A novel way to engineer the capsid of recombinant adeno-associated virus (AAV)

Modified AAV capsids with peptide insertions at specific sites address the issue of low tissue specificity and transduction efficiency, improving targeting and reducing off-target toxicity while maintaining viral production, thus enhancing therapeutic efficacy.

WO2025139812A1PCT designated stage expired Publication Date: 2025-07-03RENOVIRON (SUZHOU) BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/138719
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-29
Filing Date
2024-12-12
Publication Date
2025-07-03

AI Technical Summary

Technical Problem

Existing recombinant adeno-associated virus (AAV) vectors face challenges with low tissue specificity and transduction efficiency, leading to off-target toxicity and poor efficacy due to inadequate targeting of target tissues.

Method used

Modification of AAV capsid proteins with peptide insertions at specific sites, such as positions 264, 452, 498, and 586, to enhance tropism towards target cells without significantly reducing viral production or infectivity.

Benefits of technology

The modified AAV capsids demonstrate enhanced specificity and affinity for target cells, maintaining or improving viral production efficiency and reducing off-target accumulation, thereby enhancing therapeutic efficacy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2024138719-FTAPPB-I100001
    Figure PCTCN2024138719-FTAPPB-I100001
  • Figure PCTCN2024138719-FTAPPB-I100002
    Figure PCTCN2024138719-FTAPPB-I100002
  • Figure PCTCN2024138719-FTAPPB-I100003
    Figure PCTCN2024138719-FTAPPB-I100003
Patent Text Reader

Abstract

The present disclosure provides modified AAV capsid proteins with modulated specificity and affinity to the target cells / tissues, AAV capsid comprising such modified capsid proteins, and AAV vectors comprising such AAV capsids. Methods of using such AAV capsids are also provided.
Need to check novelty before this filing date? Find Prior Art

Description

A NOVEL WAY TO ENGINEER THE CAPSID OF RECOMBINANT ADENO-ASSOCIATED VIRUS (AAV)TECHNICAL FIELD

[0001] The present disclosure relates generally to the field of gene therapies, specifically to a novel way to engineer the capsid of recombinant adeno-associated virus (AAV) , the modified AAV capsid proteins and uses thereof.BACKGROUND

[0002] Recombinant adeno-associated virus (AAV) is a leading vector for in vivo delivery of gene therapy drugs and has been successfully used to treat multiple clinical indications (Wang et al., 2019) . Although the clinical success of rAAV gene therapy is exciting, the limitations and challenges of this gene delivery vehicle remain (Ertl HCJ, 2022) . Particularly, previous recombinant AAV vectors in clinical development often show low tissue specificity or insufficient transduction of the target tissue. In gene therapy trials, these problems contribute to tissue toxicity due to high accumulation in off-target organs such as liver and kidney (Hinderer et al., 2018; Chand et al., 2021) or low efficacy due to poor accumulation in target organs.

[0003] However, how to efficiently overcome the problems has become a critical challenge in the AAV gene therapy filed. Therefore, needs remain for methods of modifying AAV mutants to efficiently modulate the specificity and affinity to the target cells / tissues.SUMMARY OF INVENTION

[0004] The present disclosure provides modified Adeno-Associated Virus (AAV) capsid proteins comprising at least one peptide insertion at one or more sites selected from the group consisting of positions 264, 452, 498, 550, and 586 or any functional equivalent sites thereof, wherein the numbering corresponds to the wildtype AAV9 VP1 protein (SEQ ID NO: 1) .

[0005] In one aspect, the present disclosure provides a polynucleotide encoding the modified AAV capsid protein as disclosed herein. In one aspect, the present disclosure provides an expression vector comprising the polynucleotide as disclosed herein. In one aspect, the present disclosure provides a cell comprising the polynucleotide or the expression vector as disclosed herein.

[0006] In one aspect, the present disclosure provides an AAV capsid comprising the modified AAV capsid protein as disclosed herein. In one aspect, the present disclosure provides an AAV virus vector comprising the AAV capsid as disclosed herein.

[0007] In one aspect, the present disclosure provides a pharmaceutical composition comprising the AAV virus vector as disclosed herein, and a pharmaceutically acceptable carrier.

[0008] In one aspect, the present disclosure provides a method of delivering a cargo nucleic acid to a cell, comprising contacting the cell with the virus vector as disclosed herein.

[0009] In one aspect, the present disclosure provides a method of delivering a cargo nucleic acid to a subject, comprising administering to the subject an effective amount of the virus vector as disclosed herein or the pharmaceutical composition as disclosed herein.

[0010] In one aspect, the present disclosure provides a method of treating a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the AAV virus vector as disclosed herein or the pharmaceutical composition as disclosed herein.

[0011] In a further aspect, the present disclosure provides a method of producing an AAV vector that has substantially no impact on viral production, comprising, a) inserting a short peptide into a variety of positions in VP1 protein to produce a library of modified AAV vectors; b) determining viral production; c) identifying the modified AAV vector with substantially retained viral production. As used herein, the “substantially retained viral production” means that the modified AAV vector has a viral production efficiency of no less than 50%of the viral production efficiency of the counterpart AAV vector comprising a non-modified or corresponding wildtype AAV capsid protein, under equivalent assay conditions.

[0012] The foregoing summary is illustrative only and is not intended to be in any way limiting. In addition to the illustrative aspects, embodiments, and features described above, further aspects, embodiments, and features will become apparent by reference to the drawings and the following detailed description. BRIEF DESCRIPTION OF THE FIGURES

[0013] Figure 1 shows viral production of the mutant AAVs. Virus was generated on 15 cm plates using same amounts of plasmid DNA. The viral titers were measured as vector genome (Vg) per dish. Relative viral production was then calculated using wildtype AAV9 as a reference (100%) .

[0014] Figures 2A and 2B show binding activities of the mutant AAVs to anti-Strep-tag antibody or anti-c-Myc antibody. P8 denotes the wildtype AAV9 control. Left panel: Binding to anti-Strep-tag II antibody. Right panel: Binding activities of the mutant AAVs to anti-c-Myc antibody.

[0015] Figure 3 shows pulldown assay with Strep-Tactin magnetic beads. Unbound, Wash, EB1, EB2, EB3, and Beads denote unbound virus, collected virus at the two washing steps combined, eluate at the first elution step with 2.5mM D-Desthiobiotin, eluate at the second elution step with 2.5mM D-Desthiobiotin, eluate at the third elution step with 12.5mM D-Desthiobiotin, and eluate at the final step with 12.5mM D-Desthiobiotin for an extended time, respectively.

[0016] Figure 4 shows pulldown assay with anti-c-Myc magnetic beads. Unbound, Wash, EB1, EB2, EB3, and Beads denote unbound virus, collected virus at the two washing steps combined, eluate at the first elution step with 0.5mg / ml c-Myc peptide, eluate at the second elution step with 2.5mg / ml c-Myc peptide, eluate at the third elution step with 5mg / ml c-Myc peptide, and eluate at the final step with proteinase K treatment, respectively.

[0017] Figure 5 shows viral production of the mutant AAVs. Virus was generated on 15 cm plates using same amounts of plasmid DNA. The viral titers were measured as vector genome (Vg) per dish. Data were presented as relative viral production using wildtype AAV9 as a reference (100%) .

[0018] Figures 6A-6C show binding activities of the mutant AAVs to anti-Strep tag antibody, anti-c-Myc antibody, or anti-HA tag antibody. 6A: Binding kinetics of the mutant AAVs to an anti-Strep tag antibody. 6B: Binding kinetics to an anti-c-Myc antibody. 6C: Binding to an anti-HA tag antibody.DETAILED DESCRIPTION

[0019] In the following detailed description, reference is to be made to the drawings set forth in the above, which are intended to accompany the various embodiments provided herein and are intended to constitute part of the description for the embodiments. Unless the context indicates or dictates otherwise, similar symbols in the drawings typically identify similar components in the description.

[0020] All of the descriptions as provided herein are merely intended to illustrate the various embodiments of the inventions provided herein, and are not meant to be limiting. It will be apparent to one skilled in the art that various equivalents, changes, and modifications may be made without departing from the scope of the disclosure, and it is understood that such equivalent embodiments are to be included herein.

[0021] It is to be appreciated that certain features of the present disclosure, which are, for clarity, described in the context of separate embodiments, can also be provided in combination in a single embodiment. Conversely, various features of the present disclosure, which are, for brevity, described in the context of a single embodiment, can also be provided separately or in any suitable sub-combination. In order to illustrate, if one specific embodiment disclosed herein includes components A, B and C, it should be understood that the present disclosure also intends to include embodiments which contains A, B or C individually or any combinations of A, B or C.

[0022] All references cited in the present disclosure, including patent applications, issued patents, published articles or other publications, are incorporated by reference in their entirety, which are for the purpose of providing methodologies that might be used in connection with the description provided herein. With respect to any term that is presented in one or more publications that is similar to, or identical with, a term that has been expressly defined in this disclosure, the definition of the term as expressly provided in this present disclosure will control in all respects.

[0023] All technical and scientific terms used, unless expressly defined otherwise, in this present disclosure, are generally deemed to have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. I. Definitions

[0024] Before detailed description of the inventions in this present disclosure is provided, the following are noted and defined.

[0025] As used herein, i.e., throughout the whole disclosure, the articles “a, ” “an, ” and “the” are to be construed to mean “one or more” or “at least one” unless specified otherwise. By way of example, “a gene” can mean one gene or more than one gene.

[0026] As used herein, unless explicitly indicated otherwise, any number range described herein can include each number within the range and each subrange.

[0027] As used herein, the terms “about, ” “approximately, ” “around” or alike, refer to a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that varies by as much as 30, 25, 20, 25, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1%to a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length. In particular embodiments, the terms “about” or “approximately” when preceding a numerical value indicates the value plus or minus a range of 15%, 10%, 5%, or 1%.

[0028] As used herein, the term “polypeptide” is used interchangeably to “peptide, ” “protein, ” or alike, and is used to refer to a polymer of amino acid residues, or an assembly of multiple polymers of amino acid residues. The term applies to both a naturally occurring amino acid polymer and a non-naturally occurring amino acid polymer, and is construed to also cover an amino acid polymer in which one or more amino acid residues are artificial or synthetic chemical mimetics of their corresponding naturally occurring amino acids. The term “protein” typically refers to large polypeptides. The term “peptide” typically refers to short polypeptides. Polypeptide sequences are usually described as the left-hand end of a polypeptide sequence is the amino-terminus (N-terminus) , and the right-hand end of a polypeptide sequence is the carboxyl-terminus (C-terminus) .

[0029] As used herein, the term “nucleic acid” refers to oligonucleotides or polynucleotides such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) , and by extension, shall also be interpreted to include, as equivalents, derivatives, variants and analogs of RNA or DNA made from nucleotide analogs, single (sense or antisense) and double-stranded polynucleotides. It is to be understood that the term “nucleic acid” does not refer to or infer a specific length of the polynucleotide chain, thus nucleotides, polynucleotides, and oligonucleotides are also included in the definition.

[0030] As used herein, the terms “comprise, ” “comprises, ” “comprising, ” “include, ” “includes, ” “including, ” “contain, ” “contains, ” “containing” , “have, ” “has, ” “having” and the like, are synonymous and are used inclusively, in an open-ended fashion, and do not exclude additional elements, features, steps, acts, operations, and so forth.

[0031] As used herein, the term “or” is used in its inclusive sense (and not in its exclusive sense) so that when used, for example, to connect a list of elements, the term “or” means one, some, or all of the elements in the list.

[0032] As used herein, the phrase “at least one” means one or more, i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more. A phrase referring to “at least one of” a list of items is construed to refer to any combination of those items, including single members. As an example, “at least one of: A, B, or C” is intended to cover: A, B, C, A and B, A and C, B and C, and A, B, and C. Conjunctive language such as the phrase “at least one of X, Y and Z, ” unless specifically stated otherwise, is otherwise understood with the context as used in general to convey that an item, term, etc. may be at least one of X, Y or Z. Thus, such conjunctive language is not generally intended to imply that certain embodiment requires at least one of X, at least one of Y, and at least one of Z to each be present.

[0033] “Percent (%) sequence identity” with respect to amino acid sequence (or nucleic acid sequence) is defined as the percentage of amino acid (or nucleic acid) residues in a candidate sequence that are identical to the amino acid (or nucleic acid) residues in a reference sequence, after aligning the sequences and, if necessary, introducing gaps, to achieve the maximum correspondence. Alignment for purposes of determining percent amino acid (or nucleic acid) sequence identity can be achieved, for example, using publicly available tools such as BLASTN, BLASTp (available on the website of U.S. National Center for Biotechnology Information (NCBI) , see also, Altschul S.F. et al, J. Mol. Biol., 215: 403–410 (1990) ; Stephen F. et al, Nucleic Acids Res., 25: 3389–3402 (1997) ) , ClustalW2 (available on the website of European Bioinformatics Institute, see also, Higgins D.G. et al, Methods in Enzymology, 266: 383-402 (1996) ; Larkin M. A. et al, Bioinformatics (Oxford, England) , 23 (21) : 2947-8 (2007) ) , and ALIGN or Megalign (DNASTAR) software. Those skilled in the art may use the default parameters provided by the tool, or may customize the parameters as appropriate for the alignment, such as for example, by selecting a suitable algorithm. In certain embodiments, the non-identical residue positions may differ by conservative amino acid substitutions.

[0034] As used herein, a “homologue sequence” and “homologous sequence” are used interchangeable and refer to polynucleotide sequences (or its complementary strand) or amino acid sequences that have sequence identity of at least 80% (e.g. at least 85%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) to another sequences when optionally aligned.

[0035] A “conservative amino acid substitution” is one in which an amino acid residue is substituted by another amino acid residue having a side chain (R group) with similar chemical properties (e.g., charge or hydrophobicity) . In general, a conservative amino acid substitution will not substantially change the functional properties of a protein. In cases where two or more amino acid sequences differ from each other by conservative substitutions, the percent or degree of similarity may be adjusted upwards to correct for the conservative nature of the substitution. Means for making this adjustment are well known to those of skill in the art. See, e.g., Pearson (1994) Methods Mol. Biol. 24: 307-331, which is herein incorporated by reference.

[0036] As used herein, the references “one embodiment, ” “an embodiment, ” “a particular embodiment, ” “a related embodiment, ” “a certain embodiment, ” “an additional embodiment, ” or “a further embodiment” or combinations thereof, are to be understood to mean that a particular feature, structure or characteristic described in connection with this particular embodiment is included in at least one embodiment of the present disclosure. Thus, the presences or appearances of the foregoing phrases in various places throughout this disclosure are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

[0037] Conditional language used herein, such as, among others, “can, ” “could, ” “might, ” “may, ” “e.g., ” and the like, unless stated expressly otherwise, or otherwise understood within the context as used, is generally intended to convey that certain embodiments include, while other embodiments do not include, certain features, elements and / or steps. Thus, such conditional language is not generally intended to imply that features, elements and / or steps are in any way required for one or more embodiments. II. Modified Adeno-Associated Virus (AAV) Capsid Proteins

[0038] The present disclosure provides modified AAV capsid proteins that have modifications that confer tropism towards specific target cells of interest, without substantially reducing their replication or production efficiency.

[0039] AAV vectors are recognized for their therapeutic gene delivery potential, but their natural tropism often limits their utility in targeting specific cell types. Modifying their tropism would be useful, for example, by fusing heterologous peptides that have recognition sites for receptors present on the target cell membrane. However, this method, involving genetic insertion of peptide motifs into AAV capsids, often impairs the packaging and infectivity of the vectors.

[0040] The present inventors found that certain sites in the AAV capsid proteins can be more tolerant to insertion of heterologous peptides, while others can have significantly decreased efficiency of virus vector packaging and infection. This highlights the importance of site selection for AAV capsid modification.

[0041] The present disclosure provides specific insertion sites within the AAV capsid protein. These sites enable the display of heterologous peptides on the AAV capsid surface and allow redirection of AAV tropism towards specific target cells, without substantially reducing or impairing the replication or production of the AAV vector.

[0042] In one aspect, the present disclosure provides modified Adeno-Associated Virus (AAV) capsid proteins comprising at least one peptide insertion at one or more sites selected from the group consisting of positions 264, 452, 498, 550, and 586, wherein the numbering corresponds to the wildtype AAV9 VP1 protein (SEQ ID NO: 1) . a. AAV Capsid Protein

[0043] As used herein, the term “adeno-associated virus” (AAV) , is a small virus that infects humans and some other primate species. AAV is a type of non-pathogenic single-stranded DNA virus that is common in humans and other mammals. AAV belongs to the family Parvoviridae, genus Dependoparvovirus.

[0044] As used herein, the term “capsid” refers to the protein shell of a virus that encloses the viral nucleic acid. Typically, a capsid comprises several oligomeric structural subunits (i.e., protomers) .

[0045] AAV capsid, which is useful for enclosing genetic materials such as a viral genome, is a 20-sided hollow structure with a diameter of approximately 26nm. It can be visualized as an icosahedron made up of 20 triangles, with every 5 triangles forming a pentagon. There is a five-fold rotational axis between each pair of opposing pentagons, a three-fold rotational axis between each pair of opposing triangles’ centers, and a two-fold rotational axis between each pair of opposing edges’ midpoints. AAV capsid comprises a total of 60 copies of capsid proteins VP1, VP2, and VP3, with a ratio of 5: 5: 50 for these three subunits on each capsid. These subunits are encoded by overlapping sequences within the same open reading frame. Neutralizing antibodies recognize antigenic epitope regions on the virus capsid surface and bind to the AAV.

[0046] As used herein, the term “capsid protein” refers to a structural protein of the capsid of a virus. AAV capsid has three capsid proteins, including viral protein 1 (VP1) , VP2 and VP3, which assemble to the icosahedral capsid. In an AAV genome, VP1, VP2 and VP3 are all encoded by overlapping sequences within one open reading frame. The entire sequence of VP3 is contained within VP2, and all of VP2 is contained within VP1, which has a unique N-terminal (VP1u) domain. Only the common VP3 region is observed in all of the capsid structures of AAV serotypes determined to date, either by cryo-electron microscopy (cryo-EM) and image reconstruction (cryo-reconstruction) or by X-ray crystallography.

[0047] In certain embodiments, the modified AAV capsid proteins provided herein comprise at least one peptide insertion at one or more sites. Such sites enable the display of heterologous peptides on the AAV capsid surface and allow redirection of AAV tropism towards specific target cells, without substantially reducing or impairing the replication or production of the AAV vector.Insertion sites

[0048] In certain embodiments, the one or more sites is selected from the group consisting of positions 264, 452, 498, 550, and 586 or any functional equivalent sites thereof, wherein the numbering corresponds to the wildtype AAV9 VP1 protein. In some embodiments, the VP1 capsid protein of AAV9 comprises an amino acid sequence of SEQ ID NO: 1.

[0049] As used herein, the term “functional equivalent site” refers to an amino acid position that is within 10 amino acid range adjacent to the relevant position in the variable region of the capsid protein, and that allows an AAV virus with a modified AAV capsid protein which contains a modification at this position to achieve viral production that is at least 50%of that of the wildtype AAV virus. Optionally, it also retains at least 50%of the antigenic binding capacity compared to the wildtype AAV capsid protein.

[0050] As used herein, the term “variable region” of a capsid protein refers to the region located on surface loops of the capsid protein. These loops connect multiple conserved structural motifs, such as β-barrels and / or α-helixes, which are pivotal in shaping the unique topography of the capsid surface. This unique topography lead to variations in cellular tropism, tissue transduction efficiencies, and antigenic properties.

[0051] In certain embodiments, the functional equivalent sites of position 452 comprise positions 453, 454, 455 and 456, wherein the numbering corresponds to the wildtype AAV9 VP1 protein. In certain embodiments, the functional equivalent sites of position 498 comprise positions 492 and 493, wherein the numbering corresponds to the wildtype AAV9 VP1 protein. In certain embodiments, the functional equivalent sites of position 586 comprise positions 587, 588 and 589, wherein the numbering corresponds to the wildtype AAV9 VP1 protein.

[0052] As used herein, the phrase “correspond to” with respect to AAV capsid protein, reflects the correspondence of amino acid residues of a reference capsid protein to the numbered amino acid residues of a standard AAV capsid protein (e.g. wildtype AAV9 VP1 protein) having certain homology to the reference capsid protein. The reference capsid protein and the standard capsid protein can be of different AAV serotypes, and such correspondence can be obtained by, for example, sequence alignment. Sequence alignment can be performed by aligning a selected AAV capsid sequence with a reference sequence, such as AAV9 or another AAV serotype, using any suitable computer programs and techniques such as Clustal W, CAP Sequence Assembly, MAP, MEME, and Vector NTI utilities.

[0053] High degree of conservation in the capsid amino acid sequence has been reported among different AAV serotypes. In this sense, insertions at the corresponding residue on AAV serotypes other than AAV9 may have similar modification effects. Therefore, in the present disclosure, when listing the positions which are introduced with insertions, it only uses the specific positions in the specific AAV9 VP1 protein (e.g., with the sequence of SEQ ID NO: 1) as the reference or as an example, and it is not intended to specifically limit the mutation positions to the capsid protein of wildtype AAV9.

[0054] In other words, the positions of the amino acid to be introduced with peptide insertions by the present disclosure (e.g., positions 264, 452, 498, 550, and 586 as mentioned above, among others) not only include the specific positions in AAV9 VP1 protein (with the amino acid sequence of SEQ ID NO: 1) , but also includes those conserved positions in the capsid proteins in the AAV serotypes other than AAV9 VP1, which can be obtained by e.g., sequence alignment. For example, position 264 of AAV9 VP1 protein correspond to position 262 of AAV2, position 263 of AAV6, and position 265 of AAV8.

[0055] In some embodiments, the wildtype AAV9 VP1 protein comprises or consists of the amino acid sequence as set forth in SEQ ID NO: 1.

[0056] Wildtype AAV9 VP1 protein (SEQ ID NO: 1)

[0057]

[0058] The modified AAV capsid proteins provided herein can be any suitable AAV serotype. In some embodiments, the modified AAV capsid proteins provided herein is of an AAV serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV12, AAV843, AAVbb2, AAVcyS, AAVrh10, AAVrh20, AAVrh39, AAVrh43, AAVrh64, AAVhu37, AAV3B, AAVhu48, AAVhu43, AAVhu44, AAVhu46, AAVhu19, AAVhu20, AAVhu23, AAVhu22, AAVhu24, AAVhu21, AAVhu27, AAVhu28, AAVhu29, AAVhu63, AAVhu64, AAVhu13, AAVhu56, AAVhu57, AAVhu49, AAVhu58, AAVhu34, AAVhu45, AAVhu47, AAVhu51, AAVhu52, AAVhu T41, AAVhu S17, AAVhu T88, AAVhu T71, AAVhu T70, AAVhu T40, AAVhu T32, AAVhu T17, AAVhu LG15, AAVhu9, AAVhu10, AAVhu11, AAVhu53, AAVhu55, AAVhu54, AAVhu7, AAVhu18, AAVhu15, AAVhu16, AAVhu25, AAVhu60, AAVch5, AAVhu3, AAVhu1, AAVhu4, AAVhu2, AAVhu61, AAVrh62, AAVrh48, AAVrh54, AAVrh55, AAVcy2, AAVrh35, AAVrh37, AAVrh36, AAVcy6, AAVcy4, AAVcy3, AAVcy5, AAVrh13, AAVrh38, AAVhu66, AAVhu42, AAVhu67, AAVhu40, AAVhu41, AAVrh40, AAVrh2, AAVbb1, AAVhu17, AAVhu6, AAVrh25, AAVpi2, AAVpi3, AAVrh57, AAVrh50, AAVrh49, AAVhu39, AAVrh58, AAVrh61, AAVrh52, AAVrh53, AAVrh51, AAVhu14, AAVhu31, AAVhu32, AAVrh34, AAVrh33, AAVrh32, Avian AAV ATCC VR-865, Avian AAV strain DA-1 or Bovine AAV.

[0059] Examples of AAV capsid gene sequences and protein sequences can be found in GenBank database, see, GenBank Accession Nos: AF043303, AF028705, AF028704, J02275, J01901, J02275, X01457, AF288061, AH009962, AY028226, AY028223, NC 001358, NC 001540, AF513851, AF513852, AY530579, AY631965, AY631966; AF063497, AF085716, AF513852, AY530579, AAS99264.1, AY243022, AY243015, AY530560, AY530600, AY530611, AY530628, AY530553, AY530606, AY530583, AY530555, AY530607, AY530580, AY530569, NC 006263, NC 005889, NC 001862, AY530609, AY530581, AY530563, AY530591, AY530562, AY530584, AY530622, AY530601, AY530586, AY243021, AY530570, AY530589, AY530595, AY530572, AY530588, AY530575, AY530565, AY530590, AY530602, AY530566, AY530587, AY530585, AY530564, AY530592, AY530623, AY530574, AY530593, AY530560, AY530594, AY530573, AF513852, AY530624, AY530561, AY242997, AY530625, AY530567, AY530556, AY530578, AY530568, AY530618, AY243020, AY530579, AY530619, AY530596, AY530612, AY243000, AY530597, AY530620, AY242998, AY530598, AY242999, AY530599, AY243016, NC 001729, NC 001401, AY243018, NC 001863, AY530608, AY243019, NC 001829, AY530610, AY243017, AY243001, AY530613, AY243013, AY243002, AY530614, AY243003, AY695378, AY530558, AY530626, AY695376, AY695375, AY530605, AY695374, AY530603, AY530627, AY695373, AY695372, AY530604, AY695371, AY530600, AY695370, AY530559, AY695377, AY243007, AY243023, AY186198, AY629583, NC 004828, AY530629, AY530576, AY243015, AY388617, AY530577, AY530582, AY530615, AY530621, AY530617, AY530557, AY530616 or AY530554.

[0060] In some embodiments, the capsid protein can be modified or chimeric or synthetic. A chimeric capsid comprises portions of two or more capsid sequences. A synthetic capsid comprises synthetic or artificially designed sequence. In some embodiments, the cap gene or the capsid protein is derived from two or more AAV serotypes.

[0061] In some embodiments, the modified AAV capsid proteins provided herein are derived from wild-type or original capsid proteins of an AAV suitable for therapeutic use, for example, without limitation, AAV1, AAV2, AAV3, AAV3B, AAV5, AAV6, AAV8, AAV9, AAV10, AAVrh. 74, AAVrh. 10, and AAVhu. 37 et al.. The exemplary amino acid sequences of the wild-type or original VP1 proteins of the aforementioned AAVs are provided in the below table.

[0062] In some embodiments, the modified AAV capsid proteins provided herein comprise a variant of an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 and 5-16, except that the variant comprises the at least one peptide insertion disclosed herein at the position set forth herein.

[0063] In some embodiments, except for the at least one peptide insertion at the position (s) specified herein, the modified AAV capsid proteins provided herein have a sequence identity of at least 90%, 95%, or at least 98%to SEQ ID NOs: 1 and 5-16 outside the region of the at least one peptide insertion.

[0064] In some embodiments, the modified AAV capsid proteins provided herein has a sequence identity of at least 90%, 95%, or at least 98%to SEQ ID NOs: 1 and 5-16.

[0065] Unless otherwise defined, the insertion site in the predetermined amino acid sequence is between the C-terminal of the residue at the defined mutation position and the N-terminal of the residue next to the defined mutation position. For example, when defining that the insertion mutation is at the position 264 corresponding to the sequence of SEQ ID NO: 1, it means that the inserted amino acid (s) is inserted between position 264 and position 265 correspond to SEQ ID NO: 1.

[0066] In some embodiments, the modified AAV capsid proteins with the peptide insertion at one or more of the sites provided herein do not substantially reduce production of an AAV comprising the modified AAV capsid protein relative to its unmodified counterpart. In some embodiments, the AAV comprising the modified AAV capsid proteins provided herein have equivalent or similar viral production efficiency compared to a counterpart AAV comprising a non-modified or corresponding wildtype AAV capsid protein, under equivalent assay conditions. In some embodiments, the AAV comprising the modified AAV capsid protein provided herein has no less than 99%, no less than 98%, no less than 97%, no less than 96%, no less than 95%, no less than 94%, no less than 93%, no less than 92%, no less than 91%, no less than 90%, no less than 85%, no less than 80%, no less than 75%, no less than 70%, no less than 65%, no less than 60%, no less than 55%, or no less than 50%of the viral production efficiency of the counterpart AAV virus comprising a non-modified or corresponding wildtype AAV capsid protein, under equivalent assay conditions.

[0067] Production of an AAV with modified capsid proteins can be ascertained using any suitable methods. In one example, quantitative assays can be used to measure the total yield of viral particles produced. This yield for AAV vectors with modified capsid proteins is compared against that of vectors with unmodified capsid proteins under equivalent production conditions. In another example, the replication efficiency of the AAV genome within host cells can be assessed using molecular techniques such as quantitative polymerase chain reaction (qPCR) . Efficient replication can be indicated by similar levels of viral genomes in cells producing both modified and unmodified AAV vectors. In still another example, capsid protein expression levels can be compared between modified and unmodified AAV vectors using Western blot or ELISA (enzyme-linked immunosorbent assay) . Similar expression levels suggest that the modification does not adversely affect the expression of capsid proteins. In yet still another example, the structural integrity of the produced viral particles can be evaluated using techniques like electron microscopy. This ensures that the capsid modifications do not result in malformed or unstable viral particles, which can be important for maintaining production efficiency.

[0068] Production of an AAV with modified capsid proteins can be further assessed by infectivity of the produced AAV vectors. Infectivity can be assessed to ensure that the modification does not impair the virus’s ability to infect host cells for virus production. Comparable infectivity rates between modified and unmodified vectors indicate that production efficiency is maintained.Peptide insertion

[0069] As used herein, the term “peptide insertion” refers to the incorporation of a peptide into a predetermined amino acid sequence. In some embodiments, the peptide insertion as disclosed herein comprises insertion of about three to about five or even up to about dozens of amino acid residues. The inserted residue (s) may be naturally occurring or non-naturally occurring. The inserted residue or residues may be “naturally occurring amino acid residues” (i.e., encoded by the genetic code) and selected from the group consisting of: alanine (Ala) ; arginine (Arg) ; asparagine (Asn) ; aspartic acid (Asp) ; cysteine (Cys) ; glutamine (Gln) ; glutamic acid (Glu) ; glycine (Gly) ; histidine (His) ; isoleucine (Ile) : leucine (Leu) ; lysine (Lys) ; methionine (Met) ; phenylalanine (Phe) ; proline (Pro) ; serine (Ser) ; threonine (Thr) ; tryptophan (Trp) ; tyrosine (Tyr) ; and valine (Val) . Insertion of one or more non-naturally occurring amino acid residues is also encompassed by the definition of an insertion herein. A “non-naturally occurring amino acid residue” refers to a residue, other than those naturally occurring amino acid residues listed above, which is able to covalently bind adjacent amino acid residues (s) in a polypeptide chain. Examples of non-naturally occurring amino acid residues include norleucine, ornithine, norvaline, homoserine and other amino acid residue analogues such as those described in Ellman et al. Meth. Enzym. 202: 301-336 (1991) . To generate such non-naturally occurring amino acid residues, the procedures of Noren et al. Science 244: 182 (1989) and Ellman et al., supra, can be used. Briefly, these procedures involve chemically activating a suppressor tRNA with a non-naturally occurring amino acid residue followed by in vitro transcription and translation of the RNA.

[0070] In some embodiments, the peptide insertion comprises at most 15, 20, 25, 30, 35, 40, 45 or 50 amino acid residues. In some embodiments, the peptide insertion is with a length of 2 to 40, 2 to 30, 2 to 20, 2 to 19, 2 to 18, 2 to 17, 2 to 16, 2 to 15, or 2 to 14 amino acid residues.

[0071] In some embodiments, the peptide insertion alters binding of the modified AAV capsid protein to a target compared to its unmodified counterpart. For example, the modified AAV capsid protein may have substantially eliminated or enhanced binding to the target.

[0072] In some embodiments, the target is a receptor expressed on a cell of interest. In some embodiments, the cell of interest is a natural host for AAV. In some embodiments, the cell of interest is not a natural host for AAV.

[0073] During its natural infection process, AAV typically binds to primary receptors and / or co-receptors on the surface of its natural host cell, leading to infection. To alter the AAV’s tropism, a strategy involves inserting a peptide fragment into a specific region of the capsid protein, such as the VP3 region. This modification aims to reduce or eliminate the AAV’s natural binding and, optionally, its infection of the natural host cell. Alternatively or additionally, the capsid protein can be modified to enable the AAV to bind to a receptor on the surface of a cell that is not its natural host, thus facilitating AAV binding and transduction through a new, non-natural AAV receptor. Consequently, such modified capsid protein results in the AAV vector acquiring the capability to either redirect or broaden its tropism.

[0074] In some embodiments, the peptide insertion reduces or substantially eliminates binding to the target or to the cell of interest, compared to its unmodified counterpart. In some embodiments, the AAV comprising the modified capsid proteins have at least about 30%less, at least about 40%less, at least about 50%less, at least about 70%less, at least about 80%less, or at least about 90%less binding to the target, than a non-modified or corresponding wildtype AAV capsid protein, under equivalent assay conditions. In some embodiments, the AAV comprising the modified capsid proteins have no more than 20%, no more than 15%, no more than 10%, no more than 8%, no more than 5%, no more than 2%, or no more than 1%of binding to the target in a suitable detecting assay as compared to a non-modified or corresponding wildtype AAV capsid protein, under equivalent assay settings. In some embodiments, the AAV comprising the modified capsid proteins have at least about 30%less, at least about 40%less, at least about 50%less, at least about 70%less, at least about 80%less, or at least about 90%less infection to the cell of interest expressing the target, than a non-modified or corresponding wildtype AAV capsid protein, under equivalent assay conditions. In some embodiments, the AAV comprising the modified capsid proteins have no more than 20%, no more than 15%, no more than 10%, no more than 8%, no more than 5%, no more than 2%, or no more than 1%of infection to the cell of interest expressing the target in a suitable detecting assay as compared to a non-modified or corresponding wildtype AAV capsid protein, under equivalent assay settings.

[0075] In certain embodiments, the cell of interest is a natural host for AAV. In certain embodiments, the target is a primary receptor and / or co-receptor on the surface of natural host cell of the AAV. In some embodiments, the peptide insertion reduces or substantially eliminates binding to the target expressed on a natural host for the AAV, compared to its unmodified AAV counterpart. For example, the peptide insertion can be designed to avoid or reduce binding to receptors present in the natural host. This can be achieved, for example, by inserting amino acid residues or a peptide fragment at certain site (s) or region (s) exposed on the capsid surface that is involved in binding of the AAV capsid to its natural host receptors. At least some of the insertion sites provided in the present disclosure are believed to involve in such binding to host receptors. As such, peptide insertions can be introduced to such site, for example, to reduce binding or binding affinity of the modified AAV capsid protein (and consequently, the AAV with such modified capsid proteins) to its natural host receptors. For example, peptide insertions can comprise a sequence that sterically hinder the interaction with these natural host receptors, thereby masking or modifying the capsid regions that are responsible for binding to the natural host cell receptors. Such peptide insertion sequences can be obtained by methods known in the art, for example, rational design, molecular evolution, among others.

[0076] In some embodiments, the modified AAV capsid proteins provided herein have conferred or enhanced binding to the target, compared to its unmodified counterpart. In some embodiments, the target is a receptor expressed on a cell of interest. In some embodiments, the target is a natural receptor for AAV capsid proteins. In certain embodiments, the cell of interest is not a natural host for AAV. In some embodiments, the AAV comprising the modified AAV capsid proteins provided herein have at least about 30%more, at least about 40%more, at least about 50%more, at least about 70%more, at least about 80%more, at least about 90%more, at least about 2 times, at least about 2.1 times, at least about 2.2 times, at least about 2.3 times, at least about 2.4 times, at least about 2.5 times, at least about 2.6 times, at least about 2.7 times, at least about 2.8 times, at least about 2.9 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, at least about 6 times, at least about 7 times, at least about 8 times, at least about 9 times, or at least about 10 times, binding to the target or to the cell of interest expressing the target, than a non-modified or corresponding wildtype AAV capsid protein, under equivalent assay conditions. In some embodiments, the AAV comprising the modified AAV capsid proteins provided herein have at least about 30%more, at least about 40%more, at least about 50%more, at least about 70%more, at least about 80%more, at least about 90%more, at least about 2 times, at least about 2.1 times, at least about 2.2 times, at least about 2.3 times, at least about 2.4 times, at least about 2.5 times, at least about 2.6 times, at least about 2.7 times, at least about 2.8 times, at least about 2.9 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, at least about 6 times, at least about 7 times, at least about 8 times, at least about 9 times, or at least about 10 times, infection to the target or to the cell of interest expressing the target, than a non-modified or corresponding wildtype AAV capsid protein, under equivalent assay conditions.

[0077] In some embodiments, the peptide insertion confers or enhances binding to the target, or to the cell of interest, compared to its unmodified counterpart. In some embodiments, the target can be specific receptors or molecules expressed on the cells of interest. For example, the peptide insertion can be designed to bind specifically to the target on the cells of interest but not molecules on the cells of the natural host. This can be useful to reduce off-target infectivity.

[0078]

[0079] Peptide sequences can be designed to enhance the binding of the AAV vector to the target expressed on a cell of interest, for example, by specifically targeting certain cell types or tissues. Such peptide sequences are known in the art or alternatively can be obtained by rational design, molecular evolution, or random screening, among others. In some embodiments, the cell of interest comprises, for example, various cancer cells such as ovarian, breast, prostate, lung (including non-small cell and small cell lung carcinoma) , colorectal, melanoma, leukemia (acute myeloid leukemia, chronic lymphocytic leukemia) , lymphoma (Hodgkin's and non-Hodgkin's ) , pancreatic, liver cancer cells (hepatocellular carcinoma) , and glioblastoma. In some embodiments, the cell of interest comprises, for example, muscle cells including skeletal, cardiac, and smooth muscle cells; vasculature cells, such as endothelial and vascular smooth muscle cells, as well as lung cells like alveolar and bronchial epithelial cells; heart cells, such as myocytes and cardiac fibroblasts; neural cells such as neurons (sensory, motor) , glia cells (astrocytes, oligodendrocytes, microglia) , neural stem cells, and neural progenitor cells, along with diseased brain endothelial cells; retina cells such as rod cells, cone cells, retinal ganglion cells, and bipolar cells; stem cells such as pluripotent stem cells (induced pluripotent and embryonic) , mesenchymal stem cells, and hematopoietic stem cells; liver cells (hepatocytes, Kupffer cells) , kidney cells (podocytes, mesangial cells, renal tubular cells) , gastrointestinal cells (enterocytes, goblet cells) , and various immune cells (T cells, B cells, macrophages, dendritic cells, natural killer cells) ; skin cells such as keratinocytes, melanocytes, and fibroblasts; bone cells including osteoblasts, osteoclasts, and osteocytes; cartilage cells like chondrocytescancer cell; and pancreatic cells (including alpha cells, beta cells, delta cells, gamma cells, epsilon cells, exocrine cells, duct epithelial cells) .

[0080] A skilled person in the art can select respective targets on the cell of interest. For example, for cancer cells, such as breast, prostate, ovarian, lung, leukemia, and lymphoma cells, targeting is often focused on overexpressed receptors or antigens. Breast cancer cells, for instance, frequently overexpress the HER2 / neu receptor, while prostate cancer cells are known for the presence of prostate-specific membrane antigen (PSMA) . Ovarian cancer cells can be targeted via the folate receptor or CA-125, and lung cancer cells often exhibit an abundance of the epidermal growth factor receptor (EGFR) . In hematological malignancies like leukemia and lymphoma, cell surface antigens such as CD19, CD20, or CD22 serve as potential targets.

[0081] For non-cancerous cell types, targeting strategies vary based on the cell’s function and location. Muscle cells, including skeletal and cardiac muscle cells, can be targeted through dystrophin-associated proteins or integrins. In the vascular system, endothelial cells express specific markers like VEGFR and integrins, making them distinct targets. Lung cells, including alveolar and bronchial epithelial cells, can be identified through markers like EpCAM or surfactant proteins. Cardiomyocytes in the heart may be targeted via receptors like β1-adrenergic or angiotensin II receptors. In the nervous system, neurons and glial cells present unique markers such as neuronal cell adhesion molecules, synaptic receptors, or GFAP. Specialized cells like those in the retina, including photoreceptors and retinal ganglion cells, can be targeted through cell-specific proteins like rhodopsin or opsins.

[0082] Furthermore, stem cells present a unique set of markers, with pluripotent stem cells expressing stage-specific embryonic antigens (SSEA) , TRA-1-60, and TRA-1-81, while mesenchymal and hematopoietic stem cells can be distinguished by markers like CD105, CD73, CD90, and CD34, CD117 (c-Kit) , respectively. Other cell types such as liver cells (hepatocytes) , kidney cells (podocytes, renal tubular cells) , gastrointestinal cells (enterocytes, pancreatic cells) , immune cells (T cells, B cells, macrophages) , skin cells (keratinocytes, melanocytes) , bone cells (osteoblasts, osteoclasts) , and cartilage cells (chondrocytes) also express specific markers that can be leveraged for targeted AAV vector delivery.

[0083] In some embodiments, the peptide insertion can disrupt the epitope (s) recognized by neutralizing antibodies against AAV capsids. This strategy can be used to escape pre-existing neutralizing antibodies and, therefore, enhance the effectiveness of the gene therapy drug and / or improve its safety profile. For example, certain positions on the AAV capsids can form at least part of the epitopes recognized by neutralizing antibodies in the host serum, and by inserting a peptide to disrupt such an epitope, the recognition of the neutralizing antibodies can be reduced. Examples of such positions include, without limitation, position 498, 588 and 589. For details, please refer to, for example, Giles, A. R. et al, J. Virol. (2018) 92 (20) : e01011-18.

[0084] In some embodiments, the peptide insertion modifies immune responses, compared to its unmodified counterpart. For example, the peptide insertion can be designed to reduce innate immune responses, T cell responses, or humoral responses against the capsid or the transgene. This strategy may also help the AAV escape pre-existing neutralizing antibodies. For example, peptide insertions can be introduced to interfere with Toll-like receptor signaling, thereby improving early steps of host-vector interaction and reducing innate and adaptive immune responses. For details, please refer to, for example, Bentler, M. et al, Mol Ther Methods Clin Dev. (2023) 30: 576-592.

[0085] Exemplary peptide insertion sequences that confer binding to certain targets or certain cells of interest have been known in the art and extensively reviewed, see, for example, Buning, H. et al, Mol Ther Methods Clin Dev. (2019) 12: 248-265; PCT publication No. WO2019178412A1, WO2020219656A1, and WO2022061378A2, which are incorporated herein by reference to entirety.

[0086] In some embodiments, the peptide insertion promotes purification of the AAV capsid.

[0087] In some embodiments, the peptide insertion comprises a commonly used protein tag (e.g., a protein purification tag) with a length of no more than 6 to 26 amino acid residues. In some embodiments, the protein tag is well-established and commercially available, allowing rapid identification of mutant viruses produced. In some embodiments, the protein tag has a uniform polarity and charge properties.

[0088] In some embodiments, the insertion comprises the amino acid sequence of Strep-II tag or fragments thereof. In certain embodiments, the Strep-II tag comprises an amino acid sequence of WSHPQFEK (SEQ ID NO: 2) . In some embodiments, the insertion comprises the amino acid sequence of Myc tag or a fragment thereof. In certain embodiments, the c-Myc tag comprises an amino acid sequence of EQKLISEEDL (SEQ ID NO: 3) . In some embodiments, the insertion comprises the amino acid sequence of HA tag or a fragment thereof. In certain embodiments, the HA tag comprises an amino acid sequence of YPYDVPDYA (SEQ ID NO: 4) .

[0089] In some embodiments, the peptide insertion comprises the insertion of Strep-II tag, e.g., comprising the amino acid sequence of SEQ ID NO: 2, at position selected from the group consisting of 264, 452, 498, 550, and 586 of wildtype AAV9 VP1 protein SEQ ID NO: 1. In some embodiments, the peptide insertion comprises the insertion of c-Myc tag, e.g., comprising the amino acid sequence of SEQ ID NO: 3, at position selected from the group consisting of 264, 452, 498, 550, and 586 of wildtype AAV9 VP1 protein SEQ ID NO: 1. In some embodiments, the peptide insertion comprises the insertion of HA tag, e.g., comprising the amino acid sequence of SEQ ID NO: 4, at position selected from the group consisting of 264, 452, 498, 550, and 586 of wildtype AAV9 VP1 protein SEQ ID NO: 1.

[0090] In certain embodiments, the peptide insertion comprises a first insertion of Strep-II tag, e.g., comprising the amino acid sequence of SEQ ID NO: 2, at a position selected from the group consisting of 264, 452, 498, 550, and 586, and a second insertion of c-Myc tag, e.g., comprising the amino acid sequence of SEQ ID NO: 3, at a position selected from the group consisting of 264, 452, 498, 550, and 586, of wildtype AAV9 VP1 protein SEQ ID NO: 1. First site and second site

[0091] In some embodiments, the at least one peptide insertion in the modified AAV capsid protein provided herein comprises a first peptide insertion at a first site selected from the group consisting of positions 264, 452, 498, 550, and 586. In some embodiments, the at least one peptide insertion further comprises a second peptide insertion at a second site, and the second site is different from the first site.

[0092] In some embodiments, the first site and the second site are selected respectively from the group consisting of positions 264, 452, 498, 550, and 586. In some embodiments, the first site is selected from the group consisting of positions 264, 452, 498, and 586. In some embodiments, the second site is selected from the group consisting of positions 264, 452, and 498.

[0093] In some embodiments, the first site and the second site are at a pair of sites selected from the group consisting of: (a) positions 264 and 452; (b) positions 264 and 498; (c) positions 452 and 498; (d) positions 586 and 452; (e) positions 586 and 498; and (f) positions 586 and 264.

[0094] In some embodiments, the at least one peptide insertion further comprises a third peptide insertion at a third site, and the third site is different from the first site and the second site. In some embodiments, the third site is selected from the group consisting of positions 264, 452, 498, 550, and 586. In some embodiments, the first site, the second site and the third site are selected respectively from the group consisting of positions 264, 452, 498, 550, and 586. In some embodiments, the first site, the second site and the third site are a group of sites selected from the group consisting of: positions 264, 452 and 498, and positions 452, 498 and 586.

[0095] In some embodiments, the first peptide insertion and the second peptide insertion each comprises a different peptide fragment. In some embodiments, the first peptide insertion or the second peptide insertion has at least one of the following properties: (a) reduces or substantially eliminates binding of the modified capsid protein to a first target, (b) confers or enhances binding of the modified capsid protein to a second target, (c) promotes purification of the AAV capsid or the AAV with the modified AAV capsid; d) disrupt the epitope (s) recognized by neutralizing antibodies against AAV capsids; e) modifies immune responses, compared to its unmodified counterpart; or any combination thereof. In certain embodiments, the first peptide insertion or the second peptide insertion reduces or substantially eliminates binding of the modified capsid protein to a first target, and confers or enhances binding of the modified capsid protein to a second target.

[0096] In some embodiments, the at least one peptide insertion further comprises a third peptide insertion at a third site, and the third site is different from the first site and the second site.

[0097] In some embodiments, the first peptide insertion, the second peptide insertion and the third peptide insertion each comprises a different peptide fragment. b. Polynucleotide, Expression Vectors, Cells and Virus Vectors

[0098] In one aspect, the present disclosure provides polynucleotides encoding the modified AAV capsid proteins disclosed herein. Further provided are expression vectors comprising the polynucleotide, and cells (in vivo or in culture) comprising the polynucleotide and / or expression vectors of the disclosure.

[0099] In one aspect, the present disclosure provides an AAV capsid, which comprises the modified AAV capsid protein provided herein.

[0100] In one aspect, the present disclosure provides a virus vector, which comprises the AAV capsid provided herein. In certain embodiments, the virus vector provided herein further comprises a nucleic acid comprising at least one terminal repeat sequence, wherein the nucleic acid is encapsidated by the AAV capsid provided herein.

[0101] As used herein, an “virus vector” refers to a nucleic acid vector comprising a nucleic acid having a 5’ viral terminal repeat (TR) and / or 3’ viral terminal repeat sequences. A virus vector can comprise a pair of TRs or a single TR.

[0102] The term “terminal repeat” or “TR” includes any viral terminal repeat or synthetic sequence that forms a hairpin structure and mediates the desired functions such as replication, virus packaging, integration and / or provirus rescue, and the like. For example, the 5’ viral terminal repeat and 3’ viral terminal repeat sequences can contain originals of replication, and allow for DNA synthesis initiation at one of the viral terminal repeat and proceeds to the other viral terminal repeat. Examples of viral terminal repeats include but are not limited to, inverted terminal repeats (ITR) (for example, those includes in the adeno-associated virus (AAV) ) , long terminal repeats (LTR) (for example, those included in the retrovirus) etc.

[0103] In certain embodiments, the virus vector of the present disclosure comprises at least one ITR of AAV. The ITRs sequences of AAV is capable of guiding replication and packaging of the viral vector genome. In certain embodiments, the virus vector comprises at least part of the AAV genome. In certain embodiments, the virus vector lacks the REP and CAP genes within an AAV genome.

[0104] An AAV ITR can be derived from any AAV, including but not limited to AAV serotype 1 (AAV 1) , AAV 2, AAV 3, AAV 4, AAV 5, AAV 6, AAV 7, AAV 8, AAV 9, AAV 10, AAV 11, AAV 12, avian AAV, bovine AAV, canine AAV, equine AAV, and ovine AAV and any other AAV now known or later discovered. For details please see, e.g., BERNARD NF et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers) , Gao et al., (2004) J. Virol. 78: 6381-6388. The nucleotide sequences of AAV ITR regions are known. See for example, Kotin, R.M. (1994) Human Gene Therapy 5: 793-801; Berns, K.I. “Parvoviridae and their Replication” in Fundamental Virology, 2nd Edition, (B.N. Fields and D.M. Knipe, eds. ) .

[0105] An AAV ITR can be native AAV ITR, or alternatively can be altered from a native AAV ITR, for example by mutation, deletion or insertion, so long as the altered ITR can still mediate the desired biological functions such as replication, virus packaging, integration, and the like. The 5’ and 3’ ITRs which flank a selected nucleotide sequence in an AAV vector need not necessarily be identical or derived from the same AAV serotype, so long as they function as intended, for example, to allow for excision and rescue of the sequence of interest from and integration into the recipient cell genome.

[0106] In some embodiments, the nucleic acid further comprises a cargo nucleic acid operably linked to the at least one terminal repeat sequence. In certain embodiments, the viral vector can comprise at the 5’ end of the TR or ITR, and / or at the 3’ end of the TR or ITR, or between the TRs or ITRs, one or more cargo nucleic acids that are heterologous to the viral genome. In certain embodiments, the cargo nucleic acid replaces the REP and CAP genes originally present in the AAV genome.

[0107] In some embodiments, the cargo nucleic acid encodes a therapeutic protein or RNA, which is aimed to be delivered to the target or the cell of interest.

[0108] The cargo nucleic acid sequence delivered in the virus vectors of the present disclosure may be any heterologous nucleic acid sequence (s) of interest. Nucleic acids of interest include nucleic acids encoding polypeptides, including therapeutic (e.g., for medical or veterinary uses) or immunogenic (e.g., for vaccines) polypeptides or functional RNAs.

[0109] Optionally, the cargo nucleic acid encodes a secreted polypeptide (e.g., a polypeptide that is a secreted polypeptide in its native state or that has been engineered to be secreted, for example, by operable association with a secretory signal sequence as is known in the art) .

[0110] Alternatively, the cargo nucleic acid provided herein may encode an antisense nucleic acid, a ribozyme (e.g., as described in U.S. Pat. No. 5,877,022) , RNAs that effect spliceosome-mediated / ram-splicing, interfering RNAs (RNAi) including siRNA, shRNA or miRNA that mediate gene silencing, and other non-translated RNAs, such as guide RNAs, and the like. Exemplary untranslated RNAs include RNAi against PCSK9 mRNA, RNAi against transthyretin mRNA, RNAi against a multiple drug resistance (MDR) mRNA (e.g., to treat and / or prevent tumors and / or for administration to the heart to prevent damage by chemotherapy) , RNAi against myostatin mRNA (e.g., for Duchenne muscular dystrophy) , RNAi against VEGF mRNA (e.g., to treat and / or prevent tumors) , RNAi against phospholamban mRNA (e.g., to treat cardiovascular disease) ; phospholamban inhibitory or dominant-negative molecules such as phospholamban S 16E (e.g., to treat cardiovascular disease) , RNAi to adenosine kinase (e.g., for epilepsy) , and RNAi directed against pathogenic organisms and viruses (e.g., hepatitis B and / or C virus, human immunodeficiency virus, CMV, herpes simplex virus, human papilloma virus, etc. ) .

[0111] In some embodiments, the cargo nucleic acid provided herein can comprise a nucleic acid sequence that directs gene editing. For example, the nucleic acid may encode a guide RNA. In some embodiments, the guide RNA is a single guide RNA (sgRNA) comprising a crRNA sequence and a tracrRNA sequence. In some embodiments, the cargo nucleic acid provided herein may encode a nuclease. In some embodiments, the nuclease is a zinc-finger nuclease, a homing endonuclease, a TALEN (transcription activator-like effector nuclease) , a NgAgo (agronaute endonuclease) , a SGN (structure-guided endonuclease) , a RGN (RNA-guided nuclease) , or modified or truncated variants thereof. In some embodiments, the RNA-guided nuclease is a Cas9 nuclease, a Cas12 (a) nuclease (Cpf1) , a Cas12b nuclease, a Cas12c nuclease, a TrpB-like nuclease, a Cas13a nuclease (C2c2) , a Cas13b nuclease, or modified or truncated variants thereof. In some embodiments, the Cas9 nuclease is isolated or derived from S. pyogenes or S. aureus.

[0112] In some embodiments, the cargo nucleic acid provided herein can encode an immunogenic polypeptide, e.g., useful for vaccination. An immunogenic polypeptide can be any polypeptide suitable for eliciting an immune response and / or protecting the subject against an infection and / or disease, including, but not limited to, microbial, bacterial, protozoal, parasitic, fungal and / or viral infections and diseases. Alternatively, the immunogenic polypeptide can be any tumor or cancer cell antigen. Optionally, the tumor or cancer antigen is expressed on the surface of the cancer cell. The nucleic acid may encode any immunogen of interest known in the art including, but not limited to, immunogens from human immunodeficiency virus (HIV) , HPV, simian immunodeficiency virus (SIV) , influenza virus, HIV or SIV gag proteins, tumor antigens, cancer antigens, bacterial antigens, viral antigens, and the like.

[0113] AAV vectors can be constructed using methods known in the art. General principles of rAAV vector construction are known in the art. See, e.g., Carter, 1992, Current Opinion in Biotechnology, 3: 533-539; and Muzyczka, 1992, Curr. Top. Microbiol. Immunol., 158: 97-129. For example, a cargo nucleic acid can be directly inserted between the ITRs of an AAV genome in which the Rep gene and / or Cap gene have been deleted. Other portions of the AAV genome can also be deleted, so long as a sufficient portion of the ITRs remain to allow for replication and packaging functions. Such constructs can be designed using techniques well known in the art. See, e.g., U.S. Pat. Nos. 5,173,414 and 5,139,941; International Publication Nos. WO 92 / 01070 (published Jan. 23, 1992) and WO 93 / 03769 (published Mar. 4 1993) ; Lebkowski et al. (1988) Molec. Cell. Biol. 8: 3988-3996; Vincent et al. (1990) Vaccines 90 (Cold Spring Harbor Laboratory Press) ; Carter, B. J. (1992) Current Opinion in Biotechnology 3: 533-539; Muzyczka, N. (1992) Current Topics in Microbiol. and Immunol. 158: 97-129; Kotin, R. M. (1994) Human Gene Therapy 5: 793-801; Shelling and Smith (1994) Gene Therapy 1: 165-169; and Zhou et al. (1994) J. Exp. Med. 179: 1867-1875. Alternatively, AAV ITRs can be excised from the viral genome or from an AAV vector containing the same, and fused to 5’ and 3’ of a cargo nucleic acid using standard ligation techniques.

[0114] In certain embodiments, the AAV virus vector of the present disclosure can also encompass AAV virus particles. A “virus particle” as used herein means a viral genome packaged within a viral capsid. The viral genome in the virus particle can be a modified viral genome such that it may lack some of the native viral sequences and / or may contain some sequences heterologous to the native viral genome. AAV virus particles can be produced by introducing an AAV expression vector into a suitable host cell using known techniques, such as by transfection, together with other necessary machineries such as plasmids encoding AAV cap / rep gene, and helper genes provided by either adeno or herpes viruses (see, for example, M.F. Naso et al, BioDrugs, 31 (4) : 317-334 (2017) , which are incorporated herein to its entirety) . The AAV expression vector can be expressed in the host cell and packaged into virus particles.

[0115] The cargo nucleic acid can further comprise one or more regulatory sequences operably linked to the nucleic acid encoding the therapeutic protein or RNA. The term “operably linked” as used herein means that the encoding sequence is directly or indirectly linked to or associated with one or more regulatory sequences in the exogenous nucleic acid, in a manner that allows expression of the protein of interest from the encoding sequence in the cell. The encoding sequence together with the regulatory sequences can be referred to herein as an expression cassette. In certain embodiments, the exogenous nucleic acid can be in the form of an expression vector. Example of transcription regulatory elements include, one or more promoters and / or enhancers and, optionally, a polyadenylation sequence and / or one or more introns inserted between exons of the protein-coding sequence.

[0116] The term “regulatory sequence” as used herein refers to any nucleotide sequence that is necessary or advantageous for the expression of an encoding sequence. A regulatory sequence may include, but is not limited to, one or more promoters, enhancers, transcription terminators, polyadenylation sequences, internal ribosome entry sites, and / or one or more introns inserted between exons of the protein-coding sequence. c. Methods of Producing the Virus Vectors

[0117] The present disclosure further provides methods of producing the virus vectors provided herein.

[0118] In one embodiment, the present disclosure provides a method of producing a virus vector, the method comprising providing to a cell: (a) a nucleic acid comprising at least one TR sequence (e.g., AAV TR sequence) , and (b) AAV sequences sufficient for replication of the nucleic acid template and encapsulation into AAV capsids (e.g., AAV rep sequences and AAV cap sequences encoding the AAV capsids of the disclosure) . Optionally, the nucleic acid further comprises at least one cargo nucleic acid. In particular embodiments, the nucleic acid comprises two AAV ITR sequences, which are located 5’ and 3’ to the cargo nucleic acid (if present) , although they need not be directly contiguous thereto.

[0119] The nucleic acid and AAV rep and cap sequences are provided under conditions such that virus vector comprising the nucleic acid packaged within the AAV capsid is produced in the cell. The method can further comprise the step of collecting the virus vector from the cell. The virus vector can be collected from the medium and / or by lysing the cells.

[0120] In one embodiment, the present disclosure provides a method of producing a virus vector provided herein with modulated binding affinity to the target or the cell of interest, comprising: a) introducing at least one peptide insertion provided herein at one or more sites as disclosed herein on an AAV capsid protein; b) detecting the binding of the mutated AAV capsid protein to the target or the cell of interest; and c) selecting the modified AAV capsid protein that has the desired binding affinity to the target or the cell of interest compared to the non-mutated counterpart AAV capsid protein.

[0121] In some embodiments, the method further comprises d) testing whether the at least one peptide insertion is presented on the surface of the modified AAV capsid protein, and / or e) testing whether the at least one peptide insertion on the modified AAV capsid can be recognized and captured by its binding partner (e.g., an antibody that specifically binds to the peptide, or a target receptor that specifically binds to the peptide) .

[0122] In some embodiments, the method further comprises f) testing the viral production of the AAV virus comprising the modified AAV capsid protein.

[0123] This comprehensive approach presents a platform technology that can be applied to modifying any AAV capsid. Application of this platform technology yields AAV antigenic variants derived from the original AAV capsid template without loss of transduction efficiency. III. Methods of Delivering Cargo Nucleic Acids to Cells and Subjects

[0124] The virus vectors of the present disclosure are useful for the delivery of nucleic acids to targeted cells in vitro, ex vivo , and in vivo. In particular, the virus vectors can be advantageously employed to deliver or transfer nucleic acids to animal, including mammalian cells. Thus, in some embodiments, a nucleic acid ( “cargo nucleic acid” ) may be encapsulated by a modified capsid protein of the disclosure.

[0125] In general, the virus vectors of the present disclosure can be employed to deliver a cargo nucleic acid encoding a polypeptide or functional RNA to treat and / or prevent any disease state for which it is beneficial to deliver a therapeutic polypeptide or functional RNA. In some embodiments, the virus vectors of the present disclosure can be employed to deliver a cargo nucleic acid encoding a polypeptide or functional RNA to treat and / or prevent a liver disease or disorder.

[0126] The virus vectors according to the present disclosure provide a means for delivering cargo nucleic acids into a broad range of target cells, including dividing and non-dividing cells. The virus vectors can be employed to deliver a nucleic acid of interest to a cell in vitro, e.g., to produce a polypeptide in vitro or for ex vivo gene therapy. The virus vectors are additionally useful in a method of delivering a nucleic acid to a subject in need thereof e.g., to express an immunogenic or therapeutic polypeptide or a functional RNA. In this manner, the polypeptide or functional RNA can be produced in vivo in the subject. The subject can be in need of the polypeptide because the subject has a deficiency of the polypeptide. Further, the method can be practiced because the production of the polypeptide or functional RNA in the subject may impart some beneficial effect.

[0127] As used herein and in the broadest sense, the term “administer” , “administering” or “administration” , refers to giving or dispensing a pharmaceutically active material to a subject in a pharmacologically compatible manner. The term is intended to include “causing to be administered” , which means causing, urging, encouraging, aiding, inducing or directing, directly or indirectly, another party to administer the pharmaceutically active material to the subject. It is noted that in certain embodiments the term is also exchangeable to “deliver” , “delivery” , “delivering” , or alike.

[0128] Exemplary modes of administration include oral, rectal, transmucosal, intranasal, inhalation (e.g., via an aerosol) , buccal (e.g., sublingual) , vaginal, intrathecal, intraocular, transdermal, in utero (or in ovo) , parenteral (e.g., intravenous, subcutaneous, intradermal, intramuscular (including administration to skeletal, diaphragm and / or cardiac muscle) , intradermal, intrapleural, intracerebral, and intraarticular) , topical (e.g., to both skin and mucosal surfaces, including airway surfaces, and transdermal administration) , intralymphatic, and the like, as well as direct tissue or organ injection (e.g., to liver, skeletal muscle, cardiac muscle, diaphragm muscle or brain) . Administration can also be to a tumor (e.g., in or near a tumor or a lymph node) . The most suitable route in any given case will depend on the nature and severity of the condition being treated and / or prevented and on the nature of the particular vector that is being used.

[0129] Dosages of the virus vector and / or capsid to be administered to a subject depend upon the mode of administration, the disease or condition to be treated and / or prevented, the individual subject's condition, the particular virus vector or capsid, and the nucleic acid to be delivered, and the like, and can be determined in a routine manner. Exemplary doses for achieving therapeutic effects are titers of at least about 105, 106, 107, 108, 109, 1010, 1011, 1012, 1013, 1014, 1015 transducing units, optionally about 108-1013 transducing units.

[0130] In particular embodiments, more than one administration (e.g., two, three, four or more administrations) may be employed to achieve the desired level of gene expression over a period of various intervals, e.g., daily, weekly, monthly, yearly, etc.

[0131] As used herein, the term “subject” includes human and non-human animals. Non-human animals include all vertebrates, e.g., mammals and non-mammals, such as non-human primates, mice, rats, cats, rabbits, sheep, dogs, cows, chickens, amphibians, and reptiles. Except when noted, the terms “patient” or “subject” are used herein interchangeably. In certain embodiments, the subject is human. In some embodiments, the subject is a non-human primate. IV. Pharmaceutical Compositions

[0132] In a further aspect, a pharmaceutical composition is provided comprising a virus vector and / or capsid and / or capsid protein of the disclosure in a pharmaceutically acceptable carrier and, optionally, other medicinal agents, pharmaceutical agents, stabilizing agents, buffers, carriers, adjuvants, diluents, etc.

[0133] As used herein and in a broadest sense, the term “pharmaceutical composition” refers to a preparation comprising a therapeutically effective amount of a pharmaceutically active ingredient, and optionally together with pharmaceutically acceptable excipients and / or carriers, etc. The term "pharmaceutically acceptable" as used herein means suited for normal pharmaceutical applications, i.e. giving rise to no serious side effects such as adverse events in subjects. The term “therapeutically effective amount” , or "effective amount" as used herein means a dosage which is sufficient in order for the treatment of the patient to be effective compared with no treatment. As used herein, “effective amount” refers to an amount that brings about a desired effect, such as an amount capable of treating or ameliorating a disease or condition or otherwise capable of producing an intended therapeutic effect (e.g. inducing immunotolerance) .

[0134] The pharmaceutically active ingredient typically require one or more pharmaceutically acceptable carriers or excipients to thereby take a suitable form (i.e. pharmaceutical compositions) and dosage form, in order for the effective administration to subject. As used herein, the term "pharmaceutically acceptable carrier" refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered pharmaceutically active agent. Herein the term "pharmaceutically acceptable excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of the pharmaceutically active ingredient.

[0135] Herein, pharmaceutical compositions suitable for use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. In all cases, the composition must be sterile and stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.

[0136] A pharmaceutically acceptable carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like) , and suitable mixtures thereof. For intravenous administration, for example, suitable carriers may include physiological saline, bacteriostatic water, or phosphate buffered saline (PBS) . The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the internal compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0137] Pharmaceutical compositions may comprise, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that comprise, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids.

[0138] In some embodiments, the pharmaceutical composition provided herein comprise a therapeutically effective amount of virions in admixture with a pharmaceutically acceptable carrier and / or excipient, for example saline, phosphate buffered saline, phosphate and amino acids, polymers, polyols, sugar, buffers, preservatives and other proteins. Exemplary amino acids, polymers and sugars and the like are octylphenoxy polyethoxy ethanol compounds, polyethylene glycol monostearate compounds, polyoxyethylene sorbitan fatty acid esters, sucrose, fructose, dextrose, maltose, glucose, mannitol, dextran, sorbitol, inositol, galactitol, xylitol, lactose, trehalose, bovine or human serum albumin, citrate, acetate, Ringer's and Hank's solutions, cysteine, arginine, carnitine, alanine, glycine, lysine, valine, leucine, polyvinylpyrrolidone, polyethylene and glycol. In certain embodiments, this formulation is stable for at least six months at 4℃.

[0139] In some cases, the unit dose of the pharmaceutical composition of the disclosure may be measured as pfu (plaque forming units) . In some cases, the pfu of the unit dose of the pharmaceutical composition of the disclosure comprising the modified AAV may be above 1×108 to about 1×1014 pfu.

[0140] Compositions provided herein may comprise inorganic or organic buffers (e.g., sodium or potassium salts of phosphate, carbonate, acetate, or citrate) and pH adjustment agents (e.g., hydrochloric acid, sodium or potassium hydroxide, salts of citrate or acetate, amino acids and their salts) antioxidants (e.g., ascorbic acid, alpha-tocopherol) , surfactants (e.g., polysorbate 20, polysorbate 80, polyoxyethylene9-10 nonyl phenol, sodium desoxycholate) , solution and / or cryo / lyo stabilizers (e.g., sucrose, lactose, mannitol, trehalose) , osmotic adjustment agents (e.g., salts or sugars) , antibacterial agents (e.g., benzoic acid, phenol, gentamicin) , antifoaming agents (e.g., polydimethylsilozone) , preservatives (e.g., thimerosal, 2-phenoxyethanol, EDTA) , polymeric stabilizers and viscosity-adjustment agents (e.g., polyvinylpyrrolidone, poloxamer 488, carboxymethylcellulose) and co-solvents (e.g., glycerol, polyethylene glycol, ethanol) .

[0141] Compositions according to the invention may comprise pharmaceutically acceptable excipients. The compositions may be made using conventional pharmaceutical manufacturing and compounding techniques to arrive at useful dosage forms. Techniques suitable for use in practicing the present invention may be found in Handbook of Industrial Mixing: Science and Practice, Edited by Edward L. Paul, Victor A. Atiemo-Obeng, and Suzanne M. Kresta, 2004 John Wiley &Sons, Inc.; and Pharmaceutics: The Science of Dosage Form Design, 2nd Ed. Edited by M. E. Auten, 2001, Churchill Livingstone. In an embodiment, compositions are in a sterile saline solution for injection together with a preservative.

[0142] In the following, one example is provided as one specific embodiment of the methods and kits provided in the present disclosure. It is of note that the example is for illustration purpose only and does not limit the scope of the present disclosure. EXAMPLE 1. Plasmid construction

[0143] Plasmid construction

[0144] The plasmid carrying AAV2 ITR and the coding sequence for AAV2 Rep protein and AAV9 capsid VP1 protein was synthesized by Azenta (Azenta Life Sciences, Burlington, USA) . DNA fragments encoding Strep-tag II (TGGAGCCACCCCCAGTTCGAGAAG) , c-Myc tag (GCTGCTGAGCAGAAGCTGATCAGCGAAGAGGACCTGGCTGCT) , and HA tag (GCTGCCTACCCCTACGACGTGCCTGATTACGCC) were PCR amplified and inserted at different sites (as set forth in Table 1 below) of AAV9 VP1 proteins using Golden Gate cloning.

[0145] Virus production and purification

[0146] Adherent HEK 293T cells were cultured in 15 cm plates using Dulbecco’s Modified Eagle's Medium (Gibco, ThermoFisher Scientific) with 10%fetal bovine serum (Cellmax, Beijing, China) supplemented with 2 mmol / l GlutaMAX (Gibco, ThermoFisher Scientific) . AAV virus was produced with Polyethylenimine Max (PEI Max) -mediated triple transfection of 293T cells.

[0147] At harvest, culture media were collected and clarified by depth filtration with 0.04-0.6 micron Cobetter polypropylene membrane (Hangzhou Cobetter Filtration Equipment LLC, Hangzhou, China) . Cell lysates were then centrifuged to remove debris, treated with benzonase, and loaded onto a G25 size-exclusion chromatography followed by Cytiva Capto Core 400 column purification. Fractions containing AAV were pooled and concentrated with Sartorius Vivaspin Turbo 15 Centrifugal Concentrators (Sartorius Stedim Biotech GmbH, Goettingen, Germany) .

[0148] Viral titers were determined with qPCR using the Applied Biosystems QuantStudio 5 Real-Time PCR System or ddPCR using a Bio-Rad QX200 AutoDG Droplet Digital PCR system.

[0149] Determination of intermolecular binding kinetics

[0150] Intermolecular binding kinetics was analyzed on the GatorPrime biolayer interferometry system (Gator Bio, Palo Alto, California, USA) , a label-free analysis instrument based on the biolayer interferometry technology. Antibodies were purchased from the following commercial resources: anti-c-Myc monoclonal antibody from Sino Biological (Cat#100029-MM07) , anti-HA tag antibody from Biodragon (Cat#B1003) , and anti-Strep-tag II antibody from Novus Biologicals (Cat#NBP2-43719) . Antibodies were loaded on the instrument through an anti-mouse IgG Fc probe (Gator Bio, Cat#20-5046) . Novel AAV samples were then analyzed along with wildtype AAV9 control and / or Q buffer control that only contains agents to decrease nonspecific binding and background signal of crude samples.

[0151] Pulldown assay

[0152] For pulldown assay with Strep-tag II, 1E9 Vg AAV virus was resuspended in 200μl binding buffer (10 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 0.1%PF-68, pH 8.0) and mixed well with 20μl magnetic beads from BeaverBeads Magrose Strep-Tactin KIT (Cat#70808-K10, BEAVER biomedical, Suzhou, China) . After the beads were washed twice with 500μl binding buffer, beads-bound AAV was eluted twice with the binding buffer supplemented with 2.5mM D-Desthiobiotin (MedChemExpress, Monmouth Junction, New Jersey, USA) and once with the binding buffer supplemented with 12.5mM D-Desthiobiotin. At the final step, the beads was incubated with the binding buffer supplemented with 12.5mM D-Desthiobiotin for 30min to recover any tightly bound AAV virus.

[0153] For pulldown assay with c-Myc tag, 1E9 Vg AAV virus was resuspended in 200μl binding buffer (10 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 0.1%PF-68, pH 8.0) and mixed well with 10μl Pierce anti-c-Myc magnetic beads (Cat#88842, Thermo Scientific) . After beads were washed with 500μl binding buffer, beads-bound AAV was eluted once with 100μl binding buffer supplemented with 0.5mg / ml c-Myc peptide (Cat#P9805-25mg, Beyotime Biotechnology, Shanghai, China) , once with 100μl binding buffer supplemented with 2.5mg / ml c-Myc peptide, and once with 100μl binding buffer supplemented with 5mg / ml c-Myc peptide. At the final step, the beads were treated with proteinase K (Roche) to remove proteins and recover any leftover AAV DNA.

[0154] Results

[0155] Simultaneous peptide insertion at two different sites of VP capsid proteins was first tested with the following combinations of locations using Strep-tag II and c-Myc tag (Table 1) : Note:a Site numbers represent amino acid positions according to VP1 numbering of AAV9.  Based on the protein sequence alignment, the sites 264, 452, 498, 550, and 586 of AAV9 VP1 correspond to AAV2 VP1 numbering 262, 450, 497, 549, and 585, respectively.

[0156] AAV was produced with the modified capsid DM1, DM2, DM3, DM4, DM5, DM6, DM8, DM9, DM10, and DM11 using the three-plasmid transfection system, in parallel with the wild-type AAV9 capsid. The amount of the virus was accurately determined with ddPCR. As shown in Figure 1, capsid DM3, DM5, DM6, or DM10 yielded lower than 10%of normal AAV production, as compared with the wildtype AAV9, indicating that the simultaneous insertion of Strep-tag II and c-Myc tag at site combinations of #3, #5, #6, or #10 might interfere with AAV9 production. In contrast, the simultaneous insertion of these two tags at site combinations of 1, 2, 4, 8, 9, and 11 had a much milder impact on viral production and yielded more than 50%of normal AAV9 production.

[0157] Next, mutant AAVs with the modified capsids DM1, DM2, DM4, DM8, DM9, and DM11 were purified and tested for each tag’s ability to bind to its corresponding antibody on Gator system. All mutant AAVs could be loaded with an anti-Strep-tag antibody, implying that Strep tags on these mutant AAVs were well presented at the surface of the viral particles. Next, the loaded AAVs were tested for their binding activities to two anti-c-Myc antibodies. The results were summarized in Figures 2A and 2B. As compared to the wildtype AAV9 (sample P8) , all of the mutant AAVs displayed strong binding activities to anti-Myc Tag antibodies. These results indicate that, in all of the five selected mutant AAVs with double insertions, both Strep-tag II and c-Myc tag were well presented at the surface of the viral particles.

[0158] These results were further confirmed with a pull-down assay using antibody-conjugated magnetic beads. As shown in Figure 3, all of the mutant AAVs could be bound by Strep-Tactin magnetic beads, with the DM4 mutant displaying the strongest binding activity. Also, all of the mutant AAVs bound to anti-c-Myc magnetic beads very well (Figure 4) . As a comparison, in the control experiment with the wildtype AAV9, neither type of magnetic beads could bind to AAV9. EXAMPLE 2

[0159] To further explore the simultaneous insertion of three peptides, an HA tag was introduced at two different site combinations, as shown in the table below (Table 2) . Note:a Site numbers represent amino acid positions according to VP1 numbering of AAV9.  Based on the protein sequence alignment, the sites 264, 452, 498, and 586 of AAV9 VP1 correspond to AAV2 VP1 numbering 262, 450, 497, and 585, respectively.

[0160] Both mutant HA1 and HA2 AAVs were produced in parallel with the wild-type AAV9. As shown in Figure 5, virus production was only mildly impaired with the simultaneous insertion of Strep-tag II, c-Myc and HA tag at three different locations.

[0161] Finally, these two mutant AAVs with the insertion of three peptides were purified and tested for each tag’s binding kinetics to its corresponding antibody on GatorPrime system. Both mutant AAVs were efficiently loaded through an anti-Strep-tag antibody and then tested for their abilities to bind to either an anti-c-Myc antibody or an anti-HA tag antibody. As shown in Figures 6A, 6B and 6C, wildtype AAV9 or Q buffer-only mock control displayed little binding to either anti-Strep tag antibody, or anti-c-Myc antibody, or anti-HA tag antibody. In stark contrast, both HA1 and HA2 mutant AAVs exhibited a strong binding to an anti-Strep tag antibody (Figure 6A) , an anti-c-Myc antibody (Figure 6B) , and an anti-HA tag antibody (Figure 6C) very well. These results indicate that these three tags were well presented at the surface of the viral particles and provides the proof-of-concept that the sites utilized to introduce these tags can be used simultaneously for peptide insertions with only mild impact on viral production and little interference on peptide presentation.

[0162] The sites 452, 498, and 586 are all in one of the variable regions that can tolerate certain amino acid changes and are flexible in structures. Insertions at adjacent positions were tested to explore the possibility of achieving comparable or equivalent effects at such adjacent positions. Strep-II tag was inserted into these sites individually, yield of production was measured by qPCR and binding activities of the mutant AAVs to anti-Strep-tag antibody were evaluated by GatorPrime system using wild-type AAV9 as a control in parallel. The results were summarized in the following table (Table 3) . Note:a Site numbers represent amino acid positions according to VP1 numbering of  AAV9.b-denotes no binding at all, while ++++, +++, ++, and + denote super strong  binding, strong binding, weaker binding and very weak binding, respectively. Based on these results, it is proposed that the functional equivalent sites of site 586  comprise the sites 587, 588 and 589; and that the functional equivalent sites of site 452 comprise the sites 453, 454, 455 and 456; and that the functional equivalent sites of site 498 comprise site 492 and site 493.

Claims

1.A modified Adeno-Associated Virus (AAV) capsid protein comprising at least one peptide insertion at one or more sites selected from the group consisting of positions 264, 452, 498, 550, and 586 or any functional equivalent sites thereof, wherein the numbering corresponds to the wildtype AAV9 VP1 protein (SEQ ID NO: 1) .2.The modified AAV capsid protein of claim 1, wherein the peptide insertion comprises at most 15, 20, 25, 30, 35, 40, 45 or 50 amino acid residues.3.The modified AAV capsid protein of claim 1 or 2, wherein the peptide insertion is of a length of 2 to 40, 2 to 30, 2 to 20, 2 to 19, 2 to 18, 2 to 17, 2 to 16, 2 to 15, or 2 to 14 amino acid residues.4.The modified AAV capsid protein of any one of claims 1-3, wherein the peptide insertion alters binding of the modified AAV capsid protein to a target compared to its unmodified counterpart.5.The modified AAV capsid protein of claim 4, wherein the target is a receptor expressed on a cell of interest.6.The modified AAV capsid protein of claim 5, wherein the cell of interest is a natural host for AAV.7.The modified AAV capsid protein of claim 6, wherein the peptide insertion reduces or substantially eliminates binding of the modified AAV capsid protein to the target, compared to its unmodified counterpart.8.The modified AAV capsid protein of claim 5, wherein the cell of interest is not a natural host for AAV.9.The modified AAV capsid protein of claim 8, wherein the peptide insertion confers or enhances binding of the modified AAV capsid protein to the target or to the cell of interest, compared to its unmodified counterpart.10.The modified AAV capsid protein of any one of claims 1-9, wherein the modified AAV capsid protein does not substantially reduce production of an AAV comprising the modified AAV capsid protein relative to its unmodified counterpart.11.The modified AAV capsid protein of any one of claims 1-10, wherein the at least one peptide insertion comprises a first peptide insertion at a first site selected from the group consisting of positions 264, 452, 498, 550, and 586.12.The modified AAV capsid protein of claim 11, wherein the at least one peptide insertion further comprises a second peptide insertion at a second site, and the second site is different from the first site.13.The modified AAV capsid protein of claim 12, wherein the first site and the second site are selected respectively from the group consisting of positions 264, 452, 498, 550, and 586.14.The modified AAV capsid protein of any one of claims 11-13, wherein the first site is selected from the group consisting of positions 264, 452, 498, and 586.15.The modified AAV capsid protein of any one of claims 12-14, wherein the second site is selected from the group consisting of positions 264, 452, and 498.16.The modified AAV capsid protein of any one of claims 12-15, wherein the first site and the second site are at a pair of sites selected from the group consisting of:a) positions 264 and 452;b) positions 264 and 498;c) positions 452 and 498;d) positions 586 and 452;e) positions 586 and 498; andf) positions 586 and 264.17.The modified AAV capsid protein of any one of claims 12-16, wherein the at least one peptide insertion further comprises a third peptide insertion at a third site, and the third site is different from the first site and the second site.18.The modified AAV capsid protein of claim 17, wherein the third site is selected from the group consisting of positions 264, 452, 498, 550, and 586.19.The modified AAV capsid protein of claim 17 or 18, wherein the first site, the second site and the third site are selected respectively from the group consisting of positions 264, 452, 498, 550, and 586.20.The modified AAV capsid protein of any one of claims 17-19, wherein the first site, the second site and the third site are a group of sites selected from the group consisting of:a) positions 264, 452 and 498, andb) positions 452, 498 and 586.21.The modified AAV capsid protein of any one of claims 12-16, wherein the first peptide insertion and the second peptide insertion each comprises a different peptide fragment, optionally wherein the first peptide insertion reduces or substantially eliminates binding of the modified capsid protein to a first target, and the second peptide insertion confers or enhances binding of the modified capsid protein to a second target.22.The modified AAV capsid protein of any one of claims 1-21, wherein the functional equivalent site of position 452 comprises sites 453, 454, 455 and 456, the functional equivalent site of position 498 comprises sites 492 and 493, and / or the functional equivalent site of position 586 comprises sites 587, 588 and 589.23.The modified AAV capsid protein of any one of claims 17-20, wherein the first peptide insertion, the second peptide insertion and the third peptide insertion each comprises a different peptide fragment.24.The modified AAV capsid protein of any one of claims 1-23, wherein the peptide insertion comprises an amino acid sequence selected from the group consisting of: SEQ ID NOs: 2-4.25.The modified AAV capsid protein of any one of claims 1-24, wherein the peptide acid insertion is inserted in addition to or as a replacement of the wildtype protein.26.The modified AAV capsid protein of any one of claims 1-25, wherein the AAV capsid protein is of an AAV serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV12, AAV843, AAVbb2, AAVcyS, AAVrh10, AAVrh20, AAVrh39, AAVrh43, AAVrh64, AAVhu37, AAV3B, AAVhu48, AAVhu43, AAVhu44, AAVhu46, AAVhu19, AAVhu20, AAVhu23, AAVhu22, AAVhu24, AAVhu21, AAVhu27, AAVhu28, AAVhu29, AAVhu63, AAVhu64, AAVhu13, AAVhu56, AAVhu57, AAVhu49, AAVhu58, AAVhu34, AAVhu45, AAVhu47, AAVhu51, AAVhu52, AAVhu T41, AAVhu S17, AAVhu T88, AAVhu T71, AAVhu T70, AAVhu T40, AAVhu T32, AAVhu T17, AAVhu LG15, AAVhu9, AAVhu10, AAVhu11, AAVhu53, AAVhu55, AAVhu54, AAVhu7, AAVhu18, AAVhu15, AAVhu16, AAVhu25, AAVhu60, AAVch5, AAVhu3, AAVhu1, AAVhu4, AAVhu2, AAVhu61, AAVrh62, AAVrh48, AAVrh54, AAVrh55, AAVcy2, AAVrh35, AAVrh37, AAVrh36, AAVcy6, AAVcy4, AAVcy3, AAVcy5, AAVrh13, AAVrh38, AAVhu66, AAVhu42, AAVhu67, AAVhu40, AAVhu41, AAVrh40, AAVrh2, AAVbb1, AAVhu17, AAVhu6, AAVrh25, AAVpi2, AAVpi3, AAVrh57, AAVrh50, AAVrh49, AAVhu39, AAVrh58, AAVrh61, AAVrh52, AAVrh53, AAVrh51, AAVhu14, AAVhu31, AAVhu32, AAVrh34, AAVrh33, AAVrh32, Avian AAV ATCC VR-865, Avian AAV strain DA-1 or Bovine AAV.27.The modified AAV capsid protein of any one of claims 1-26, wherein the AAV capsid protein comprises the amino acid sequence of SEQ ID NOs: 1 and 5-16, with the exception of the at least one peptide insertion at the one or more sites.28.A polynucleotide encoding the modified AAV capsid protein of any one of claims 1-27.29.An expression vector comprising the polynucleotide of claim 28.30.A cell comprising the polynucleotide of claim 28 or the expression vector of claim 29.31.An AAV capsid comprising the modified AAV capsid protein of any one of claims 1-27.32.An AAV virus vector comprising the AAV capsid of claim 31.33.The AAV virus vector of claim 32, further comprising a nucleic acid comprising at least one terminal repeat sequence, wherein the nucleic acid is encapsulated by the AAV capsid.34.The AAV virus vector of claim 33, wherein the nucleic acid further comprises a cargo nucleic acid operably linked to the at least one terminal repeat sequence.35.The AAV virus vector of claim 34, wherein the cargo nucleic acid encodes a therapeutic protein or RNA.36.A pharmaceutical composition comprising the AAV virus vector of any one of claims 32-35, and a pharmaceutically acceptable carrier.37.[Corrected under Rule 26, 24.01.2025]A method of delivering a cargo nucleic acid to a cell, comprising contacting the cell with the AAV virus vector of claim 34 or 35 under condition.38.A method of delivering a cargo nucleic acid to a subject, comprising administering to the subject an effective amount of the AAV virus vector of claim 34 or 35 or the pharmaceutical composition of claim 36.39.A method of treating a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the AAV virus vector of claim 34 or 35 or the pharmaceutical composition of claim 36.40.A method of producing an AAV vector that has substantially no impact on viral production, comprising, a) inserting a short peptide into a variety of positions in VP1 protein to produce a library of modified AAV vectors; b) determining viral production; c) identifying the modified AAV vector with substantially retained viral production.