contain nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, or combinations thereof. The food composition may also contain fruit pulp for the production of natural fruit juice, fruit juice drinks, vegetable drinks, or combinations thereof.

[0057] Another aspect provides a method for preventing, improving, or treating a skin condition in a companion animal, comprising administering to the companion animal an effective amount of the composition described above.

[0058] The above skin condition may be a condition related to the skin, and specifically, may be a disease caused by damage to the skin barrier function, a skin inflammatory disease, or a skin allergic disease.

[0059] The term "effective amount" means an amount effective enough to produce the effect mentioned above.

[0060] As used herein, the terms "administering," "introducing," and "implanting" are used interchangeably and may refer to placement of a composition according to an embodiment into a subject by a method or route that results in at least partial localization of the composition to a desired site according to an embodiment.

[0061] Administration may be by any method known in the art. The route of administration, frequency of administration, and other administration methods can be appropriately selected by those skilled in the art. Administration may be administered directly to a subject by any means, including intravenous, intramuscular, oral, transdermal, mucosal, intranasal, intratracheal, or subcutaneous administration. Administration may be systemic or local. Administration may include application to the skin.

[0062] The companion animal may be, for example, a dog or a cat. The companion animal may be a pet requiring improvement in skin condition, for example, a pet requiring moisturizing effects, strengthening the skin barrier, anti-inflammatory effects, anti-allergy effects, antipruritic effects (anti-itching effects), or skin soothing effects.

[0063] The above administration may be 0.1 mg to 1,000 mg of the composition according to one specific example per subject per day, for example, 0.1 mg to 500 mg, 0.1 mg to 100 mg, 0.1 mg to 50 mg, 0.1 mg to 25 mg, 1 mg to 1,000 mg, 1 mg to 500 mg, 1 mg to 100 mg, 1 mg to 50 mg, 1 mg to 25 mg, 5 mg to 1,000 mg, 5 mg to 500 mg, 5 mg to 100 mg, 5 mg to 50 mg, 5 mg to 25 mg, 10 mg to 1,000 mg, 10 mg to 500 mg, 10 mg to 100 mg, 10 mg to 50 mg, or 10 mg to 25 mg. However, the dosage may vary depending on factors such as the formulation method, administration method, patient age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and response sensitivity, and those skilled in the art can appropriately adjust the dosage by considering these factors. The frequency of administration may be once a day or twice or more within the range of clinically acceptable side effects. Regarding the site of administration, it may be administered to one or more sites, and the total number of days of administration may be from 1 to 30 days per treatment, daily or at intervals of 2 to 5 days. If necessary, the same treatment may be repeated after an appropriate period.

[0064] Another aspect provides the use of a mixture of the above oat extract and barley extract for preparing a composition for improving the skin condition of a pet.

[0065] Another aspect provides the use of a mixture of the above oat extract and barley extract for use in preparing a medicament for the prevention or treatment of a pet skin inflammatory disease or skin allergic disease.

[0066] Duplicate content is omitted in consideration of the complexity of this specification, and terms not otherwise defined herein have the meanings commonly used in the technical field to which the present invention belongs.

[0067] According to one aspect, the composition comprises a mixture of oat extract and barley extract, thereby exhibiting synergistic effects in improving pet skin conditions, including moisturizing, strengthening the skin barrier, anti-inflammation, anti-allergy, antipruritus (anti-itching), and skin soothing. Therefore, the composition comprising the mixture can be usefully used in cosmetics, pharmaceuticals, foods, and other applications.

[0068] Figure 1 is a graph showing the relative expression level of filaggrin according to the mixing ratio of oat extract and barley extract in companion dog keratinocytes. ## p< 0.01, # p< 0.05 vs. None (negative control).

[0069] Figure 2 is a graph showing the relative expression level of filaggrin according to the concentration of a 1:1 mixture of oat extract and barley extract in companion dog keratinocytes. ## p< 0.01, # p< 0.05 vs. None (negative control).

[0070] Figure 3 is a graph showing the relative expression level of TNF-α according to the mixing ratio of oat extract and barley extract in companion dog keratinocytes. # p< 0.05 vs. None (untreated extract + untreated inflammation-inducing substance group), ***p< 0.005 vs. Veh. (negative control group), **p< 0.01 vs. Veh. (negative control group), *p< 0.05 vs. Veh (negative control group).

[0071] Figure 4 is a graph showing the relative expression level of TNF-α according to the concentration of a 1:1 mixture of oat extract and barley extract in companion dog keratinocytes. #p< 0.05 vs. None (untreated extract + untreated inflammation-inducing substance group), ***p< 0.005 vs. Veh. (negative control group), **p< 0.01 vs. Veh. (negative control group), *p< 0.05 vs. Veh (negative control group).

[0072] The following examples are provided for more detailed description. However, these examples are provided solely to illustrate one or more specific examples, and the scope of the present invention is not limited to these examples.

[0073] Manufacturing Example 1: Manufacturing of oat extract

[0074] The oat leaf part was mixed with 30% (v / v) ethanol solvent and then ultrasonically extracted at 20 to 30 KHz at 50°C for 72 hours. The extract was filtered, concentrated, and then freeze-dried to prepare an oat extract.

[0075] Manufacturing Example 2: Manufacturing of barley extract

[0076] Barley sprouts were mixed with 30% (v / v) ethanol solvent and then ultrasonically extracted at 20 to 30 KHz at 50°C for 72 hours. The extract was filtered, concentrated, and then freeze-dried to prepare a barley extract.

[0077] Examples and Comparative Examples: Preparation of a Mixture of Oat Extract and Barley Extract

[0078] The oat extract prepared in Manufacturing Example 1 and the barley extract prepared in Manufacturing Example 2 were mixed in a mixing ratio as shown in Table 1 below to prepare a mixture of oat extract and barley extract.

[0079] Oat extractBarley extractMixing ratio (oat:barley)Comparative example 110 ppm-1:0Comparative example 2-10 ppm0:1Example 15 ppm5 ppm1:1Example 26.7 ppm3.3 ppm2:1Example 38 ppm2 ppm4:1Example 43.3 ppm6.7 ppm1:2Example 52 ppm8 ppm1:4Example 60.5 ppm0.5 ppm1:1

[0080] [Experimental Example]

[0081] Experimental Example 1: Confirmation of skin moisturizing and skin barrier strengthening effects in companion animals.

[0082] To confirm the skin moisturizing and skin barrier strengthening effects of oat extract and barley extract in companion animals, the expression level of filaggrin (FLG) was analyzed.

[0083] 1-1: Cell culture and sample processing

[0084] Canine keratinocytes were cultured in DMEM medium (Dulbecco's modified Eagle's Medium, Gibco 1210-0038) containing 10% fetal bovine serum, and all cultures were performed in a 5% CO2 incubator at 37°C. The cultured cells were treated with Examples 1 to 6 and Comparative Examples 1 to 2 and further cultured for 24 hours. The untreated group served as a negative control.

[0085] 1-2: Gene expression level analysis

[0086] The culture medium was harvested, 1 ml of Trizol (RNA iso, DAKARA, Japan) was added to isolate RNA, and the RNA was quantified using Nanodrop 2000 (Thermo, USA). cDNA was synthesized by reacting at 37°C for 15 min, 50°C for 5 min, and 98°C for 5 min (Reverse Transcriptase Mix, ELPIS biotech, Korea). RT-PCR was performed using Step One Plus (Applied Biosystems, USA), and CyberGreen (SYBR Green supermix, Applied Biosystems, USA) was added together with the filaggrin primer and cDNA. After a 10-minute pre-incubation at 95°C, 40 cycles of 95°C for 15 sec, 60°C for 1 min, and 95°C for 15 sec were repeated. The expression level of the gene was finally analyzed through correction for the GAPDH gene. The primer information used is as shown in Table 2 below.

[0087] Gene sequence number direction sequence (5'→3') Filaggrin 1 forward TGGTTTTGCTCTGATGGTG 2 reverse GATGAACCCAGACACTGCTG

[0088] 1-3: Results

[0089] Figure 1 is a graph showing the relative expression level of filaggrin according to the mixing ratio of oat extract and barley extract in companion dog keratinocytes.

[0090] Figure 2 is a graph showing the relative expression level of filaggrin according to the concentration of a 1:1 mixture of oat extract and barley extract in companion dog keratinocytes.

[0091] As a result, as shown in Fig. 1, it was confirmed that a 1:1 mixture of oat extract and barley extract (Example 1) significantly increased the expression of filaggrin compared to the negative control, oat extract alone (Comparative Example 1), or barley extract alone (Comparative Example 2), thereby exhibiting a synergistic effect. In particular, a 1:1 mixture of oat extract and barley extract (Example 1) exhibited a significantly superior synergistic effect compared to mixtures having other mixing ratios (Examples 2 to 5).

[0092] In addition, as shown in Fig. 2, it was confirmed that a synergistic effect was observed in increasing filaggrin expression when a 1:1 mixture of oat extract and barley extract was used at 10 ppm or more.

[0093] Therefore, it was confirmed that the mixture of oat extract and barley extract had excellent skin moisturizing and skin barrier strengthening effects on pet skin at a mixing ratio range of 1:0.5 to 2.

[0094] Experimental Example 2: Confirmation of anti-inflammatory, anti-allergy, and skin-soothing effects in companion animals.

[0095] To confirm the anti-inflammatory, anti-allergy, and skin-soothing effects of oat extract and barley extract in companion animals, the expression level of the pro-inflammatory cytokine TNF-α was analyzed.

[0096] 2-1: Cell culture and sample processing

[0097] Canine keratinocytes were cultured in DMEM medium (Dulbecco's modified Eagle's Medium, Gibco 1210-0038) containing 10% fetal bovin serum, and all cultures were performed in a 5% CO2 incubator at 37°C. The cultured cells were treated with 10 μg / mL of Poly I:C and 10 ng / mL of IL-4 to induce inflammation. Thereafter, the cells were treated with Examples 1 to 6 and Comparative Examples 1 to 2 and further cultured for 4 hours. The untreated group served as a negative control. The group treated with 10 μM of AEBSF (4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride) served as a positive control.

[0098] 2-2: Gene expression level analysis

[0099] Gene expression levels were analyzed in the same manner as in Experimental Example 1-2, except that primers for TNF-α were used. Information on the primers used is shown in Table 3 below.

[0100] Gene sequence number direction sequence (5'→3') TNF-α3 forward AGCCAGAGACTCATGTTGTAG4 reverse GGCACTATCAGCTGGTTGTCT

[0101] 2-3: Results

[0102] Figure 3 is a graph showing the relative expression level of TNF-α according to the mixing ratio of oat extract and barley extract in companion dog keratinocytes.

[0103] Figure 4 is a graph showing the relative expression level of TNF-α according to the concentration of a 1:1 mixture of oat extract and barley extract in companion dog keratinocytes.

[0104] As a result, as shown in Fig. 3, the expression of TNF-α in canine keratinocytes increased by treatment with an inflammatory substance. In addition, it was confirmed that the increased expression of TNF-α was significantly reduced by treatment with a 1:1 mixture of oat extract and barley extract (Example 1). The 1:1 mixture of oat extract and barley extract (Example 1) significantly reduced the expression of TNF-α compared to the negative control, oat extract alone (Comparative Example 1), or barley extract alone (Comparative Example 2), thus demonstrating a synergistic effect. In particular, the 1:1 mixture of oat extract and barley extract (Example 1) showed a significantly superior synergistic effect compared to mixtures having other mixing ratios (Examples 2 to 5), and also showed a significantly superior effect of reducing the expression of TNF-α compared to the positive control.

[0105] In addition, as shown in Fig. 4, it was confirmed that a synergistic effect was observed in reducing TNF-α expression when a 1:1 mixture of oat extract and barley extract was used at 1 ppm or more.

[0106] Therefore, it was confirmed that a mixture of oat extract and barley extract has excellent anti-inflammatory and allergy suppressing effects on pet skin at a mixing ratio of 1:0.5 to 2, and thus can be used to soothe pet skin.

Claims

1. A cosmetic composition for moisturizing pet skin or strengthening the skin barrier, comprising a mixture of oat extract and barley extract as an effective ingredient.

2. A cosmetic composition according to claim 1, wherein the oat extract is an ultrasonic extract of oats, and the barley extract is an ultrasonic extract of barley.

3. A cosmetic composition according to claim 1, wherein the mixing weight ratio of the oat extract and the barley extract is 1:0.5 to 2.

4. A cosmetic composition according to claim 1, wherein the oat is any one part selected from the group consisting of oat bran, sprout, kernel, flower, leaf, stem, seed, petiole, straw, bran, and root.

5. A cosmetic composition according to claim 1, wherein the barley is any one part selected from the group consisting of barley whole plant, root, seed, leaf, sprout, stem, and flower.

6. A composition for anti-inflammatory, anti-allergy, or skin soothing for companion animals, comprising a mixture of oat extract and barley extract as an active ingredient.

7. A composition according to claim 6, wherein the oat extract is an ultrasonic extract of oats, and the barley extract is an ultrasonic extract of barley.

8. A composition according to claim 6, wherein the mixing weight ratio of the oat extract and the barley extract is 1:0.5 to 2.

9. A composition according to claim 6, which is an external skin preparation.

10. A composition according to claim 6, wherein the oat is any one part selected from the group consisting of oat forebrain, sprout, kernel, flower, leaf, stem, seed, petiole, straw, bran, and root.

11. A composition according to claim 6, wherein the barley is any one part selected from the group consisting of barley whole plant, root, seed, leaf, sprout, stem, and flower.

12. A pharmaceutical composition for preventing or treating skin inflammatory disease or skin allergic disease in companion animals, comprising a mixture of oat extract and barley extract as an active ingredient.

13. A pharmaceutical composition according to claim 12, wherein the oat extract is an ultrasonic extract of oats, and the barley extract is an ultrasonic extract of barley.

14. A pharmaceutical composition according to claim 12, wherein the mixing weight ratio of the oat extract and the barley extract is 1:0.5 to 2.

15. A pharmaceutical composition according to claim 12, wherein the oat is any one part selected from the group consisting of oat bran, sprout, kernel, flower, leaf, stem, seed, petiole, straw, bran, and root.

16. A pharmaceutical composition according to claim 12, wherein the barley is any one part selected from the group consisting of barley whole plant, root, seed, leaf, sprout, stem, and flower.

Images