Rice female sterility related mutant protein and gene, and molecular marker and use thereof

By introducing recessive mutations of the LOC_Os12g38460 gene, a female sterility retention system was constructed, and combined with seed marking technology, the problem of difficult utilization of female sterility characteristics in the existing technology was solved, and the mechanized seed production and production cost of hybrid rice was achieved.

WO2025131041A1PCT designated stage expired Publication Date: 2025-06-26SHENZHEN INST OF MOLECULAR CROP DESIGN +1
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/140908
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-22
Filing Date
2024-12-20
Publication Date
2025-06-26

AI Technical Summary

Technical Problem

The prior art is difficult to effectively utilize the female sterile characteristics of rice for mechanized seed production of hybrid rice, resulting in high production costs and unstable production.

Method used

By introducing recessive mutations of the LOC_Os12g38460 gene, a female sterile retention line was constructed, and combined with seed marking technology, the reproduction of female sterile lines and the mechanized seed production of hybrid rice was achieved.

Benefits of technology

The stable breeding of female sterile lines and the mechanized seed production of hybrid rice are achieved, which reduces production costs and ensures the purity of hybrid species.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024140908_26062025_PF_FP_ABST
    Figure CN2024140908_26062025_PF_FP_ABST
Patent Text Reader

Abstract

A rice female sterility related mutant protein and gene, and a molecular marker and the use thereof. The 1106th nucleotide of the LOC_Os12g38460 gene of rice is mutated from A to G, so as to obtain a mutant h569 with a phenotype of normal male fertility and female sterility. The phenotype of female sterility of the mutant is formed due to embryo sac abortion because megaspore mother cells thereof cannot undergo meiosis. Thus, a Guang three-line system female sterility maintainer line constructed by using the mutant can solve the problem in breeding of female sterile mutants. The present application can be applied for hybrid rice seed production, thereby avoiding the operations of planting male parents and female parents in separate rows and manually cutting off male parents after pollination, changing current seed production processes which involve complex steps and consume a large amount of time and labor, achieving fully-mechanized seed production which involves mixed planting and harvesting of male and female parents of hybrid rice, and exhibiting important practical significance for agricultural production.
Need to check novelty before this filing date? Find Prior Art

Description

Rice female sterility-related mutant proteins, genes, and their molecular markers and applications

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to a prior application, patent application number 202311795404.X, filed with the State Intellectual Property Office of China on December 22, 2023, entitled “Mutant proteins, genes, and molecular markers related to female sterility in rice, and their applications.” The entire text of this prior application is incorporated herein by reference. Technical Field

[0003] The present invention belongs to the field of biotechnology, and specifically relates to a plant hybrid breeding method, including sterile line propagation and hybrid seed preparation, and more specifically relates to the application of a female sterile site and its mutants in hybrid breeding. Technical Background

[0004] Rice (Oryza sativa) is an important food crop. With the reduction of cultivated land and the increase in population, increasing rice yield is crucial to ensuring food security. Utilizing hybrid vigor is an effective method to increase rice yield. Male sterile lines are key to utilizing hybrid vigor in rice. Currently, hybrid rice production includes the first-generation hybrid rice technology (three-line method), which focuses on cytoplasmic male sterility, and the second-generation hybrid rice technology (two-line method), which focuses on photothermosensitive nuclear male sterility regulated by natural conditions (photoperiod, temperature, etc.). The "three-line method" is restricted by the restoration relationship, has limited pairing freedom, and has small genetic differences between parents, making it difficult to fully utilize the hybrid vigor of rice. The "two-line method" is not restricted by the restoration relationship, allows for free pairing, and simplifies the seed production process with one line for two purposes. However, the fertility of the sterile line is affected by light and temperature conditions, increasing instability and posing significant safety risks to large-scale seed production. In recent years, third-generation hybrid rice technology, centered around environmentally insensitive recessive nuclear male sterility (ENMS), has been successfully established. This technology, based on a male sterile line, introduces fertility-restoring genes, pollen-killing genes, and seed marker genes through transgenic means to create a maintainer line, enabling large-scale propagation of this male sterile line. The environmentally insensitive recessive NMS lines utilized in this third-generation hybrid rice technology offer stable fertility and flexible assortment, overcoming the limitations of the limited assortment of three-line male sterile lines and the climatic constraints of two-line male sterile lines. This represents a development trend in hybrid rice production. Because this third-generation hybrid rice technology significantly improves the utilization of rice heterosis resources, it is also known as the "Guang three-line method."

[0005] Hybrid rice has made a significant contribution to increasing grain production, but to this day, hybrid rice seed production still relies on a large number of complex manual operations, including planting the parent plants in separate rows and manually removing the parent plant after pollination. This results in high hybrid rice seed production costs, which has limited the further development of hybrid rice. The realization of mechanized hybrid rice seed production can reduce the production cost of hybrid seed production and promote the development of modern agriculture.

[0006] There are three main technical approaches to mechanized hybrid rice seed production. The first is the chemical paternalization method, which uses chemical marker genes to mark the sterile line (female parent) or the restorer line (male parent), and sows the hybrid rice parent seeds together. After the female parent is pollinated, the male parent is killed by chemical methods, and the hybrid seeds are harvested mechanized after maturity. The second is the differential trait sorting method, which uses the differences in the color of the parental husk or the size and weight of the seeds to sow and harvest the parental seeds of hybrid rice together. The hybrid seeds and the male parent seeds are separated by screening machinery to achieve full mechanization of the mixed sowing and harvesting of the parents. Both approaches add restrictions to the selection of parents. The third technical approach is to use a female sterile line as the male parent. The female sterile line refers to the material in which the female is completely sterile but the male is fully fertile. It is used as the male parent and the male sterile line as the female parent. The parents can be mixed sown and planted. When flowering, the male parent can transfer normal pollen to the female parent to produce hybrid seeds. The male parent cannot self-pollinate and bear fruit due to abnormal development of the female organs. Therefore, the purity of the hybrid seeds can be guaranteed under the conditions of mixed harvesting, realizing the full mechanized seed production of mixed sowing and harvesting of hybrid rice.

[0007] However, the traditional "three-line" and "two-line" methods fail to address the reproductive challenges of female sterile rice materials, preventing their application in hybrid rice production. The "Guang Three-line Method" is also applicable to the construction of female sterile lines and maintainer lines, making their application in hybrid rice production possible. Three tightly linked expression cassettes are introduced into female sterile mutants to create female sterile maintainer lines: 1) a female fertility restorer gene expression cassette; 2) a pollen inactivation gene expression cassette; and 3) a seed marker gene expression cassette. During self-pollination of the female sterile maintainer line, pollen carrying the transgene is inactive and unable to fertilize. Only pollen grains without the transgene can fertilize the female gametophyte and produce seeds. Seed markers are used to select unmarked seeds from the female sterile line as restorer lines for mechanized hybrid rice seed production, while marked maintainer seeds are used for propagation of the female sterile line. Currently, the most common seed marker gene is red fluorescent protein.

[0008] Compared to the in-depth study of male sterility, research on female sterility genes in rice is still in its infancy due to the difficulty in identifying traits related to female gamete development, the difficulty in obtaining mutants, and the complex internal mechanisms. Discovering more high-quality female sterility mutants and genes regulating female fertility is of great application value for further improving hybrid rice production technology. Summary of the Invention

[0009] One object of the present invention is to provide a gene that causes female sterility phenotype in rice and its encoded protein.

[0010] The gene responsible for the female sterility phenotype in rice is caused by a mutation in the LOC_Os12g38460 gene. This mutation occurs at position 72 of exon 6, from adenine (A) to guanine (G). This mutation also occurs at position 1106 of the CDS (Cellulose Dinucleotide Sequence) sequence, from an A to a G. The protein sequence encoded by this mutant gene also undergoes a mutation from histidine (His) to arginine (Arg) at position 369. Specifically, the genomic sequence after the mutation is shown in SEQ ID NO: 4, the CDS sequence after the mutation is shown in SEQ ID NO: 3, and the protein sequence after the mutation is shown in SEQ ID NO: 2.

[0011] Another object of the present invention is to provide an expression cassette, a recombinant vector or a cell containing the mutant gene or nucleic acid.

[0012] Another object of the present invention is to provide the use of the protein, the mutant gene or nucleic acid, the expression cassette, recombinant vector or cell in breeding.

[0013] Another object of the present invention is to provide a method for obtaining a plant having a female sterile rice phenotype, characterized in that it comprises the following steps:

[0014] 1) making the plant contain the mutant gene or nucleic acid; or

[0015] 2) The plant is made to express the mutant protein.

[0016] Another object of the present invention is to provide a female sterile mutant material for use in hybrid rice seed production, which can be used to cultivate new female sterile lines and serve as the male parent for hybrid rice production. The female sterility trait of this material is caused by a recessive mutation in the LOC_Os12g38460 gene. The mutation site was determined by SIMM, a method for mapping mutant genes based on genome sequencing, to be a mutation from adenine (A) to guanine (G) at position 72 in exon 6 of the gene, i.e., a mutation from A to G (A) at position 1106 of the CDS. 1106 G), the protein sequence encoded by the gene is mutated from His to Arg at position 369. Specifically, the genomic sequence after the mutation is shown in SEQ ID NO: 4, the CDS sequence after the mutation is shown in SEQ ID NO: 3, and the protein sequence after the mutation is shown in SEQ ID NO: 2.

[0017] The present invention provides a female sterile rice mutant h569. Its female sterility is caused by a recessive mutation in the LOC_Os12g38460 gene, specifically manifested by the inability of megaspore mother cells to enter meiosis, resulting in embryo sac abortion. The 72nd nucleotide base in exon 6 of the mutant LOC_Os12g38460 gene mutates from A to G, the 1106th base in the CDS sequence mutates from A to G, and the 369th base in the protein sequence encoded by the gene mutates from His to Arg. Specifically, the genomic sequence after the mutation is shown in SEQ ID NO: 4, the CDS sequence after the mutation is shown in SEQ ID NO: 3, and the protein sequence after the mutation is shown in SEQ ID NO: 2.

[0018] Another object of the present invention is to provide two sets of specific molecular markers for detecting whether the rice female sterility gene is homozygous or not, which are used to identify whether the 72nd nucleotide base on the 6th exon of the LOC_Os12g38460 gene is wild type (adenine A), homozygous mutant (guanine G) or heterozygous mutant.

[0019] Another object of the present invention is to provide a reagent for detecting a molecular marker for the female sterile phenotype of rice for use in plant breeding of the female sterile phenotype of rice; the molecular marker is located at position 72 of the 6th exon of the LOC_Os12g38460 gene, and the nucleotide base is mutated from adenine (A) to guanine (G), wherein the sterile phenotype is a homozygous G mutation; preferably, the detection reagent is an RFLP primer for the Tat I endonuclease recognition site (WGTACW); further preferably, the detection reagent is an HRM primer and probe.

[0020] Specifically, the first set of specific molecular markers uses a primer pair consisting of SEQ ID NO: 5 and SEQ ID NO: 6, and uses the genomic DNA of the rice being tested as a template. A conventional PCR system is used to amplify a 978-bp specific sequence on the LOC_Os12g38460 gene. The amplified product is digested with the restriction endonuclease Tat I, and the digested product is subjected to electrophoresis. The genotype of the tested rice material at this locus is determined based on the electrophoresis detection results. The determination method is as follows: a rice material that cannot be digested by Tat I and still has a 978-bp PCR product is a homozygous mutant; a rice material that shows two bands of 644 bp and 334 bp after digestion is a wild-type; a rice material that shows three bands of 978 bp, 644 bp, and 334 bp after digestion is a heterozygous mutant.

[0021] The primer pair sequences of the first group of specific molecular markers are as follows:

[0022] SEQ ID NO: 5: CAGCGTTATGGAGAGATCGCAAC

[0023] SEQ ID NO: 6: GGATGGTAAGTGCATCAAGTCGTC

[0024] The second set of specific molecular markers used a primer pair consisting of SEQ ID NO: 7 and SEQ ID NO: 8, using the rice genomic DNA as a template. A 150-bp sequence specific to the LOC_Os12g38460 gene was amplified using a conventional PCR system supplemented with the fluorescent dye Evagreen Dye (Biotium). The melting temperature of the amplified product was analyzed using a high-resolution melting curve analyzer, LightScanner 96 (Idaho). The genotype of the rice material at this locus was determined based on the melting curve of the amplified product. The determination method was as follows: a melting temperature of approximately 86.1°C indicated the wild type, a melting temperature of approximately 86.7°C indicated the homozygous mutant, and a melting temperature of approximately 85.7°C indicated the heterozygous mutant.

[0025] The primer pair sequences of the second group of specific molecular markers are as follows:

[0026] SEQ ID NO: 7: GCAGGATTGTGTGGCTCCT

[0027] SEQ ID NO: 8: AAATGCCATCGTGTGAGTAGA

[0028] Another object of the present invention is to provide a method for constructing a female sterile maintainer line of rice, by obtaining a rice variety carrying the mutation site of the LOC_Os12g38460 gene through methods including but not limited to hybridization, gene editing, etc., and by introducing three tightly linked expression cassettes of a female fertility restorer gene, a pollen inactivation gene, and a seed screening marker gene, screening out a single-copy insertion line. Any rice variety can be transformed into a female sterile maintainer line, and self-pollination can produce female sterile line seeds and maintainer line seeds, which can be distinguished by seed markers.

[0029] In a specific embodiment of the present invention, the construction method comprises the following steps: 1) constructing a plant carrying a homozygous mutation (A->G) at position 72 of exon 6 of the LOC_Os12g38460 gene and introducing three tightly linked expression cassettes: a female fertility restorer gene, a pollen inactivation gene, and a seed selection marker gene; 2) selfing the plant obtained in step 1) to obtain seeds, wherein the seeds carrying the selection marker gene are the maintainer line, and the seeds not carrying the selection marker gene are the sterile line;

[0030] Preferably, step 1) comprises obtaining a rice variety carrying the mutation site of the LOC_Os12g38460 gene by methods including but not limited to hybridization, gene editing, etc., introducing three tightly linked expression cassettes of a female fertility restorer gene, a pollen inactivation gene, and a seed selection marker gene, and screening for single-copy insertion lines;

[0031] Preferably, step 1) comprises: 1-1) providing a restorer line, introducing three tightly linked expression cassettes comprising a female fertility restorer gene, a pollen inactivation gene, and a seed selection marker gene; 1-2) using the plant obtained in 1-1) as a female parent, and pollinating with pollen from a plant carrying the homozygous LOC_Os12g38460 gene mutation site; 1-3) screening the F2 generation of 1-2) for plants carrying the homozygous LOC_Os12g38460 gene mutation site and introduced with three tightly linked expression cassettes comprising the female fertility restorer gene, the pollen inactivation gene, and the seed selection marker gene;

[0032] Preferably, step 1) comprises: using a plant or propagation material carrying a homozygous LOC_Os12g38460 gene mutation site as a recipient, introducing three tightly linked expression cassettes comprising a female fertility restorer gene, a pollen inactivation gene, and a seed selection marker gene, wherein the female fertility restorer gene is a wild-type LOC_Os12g38460 gene;

[0033] Preferably, the seed screening marker gene is a red fluorescent marker gene or an endosperm fullness seed marker gene.

[0034] Specifically, the female fertility restorer gene expression cassette refers to an 11kb genomic fragment obtained by amplifying wild-type rice genomic DNA as a template using the specific primer pair shown in SEQ ID NO: 9 and SEQ ID NO: 10, as shown in SEQ ID NO: 11, including the LOC_Os12g38460 gene region, 4.1kb upstream and 2kb downstream sequences.

[0035] SEQ ID NO: 9: CGCCAACAGTCATGGAATCGTTGATGCTCGAGG

[0036] SEQ ID NO: 10: AGGCAGAGAGGAGGATGAAACTGAAATGGTA

[0037] The pollen inactivation gene expression cassette may be composed of the maize pollen-specific promoter PG47, the maize α-amylase gene ZM-AA1 with the amyloplast signal peptide Bt1, and the terminator IN2-1 from the maize genome. The pollen inactivation gene expression cassette may also be composed of the rice pollen-specific promoter LSP6, the rice α-amylase gene OsAA1 with the amyloplast signal peptide ASP1, and the terminator IN2-1 from the maize genome.

[0038] The seed screening marker gene expression cassette can be composed of the barley endosperm-specific expression promoter LTP2, the red fluorescent protein gene DsRed2, and the potato terminator PIN II, which can make the maintainer seeds have a red fluorescent marker and the sterile seeds have no red fluorescence. The seed screening marker gene expression cassette can also be composed of the endosperm-specific expression OsAGPL2 promoter or OsRA16 promoter, an amiRNA sequence specifically targeting the key starch synthesis genes OsAGPL2 or OsAGPS2, and the potato terminator PIN II, which can make the maintainer seeds have an unfilled endosperm and the sterile seeds have a plump endosperm.

[0039] Another object of the present invention is to provide a method for maintaining the purity of a female sterile line and a female sterile maintainer line, by introducing an expression cassette containing a plant selection marker into a plant carrying the three tightly linked expression cassettes of the above female fertility restorer gene, pollen inactivation gene and seed selection marker gene, thereby sorting the self-pollinated progeny of the female sterile maintainer line to distinguish between maintainer line plants and sterile line plants.

[0040] The expression cassette containing the plant selection marker can be a glufosinate-resistance gene expression cassette and a bentazon-sensitivity gene expression cassette, so that the resulting female sterile maintainer line is glufosinate-resistant but bentazon-sensitive. After sorting the selfed seeds of the female sterile maintainer line, glufosinate-resistance and other contaminating plants can be removed by spraying the maintainer seeds with glufosinate after sowing and raising seedlings. Similarly, bentazon can be sprayed with the sterile seeds with bentazon after sowing and raising seedlings to remove contaminating maintainer plants.

[0041] Specifically, the glufosinate-resistance gene expression cassette can be composed of a constitutive promoter such as the maize Ubiquitin promoter or the tobacco mosaic virus CaMV 35S promoter driving a glufosinate-acetyltransferase gene such as the Bar (Bialophos resistance) gene of Streptomyces hygroscopicus or the Pat (Phosphinothricin-acetyl transferase) gene of Streptomyces viride.

[0042] The bentazon-sensitive gene expression cassette may be composed of an RNAi sequence of a rice bentazon-resistant gene CYP81A6 driven by a maize Ubiquitin promoter.

[0043] Specifically, the bentazon-sensitive gene expression cassette refers to a specific fragment of the bentazon-resistant gene CYP81A6 coding region amplified using wild-type rice cDNA as a template, such as the sequence shown in SEQ ID NO: 12-SEQ ID NO: 14, and the specific fragment is inserted into the downstream of the maize Ubiquitin promoter in both forward and reverse directions, with an intron sequence between the forward sequence and the reverse sequence.

[0044] Another object of the present invention is to provide a hybrid rice seed production method. The female sterile line obtained by the above method can be used as the male parent of hybrid rice, and the three-line, two-line or wide three-line male sterile line can be used as the female parent to carry out mixed planting and mixed harvesting mechanized seed production. There is no need to plant the parent parents in separate rows, nor is there any need to remove the male parent after pollination. This can greatly reduce labor input and significantly reduce the production cost of hybrid rice seed production.

[0045] Another object of the present invention is to provide a rice having a female sterile phenotype, wherein the rice expresses a mutation (A->G) at position 72 of exon 6 of the LOC_Os12g38460 gene; or 2) or expresses the mutant protein described in SEQ ID NO: 2;

[0046] Preferably, the rice comprises a homozygous mutation (A->G) at position 72 of exon 6 of the LOC_Os12g38460 gene;

[0047] Preferably, the rice expression further comprises three tightly linked expression cassettes of a female fertility restorer gene, a pollen inactivation gene and a seed selection marker gene, wherein the female fertility restorer gene is the wild-type LOC_Os12g38460 gene;

[0048] Preferably, the rice further expresses an expression cassette containing a plant selection marker.

[0049] The mutant gene, protein, or mutant provided by the present invention exhibits normal male sex and female sterility. Through transgenic means, a female sterility maintenance line is obtained, allowing the female mutant to be bred normally, and then the female sterility trait is used in hybrid rice seed production. If the parents are mixed and planted together during hybrid seed production, the pollination distance between the parents will be shortened, and the outcrossing fruit set rate will be increased. Because the female fertility of the male parent is abnormal and self-pollination is impossible, mechanized production can be achieved, and the purity of the hybrid can be ensured while reducing seed costs. Therefore, the mutant of the present invention has important applications in hybrid rice production.

[0050] Definition of terms:

[0051] Unless otherwise specified, all scientific and technical terms used herein have the meanings generally used in the art. The definitions provided herein are for the purpose of facilitating the understanding of certain terms frequently used herein and are not intended to limit the scope of this disclosure.

[0052] The term "amino acid sequence" is synonymous with the terms "polypeptide," "protein," and "peptide," and is used interchangeably. The conventional one-letter code or the three-letter code for amino acid residues is used, with the amino acid sequence presented in the standard amino to carboxyl terminal orientation (i.e., N→C).

[0053] Sequence identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "sequence identity". When aligned using the CLUSTALW algorithm with preset parameters, a specific sequence has at least a certain percentage of amino acid residues that are identical to the amino acid residues of a specified reference sequence. The preset parameters of the CLUSTALW algorithm are: deletion counts are residues that are not identical to the reference sequence. Deletions occurring at any end are included. For example, a variant 500 amino acid residue polypeptide lacking five amino acid residues at the C-terminus has a sequence identity percentage of 99% (495 / 500 identical residues x 100) relative to the parent polypeptide. Such variants are covered by the language "variants having at least 99% sequence identity with the parent".

[0054] As used herein, the term "about" means ±10%. The terms "comprising," "including," and "having" mean "including but not limited to." As used herein, the term "about" means a value that may deviate from the stated value by up to 1%, more specifically 5%, more specifically 10%, more specifically 15%, and in some cases up to or below 20%, and the deviation range includes integer values ​​and, where applicable, non-integer values ​​to form a continuous range.

[0055] Coding sequence: As used herein, the term "coding sequence" means a polynucleotide sequence that directly specifies the amino acid sequence of its protein product. The boundaries of the coding sequence are generally determined by an open reading frame, which usually begins with the ATG start codon or alternative start codons such as GTG and TTG, and ends with a stop codon such as TAA, TAG, and TGA. The coding sequence can be a DNA, cDNA, RNA, synthetic, or recombinant nucleotide sequence.

[0056] Control sequences: When used herein, the term "control sequences" means nucleic acid sequences required for expression of a polynucleotide encoding a variant of the present invention. Each control sequence can be native (i.e., from the same gene) or exogenous (i.e., from a different gene) to the polynucleotide encoding the variant, or native or exogenous to each other. Such control sequences include, but are not limited to, leaders, polyadenylation sequences, propeptide sequences, promoters, signal peptide sequences, and transcription terminators. At a minimum, control sequences include promoters and transcriptional and translational termination signals. These control sequences can be provided with multiple linkers for the purpose of introducing specific restriction enzyme sites that facilitate ligation of these control sequences to the coding region of the polynucleotide encoding the variant.

[0057] The term "operably linked" means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs the expression of the coding sequence.

[0058] The term "expression" in the context of the present invention includes any step involved in the production of the muteins of the present invention including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification and secretion.

[0059] The principles, construction, and components of the expression cassettes used herein are known to those skilled in the art and are documented in the literature. A typical expression cassette consists of at least one gene to be expressed and a promoter operably linked thereto, which may be capable of mediating transgenic expression of a particular gene in a plant development-specific or tissue-specific manner. The expression cassette may also contain one or more resistance genes that can be used to screen for successfully transformed or transfected cells. Various resistance genes (selectable markers) known to those skilled in the art are known to those skilled in the art. For example, resistance to kanamycin, streptomycin, or ampicillin may be present. The expression cassette may be in the form of a linear nucleic acid, or in the form of a vector or plasmid.

[0060] On the other hand, the present invention relates to a kind of vector, it comprises nucleic acid of the present invention or expression cassette of the present invention.Carrier can be plasmid, cosmid, phage or expression vector, transformation vector, shuttle vector or cloning vector.It can be double-stranded or single-stranded, linear or circular, or it can be transformed prokaryotic or eukaryotic host by being integrated into its genome or chromosome extraterrestrially.Preferably, nucleic acid of the present invention or expression cassette are operably connected with one or more regulatory sequences that can be transcribed and optionally expressed in prokaryotic or eukaryotic host cell.Regulatory sequence, preferably DNA, can be homologous or heterologous to nucleic acid of the present invention.For example, nucleic acid can be controlled by suitable promoter or terminator.

[0061] In addition to the above-described vectors, the present invention also provides a method comprising introducing the vector into a host cell. The vector can be introduced by methods such as conjugation, mobilization, biolistic transformation, Agrobacterium-mediated transformation, transfection, transduction, vacuum infiltration, or electroporation. Such methods and methods for preparing the vectors are well known to those skilled in the art.

[0062] In another aspect, the present invention relates to a host cell comprising a nucleic acid, expression cassette or vector of the present invention. A "host cell" in the present invention can be a prokaryotic cell (e.g., a bacterium) or a eukaryotic cell (e.g., a plant cell or a yeast cell). Preferably, the host cell is an Agrobacterium (e.g., Agrobacterium tumefaciens or Agrobacterium rhizogenes) or a plant cell comprising a nucleic acid, expression cassette or vector of the present invention. Many methods are known to those skilled in the art, such as conjugation or electroporation methods for introducing a nucleic acid, expression cassette or vector of the present invention into Agrobacterium, as well as various transformation methods (biolistic transformation, Agrobacterium-mediated transformation) for introducing a nucleic acid, expression cassette or vector of the present invention into plant cells.

[0063] "Markers" or "molecular markers" are nucleotide sequences used as references or anchor points. Markers used to identify recombination events should be suitable for monitoring differences or polymorphisms in plant populations. For markers, these differences are at the DNA level, for example, polynucleotide sequence differences, such as SSR (simple sequence repeats), RFLP (restriction fragment length polymorphisms), FLP (fragment length polymorphisms) or SNP (single nucleotide polymorphisms). Markers that relate to genetic polymorphisms between different parts of a population can be detected using methods known in the art, for example, DNA sequencing, PCR-based sequence-specific amplification or RFLP assays.

[0064] In another aspect, the present invention relates to transgenic plant cells comprising a nucleic acid according to the invention as a transgene or comprising an expression cassette or vector according to the invention, as well as transgenic plants or parts thereof comprising such transgenic plant cells. Examples of transgenic plant cells or transgenic plants of the aforementioned type are transgenic plant cells or transgenic plants that have been transformed, preferably stably transformed, with a nucleic acid according to the invention, an expression cassette or a vector according to the invention. The transgenic plants or plant cells according to the invention preferably comprise the newly conferred female sterility trait compared to an isogenic wild-type plant that has not been transformed, preferably stably transformed, with a nucleic acid according to the invention, an expression cassette or a vector according to the invention.

[0065] On the other hand, the present invention relates to female sterile plants, and rice varieties carrying the mutation site of the LOC_Os12g38460 gene are obtained by methods including but not limited to hybridization, gene editing, etc., and homozygous mutants are screened.

[0066] On the other hand, the present invention relates to a female sterile plant maintainer line. Rice varieties carrying the mutation site of the LOC_Os12g38460 gene are obtained by methods including but not limited to hybridization, gene editing, etc., and by introducing three tightly linked expression cassettes of a female fertility restorer gene, a pollen inactivation gene, and a seed screening marker gene, single-copy insertion strains are screened out. Any rice variety can be transformed into a female sterile maintainer line, and self-pollination can produce female sterile line seeds and maintainer line seeds, which can be distinguished by seed markers.

[0067] The plant of the present invention may be a monocotyledonous plant of the family rice, preferably rice and other grass plants other than rice (eg, wheat, barley, corn, sugarcane, milo, etc.). BRIEF DESCRIPTION OF THE DRAWINGS

[0068] Figure 1 shows a phenotypic comparison between the wild type (WT) and mutant h569. A. Plant; B. Spike; C. Spikelet with the inner and outer lemmas removed; D. Pistil; E. Fruit set in osnp1 and h569 (osnp1 was pollinated with wild-type HHZ and h569 pollen, while h569 was pollinated with wild-type HHZ pollen); F. Pollen I2-KI staining; G. Pollen tube growth. Scale bars: A = 10 cm, B = 1 cm, C = 1 mm, D = 1 mm, E = 1 cm, F = 100 μm, G = 1 mm.

[0069] Figure 2 shows the embryo sac development process of wild-type HHZ (WT) and h569 mutant.

[0070] Figure 3 is a schematic diagram of the SIMM positioning of the mutant gene and the gene structure, mutation site, and complementary fragment.

[0071] Figure 4 is a diagram of RFLP molecular marker identification of the LOC_Os12g38460 gene mutation site in the h569 mutant. The first lane is the GL10000 DNA marker, W is the wild type, H is the heterozygous mutant, and M is the homozygous mutant.

[0072] Figure 5 is an HRM molecular marker identification diagram of the LOC_Os12g38460 gene mutation site in the h569 mutant, where W represents the wild type, H represents the heterozygous mutant, and M represents the homozygous mutant.

[0073] FIG6 shows the phenotypes of transgenic complementation-positive (COM+) and -negative (COM-) plants of the h569 homozygous mutant, wherein scale bars: A=5 cm, B=1 cm.

[0074] FIG. 7 is a schematic diagram of a rice female sterility maintainer vector using a red fluorescent seed marker.

[0075] Figure 8 shows the phenotypes of rice female sterile maintainer lines and their plants using red fluorescent seed markers. A. HR1607-2A is a female sterile maintainer plant grown from non-fluorescent seeds, and HR1607-2B is a female sterile maintainer plant grown from red fluorescent seeds. B. Ear morphology of the HR1607-2B female sterile maintainer under bright field (BF) and red fluorescent filter (RFP). C. Pollen I2-KI staining of the HR1607-2A and HR1607-2B female sterile maintainers. D. Pollen staining ratio of the HR1607-2B female sterile maintainer. E. Red fluorescence ratio of self-pollinated seeds of the HR1607-2B female sterile maintainer. Scale bars: A = 5 cm, B = 1 cm, C = 100 μm.

[0076] FIG9 is a schematic diagram of a rice female sterility maintainer vector using endosperm fullness seed markers.

[0077] Figure 10 shows the phenotypes of rice female sterile maintainer lines and their female sterile plants marked by endosperm plumpness seeds, among which AF-B-H569A is a female sterile maintainer plant grown from plump seeds, and FB-H569B is a female sterile maintainer plant grown from unfilled seeds; pollen I2-KI staining of BF-B-H569A female sterile maintainer line and FB-H569B female sterile maintainer line; pollen staining ratio of CF-B-H569B female sterile maintainer line; plump-to-unfilled ratio of self-pollinated seeds of DF-B-H569B female sterile maintainer line; stratification of self-pollinated seeds of EF-B-H569B female sterile maintainer line in water; morphology of seeds floating on the upper layer and seeds sinking to the bottom of water after shelling in FGH.E.

[0078] FIG11 shows the growth of the selfed progeny of the FB-H569B female sterile maintainer line 10 days after spraying 1× the recommended concentration of glufosinate at the seedling stage.

[0079] Figure 12 shows a schematic diagram of the T-DNA vector expressing the bentazon-sensitive gene and analysis of its T0-generation effects. A. Schematic diagram of the Ubi:BTZi vector T-DNA; B. Rice protoplast analysis of the CYP81A6 gene inhibition effects of five Ubi:BTZi vectors; CE. Transformation of Wuyunjing 7 with Ubi:BTZi-1 and Ubi:BTZi-3 vectors, positive T0-generation transgenic plants (C), CYP81A6 gene expression assay (D), and bentazon-treated plants (E). Neg: transgenic-negative plants; T0-S: bentazon-sensitive plants. F. Growth of T1-generation Wuyunjing 7 transformed with Ubi:BTZi-1 and Ubi:BTZi-3 vectors five days after spraying with 2× the recommended bentazon concentration.

[0080] Figure 13 shows the single plant yield of the F1 generation obtained by hybridizing an F4 generation genetically stable female sterile line HR1607A1 with eight male sterile lines, compared with the single plant yield of the control variety Y Liangyou 3089 and the hybrid F1 generation of the three-line sterile line and the conventional restorer line in the same period.

[0081] Figure 14 shows a schematic diagram of the seed production plots for hybridization using the female sterile line HR1607A1 as the male parent and the male sterile line Zhenxing 1A. The hollow circles represent the female parent, Zhenxing 1A; the dark-filled solid circles represent the first-stage male parent, sown simultaneously with the female parent; and the light-filled solid circles represent the second-stage male parent, sown six days later than the female parent. DETAILED DESCRIPTION

[0082] The present invention will be further described below with reference to specific embodiments for better understanding, but the scope of the present invention is not limited thereby.

[0083] Example 1: Phenotypic Analysis of Rice Female Sterility Mutants

[0084] Screening a library of EMS-induced Huanghuazhan (HHZ) mutants yielded a sterile mutant, designated h569. This mutant exhibited normal vegetative growth (Figure 1A), normal anther and pistil morphology (Figures 1C-D), and no significant differences in pollen I2-KI staining compared to the wild type (Figure 1F), indicating normal pollen development. However, the plant ultimately exhibited complete fruitlessness (Figure 1B). Pollination of the mutant with wild-type HHZ pollen resulted in the h569 mutant being fruitless. In contrast, the male-sterile control osnp1-1, when pollinated with either wild-type HHZ or h569 pollen, exhibited outcrossing fruiting rates of 82.1% and 79.5%, respectively (Figure 1E), indicating that h569 exhibited normal pollen fertility and its fruitlessness was due to abnormal female fertility.

[0085] To understand the cause of the abnormal female fertility of the h569 mutant, the h569 mutant was pollinated with wild-type HHZ pollen, and pollen germination and pollen tube growth in the pistil were observed. Consistent with the self-pollinated wild-type, pollen in the h569 mutant germinated normally on the stigma two hours after pollination, and the pollen tubes elongated normally until they entered the micropyle of the ovule (Figure 1G). Furthermore, the development of the embryo sac of the wild-type and h569 mutants was observed under laser confocal microscopy. In the wild-type, the megaspore mother cell is clearly visible, undergoing two meiotic divisions to produce tetrads (Figures 2A-C). Subsequently, the three daughter cells at the top near the micropyle gradually degenerate and disappear, and the remaining one develops into a functional megaspore (Figure 2D), which undergoes three rounds of mitosis to form a mature seven-cell, eight-nucleate embryo sac (Figure 2E). However, the megaspore mother cells of the h569 mutant failed to initiate meiosis to form functional megaspores, and their embryo sac eventually formed a solid structure (Figure 2F-J). These results indicate that the abnormal development of the megaspore mother cells of the h569 mutant leads to female sterility in this plant.

[0086] Example 2: Cloning of the h569 mutant gene

[0087] When the h569 mutant was hybridized with the wild-type Huang Huazhan, all F1 plants showed normal fertility, and fertility segregation occurred in the F2 population. Statistics showed that the ratio of fertile plants to sterile plants met the segregation ratio of 3:1 (211:72), indicating that the female sterility phenotype of the h569 mutant was caused by a recessive mutation in a single nuclear gene.

[0088] To clone the mutant gene responsible for the female sterility phenotype of mutant h569, we extracted DNA from leaves of 30 typical sterile plants in the F2 segregating population, mixed them in equal amounts, and then subjected them to genomic resequencing. The resequencing data were further analyzed using the SIMM method (Yan et al., Simultaneous identification of multiple causal mutations in rice. Frontiers in Plant Science, 2017, 7:2055). A candidate locus on chromosome 12 was identified, located in exon 6 of the LOC_Os12g38460 gene (Figure 3). This site causes a mutation from A to G at position 1106 of the gene's CDS, and a mutation from histidine to arginine at position 369 of the translated mutant protein's amino acid sequence. Specifically, the genomic DNA sequence of the mutant gene is shown in SEQ ID NO:4, the CDS sequence is shown in SEQ ID NO:3, and the amino acid sequence is shown in SEQ ID NO:2.

[0089] Example 3: RFLP markers of the h569 mutation site

[0090] Because the h569 mutant has a mutation in exon 6 of the LOC_Os12g38460 gene (from AGTACA to AGTACG), it loses the Tat I endonuclease recognition site (WGTACW), while this restriction site exists in the wild type. Therefore, a pair of specific primers were designed upstream and downstream of this site. PCR amplified a 978-bp sequence of the LOC_Os12g38460 gene, representing positions 980 to 1957 of SEQ ID NO: 4. The amplified product was digested with Tat I and electrophoresed to distinguish different genotypes. The specific primers are shown below:

[0091] h569-Tag-978-F: CAGCGTTATGGAGAGATCGCAAC (shown in SEQ ID NO: 5)

[0092] h569-Tag-978-R: GGATGGTAAGTGCATCAAGTCGTC (shown in SEQ ID NO: 6)

[0093] This primer combination was used to amplify rice genomic DNA as a template. The PCR amplification system consisted of 1 μL DNA, 5 μL 2× Glorla Nova HS (ABclonal), 0.2 μL 10 μM h569-Tag-978-F primer, 0.2 μL 10 μM h569-Tag-978-R primer, and 3.6 μL ddH₂O, for a total volume of 10 μL. The PCR program included pre-denaturation at 98°C for 3 minutes, followed by 35 cycles of denaturation at 98°C for 10 seconds, annealing at 59°C for 30 seconds, and extension at 72°C for 30 seconds, followed by a post-extension at 72°C for 5 minutes.

[0094] After PCR amplification, add 1.5 μL of 10× Tango Buffer, 0.2 μL of Tat I enzyme (ThermoFisher), and 3.3 μL of ddH₂O to the PCR product to a total volume of 15 μL. Incubate at 65°C for at least 1 hour, and analyze by electrophoresis. The homozygous mutant (M) is resistant to Tat I digestion and remains at 978 bp. The wild-type (W) exhibits a double band pattern of 644 bp and 334 bp after digestion. The heterozygous mutant (H) exhibits a triple band pattern of 978 bp, 644 bp, and 334 bp (Figure 4).

[0095] Example 4: HRM labeling of the h569 mutation site

[0096] Identifying the h569 mutation site using RFLP markers requires enzyme digestion and electrophoresis after PCR amplification, which is time-consuming for testing large numbers of samples. In a double-stranded DNA, there are two hydrogen bonds between AT base pairs and three hydrogen bonds between GC base pairs. Therefore, the mutation of an AT base pair to a GC base pair results in a slight difference in the melting temperature of a specific DNA fragment between the wild-type and homozygous mutants. This difference can be detected using high-resolution melting curve analysis (HRM). Utilizing this principle, a pair of specific primers were designed upstream and downstream of the A-to-G mutation occurring in the sixth exon of the LOC_Os12g38460 gene in the h569 mutant. PCR was used to amplify a 150-bp specific sequence within the LOC_Os12g38460 gene, i.e., positions 1553 to 1702 of SEQ ID NO: 4. The amplified product was subjected to melting curve analysis using a LightScanner 96 (Idaho). The specific primers are shown below:

[0097] H569-12g38460HRMF:GCAGGATTGTGTGGCTCCT (shown in SEQ ID NO: 7)

[0098] H569-12g38460HRMR:AAATGCCATCGTGTGAGTAGA (shown in SEQ ID NO: 8)

[0099] This primer combination was used to amplify rice genomic DNA as a template. The PCR amplification system consisted of 1 μL DNA, 1 μL 10× PCR Buffer, 0.1 μL 2.5 mM dNTPs, 0.1 μL 10 μM H569-12g38460HRMF primer, 0.1 μL 10 μM H569-12g38460HRMR primer, 0.1 μL 20× Evagreen Dye (Biotium), 0.1 μL rTaq enzyme, and 7.5 μL ddH₂O (total volume 10 μL). The PCR program was as follows: 94°C pre-denaturation for 3 minutes; 40 cycles of 94°C denaturation for 30 seconds, 58°C annealing for 30 seconds, and 72°C extension for 10 seconds; 72°C post-extension for 1 minute; 95°C denaturation for 1 minute; and annealing at 25°C.

[0100] After PCR, take a clean Bio-Rad Blackwell 96-well plate and add 1 μL of low-temperature internal standard (melting temperature around 59°C) to each well to correct for systematic deviations between wells and improve detection accuracy. The sequence of the low-temperature internal standard is as follows:

[0101] HRM-LF:TTAAATTATAAAATATTTATAATATTAATTATATATATATAAATATAATA (SEQ ID NO: 19)

[0102] HRM-LR: TATTATATTTATATATATATAATTAATATTATAAATATTTTATAATTTAA (SEQ ID NO: 20)

[0103] Dissolve the HRM-LF and HRM-LR primer powders in ddH2O to 10 μM and prepare the mixture according to the ratio of HRM-LF:HRM-LR:saturated NaCl solution:ddH2O=1:1:1:7 (v / v). Mix well, heat at 95°C for 5 minutes, cool naturally to room temperature, and then divide into aliquots and store at -20°C until use.

[0104] The PCR products were transferred to the aforementioned Bio-Rad Blackwell 96-well plate, and fluorescence signals between 53°C and 98°C were collected on a LightScanner 96 instrument. The low-temperature internal standard melting temperature of each well was calibrated to a consistent temperature, and the melting temperature of the amplified products was analyzed. The genotype of each sample at that locus was determined based on the melting curve typing of the amplified products. The results showed that the melting temperature of the wild-type (W) amplified product was around 86.1°C, the melting temperature of the homozygous mutant (M) amplified product was around 86.7°C, and the melting temperature of the heterozygous mutant (H) amplified product was around 85.7°C. The melting curve peaks of the three were very different (Figure 5), making it more efficient for identifying the genotype of a large number of samples than RFLP markers.

[0105] Example 5: Verification of the h569 mutant gene

[0106] To confirm the linkage between the A-to-G mutation in exon 6 of the LOC_Os12g38460 gene and the h569 mutant phenotype, 275 sterile and 797 fertile plants from the F2 generation segregating population were genotyped using the aforementioned HRM markers. The results showed that all 275 sterile plants were homozygous for the mutation, while the ratio of heterozygous genotypes (533 plants) to wild-type genotypes (264 plants) was approximately 2:1, indicating that the mutation is completely linked to the sterility phenotype.

[0107] To further examine the biological function of the LOC_Os12g38460 gene, the following specific primer pair was designed to amplify an 11-kb genomic fragment containing the gene from wild-type HHZ, as shown in SEQ ID NO: 11, including the LOC_Os12g38460 gene region, 4.1 kb upstream, and 2 kb downstream sequences ( FIG3 ).

[0108] SEQ ID NO: 9: CGCCAACAGTCATGGAATCGTTGATGCTCGAGG

[0109] SEQ ID NO: 10: AGGCAGAGAGGAGGATGAAACTGAAATGGTA

[0110] To ligate the 11 kb genomic fragment into the binary transformation vector pCAMBIA1300 using InFusion homologous recombination technology (TaKaRa), homology arm sequences were added to the primer pair described above:

[0111] 1300-38460-F-EcoR I: CCATGATTACGAATTCCGCCAACAGTCATGGAATCGTTGATGCTCGAGG (SEQ ID NO: 17)

[0112] 1300-38460-R-Hind III: GGCCAGTGCCAAGCTTAGGCAGAGAGGAGGATGAAACTGAAATGGTA (SEQ ID NO: 18)

[0113] The amplified products of 1300-38460-F-EcoR I and 1300-38460-R-Hind III were ligated into the pCAMBIA1300 vector via the EcoR I and Hind III restriction sites and back-completioned into the h569 mutant. Transgenic plants (Com+) in the homozygous mutant background showed normal fruit set (Figure 6). These results indicate that the LOC_Os12g38460 gene is indeed the gene controlling the female sterility phenotype in h569.

[0114] Example 6: Construction of Rice Female Sterility Maintainer Line Using Red Fluorescent Seed Markers

[0115] First, a two-T-DNA binary transformation vector, GSX-H569-Red, was constructed, as shown in Figure 7. The first T-DNA carries an expression cassette for the neomycin phosphotransferase gene NPTII, driven by the CaMV35S promoter, for use in plant transformation to screen for resistant calli. The second T-DNA carries three tightly linked expression cassettes: a fertility restorer gene, a pollen inactivation gene, and a red fluorescent marker gene. The fertility restorer gene expression cassette consists of the LOC_Os12g38460 gene region (shown in SEQ ID NO:11), along with 4.1 kb upstream and 2 kb downstream sequences. The pollen inactivation gene expression cassette consists of the maize pollen-specific promoter PG47, the maize α-amylase gene ZM-AA1 with an amyloplast signal peptide, and the maize terminator IN2-1. The red fluorescent marker gene expression cassette consists of the barley endosperm-specific promoter LTP2, the red fluorescent protein gene DsRed2, and the potato terminator PIN II.

[0116] The sequence-verified GSX-H569-Red plasmid was transformed into Agrobacterium tumefaciens AGL0 and used to infect the rice restorer line Zhongzhong Hui 1607. Pollen from the resulting T0 generation transgenic-positive plants was stained with I2-KI, and a single plant with a ratio of dyeable to non-dyed pollen close to 1:1 was selected, indicating a single-copy insertion of the second T-DNA and the expected pollen-killing effect of the pollen-inactivating gene expression cassette. This single plant was used as the female parent and inoculated with pollen from an h569 mutant plant. The F2 generation was screened for plants homozygous for the h569 mutation, a single-copy insertion of the second T-DNA, and lacking the first T-DNA. These self-pollinated progenies were further analyzed.

[0117] Seeds obtained from the self-pollination of the above-mentioned individual plants were divided into non-fluorescent seeds (denoted as HR1607-2A) and red fluorescent seeds (denoted as HR1607-2B). Plants grown from the non-fluorescent seeds had a phenotype similar to that of the h569 mutant, with normal vegetative growth but no seed set (Figure 8A). Pollen stained normally (Figure 8C), indicating a female sterile line. Plants grown from the red fluorescent seeds set seed normally (Figure 8A), with half of their pollen staining normally and half staining abnormally (i.e., aborted) (Figure 8CD). Half of the seeds produced were red fluorescent and half were non-fluorescent (Figure 8BE), indicating a female sterile maintainer line. These phenotypes indicate that the second T-DNA is stably inserted into the rice genome as a single copy. The fertility restorer gene expression cassette it carries can effectively restore the female sterility phenotype of the h569 mutation. The pollen inactivation gene expression cassette can make the pollen grains carrying the transgene aborted, effectively ensuring that the ratio of sterile line to maintainer line seeds in the offspring seeds is 1:1. The red fluorescent marker gene expression cassette can effectively distinguish between sterile line seeds and maintainer line seeds.

[0118] Example 7: Construction of Rice Female Sterility Maintainer Line Using Endosperm Fullness Seed Marker

[0119] A single T-DNA binary transformation vector, FB-H569, was constructed, as shown in Figure 9. This T-DNA carries four tightly linked expression cassettes: a glufosinate-resistance gene, a fertility restorer gene, a pollen inactivation gene, and an endosperm plumpness seed marker gene. The glufosinate-resistance gene expression cassette consists of the CaMV 35S promoter driving the Bar gene; the fertility restorer gene expression cassette consists of the LOC_Os12g38460 gene region shown in SEQ ID NO: 11, along with 4.1 kb upstream and 2 kb downstream sequences; the pollen inactivation gene expression cassette consists of the rice pollen-specific promoter LSP6, the rice α-amylase gene OsAA1 with the amyloplast signal peptide ASP1, and the maize terminator IN2-1; and the endosperm plumpness seed marker gene expression cassette consists of the endosperm-specific OsAGPL2 promoter, an amiRNA sequence specifically targeting the key starch biosynthesis gene OsAGPL2, and the potato terminator PIN II.

[0120] The sequencing-verified FB-H569 plasmid was transformed into Agrobacterium tumefaciens AGL0 and used to infect callus induced from selfed seeds of the h569 heterozygous mutant. The Bar gene expression cassette was used to screen for glufosinate-resistant calli. The resulting T0 generation plants were genotyped at the h569 mutation site and subjected to I2-KI staining of pollen. Individual plants homozygous for the h569 mutation site and with a near-1:1 ratio of dyeable to non-dyed pollen were selected for further analysis of their selfed progeny.

[0121] Twelve transgenic plants isolated from the T1 generation that were homozygous for the h569 mutation (designated FB-H569B, the female sterile maintainer line) showed no significant differences in growth and fruiting compared to the wild type. Transgenic-negative plants (designated FB-H569A, the female sterile line) exhibited phenotypes consistent with the h569 mutant (Figure 10A). This indicates that the T-DNA insertion had no adverse effects on either vegetative or reproductive growth, and that the fertility-restoring gene expression cassette carried by the plants effectively restored the female sterility phenotype of the h569 mutation. Pollen I2-KI staining revealed a ratio of viable to non-viable pollen of approximately 1:1 in these plants (Figure 10BC), demonstrating that the T-DNA insertion was a single-copy insertion and that the pollen-inactivating gene expression cassette carried by the plants was stably inherited. When seeds of self-pollinated FB-H569B were soaked in water and stirred, they quickly separated into two layers (Figure 10E). The seeds floating on the upper layer had a less plump endosperm and were female sterile maintainer seeds, while the seeds sinking to the bottom had a plump endosperm and were female sterile seeds (Figures 10F-G-H). The ratio of these two layers was approximately 1:1 (Figure 10D), demonstrating that the endosperm plumpness seed marker gene expression cassette can easily and effectively distinguish sterile and maintainer seeds. To test the efficacy of the glufosinate-resistance gene expression cassette, self-pollinated FB-H569B seeds were sown and raised to the three- to four-leaf stage. They were then sprayed with 1× the recommended concentration of glufosinate. Ten days after spraying, nearly half of the plants had completely died, while the other half survived and resumed normal growth (Figure 11). DNA was extracted from the surviving plants and identified as maintainer plants, indicating that the glufosinate-ammonium resistance gene expression cassette can accurately screen maintainer plants at the seedling stage, effectively avoiding the possibility of maintainer plants being mixed with sterile lines, weedy rice, or other field weeds during the breeding process.

[0122] Example 8: Bentazone-sensitive gene expression cassette

[0123] First, RNAi vectors targeting the bentazon-resistance gene were constructed. Specifically, five specific fragments located in the coding region of the rice bentazon-resistance gene CYP81A6, represented by SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, and SEQ ID NO:16, were inserted into the Spe I restriction site of the pUBI-intron vector in the forward orientation and the BamH I restriction site of the vector in the reverse orientation, respectively. Five RNAi vectors were constructed, designated Ubi:BTZi-1 to Ubi:BTZi-5 (Figure 12A). The forward and reverse sequences of the RNAi vectors are separated by an intron sequence. Driven by the maize Ubiquitin promoter, these vectors can be expressed in rice to form double-stranded RNA, which is cleaved by the Dicer enzyme to form 21-25 base pair siRNAs, thereby mediating the degradation of the CYP81A6 target gene mRNA.

[0124] SEQ ID NO: 12:

[0125] SEQ ID NO: 13:

[0126] SEQ ID NO: 14:

[0127] SEQ ID NO: 15:

[0128] SEQ ID NO: 16:

[0129] These five vectors were transformed into rice protoplasts, and the expression levels of the target genes were preliminarily compared. The results showed that, except for Ubi:BTZi-5, the other four vectors could effectively inhibit the expression of the target gene CYP81A6, and compared with the control Ubi:BTZi-2 (see Chinese patent application CN202111643733.3), Ubi:BTZi-1 and Ubi:BTZi-3 had better inhibitory effects (Figure 12B). Therefore, the Ubi:BTZi-1 and Ubi:BTZi-3 vectors were respectively transformed into Wuyunjing No. 7, and its T0 seedlings were sprayed with bentazon. As expected, the expression level of the target gene CYP81A6 in the transgenic positive plants was significantly reduced, and the plants were sensitive to bentazon (Figures 12C-E). Selfed progenies of single-copy transgenic-positive plants of Ubi:BTZi-1 and Ubi:BTZi-3 were further planted and sprayed with 2× the recommended concentration of bentazon at the three- to four-leaf stage. Five days later, approximately 75% of the plants died, while the remaining 25% remained unaffected (Figure 12F). DNA was extracted from the surviving plants and identified as transgene-negative. These results demonstrate that an RNAi expression cassette carrying the CYP81A6 gene, also known as a bentazon-sensitive gene expression cassette, can sensitize rice plants to bentazon. Introducing this expression cassette into a female sterile maintainer line can render the maintainer sensitive to bentazon and the female sterile line resistant to bentazon. Therefore, spraying bentazon during the raising of female sterile lines can remove contaminated maintainer seeds, effectively preventing transgenic contamination in hybrid rice seed production.

[0130] Example 9: Mixed Planting and Harvesting of Female and Male Sterile Lines for Seed Production

[0131] As described in Example 6, the female sterile maintainer line HR1607-2B using red fluorescent seed markers was bred from the hybrid offspring of the rice restorer line Zhonghui 1607 and the mutant h569 in the Huanghuazhan background. In the F4 generation, a genetically stable female sterile line HR1607-A1 was obtained, which was used as the male parent for hybridization with eight male sterile lines, including five three-line sterile lines, one two-line sterile line, and two Guang three-line sterile lines. The results showed that the single-plant yield of the F1 generation of the eight hybrid combinations was higher than that of the control varieties planted at the same time ( Figure 13 ), indicating that the female sterile line created by carrying the homozygous LOC_Os12g38460 gene mutation site has great application potential as a restorer line.

[0132] To analyze the practical application of female sterile lines in hybrid rice seed production, HR1607-A1 was used as the male parent, and the Guangsan-line male sterile line Zhenxing 1A was used as the female parent. Three plots were established: conventional separate-row planting plots with a male-to-female ratio of 1:6, mixed planting plots with a ratio of 1:6, and mixed planting plots with a ratio of 1:8 (Figure 14), with three replicates per plot. An appropriate amount of "920" (gibberellic acid) was sprayed early in the heading phase to relieve the female parent from panicle encapsulation and raise the male parent's plant height. During the peak flowering phase, artificial pollination was performed two to three times daily, with intervals of approximately 20 minutes between each application. This was continued for approximately 10 days, until the flowering period was nearing its end. Each plot was individually harvested, and seed yield was calculated. Under identical conditions, the three 1:8 mixed planting plots had the highest average seed yield, followed by the 1:6 mixed planting plot, while the traditional 1:6 separate-row planting plot had the lowest average seed yield (Table 1). This result shows that the seed production yield of using female sterile lines as the male parent and mixed planting with male sterile lines is not inferior to the traditional parent-parent row planting method. The mixed planting of parents can greatly reduce the labor input of manual row transplanting. The female sterility of the male parent will not produce seeds mixed into the hybrid seeds, and there is no need to cut off the male parent after pollination, which can greatly reduce the labor cost of hybrid rice seed production.

[0133] Table 1 Seed production plot yield (kg) of hybrids between the female sterile line HR1607-A1 and the male sterile line Zhenxing 1A

[0134] Example 10: Analysis of polymorphism of rice LOC_Os12g38460 gene

[0135] An analysis of over 1,000 rice accessions in the RiceVarMap database revealed multiple synonymous SNPs and five non-synonymous SNPs within the coding region of the LOC_Os12g38460 gene, as well as one indel that alters the amino acid sequence by ±1 or +2. The indels at the beginning of the coding region and the non-synonymous SNPs at the end primarily contribute to differences between indica and japonica rice varieties.

[0136] The SNP polymorphism list is as follows:

[0137] The list of InDel polymorphisms is as follows:

[0138] Sequence Listing

[0139] SEQ ID NO: 1 Wild-type protein sequence 1163aa

[0140] SEQ ID NO: 2 mutant protein sequence 1163aa

[0141] SEQ ID NO: 3 mutant CDS sequence 3489 bp

[0142] SEQ ID NO: 4 mutant genomic sequence 4948 bp

[0143] SEQ ID NO: 5 h569-Tag-978-F 23 bp

[0144] SEQ ID NO: 6 h569-Tag-978-R 24 bp

[0145] SEQ ID NO: 7 H569-12g38460HRMF 19bp

[0146] SEQ ID NO: 8 H569-12g38460HRMR 21bp

[0147] SEQ ID NO: 9 1300-38460-F

[0148] SEQ ID NO: 10 1300-38460-R

[0149] SEQ ID NO: 11 complementary fragment 11116 bp

[0150] SEQ ID NO: 12:

[0151] SEQ ID NO: 13:

[0152] SEQ ID NO: 14:

[0153] SEQ ID NO: 15:

[0154] SEQ ID NO: 16:

[0155] SEQ ID NO: 17 1300-38460-F-ECORI

[0156] SEQ ID NO:18 1300-38460-R-HIND III

[0157] SEQ ID NO:19 HRM-LF

[0158] SEQ ID NO:20 HRM-LR

Claims

1. A mutant protein causing female sterility phenotype in rice, characterized in that: The amino acid sequence of the mutant protein corresponds to the amino acid sequence of the wild-type protein, in which position 369 is mutated from His to Arg, wherein the amino acid sequence of the wild-type protein is as shown in SEQ ID NO: 1 or has at least 99% sequence identity with SEQ ID NO:

1.

2. The method of claim 1, wherein the amino acid sequence of the mutant protein is as shown in SEQ ID NO: 2 or has at least 99% sequence identity with SEQ ID NO:

2.

3. A mutant gene or nucleic acid causing female sterility phenotype in rice, characterized in that: The genomic nucleotide sequence is shown in SEQ ID NO:4, and the CDS sequence is shown in SEQ ID NO:

3.

4. An expression cassette, a recombinant vector or a cell, which expresses the mutant protein according to claim 1 or contains the mutant gene or nucleic acid according to claim 3.

5. Use of the mutant protein according to claim 1 or 2, the mutant gene or nucleic acid according to claim 3, the expression cassette, recombinant vector or cell according to claim 4, or a plant expressing the mutant protein according to claim 1 or 2 and comprising the mutant gene or nucleic acid according to claim 3, or the expression cassette, recombinant vector or cell according to claim 4 in breeding.

6. The use according to claim 5, comprising using a plant with a rice female sterility phenotype carrying a homozygous mutation (A->G) at position 72 of the 6th exon of the LOC_Os12g38460 gene as a male parent, and hybridizing it with a three-line, two-line or wide three-line male sterile line female parent to produce a hybrid.

7. A molecular marker for detecting whether a rice female sterility gene is homozygous or not, characterized in that: The molecular marker is selected from the following first group or second group: the nucleotide sequence of the first group is shown as SEQ ID NO: 5 and SEQ ID NO: 6, or the nucleotide sequence of the second group is shown as SEQ ID NO: 7 and SEQ ID NO:

8.

8. A method for obtaining a plant having a female sterile phenotype of rice, characterized in that: The steps include: 1) causing the plant to contain a mutation (A->G) at position 72 of exon 6 of the LOC_Os12g38460 gene; or 2) causing the plant to express the amino acid sequence of SEQ ID NO: 2 or a mutant protein having an amino acid sequence having at least 99% sequence identity with SEQ ID NO: 2; Preferably, the method further comprises the step of screening homozygous mutant plants.

9. A method for constructing a female sterility maintenance line, characterized in that: The method comprises the following steps: 1) constructing a plant carrying a homozygous mutation (A->G) at position 72 of the sixth exon of the LOC_Os12g38460 gene and introducing three tightly linked expression cassettes of a female fertility restorer gene, a pollen inactivation gene and a seed selection marker gene; 2) self-pollinating the plant obtained in step 1) to obtain seeds, wherein the seeds carrying the selection marker gene are the maintainer line, and the seeds not carrying the selection marker gene are the sterile line; Preferably, step 1) comprises obtaining a rice variety carrying the mutation site of the LOC_Os12g38460 gene by methods including but not limited to hybridization, gene editing, etc., introducing three tightly linked expression cassettes of a female fertility restorer gene, a pollen inactivation gene, and a seed selection marker gene, and screening out a strain with a single copy insertion; Preferably, step 1) comprises: 1-1) providing a restorer line, introducing three tightly linked expression cassettes of a female fertility restorer gene, a pollen inactivation gene and a seed screening marker gene; 1-2) using the plant obtained in 1-1) as a female parent, and pollinating with pollen of a plant carrying a homozygous LOC_Os12g38460 gene mutation site; 1-3) screening the F2 generation of 1-2) for plants carrying a homozygous LOC_Os12g38460 gene mutation site and introduced with three tightly linked expression cassettes comprising a female fertility restorer gene, a pollen inactivation gene and a seed screening marker gene; Preferably, step 1) comprises: using a plant or propagation material carrying a homozygous LOC_Os12g38460 gene mutation site as a recipient, introducing three tightly linked expression cassettes comprising a female fertility restorer gene, a pollen inactivation gene and a seed selection marker gene, wherein the female fertility restorer gene is a wild-type LOC_Os12g38460 gene; Preferably, the seed screening marker gene is a red fluorescent marker gene or an endosperm fullness seed marker gene.

10. A method for constructing a female sterile maintainer line as described in claim 9, further comprising introducing an expression cassette containing a plant selection marker, thereby sorting the self-pollinated progeny of the female sterile maintainer line to distinguish between maintainer line plants and sterile line plants; preferably, the expression cassette containing the plant selection marker can be a glufosinate resistance gene expression cassette and a bentazon sensitivity gene expression cassette.

11. A method for maintaining a female sterile line and maintaining the purity of a female sterile line, characterized in that: The female sterile maintainer line as described in claim 9 is used as a recipient, and an expression cassette containing a plant selection marker is introduced to sort the self-pollinated progeny of the female sterile maintainer line to distinguish between maintainer line plants and sterile line plants; preferably, the expression cassette containing the plant selection marker can be a glufosinate resistance gene expression cassette and a bentazon sensitivity gene expression cassette.

12. Use of a reagent for detecting a molecular marker for a female sterile phenotype of rice in plant breeding for a female sterile phenotype of rice; the molecular marker is located at position 72 of the 6th exon of the LOC_Os12g38460 gene, and the nucleotide base mutates from adenine (A) to guanine (G), wherein the sterile phenotype is a homozygous G mutation; preferably, the detection reagent is an RFLP primer for a Tat I endonuclease recognition site (WGTACW); also preferably, the detection reagent is an HRM primer and probe.

13. A method for producing rice hybrids, comprising the steps of using a plant with a rice female sterile phenotype carrying a homozygous mutation (A->G) at position 72 of the 6th exon of the LOC_Os12g38460 gene as a male parent, and hybridizing it with a three-line, two-line or wide three-line male sterile line female parent; preferably, the male parent and the female parent are planted together.

14. A rice plant having a female sterile phenotype, wherein the rice plant expresses a mutation (A->G) at position 72 of the sixth exon of the LOC_Os12g38460 gene; or 2) or expresses a mutant protein described in SEQ ID NO: 2; Preferably, the rice comprises a homozygous mutation at position 72 (A->G) in exon 6 of the LOC_Os12g38460 gene; Preferably, the rice expression further comprises three tightly linked expression cassettes of a female fertility restorer gene, a pollen inactivation gene and a seed screening marker gene, wherein the female fertility restorer gene is a wild-type LOC_Os12g38460 gene; Preferably, the rice further expresses an expression cassette containing a plant selection marker.

Citation Information

Patent Citations

  • Paddy rice female sterility gene and application thereof in hybridized paddy rice seed production

    CN102731635A

  • Gene AG1 for controlling male and female fertility of rice and application thereof

    CN109810994A

  • Rice powder protein transport signal peptide and application thereof in pollen fertility regulation and control

    CN110642929A

  • Mutant genes for regulating and controlling female development of rice, proteins encoded by mutant genes, application of mutant genes and primers

    CN113046359A

  • Reproduction of female sterility lines and its application in hybrid seed production

    US20160326536A1