Polynucleotide construct capable of improving expression effect of target polypeptide and use thereof

By reducing the expression level and enzyme activity of selective markers in the polynucleotide constructs, and using the wheyside-5'-phosphate decarboxylase mutant as the screening marker, the high cost and complexity of screening markers in the prior art were solved, and efficient screening of high copy number host cells was achieved, improving the yield and enzyme activity of the target polypeptides, and promoting industrialized protein production.

WO2025140482A1PCT designated stage expired Publication Date: 2025-07-03NANJING BESTZYME BIO ENG CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/142987
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-28
Filing Date
2024-12-27
Publication Date
2025-07-03

AI Technical Summary

Technical Problem

When the prior art improves protein yield, commonly used screening labeling methods have problems such as high cost, safety hazards and complex operation, and it is difficult to accurately screen out host cells with high copy number, affecting the efficiency of industrialized protein production.

Method used

By reducing the expression level and enzyme activity of selective markers in polynucleotide constructs, using key enzymes related to host cell survival as screening markers, we designed wheyside-5'-phosphate decarboxylase mutants to reduce their expression level and enzyme activity, and combined with nutritional defective screening, we efficiently screened host cells with high copy number.

Benefits of technology

It has achieved low-copy-number host cells screening at low cost and efficiently, significantly improving the yield and enzyme activity of the target peptides, and improving the efficiency of industrialized protein production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024142987_03072025_PF_FP_ABST
    Figure CN2024142987_03072025_PF_FP_ABST
Patent Text Reader

Abstract

A polynucleotide construct capable of improving the expression effect of a target polypeptide and the use thereof. The polynucleotide construct comprises a first polynucleotide encoding a selective marker, and one or more second polynucleotides encoding the target polypeptide; wherein the selective marker is selected from key enzymes associated with the survival of a host cell. Compared to a selective marker encoded by a wild-type encoding gene, the selective marker encoded by the first polynucleotide has a lower expression level and / or a lower enzyme activity. By means of reducing the expression level and / or enzyme activity of the selective marker in the polynucleotide construct, a host cell comprising high copy number of the target polypeptides can be efficiently screened out in a low-cost manner, and the yield and enzyme activity of the target polypeptide can be significantly increased, which has great guiding significance in the industrial production process of proteins.
Need to check novelty before this filing date? Find Prior Art

Description

Polynucleotide construct capable of improving target polypeptide expression effect and its application

[0001] Cross-reference information

[0002] This application claims priority to Chinese patent application No. 2023118464758 filed on December 28, 2023, the entire contents of which are incorporated herein by reference. Technical Field

[0003] The present invention belongs to the field of genetic engineering, and in particular relates to a polynucleotide construct capable of improving the expression effect of a target polypeptide and its application. Background Art

[0004] Protein production has widespread applications in life sciences, biotechnology, medicine, and materials science. To achieve high-yield industrial protein production, biotechnologists often utilize selectable marker genes to integrate multiple copies of a target gene into host cells. Because target gene copy number often positively correlates with final product yield, increasing the number of target gene copies in microbial production strains is a common approach. Selectable marker genes enable transformants to acquire new genetic traits not previously possessed by their native host, and are essential components of genetic transformation vectors.

[0005] Currently, common selection markers fall into two main categories: the first is drug-resistance marker genes, the introduction of which enables the recipient bacteria to grow normally under certain drug concentrations, thus exhibiting drug resistance. Drug selection markers are simple and convenient. Over the past 20 years, antibiotic selection markers have been widely used in many host strains and have proven to be an effective way to develop high-yield strains in a relatively short period of time. However, the high cost and safety of antibiotics cannot be ignored: horizontal gene transfer can lead to host resistance, posing potential hazards to humans and their environment; herbicide selection marker genes used in genetic transformation may also alter the genetic diversity of organisms, causing ecological harm. The second category is nutritional selection, including nitrogen and carbon source nutritional genes and nutritional deficiency complementation marker genes. By complementing the mutant genes of the recipient bacteria with the transferred marker genes, the recipient bacteria can be restored to wild type. The most widely used genes in this category include amdS, niaD, argB, and pyrG. Among these genes, the pyrG gene encodes orotidine-5'-phosphate decarboxylase, a key enzyme in the synthesis of uracil nucleotides. Inactivation of orotidine-5'-phosphate decarboxylase manifests as uridine or uracil auxotrophy, limiting growth in media supplemented with uridine or uracil. Orotidine-5'-phosphate decarboxylase has been used as an auxotrophic selection marker for over 40 years, ever since Struhl et al. first isolated the gene encoding orotidine-5'-phosphate decarboxylase from Saccharomyces cerevisiae using recombinant DNA technology and used it as a selectable marker to construct a Saccharomyces cerevisiae transformation system.

[0006] In addition, increasing the copy number of the target gene in the microbial manufacturing strain has become an important strategy to increase protein production. This method requires screening strains with higher copy numbers from the transformed microorganisms. The current common screening methods include: (1) Screening colonies with faster growth or better growth from the culture medium through screening markers to obtain strains with higher copy numbers. Although this method is simple and easy to use, it cannot accurately determine the copy number of the target gene. At the same time, it may select some strains with growth promotion or increased antibiotic resistance, and it may not necessarily accurately screen strains with high copy numbers. (2) Comprehensively evaluate the copy number of the target gene in microorganisms through fluorescence quantitative PCR (qPCR), fluorescence in situ hybridization (FISH), next generation sequencing (NGS), flow cytometry and other technologies to help screen strains with higher copy numbers. These methods have high accuracy, but have high requirements for equipment and technicians, and are relatively complicated to operate. The above technical status has imposed certain limitations on the industrial production of proteins. Summary of the Invention

[0007] The first object of the present invention is to provide a polynucleotide construct that can improve the expression effect of a target polypeptide, which contains: a first polynucleotide for encoding a selective marker; and one or more second polynucleotides for encoding a target polypeptide; wherein the selective marker is selected from key enzymes related to the survival of the host cell; compared with the selective marker encoded by the wild-type encoding gene, the selective marker encoded by the first polynucleotide has a lower expression level and / or lower enzyme activity.

[0008] Preferably, compared to the wild-type gene encoding the selectable marker, at least one of the following changes is present in the first polynucleotide: i) the promoter is truncated; ii) one or more nucleotides in the coding region are substituted.

[0009] As a more preferred solution, the substituted site is related to the substrate binding property and / or active catalytic property of the selective marker.

[0010] As a preferred embodiment, the selective marker is selected from key enzymes or mutants thereof related to one or more pathways of nucleotide biosynthesis pathway, amino acid biosynthesis pathway, vitamin synthesis pathway, carbon metabolism pathway, and nitrogen metabolism pathway.

[0011] As a more preferred embodiment, the selective marker is selected from key enzymes encoded by amdS, niaD, argB, pyrG genes or mutants thereof.

[0012] As a preferred embodiment, the first polynucleotide is used to encode orotidine-5′-phosphate decarboxylase or a mutant thereof. Compared with the wild-type gene encoding orotidine-5′-phosphate decarboxylase, the first polynucleotide contains at least one of the following changes a) to b): a) the promoter is truncated; b) one or more nucleotides in the coding region are replaced.

[0013] As a more preferred embodiment, the substituted position is related to the substrate binding property and / or active catalytic property of orotidine-5′-phosphate decarboxylase.

[0014] As a more preferred embodiment, the first polynucleotide contains the changes in a) and b).

[0015] As a preferred embodiment, the promoter in the first polynucleotide is truncated to a length of 50 to 200 bp from the 5' end.

[0016] As a preferred embodiment, the nucleotide sequence of the promoter is as shown in any one of SEQ ID NOs: 61 to 64; or, the nucleotide sequence of the promoter has at least 90% identity with the sequence shown in any one of SEQ ID NOs: 61 to 64, and can reduce the expression level and / or enzyme activity of orotidine-5'-phosphate decarboxylase.

[0017] As a preferred embodiment, relative to the amino acid position of SEQ ID NO: 2, the orotidine-5′-phosphate decarboxylase mutant encoded by the first polynucleotide comprises at least one mutation among S38, D40, K62, H64, T102, L155, M158, Q225, Y227, T212, and I242, and compared with the orotidine-5′-phosphate decarboxylase parent, the orotidine-5′-phosphate decarboxylase mutant has a lower expression level and / or lower enzymatic activity.

[0018] As a preferred embodiment, the orotidine-5′-phosphate decarboxylase mutant comprises at least one of the following mutations: S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, and I242A.

[0019] As a preferred embodiment, the orotidine-5′-phosphate decarboxylase mutant comprises the following mutations: S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, I242A, L155A_M158A, or Q225A_Y227F.

[0020] As a preferred embodiment, the target polypeptide is an aminopeptidase, an amylase, a saccharifying enzyme, a carboxypeptidase, a catalase, a cellobiohydrolase, a cellulase, a chitinase, a cutinase, a cyclodextrin glycosyltransferase, a deoxyribonuclease, an endoglucanase, an esterase, an α-galactosidase, a β-galactosidase, a glucoamylase, an α-glucosidase, a β-glucosidase, a laccase, a lipase, a mannosidase, a mutanase, a glucose oxidase, a pectinase, a peroxidase, a phytase, a polyphenol oxidase, a protease, a ribonuclease, a transglutaminase, a xylanase, a β-xylosidase, a proline-specific protease, a trehalase, a pullulanase, a phospholipase, a mannanase, a lysozyme, a sweet protein, a lactoferrin, a lactoglobulin or a bovine serum albumin.

[0021] As a preferred embodiment, the target polypeptide is fungal amylase or Brazzein sweet protein.

[0022] The second object of the present invention is to provide a recombinant expression vector containing at least one copy of the polynucleotide construct as described in any of the above embodiments.

[0023] As a preferred embodiment, the recombinant expression vector is capable of integrating the polynucleotide construct into the genome of the host cell.

[0024] The third object of the present invention is to provide a host cell containing more than one copy of the polynucleotide construct as described in any of the above embodiments.

[0025] As a preferred embodiment, the host cell has a functional defect that can be complemented by the selectable marker.

[0026] A fourth object of the present invention is to provide an orotidine-5′-phosphate decarboxylase mutant, which comprises at least one mutation among S38, D40, K62, H64, T102, L155, M158, Q225, Y227, T212, and I242 relative to the amino acid position of SEQ ID NO: 2, and has a lower expression level and / or lower enzyme activity than that of the orotidine-5′-phosphate decarboxylase parent.

[0027] As a preferred embodiment, the orotidine-5′-phosphate decarboxylase mutant comprises at least one of the following mutations: S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, and I242A.

[0028] As a preferred embodiment, the orotidine-5′-phosphate decarboxylase mutant comprises the following mutations: S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, I242A, L155A_M158A, or Q225A_Y227F.

[0029] The fifth object of the present invention is to provide an isolated nucleic acid encoding the orotidine-5′-phosphate decarboxylase mutant described in any of the aforementioned embodiments.

[0030] As a preferred embodiment, the isolated nucleic acid further contains a promoter for driving the expression of the orotidine-5′-phosphate decarboxylase mutant, and compared with the natural promoter, the promoter is truncated.

[0031] As a preferred embodiment, the promoter is truncated from the 5' end to a length of 50 to 200 bp.

[0032] As a preferred embodiment, the nucleotide sequence of the promoter is as shown in any one of SEQ ID NOs: 61 to 64; or, the nucleotide sequence of the promoter has at least 90% identity with the sequence shown in any one of SEQ ID NOs: 61 to 64, and can reduce the expression level and / or enzyme activity of orotidine-5'-phosphate decarboxylase.

[0033] The sixth object of the present invention is to provide a use of the polynucleotide construct described in any of the aforementioned embodiments, or the recombinant expression vector described in any of the aforementioned embodiments, or the host cell described in any of the aforementioned embodiments, or the orotidine-5′-phosphate decarboxylase mutant described in any of the aforementioned embodiments, or the isolated nucleic acid described in any of the aforementioned embodiments in improving the expression level and / or enzyme activity of a target polypeptide.

[0034] A seventh object of the present invention is to provide a method for producing a target polypeptide, comprising: culturing the host cell described in any of the aforementioned schemes; and optionally recovering the target polypeptide.

[0035] As a preferred solution, the culture medium used to culture the host cells lacks one or more nutrients, so that host cells containing more copies of the polynucleotide construct can be screened out.

[0036] The present invention has discovered that by reducing the expression level and / or enzyme activity of the selectable marker in the polynucleotide construct, host cells containing a high copy number of the target polypeptide can be efficiently screened in a low-cost manner, and the yield and enzyme activity of the target polypeptide can be significantly increased, which has important guiding significance for the industrial production of proteins. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0038] FIG1 is a plasmid map of a nucleic acid construct for target gene expression in an embodiment of the present invention.

[0039] FIG2 shows the difference in enzymatic activity of fungal amylase expressed in Aspergillus oryzae using different nucleic acid constructs in the examples of the present invention.

[0040] FIG3 shows the difference in enzymatic activity of fungal amylase expressed in Aspergillus niger using different nucleic acid constructs in the examples of the present invention.

[0041] FIG4 shows the transcriptional differences of fungal amylase genes between different strains in the examples of the present invention.

[0042] FIG5 shows the difference in enzymatic activity of fungal amylase expressed in Aspergillus oryzae and Aspergillus niger by nucleic acid constructs with different promoter truncations in the examples of the present invention. DETAILED DESCRIPTION

[0043] The following describes specific embodiments of the present invention in detail. It should be understood that the specific embodiments described herein are intended only to illustrate and explain the present invention and are not intended to limit the present invention. Those skilled in the art may make various modifications and variations to the present invention without departing from the scope or spirit of the present invention. For example, features illustrated or described as part of one embodiment may be used in another embodiment to produce further embodiments.

[0044] Terminology

[0045] Unless otherwise indicated, all terms (including technical and scientific terms) used to disclose the present invention have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs. By way of further guidance, the following definitions are provided to better understand the teachings of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0046] The terms "and / or", "or / and", and "and / or" used herein include any one of two or more related listed items, and also include any and all combinations of the related listed items, wherein the arbitrary and all combinations include any combination of two related listed items, any more related listed items, or all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in this application, the technical solution undoubtedly includes technical solutions connected by "logical and" and also undoubtedly includes technical solutions connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution of all being connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the four-item combination of A, B, C, and D (that is, the technical solution of all being connected by "logical AND").

[0047] As used herein, the terms "comprising," "including," and "comprising" are synonymous and are inclusive or open-ended and do not exclude additional, unrecited members, elements, or method steps.

[0048] The recitation of numerical ranges herein by endpoints includes all numbers and fractions subsumed within the range, as well as the recited endpoints.

[0049] Concentration values ​​used in this invention include fluctuations within a certain range. For example, fluctuations within a certain precision range are permitted. For example, for 2%, fluctuations within ±0.1% are permitted. For larger values ​​or values ​​that do not require overly precise control, greater fluctuations are permitted. For example, for 100 mM, fluctuations within ±1%, ±2%, ±5%, etc. are permitted. Regarding molecular weight, fluctuations within ±10% are permitted.

[0050] In the present invention, descriptions such as "plurality" and "multiple" refer to quantities greater than or equal to 2 unless otherwise specified.

[0051] In the present invention, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0052] In the present invention, “preferred”, “better”, “more preferred” and “suitable” are only used to describe implementation methods or examples with better effects. It should be understood that they do not constitute limitations on the scope of protection of the present invention.

[0053] In the present invention, the terms "optionally," "optional," "optionally," "optionally," "optional," and "optional" mean optional or dispensable, i.e., they refer to either option being selected from two parallel options: "with" or "without." If multiple "optional" or "optional" terms appear in a technical solution, unless otherwise specified and there are no contradictions or constraints, each "optional" or "optional" term is independent of the others.

[0054] In the present invention, the term "polynucleic acid construct" refers to a single-stranded or double-stranded nucleic acid molecule isolated from a naturally occurring gene, or modified in a manner that does not otherwise occur in nature to contain a nucleic acid fragment, or synthesized, which contains one or more control sequences.

[0055] In the present invention, the term "selective marker" refers to a key enzyme related to the survival of the host cell, which is used to screen the host cells carrying the polynucleotide encoding the target polypeptide during the transformation or transfection process. Only host cells carrying the polynucleotide encoding the selective marker can grow in the selective culture medium, while host cells that do not carry the polynucleotide encoding the selective marker will be selectively killed or their growth will be inhibited. In specific implementation, the "polynucleotide encoding the selective marker" in the present invention can be a drug resistance marker gene, an auxotrophic complementation marker gene, or other genes that can make the cell have a specific phenotype. Based on safety considerations, in the present invention, it is preferred that the "polynucleotide encoding the selective marker" is an auxotrophic complementation marker gene, more preferably the pyrG gene, which is used to encode orotidine-5'-phosphate decarboxylase.

[0056] In the present invention, the term "coding gene" refers to a gene sequence in the genome of an organism that has a specific function. They contain open reading frames that can be translated into proteins by cells, thereby participating in various biochemical and physiological processes of the organism. The open reading frame begins with a start codon such as ATG, GTG or TTG and ends with a stop codon such as TAA, TAG or TGA. The core part of the coding gene is the coding region (coding sequence), also known as the Exon region, which contains a series of consecutive codons, each corresponding to an amino acid. Through the combination of these codons, the translation process can convert the messenger RNA (mRNA) transcribed from the coding gene into the corresponding protein. In addition to the coding region, other parts of the coding gene also have important functions. For example, the start region (promoter region) of the coding gene contains a promoter (promoter), which can be recognized by transcription factors in the cell and initiate the transcription process. The termination region (termination region) of the coding gene contains a terminator sequence, which can help terminate transcription and release the synthesized mRNA molecule. In addition, the coding gene may also include other control sequences, such as enhancers and inhibitors, which can regulate the level and timing of gene expression. Each control sequence can be endogenous (i.e., from the same gene) or exogenous (i.e., from different genes) to the polynucleotide encoding the polypeptide, or endogenous or exogenous to each other. In some embodiments, these control sequences include, but are not limited to, a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal peptide sequence, and a transcription terminator. Minimally, the control sequence includes a promoter and transcription and translation termination signals. For the purpose of introducing specific restriction enzyme sites to facilitate the connection of the control sequence to the coding region of the polynucleotide encoding the polypeptide, the control sequence can be provided with a linker. "Wild-type coding gene" refers to a gene sequence with a specific function that occurs naturally in the genome of an organism, without any modifications such as mutation, substitution, insertion, or deletion.

[0057] In the present invention, the term "expression" includes any step involved in the production of the polypeptide, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification and secretion.

[0058] As used herein, the term "expression vector" refers to a linear or circular DNA molecule comprising a polynucleotide encoding a polypeptide and operably linked to control sequences for its expression. "Operably linked" means that the control sequences are positioned appropriately relative to the coding sequence of the polynucleotide so that the control sequences direct the expression of the coding sequence.

[0059] As used herein, the term "host cell" refers to any cell type susceptible to transformation, transfection, transduction, or the like with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term "host cell" includes any progeny of a parent cell that differs from the parent cell due to mutations that occur during replication.

[0060] As used herein, the term "isolated" refers to a substance that is in a non-naturally occurring form or environment. Non-limiting examples of isolated substances include: 1) any non-naturally occurring substance; 2) any substance, including but not limited to any enzyme, variant, nucleic acid, protein, peptide, or cofactor, that is at least partially removed from one or more or all of the naturally occurring components with which it is naturally associated; 3) any substance that has been artificially modified relative to a naturally occurring substance; or 4) any substance that has been modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., multiple copies of a gene encoding the substance; use of a stronger promoter than the promoter naturally associated with the gene encoding the substance). The isolated substance may be present in a fermentation broth sample.

[0061] In the present invention, the term "amino acid sequence" is synonymous with the terms "polypeptide", "protein" and "peptide" and is used interchangeably. The conventional one-letter code or three-letter code for amino acid residues is used, wherein the amino acid sequence is presented in the standard amino to carboxyl terminal orientation (i.e., N→C).

[0062] In the present invention, the term "mutation" refers to changing the amino acid at that site to an amino acid different from the natural amino acid. For example, at position 38, it is changed to any amino acid except S, and at position 40, it is changed to any amino acid except D. In the present invention, a "mutant" or "mutant protein" refers to a protein that has differences in amino acid sequence relative to the parent protein. This difference can be manifested in the presence of one or more amino acid substitutions, deletions or insertions at one or more positions in the amino acid sequence. In some examples, the wild-type protein is used as the parent protein and as a reference for sequence comparison. Wild-type protein generally refers to a protein that is naturally produced in nature or a specific species and is dominant in content. In some embodiments, the wild-type orotidine-5'-phosphate decarboxylase comprises the amino acid sequence shown in SEQ ID NO: 2.

[0063] In the present invention, "an amino acid position relative to..." refers to an amino acid position that contributes equally to the function of the compared proteins (enzymes). For example, when the amino acid sequences of the reference amino acid sequence (i.e., the amino acid sequence of SEQ ID NO: 2) are aligned to allow for optimal comparison while taking into account partial homology in primary structure (amino acid sequence) (in this case, gaps can be introduced as needed to optimize the alignment), the amino acid at the position corresponding to a specific amino acid in the reference amino acid sequence can be identified as the "corresponding amino acid." Alternatively, the "corresponding amino acid" can be identified by comparing stereostructures instead of comparing primary structures, or by comparing stereostructures in addition to primary structures. Utilizing stereostructure information can yield highly reliable comparison results. In this case, a method can be employed that compares the atomic coordinates of the stereostructures of multiple enzymes and then aligns them. The stereostructure information of the enzyme to be mutated can be obtained from protein databases commonly used in the art.

[0064] The following nomenclature is used for amino acid substitutions herein: original amino acid, position, and substituted amino acid. For example, a substitution of serine (S) at position S38 with alanine (A) is designated S38A. Multiple amino acid substitutions are separated by a comma (",), e.g., S38A, D40A, and K62A.

[0065] In the present invention, when at least two amino acid substitutions are connected by a "_", it indicates that the amino acids before and after the "_" have mutated simultaneously. As an example, when L155A and M158A mutations occur simultaneously, it is represented as L155A_M158A. Multiple different mutation schemes are separated by ",", such as I242A, L155A_M158A.

[0066] The term "at least one" as used herein encompasses both one and two or more sites. In some embodiments, one skilled in the art may select one amino acid site from "at least one selected from..." for mutation, or may select multiple (e.g., two, three, or four) amino acids for combined mutation, to achieve a mutant with lower expression level and / or lower enzyme activity.

[0067] In the present invention, the term "sequence identity" refers to the correlation between two amino acid sequences or between two nucleotide sequences. When the CLUSTALW algorithm is used for alignment with preset parameters, the specific sequence has at least a certain percentage of amino acid residues that are identical to the amino acid residues of the specified reference sequence. The preset parameters of the CLUSTALW algorithm are: the deletion count is the residues that are different from the reference sequence, including deletions occurring at any end. For example, a variant that lacks five amino acid residues at the C-terminus, a 500 amino acid residue polypeptide has a sequence identity percentage of 99% (495 / 500 identical residues × 100) relative to the parent polypeptide. Such variants are covered by the language "variants having at least 99% sequence identity with the parent."

[0068] In the present invention, brazzein, also known as brazzein, bunazhen sweet protein, or brazzein, refers to a thaumatin protein extracted from the fruit of the West African climbing plant Pentadiplandra brazzeana (Baillon) and described in WO1995031547A1, or a recombinantly produced form thereof. In nature, brazzein occurs in three different forms, with or without a Gln residue or pyroglutamic acid attached to its N-terminus. In the context of the present invention, the wild-type brazzein sequence comprises the amino acid sequence of SEQ ID NO: 65, which lacks a Gln residue or pyroglutamic acid attached to its N-terminus. The brazzein protein described in the present invention may be derived from any source, including wild-type brazzein, naturally occurring mutants thereof, or recombinant brazzein analogs. Production methods are also not limited, including recombinant expression, extraction, chemical synthesis, and in vivo or in vitro production. In one embodiment, the brazilian tamanu protein of the present invention is preferably a recombinant brazilian tamanu protein, which refers to a brazilian tamanu protein produced by a recombinant host cell, and the amino acid sequence of the brazilian tamanu protein is any one of SEQ ID NOs: 65-72, or has a sequence identity of at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or more to SEQ ID NO: 65.

[0069] In the present invention, the term "about" refers to ±10%. As used herein, the term "about" means that the value may deviate from the numerical value by up to 1%, more specifically 5%, more specifically 10%, more specifically 15%, and in some cases up to or below 20%, and the deviation range includes integer values ​​and, if applicable, non-integer values ​​to form a continuous range.

[0070] Polynucleotide constructs

[0071] The present invention relates to a polynucleotide construct comprising: a first polynucleotide encoding a selective marker; and one or more second polynucleotides encoding a target polypeptide; wherein the selective marker is selected from a key enzyme associated with the survival of the host cell; and the selective marker encoded by the first polynucleotide has a lower expression level and / or lower enzymatic activity than the selective marker encoded by the wild-type encoding gene. The present invention unexpectedly discovered that by reducing the expression level and / or enzymatic activity of the selective marker in the polynucleotide construct, host cells containing a high copy number of the target polypeptide can be efficiently screened in a low-cost manner, and the yield and enzymatic activity of the target polypeptide can be significantly increased.

[0072] In some embodiments, the lower expression level refers to an expression level below 75%, preferably below 60%, more preferably below 50%, further preferably below 40%, further preferably below 30%, further preferably below 20%, further preferably below 10%.

[0073] In some embodiments, the lower enzyme activity refers to an enzyme activity of less than 75%, preferably less than 60%, more preferably less than 50%, further preferably less than 40%, further preferably less than 30%, further preferably less than 20%, further preferably less than 10%.

[0074] During specific implementation, those skilled in the art can utilize a variety of means to reduce the expression level of the selective marker and / or the enzyme activity. For example, the amino acid sequence of the encoded protein can be changed by point mutation, thereby reducing its enzymatic activity. By inserting or deleting one or more nucleotides in the gene, the frame shift of the open reading frame of the encoded protein can be caused, resulting in changes in the entire amino acid sequence, thereby reducing the enzyme activity. By changing the promoter region or other control sequences of the gene, the transcription level of the gene can be regulated, resulting in changes in the expression level of the encoded protein, thereby affecting the enzyme activity. By introducing neutral mutations, that is, mutations that do not change the amino acid or function, the enzymatic activity of the protein can be reduced. Such mutations usually occur in regions outside the catalytic site and may cause slight changes in the protein structure, thereby affecting its activity.

[0075] In some embodiments, compared to the wild-type gene encoding the selectable marker, at least one of the following changes is present in the first polynucleotide: i) the promoter is truncated; ii) one or more nucleotides in the coding region are substituted.

[0076] In some embodiments, the first polynucleotide comprises the alteration described in i), while the coding region is unchanged. In some embodiments, the first polynucleotide comprises the alteration described in ii), while the promoter is unchanged. In more preferred embodiments, the first polynucleotide comprises the alteration described in i) and ii).

[0077] In some preferred embodiments, the substituted site is associated with the substrate binding property and / or active catalytic property of the selectable marker.

[0078] In some embodiments, the selectable marker is selected from key enzymes or mutants thereof associated with one or more pathways of nucleotide biosynthesis pathway, amino acid biosynthesis pathway, vitamin synthesis pathway, carbon metabolism pathway, and nitrogen metabolism pathway.

[0079] In some preferred embodiments, the selectable marker is selected from key enzymes encoded by amdS, niaD, argB, pyrG genes or mutants thereof.

[0080] In some embodiments, the first polynucleotide is used to encode orotidine-5′-phosphate decarboxylase or a mutant thereof, and compared to the wild-type encoding gene (pyrG) of orotidine-5′-phosphate decarboxylase, the first polynucleotide contains at least one of the following changes a) to b): a) the promoter is truncated; b) one or more nucleotides in the coding region are replaced.

[0081] In some embodiments, the substituted position is associated with the substrate binding property and / or active catalytic property of orotidine-5'-phosphate decarboxylase.

[0082] In some embodiments, the first polynucleotide comprises the alteration described in a), while the coding region is unchanged. In some embodiments, the first polynucleotide comprises the alteration described in b), while the promoter is unchanged. In more preferred embodiments, the first polynucleotide comprises the alteration described in a) and b).

[0083] In some embodiments, the promoter in the first polynucleotide is truncated to a length of 50 to 200 bp from the 5' end.

[0084] In some specific embodiments, the promoter in the first polynucleotide is truncated to a length of 50 bp, 75 bp, 100 bp, 125 bp, 150 bp, 175 bp or 200 bp from the 5' end.

[0085] In some specific embodiments, the nucleotide sequence of the promoter is as shown in any one of SEQ ID NOs: 61 to 64; or, the nucleotide sequence of the promoter has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with the sequence shown in any one of SEQ ID NOs: 61 to 64, and can reduce the expression level and / or enzymatic activity of orotidine-5'-phosphate decarboxylase.

[0086] In some embodiments, relative to the amino acid position of SEQ ID NO: 2, the orotidine-5′-phosphate decarboxylase mutant encoded by the first polynucleotide (corresponding to the mutation in b)) comprises at least one mutation among S38, D40, K62, H64, T102, L155, M158, Q225, Y227, T212, and I242, and compared with the orotidine-5′-phosphate decarboxylase parent, the orotidine-5′-phosphate decarboxylase mutant has a lower expression level and / or lower enzymatic activity.

[0087] In some embodiments, the orotidine-5′-phosphate decarboxylase mutant comprises at least one of the following mutations: S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, and I242A.

[0088] In some embodiments, the orotidine-5′-phosphate decarboxylase mutant comprises the following mutations: S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, I242A, L155A_M158A, or Q225A_Y227F.

[0089] Using these mutant sequences as selection markers, the activity of fungal amylases integrated into Aspergillus oryzae and Aspergillus niger strains was significantly enhanced. Compared to the parent sequence (i.e., the wild-type encoding gene), the use of mutant selection markers resulted in increases in fungal amylase activity of 121% to 436%. Combination mutants generated by truncation of the selection marker promoter and amino acid mutations further enhanced fungal amylase activity, with increases ranging from 486% to 663%.

[0090] In some embodiments, the orotidine-5′-phosphate decarboxylase mutant has only the aforementioned mutations based on the sequence shown in SEQ ID NO: 2.

[0091] In some embodiments, based on the sequence shown in SEQ ID NO: 2, the orotidine-5′-phosphate decarboxylase mutant has not only the aforementioned mutations, but also some other conservative substitutions, such that the orotidine-5′-phosphate decarboxylase mutant has at least 80%, preferably at least 85%, preferably at least 88%, more preferably at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with the sequence shown in SEQ ID NO: 2. The "conservative substitutions" referred to herein are also referred to as substitutions by "homologous" amino acids, and refer to substitutions in which an amino acid is replaced by an amino acid with a similar side chain, for example, amino acids with basic side chains (such as lysine, arginine, and histidine), amino acids with acidic side chains (such as aspartic acid and glutamic acid), non-charged polar side chain amino acids (such as glycine, asparagine, glutamine, serine, threonine, tyrosine, and cysteine), non-polar side chain amino acids (such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan), β-branched side chain amino acids (such as threonine, valine, and isoleucine), and aromatic side chain amino acids (such as tyrosine, phenylalanine, tryptophan, and histidine). Conservative amino acid substitutions generally have little effect on the activity of the resulting protein.

[0092] In some embodiments, the target polypeptide is an enzyme or a non-enzyme protein.

[0093] In some embodiments, the target polypeptide is an aminopeptidase, an amylase, a saccharifying enzyme, a carboxypeptidase, a catalase, a cellobiohydrolase, a cellulase, a chitinase, a cutinase, a cyclodextrin glycosyltransferase, a deoxyribonuclease, an endoglucanase, an esterase, an α-galactosidase, a β-galactosidase, a glucoamylase, an α-glucosidase, a β-glucosidase, a laccase, a lipase, a mannosidase, a mutanase, a glucose oxidase, a pectinase, a peroxidase, a phytase, a polyphenol oxidase, a protease, a ribonuclease, a transglutaminase, a xylanase, a β-xylosidase, a proline-specific protease, a trehalase, a pullulanase, a phospholipase, a mannanase, a lysozyme, a thaumatin, a lactoferrin, a lactoglobulin, or a bovine serum albumin. In some specific embodiments, the target polypeptide is a fungal amylase or a Brazzein thaumatin. In addition to the target polypeptides specifically listed above, those skilled in the art can also use the polynucleotide construct of the present invention for the expression of a variety of target polypeptides based on the content of the present invention and actual needs, all of which fall within the scope of protection of the present invention.

[0094] During specific implementation, those skilled in the art can combine the above-mentioned solutions with common sense to obtain preferred embodiments of the polynucleotide construct of the present invention.

[0095] Recombinant expression vector

[0096] The present invention also provides a recombinant expression vector comprising at least one copy of the polynucleotide construct as described in any of the above embodiments.

[0097] As a preferred embodiment, the recombinant expression vector is capable of integrating the polynucleotide construct into the genome of the host cell.

[0098] In some embodiments, the control sequences in the recombinant expression vector include a promoter and transcriptional and translational stop signals. In some embodiments, the recombinant expression vector may also contain other control sequences, such as enhancers and repressors. Each control sequence can be endogenous (i.e., from the same gene) or exogenous (i.e., from a different gene) to the polynucleotide encoding the polypeptide, or endogenous or exogenous to each other.

[0099] In some embodiments, various Nucleotide and control sequences can be linked together to produce a recombinant expression vector that can comprise one or more convenient restriction sites, which restriction sites make it possible to insert or replace the polynucleotide of the target polypeptide at the site. Alternatively, the polynucleotide can be expressed by inserting a polynucleotide or a nucleic acid construct comprising the polynucleotide into a suitable expression vector. In the process of constructing an expression vector, the coding sequence of the target polypeptide can be introduced into the vector, and the coding region sequence of the target polypeptide, the coding region sequence of a selective marker (or mutant) and the control sequence can be operably connected, thereby suitably expressing the coding sequence by the control sequence.

[0100] In some embodiments, the recombinant expression vector can be any vector (e.g., a plasmid or virus) that can be readily subjected to recombinant DNA procedures and can cause expression of the polynucleotide. The choice of vector generally depends on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector can be a linear or closed circular plasmid.

[0101] host cells

[0102] The present invention also provides a host cell containing more than one copy of the polynucleotide construct according to any of the preceding embodiments.

[0103] As a preferred embodiment, the host cell has a functional defect that can be complemented by the selectable marker.

[0104] The host cell can be any cell useful in the recombinant production of the polypeptides of the present invention, for example, a fungal cell, a bacterial cell, an insect cell or a mammalian cell.

[0105] In some embodiments, the host cell does not develop into a plant or animal organism.

[0106] As used herein, "fungi" include Ascomycota, Basidiomycota, Chytridiomycota, Zygomycota, Oomycota, and all mitotic fungi. The fungal host cell may be a yeast cell. As used herein, "yeast" includes ascospore-forming yeast, basidiomycota-forming yeast, and yeast belonging to Fungi Deuteromycota.

[0107] In some embodiments, the fungal host cell can be a filamentous fungal cell. "Filamentous fungi" includes all filamentous forms of the subdivision Eumycota and Oomycota. Filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation, and carbon catabolism is obligately aerobic. In contrast, vegetative growth of yeasts, such as Saccharomyces cerevisiae, is by budding of a unicellular thallus, and carbon catabolism can be fermentative.

[0108] In some embodiments, the filamentous fungal host cell can be Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, or the like. thora), Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma cells.

[0109] In some specific embodiments, the filamentous fungal host cell can be Aspergillus oryzae or Aspergillus niger.

[0110] In some embodiments, the bacterial cell may be Escherichia coli or Lactococcus lactis.

[0111] In some embodiments, the insect cell may be a Spodoptera frugiperda cell line, such as Sf9 or Sf21. This allows for more complex glycosylation modifications to be performed on the target polypeptide.

[0112] In some embodiments, the mammalian cells may be CHO cells (Chinese Hamster Ovary cells) or HEK293 cells (Human Embryonic Kidney 293 cells), which can perform post-translational modifications of the target polypeptide that are closest to human physiology, thereby improving the expression quality of the polypeptide.

[0113] In some embodiments, more than one copy of a polynucleotide of the invention can be inserted into a host cell to increase polypeptide production. The number of copies of the polynucleotide can be increased by integrating at least one additional copy of the sequence into the host cell genome; or by including an amplifiable selectable marker gene with the polynucleotide, such that cells containing amplified copies of the selectable marker gene can be selected by culturing the cells in the presence of a suitable selection agent, thereby selecting cells containing additional copies of the polynucleotide.

[0114] Orotidine-5′-phosphate decarboxylase mutant

[0115] The present invention also provides an orotidine-5′-phosphate decarboxylase mutant. Relative to the amino acid position of SEQ ID NO: 2, the orotidine-5′-phosphate decarboxylase mutant comprises at least one mutation among S38, D40, K62, H64, T102, L155, M158, Q225, Y227, T212, and I242. Compared with the orotidine-5′-phosphate decarboxylase parent, the orotidine-5′-phosphate decarboxylase mutant has a lower expression level and / or lower enzyme activity.

[0116] In some embodiments, the orotidine-5′-phosphate decarboxylase mutant comprises at least one of the following mutations: S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, and I242A.

[0117] In some embodiments, the orotidine-5′-phosphate decarboxylase mutant comprises the following mutations: S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, I242A, L155A_M158A, or Q225A_Y227F.

[0118] In some embodiments, the orotidine-5′-phosphate decarboxylase mutant has only the aforementioned mutations based on the sequence shown in SEQ ID NO: 2.

[0119] In some embodiments, based on the sequence shown in SEQ ID NO: 2, the orotidine-5′-phosphate decarboxylase mutant has not only the aforementioned mutations, but also some other conservative substitutions, such that the orotidine-5′-phosphate decarboxylase mutant has at least 80%, preferably at least 85%, preferably at least 88%, more preferably at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with the sequence shown in SEQ ID NO: 2. The "conservative substitutions" referred to herein are also referred to as substitutions by "homologous" amino acids, and refer to substitutions in which an amino acid is replaced by an amino acid with a similar side chain, for example, amino acids with basic side chains (such as lysine, arginine, and histidine), amino acids with acidic side chains (such as aspartic acid and glutamic acid), non-charged polar side chain amino acids (such as glycine, asparagine, glutamine, serine, threonine, tyrosine, and cysteine), non-polar side chain amino acids (such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan), β-branched side chain amino acids (such as threonine, valine, and isoleucine), and aromatic side chain amino acids (such as tyrosine, phenylalanine, tryptophan, and histidine). Conservative amino acid substitutions generally have little effect on the activity of the resulting protein.

[0120] Isolated nucleic acids

[0121] The present invention also provides an isolated nucleic acid encoding the orotidine-5′-phosphate decarboxylase mutant according to any one of the aforementioned embodiments.

[0122] In some embodiments, the isolated nucleic acid further contains a promoter for driving the expression of the orotidine-5′-phosphate decarboxylase mutant, and compared with the natural promoter, the promoter is truncated, preferably the promoter is truncated to a length of 50 to 200 bp from the 5′ end.

[0123] In some specific embodiments, the promoter is truncated to a length of 50 bp, 75 bp, 100 bp, 125 bp, 150 bp, 175 bp or 200 bp from the 5' end.

[0124] In some specific embodiments, the nucleotide sequence of the promoter is as shown in any one of SEQ ID NOs: 61 to 64; or, the nucleotide sequence of the promoter has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with the sequence shown in any one of SEQ ID NOs: 61 to 64, and can reduce the expression level and / or enzymatic activity of orotidine-5'-phosphate decarboxylase.

[0125] Application and Methods

[0126] The present invention also provides use of the polynucleotide construct described in any of the aforementioned embodiments, or the recombinant expression vector described in any of the aforementioned embodiments, or the host cell described in any of the aforementioned embodiments, or the orotidine-5′-phosphate decarboxylase mutant described in any of the aforementioned embodiments, or the isolated nucleic acid described in any of the aforementioned embodiments in improving the expression level and / or enzyme activity of a target polypeptide.

[0127] The present invention also provides a method for producing a target polypeptide, comprising: culturing the host cell described in any one of the aforementioned schemes; and optionally recovering the target polypeptide.

[0128] In some embodiments, the medium used to culture the host cells lacks one or more nutrients, so that host cells containing a greater number of copies of the polynucleotide construct can be selected.

[0129] In some embodiments, use methods known in the art to cultivate host cells in a nutrient medium that is suitable for producing polypeptide. For example, can be by in suitable medium and under the condition of allowing polypeptide expression and / or separation, carry out shake flask culture or in a laboratory or industrial fermentor, carry out small-scale or large-scale fermentation (comprising continuous fermentation, batch fermentation, batch fed fermentation or solid-state fermentation) to cultivate cells. Use steps known in the art to cultivate in a suitable nutrient medium that comprises a carbon source and a nitrogen source and an inorganic salt. Suitable medium can be obtained from commercial suppliers or can be prepared according to disclosed composition. If polypeptide is secreted into the nutrient medium, then polypeptide can be directly reclaimed from the medium. If polypeptide is not secreted out, then it can be reclaimed from cell lysate.

[0130] In some embodiments, the polypeptide can be detected using methods known in the art specifically for polypeptides. These detection methods include, but are not limited to, the use of specific antibodies, the formation of an enzyme product, or the disappearance of an enzyme substrate. For example, enzyme assays can be used to determine the activity of a polypeptide.

[0131] In some embodiments, the polypeptide can be recovered using methods known in the art. For example, the polypeptide can be recovered from the nutrient medium by conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation.

[0132] In some embodiments, substantially pure polypeptides can be obtained by purifying the polypeptides by various methods known in the art, including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoresis (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction.

[0133] Example

[0134] The embodiments of the present invention will be described in detail below with reference to the examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the invention. For experimental methods in the following examples where specific conditions are not specified, reference is made to the guidance provided in the present invention, and may also be made to experimental manuals or conventional conditions in the art, other experimental methods known in the art, or conditions recommended by the manufacturer.

[0135] While the present invention provides examples of various specific processes and materials, those skilled in the art will appreciate the applicability of other processes and / or the use of other materials. Unless otherwise indicated, the embodiments of the present invention utilize conventional techniques in chemistry, molecular biology, and the like, which are within the capabilities of those skilled in the art. Furthermore, unless otherwise indicated, nucleic acids are written from left to right in a 5' to 3' orientation, and amino acid sequences are written from left to right in an amino-terminal to carboxyl-terminal orientation.

[0136] In the following specific examples, all reagents used were obtained from conventional commercial sources unless otherwise specified. Measurement parameters for raw material components may exhibit slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations due to instrumental or operational accuracy are permitted.

[0137] Culture media and reagents:

[0138] LB solid medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 1% agar powder, pH 7.0.

[0139] LB-A resistance medium is LB medium with ampicillin added to a final concentration of 100 μg / mL. LB-Z resistance medium is LB medium with Zeocin added to a final concentration of 25 μg / mL.

[0140] YPD medium: 1% yeast extract, 2% peptone, 2% glucose.

[0141] YPD-Z resistance medium is YPD medium with Zeocin added to a final concentration of 100 μg / mL.

[0142] Induction medium BMGY: 1% yeast extract, 2% peptone, 1.34% YNB, 0.00004% biotin, 1% glycerol (v / v).

[0143] Induction medium BMMY: 0.5% methanol replaces glycerol, and the rest of the ingredients are the same as BMGY.

[0144] CD transformation medium: 2% glucose, 0.3% NaNO3, 0.1% KH2PO4, 0.2% KCl, 0.0245% MgSO4, 0.002% FeSO4·7H2O, 14.5736% sorbitol, 500 μL / L trace element stock solution, 0.5% agar powder, pH 6.5.

[0145] CD subculture medium: 2% glucose, 0.3% NaNO3, 0.1% KH2PO4, 0.2% KCl, 0.0245% MgSO4, 0.002% FeSO4·7H2O, 500 μL / L trace element stock solution, 0.5% agar powder, pH 6.5.

[0146] Trace element mother solution: FeSO4·7H2O, ZnSO4·7H2O, CuSO4·5H2O, Na2B4O7·10H2O, (NH4)6Mo7O 24 4H2O, pH 2.5, sterilized with 0.22μM filter.

[0147] TB3 low-glucose medium: 3 g / L yeast extract, 3 g / L Casamina Acids, 30 g / L sucrose, and 15 g / L agar, pH 5.5.

[0148] YPG medium: 4 g / L yeast extract, 1 g / L KH2PO4, 0.5 g / L MgSO4·7H2O and 15 g / L glucose (pH 6.0).

[0149] YPM medium: 12% maltodextrin, 0.5% soybean meal powder, 2% corn steep liquor powder, 0.1% magnesium sulfate, 0.5% urea, 1% potassium dihydrogen phosphate, 0.08% calcium chloride, 0.075% ferrous sulfate, and the remainder water. Adjust the pH to 6.0 before digestion.

[0150] MY medium: beef extract powder 8 g / L, yeast extract 2 g / L, tryptone 5 g / L, sodium chloride 2 g / L, maltose 30 g / L, pH 5.8.

[0151] STC buffer consists of 0.8 M sorbitol, 25 mM Tris (pH 8.0) and 25 mM CaCl2, made up to 1 liter with water, pH 8.0.

[0152] The STPC buffer solution was composed of 40% PEG4000 added to the STC buffer solution, pH 8.0.

[0153] Enzymes and other biochemical reagents: Endonucleases were purchased from Fermentas, ligases from Promaga, and DNA polymerases from Beijing Quanshijin Biotechnology. Plasmid extraction and purification kits were purchased from Shanghai Shenggong Company. The antibiotic Zeocin was purchased from Invitrogen. All other reagents were domestically produced, analytical grade reagents available from common biochemical reagent companies.

[0154] Aspergillus oryzae or Aspergillus niger genome extraction

[0155] Aspergillus oryzae NBRC4177 or Aspergillus niger ATCC1015 were inoculated on TB3 low-glucose medium and cultured at 30°C for 7 days until spores matured. 7 The mycelia were inoculated into YPG liquid seed culture medium and cultured at 30°C and 200 rpm for 2 days until the mycelia concentration reached 4-5 g / L for genome extraction according to the instructions of the Omega Fungal Genome Extraction Kit.

[0156] Conventional PCR amplification:

[0157] The reaction system and reaction parameters are shown in Table 1 below.

[0158] Table 1

[0159] Fusion PCR amplification

[0160] The reaction system and reaction parameters are shown in Table 2 below.

[0161] Table 2

[0162] Aspergillus oryzae or Aspergillus niger transformation method:

[0163] 1) Inoculate spores from a slant of Aspergillus oryzae or Aspergillus niger into YPG liquid medium and culture overnight at 30°C, 200 rpm (12-16 h) to form compact, small pellets (d < 2 mm). Filter the mycelium from the medium through a sterile microcloth and wash the mycelium 2-3 times with sterile water to obtain clean mycelium (approximately 200 mg).

[0164] 2) Prepare the enzyme solution system (20 ml): 0.5% cellulase, 0.5% snailase, 0.8% yatalase, 0.8 M KCl, add deionized water to 20 ml, and sterilize with a 0.22 μM filter membrane.

[0165] 3) Add the enzyme solution prepared in step 2) to the mycelium prepared in step 1) and perform enzymolysis at 80 rpm and 30° C. for 3 h.

[0166] 4) Filter the protoplasts through Microcloth to remove mycelial debris. Harvest the protoplasts and wash twice with STC buffer. Finally, resuspend the protoplasts in 200-1000 μL STC.

[0167] 5) Add 5 μg DNA to 100 μL protoplast suspension, then add 200 μL STPC buffer and incubate the mixture at room temperature for 20 minutes. Harvest the protoplasts and wash twice with 0.8 M sorbitol. Finally, resuspend the protoplasts in 200 μL 0.8 M sorbitol.

[0168] 6) Mix the suspension with CD transformation medium (approximately 50°C) and pour into a uridine- and uracil-free medium to select for transformants containing the pyrG gene. After 5-7 days of growth at 30°C, stable transformants appear to be growing vigorously and forming sporulated colonies. Purify transformants twice by conidia.

[0169] Shake flask fermentation

[0170] The spores of the above transformants were used to inoculate a shake flask containing 50 ml of YPM medium. To ensure the stability of the shake flask, all shake flasks were inoculated with a uniform inoculation volume of 2 ml and a spore concentration of 2 × 10 7 The cells were cultured at 30°C, 200 rpm on the same shaking incubator for 5 days.

[0171] Aspergillus oryzae or Aspergillus niger fermentation method

[0172] Seed culture: Spores from solid TB3 low-glucose medium culture were transferred to shake flasks (glycerol 20 g / L, yeast extract 18 g / L) and incubated at 30°C and 250 rpm for 1 day.

[0173] Fed-batch fermentation:

[0174] The tank medium (24 g / L sucrose, 10 g / L yeast extract, 5 g / L (NH₄)₂SO₄, 2 g / L MgSO₄·7H₂O, 2 g / L K₂SO₄, 1 g / L citric acid, 2 g / L KH₂PO₄, 0.5 ml / L trace element solution) was adjusted to 30°C. Aeration was 1 vvm, and the pH was controlled at 6.0 using 10% aqueous ammonia. The tank medium was inoculated from a seed culture. When the pH reached > 6.4, feed (400 g / L maltose syrup, 1 g / L citric acid) was started at a rate of 3.33 g / L / h. The agitator speed was controlled to avoid low dissolved oxygen (<20%).

[0175] SDS-PAGE

[0176] The culture supernatants or purified samples were analyzed by SDS-PAGE using 16.5% SDS gels from Criterion TM Tris Tricine precast gels (Bio-Rad). 20 μl of sample (10 μl of each sample mixed with 10 μl of loading buffer) were loaded onto the gel, and 10 μl of Marker (pre-stained SDS-PAGE standard, GenScript Bio, #M00624-250) was applied. The gel was electrophoresed at a constant current of 20 mA for 80 min in 1× SDS buffer (Bio-Rad). Protein bands were stained with Bio-Safe Coomassie dye (Bio-Rad).

[0177] Orotidine-5′-phosphate decarboxylase activity assay

[0178] Mix 500 μmol / L orotic acid, 200 μmol / L PRPP, 3 mol / L MgCl2, and 50 mmol / L Tris-HCl (pH 8.0) with 1 ml of orotic acid phosphoribosyltransferase and 1 ml of orotidine-5′-phosphate decarboxylase, and 8 ml of substrate. Incubate at 37°C, 220 rpm, and after 0-30 min, quickly remove a 1 ml sample and terminate the reaction by adding 3.5% perchloric acid. Analyze the reduction of orotic acid and the production of uracil nucleotides by HPLC. A 10 ml substrate reaction system without enzyme solution serves as a blank control.

[0179] Enzyme activity detection method (HPLC):

[0180] 1) LiChrospher C18 [5 μm, 250 × 4 mm] column (Agilent, USA);

[0181] 2) Mobile phase: triethylamine phosphate solution at pH 6.6;

[0182] 3) Column temperature: room temperature;

[0183] 4) Detection wavelength: 260nm;

[0184] 5) Flow rate: 1 ml / min;

[0185] 6) Injection volume: 20 μL

[0186] One unit of orotidine-5′-phosphate decarboxylase activity is defined as the amount of enzyme required to generate 1 μmol of uracil nucleotide per minute.

[0187] strain

[0188] Aspergillus oryzae NBRC4177: available from Institute for fermentation, Osaka; 17-25 Juso Hammachi 2-Chome Yodogawa-Ku, Osaka, Japan.

[0189] Aspergillus niger ATCC1015: can be purchased from ATCC Culture Collection Center.

[0190] Example 1 Construction of a library of mutants of Aspergillus nidulans orotidine-5′-phosphate decarboxylase

[0191] The orotidine-5′-phosphate decarboxylase selection marker nucleic acid sequence (Sequence ID: BN001301.1) from Aspergillus nidulans FGSC A4 can be obtained from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ). This sequence was synthesized using whole gene synthesis by Nanjing GenScript Biotechnology Co., Ltd. The orotidine-5′-phosphate decarboxylase selection marker nucleic acid sequence is shown in SEQ ID NO: 1. This sequence contains the promoter, gene coding region, and terminator elements. Sequence bases 1-300 bp represent the promoter sequence, 301-1184 bp represent the gene coding region (including 458-516 bp representing the intron sequence), and 1185-1540 bp represent the terminator sequence. The amino acid sequence corresponding to the orotidine-5′-phosphate decarboxylase gene coding region sequence is shown in SEQ ID NO: 2. Amino acids within the active region or key features were screened and modified to reduce the enzyme's activity. Key sites identified during the screening included S38, D40, K62, H64, T102, L155, M158, Q225, Y227, T212, and I242, which are substrate binding sites or close to the active catalytic domain. The final selected mutations were S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, and I242A, or combinations of L155A and M158A, or Q225A and Y227F. Primers were designed to construct a mutant library using the synthetic orotidine-5′-phosphate decarboxylase selection marker nucleic acid sequence as a template. The primer sequences are shown in Table 3. Overlap extension PCR was performed using primer pair S38A-F1 / S38A-R1 to amplify the upstream fragment of the orotidine 5′-phosphate decarboxylase selection marker, and primer pair S38A-F2 / S38A-R2 to amplify the downstream fragment of the orotidine 5′-phosphate decarboxylase selection marker. Primer pair S38A-F1 / S38A-R2, using the mixed upstream and downstream fragments as templates, amplified the orotidine 5′-phosphate decarboxylase selection marker mutant sequence, named S38A. Similarly, primer pair S38A-F1 / D40A-R1 was used to amplify the upstream fragment of the orotidine 5′-phosphate decarboxylase selection marker, and primer pair D40A-F2 / S38A-R2 was used to amplify the downstream fragment of the orotidine 5′-phosphate decarboxylase selection marker. Primer pair S38A-F1 / S38A-R2, using the mixed upstream and downstream fragments as templates, amplified the selection marker mutant sequence, named D40A.Similarly, the selection marker mutant sequences K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, and I242A were obtained, respectively. Using the mutant sequence M158A as a template, the primer pair S38A-F1 / L155A_M158A-R1 was used to amplify the upstream fragment of the orotidine-5′-phosphate decarboxylase selection marker, and the primer pair L155A_M158A-F2 / S38A-R2 was used to amplify the downstream fragment of the orotidine-5′-phosphate decarboxylase selection marker. Using the mixed upstream and downstream fragments as templates, the primer pair S38A-F1 / S38A-R2 was used to amplify a selection marker combination mutant sequence, named L155A_M158A. Using the mutant sequence Q225A as a template, the primer pair S38A-F1 / Q225A_Y227F-R1 was used to amplify the upstream fragment of the orotidine-5′-phosphate decarboxylase screening marker, and the primer pair Q225A_Y227F-F2 / S38A-R2 was used to amplify the downstream fragment of the orotidine-5′-phosphate decarboxylase screening marker. The primer pair S38A-F1 / S38A-R2 was used to amplify the above and downstream mixed fragments as templates to obtain the screening marker combination mutant sequence, named Q225A_Y227F, thereby obtaining the entire Aspergillus nidulans orotidine-5′-phosphate decarboxylase mutant library.

[0192] Table 3 Primer sequences used in the construction of mutant library

[0193] Example 2 Activity test of orotidine-5′-phosphate decarboxylase mutant

[0194] Using the Aspergillus nidulans orotidine-5′-phosphate decarboxylase parent or mutant sequence in Example 1 as a template, primers P1 and P2 were used to perform specific PCR amplification to separate the parent or mutant gene coding sequence, the PCR amplification results were detected by agarose electrophoresis, and the target product of PCR amplification was purified and recovered. The target fragment was double-digested with EcoRI and XbaI and then connected to the pPICZαA vector. The ligation product was transferred into Escherichia coli Top10 competent cells using the chemical conversion heat shock method, coated on LB-Z resistance plates, and inverted cultured at 37°C. After transformants appeared on the plate, single clones were picked and inoculated into LB-Z resistance test tubes and cultured at 37°C. The recombinant transformants were verified by bacterial liquid PCR, and the plasmids of the correct transformants were extracted and sequenced to determine the corresponding parent or mutant gene coding sequence.

[0195] Primer P1: 5'-CCGGAATTCTCTTCGAAGTCCCACCTCC-3' (SEQ ID NO: 31, where the 4th to 9th bp are EcoRI restriction sites)

[0196] Primer P2: 5'-CTAGTCTAGAAAGTCCAACTCTTTTCTCGTAAGCT-3' (SEQ ID NO: 32, where the 5th to 10th bp are XbaI restriction sites)

[0197] The correctly sequenced gene coding sequence plasmid was linearized using restriction endonuclease PmeI, the linearized plasmid fragment was recovered and purified, and transformed into Pichia pastoris X33 competent cells by electroporation. YPD-Z resistance medium was used for screening to obtain yeast recombinant transformants.

[0198] Preparation of Pichia pastoris X-33 competent cells: 1) Inoculate a single colony of Pichia pastoris X-33 to 5 ml 1) 1 ml of the culture was inoculated into a 500 ml shake flask containing 100 ml of YPD medium and cultured for 12-16 h until OD600 = 0.8-1.2, at which point the culture was transferred to a 50 ml pre-cooled centrifuge tube, centrifuged at 4°C, 5000 g for 5 min, and the supernatant was discarded. 2) The cells were resuspended in 25 ml of pre-cooled sterile water, centrifuged at 4°C, 5000 g for 5 min, and the supernatant was discarded. This step was repeated 2-3 times. 3) The cells were resuspended in 5 ml of pre-cooled 1 mol / L sorbitol per tube, centrifuged at 4°C, 5000 g for 5 min, and the supernatant was discarded. This step was repeated 2-3 times. 4) The cells were resuspended in 5 ml of pre-cooled 1 mol / L sorbitol per tube, centrifuged at 4°C, 5000 g for 5 min, and the supernatant was discarded. This step was repeated 2-3 times. 5) The cells were finally resuspended in 200 μL of sorbitol and aliquoted into 1.5 ml centrifuge tubes, 80 μL per tube.

[0199] Transformation screening: 1) Take one competent cell and add 10 μL of linearized and concentrated DNA, mix gently, and transfer to a pre-cooled 0.2 cm electrode cup and bathe on ice for 5 minutes; 2) Perform electric shock at the electric shock parameters of 1.5 kV, 25 μF, 200 Ω. After the electric shock is completed, quickly add 1 ml of pre-cooled 1 mol / L sorbitol, then transfer the mixture to a 1.5 ml centrifuge tube and resuscitate at 30°C for 1 hour; 3) Pipette 200 μL and spread on YPD-Z solid medium containing 100 μg / ml Zeocin. Incubate the plate at 30°C for 3 days, observe positive transformants, identify positive single colonies by PCR, and send PCR-positive colonies for sequencing verification.

[0200] Recombinant transformants were selected and inoculated into 50 ml of BMGY medium. After shaking culture at 30°C and 220 rpm for 18 hours, cells were harvested by centrifugation. An appropriate amount of cells was transferred to 50 ml of BMMY medium to a cell concentration of OD600 = 1. Shaking culture was continued at 30°C and 250 rpm, with methanol added at 1% of the culture volume every 24 hours. After 4 days of induced expression, the culture broth was centrifuged to obtain the supernatant. The parent orotidine 5′-phosphate decarboxylase and the mutant were purified using nickel affinity chromatography. The purified samples were assayed for enzyme activity, and the specific activity was calculated. The relative specific activity of the mutant was calculated by dividing the mutant specific activity by the parent specific activity. As shown in Table 4, the mutant exhibited significantly lower enzyme activity than the parent orotidine 5′-phosphate decarboxylase.

[0201] Table 4 Comparison of specific activities of parent and mutant orotidine-5′-phosphate decarboxylase

[0202] Example 3 Preparation of nucleic acid constructs for target gene expression

[0203] 3.1 Isolation of the Aspergillus oryzae α-amylase promoter (PamyB) sequence

[0204] Based on the amyB promoter sequence published in GeneBank (GenBank: AP007157.1), the amyB promoter sequence (SEQ ID NO: 33) was isolated by specific PCR amplification using Aspergillus oryzae NBRC4177 genomic DNA as a template using upstream primer PaF and downstream primer PaR. The PCR product was subjected to agarose gel electrophoresis to recover the desired fragment and purified according to the Axygen kit instructions. Here,

[0205] The sequence of the upstream primer PaF is:

[0206] GCCTGCATGCAAGCTTGGCGCGCCGAATTCATGGTGTTTTGATCATT(5'-3') (SEQ ID NO: 34).

[0207] The sequence of the downstream primer PaR is:

[0208] CTCTAGATCTCGAGACGCGTACTAGTCTTAAGAAATGCCTTCTGTGGGGTTTA (5'-3') (SEQ ID NO: 35).

[0209] 3.2 Isolation of Aspergillus niger saccharifying enzyme terminator (Ter)

[0210] Based on the Aspergillus niger glucoamylase terminator sequence published on GeneBank (GenBank: AM270061.1), genomic DNA from Aspergillus niger ATCC1015 was used as a template and specific PCR amplification was performed using the upstream primer TrF and the downstream primer TrR to isolate the glucoamylase terminator sequence (SEQ ID NO: 36), which was designated Ter. The PCR product was subjected to agarose gel electrophoresis to recover the target fragment.

[0211] in:

[0212] The sequence of the upstream primer TrF is:

[0213] CTTAAGACTAGTACGCGTCTCGAGATCTAGAGGGTGACTGACACCTGGCGGTAG(5'-3') (SEQ ID NO: 37).

[0214] The sequence of the downstream primer TrR is:

[0215] TGCGCAAGCAAGTAATGCATTGAATGACAGTGATATCAG(5'-3') (SEQ ID NO: 38).

[0216] 3.3 Sequence element fusion to prepare nucleic acid constructs for target gene expression

[0217] Using the amylase promoter PamyB and the saccharifying enzyme terminator Ter sequence as a mixed template, the upstream primer PaF and the downstream primer TrR were used to perform specific PCR amplification to isolate the PamyB_Ter fusion sequence. Using the Aspergillus nidulans orotidine-5′-phosphate decarboxylase parent or mutant sequence in Example 1 as a template, the upstream primer TpF and the downstream primer TpR were used to perform specific PCR amplification to isolate the orotidine-5′-phosphate decarboxylase parent or mutant sequence. The PamyB_Ter fusion sequence and the isolated orotidine-5′-phosphate decarboxylase parent or mutant sequence were used as mixed templates, and specific PCR amplification was performed using the upstream primer PaF and the downstream primer TpR to obtain the final nucleic acid constructs for target gene expression. The nucleic acid constructs were named PamyB-pyrG WT, PamyB-pyrG S38A, PamyB-pyrG D40A, PamyB-pyrG K62A, PamyB-pyrG H64A, PamyB-pyrG T102A, PamyB-pyrG L155A, PamyB-pyrG M158A, PamyB-pyrG Q225A, PamyB-pyrG Y227F, PamyB-pyrG T212A, PamyB-pyrG I242A, PamyB-pyrG L155A_M158A, and PamyB-pyrG Q225A_Y227F, the corresponding nucleotide sequences are SEQ ID NO: 39 to SEQ ID NO: 52. The PCR products were subjected to agarose gel electrophoresis to recover the target fragments.

[0218] The sequence of the upstream primer TpF is:

[0219] GTCATTCAATGCATTACTTGCTTGCGCAAGCGGGT(5'-3') (SEQ ID NO: 53).

[0220] The sequence of the upstream primer TpR is:

[0221] TCACATGTAAGCTtAGCCCACTTTCTCAACTGGA(5'-3') (SEQ ID NO: 54).

[0222] The nucleic acid construct sequence fragment was double-digested with SphI and PciI and ligated into the puc57 vector. The ligation product was transformed into E. coli Top10 competent cells using the chemical transformation heat shock method. The cells were plated on LB-A resistant plates and incubated upside down at 37°C. After transformants appeared on the plates, single colonies were picked and inoculated into LB-A resistant tubes and incubated at 37°C. Recombinant transformants were verified by PCR in the bacterial culture, and plasmids from the verified transformants were extracted and sequenced, completing the preparation of the nucleic acid construct for target gene expression. A schematic plasmid map is shown in Figure 1.

[0223] Example 4 Expression of fungal amylase in Aspergillus oryzae and Aspergillus niger using the above nucleic acid construct

[0224] 4.1 Isolation of uracil auxotrophic strains of Aspergillus oryzae and Aspergillus niger

[0225] The spore concentration in 5 mL was 2 × 10 7 Fresh spores of Aspergillus oryzae NBRC4177 or Aspergillus niger ATCC1015 were placed in a 5 cm diameter dish and subjected to UV mutagenesis under the following mutagenesis conditions: power 15 W, wavelength 254 nm, mutagenesis height 8 cm, mutagenesis time 3 min, magnetic stirrer speed 200 rpm. The mutagenized spores were then plated on CD subculture medium containing 0.15% 5-FOA (5-fluoroorotic acid) and 0.24% uridine. After incubation at 30°C for 5 days, individual colonies resistant to 5-FOA were selected and transferred to CD subculture medium containing 0.15% 5-FOA (5-fluoroorotic acid) and 0.24% uridine. Single Aspergillus oryzae colonies grown on a plate were spotted onto CD subculture medium and CD subculture medium containing 0.24% uridine, respectively; strains that could not grow on the CD subculture medium but grew on the CD subculture medium containing 0.24% uridine were collected as uracil auxotrophic strains of Aspergillus oryzae or Aspergillus niger; the obtained auxotrophic strains were sequenced and analyzed, and strains with inactivated orotidine-5′-phosphate decarboxylase were selected for subsequent transformation screening.

[0226] 4.2 Expression of fungal amylases in Aspergillus oryzae and Aspergillus niger using nucleic acid constructs

[0227] According to the sequence of the amyB gene published on GeneBank (GenBank: AP007157.1), Aspergillus oryzae NBRC4177 genomic DNA was used as a template, and the upstream primer amyF and the downstream primer amyR were used to perform specific PCR amplification to isolate the amyB gene sequence. The target fragment was double-digested with SpeI and XhoI and then ligated to the nucleic acid construct in Example 3. The ligation product was transformed into Escherichia coli Top10 competent cells using a chemical conversion heat shock method, coated on an LB-A resistant plate, and inverted and cultured at 37°C. After transformants appeared on the plate, a single clone was picked and inoculated into an LB-A resistant test tube and cultured at 37°C. The recombinant transformant was verified by bacterial liquid PCR, and the plasmid of the correct transformant was extracted and sequenced to obtain a vector expressing the fungal amylase gene amyB.

[0228] Primer amyF: 5'-GGACTAGTATGATGGTCGCGTGGTGGT-3' (SEQ ID NO: 55, where the 3rd to 8th bp are SpeI restriction sites)

[0229] Primer amyR: 5'-CCGCTCGAGTCACGAGCTACTACAGATCTTGCT-3' (SEQ ID NO: 56, where the 4th to 9th bp are XhoI restriction sites)

[0230] The sequenced plasmid was linearized with the restriction endonuclease HindIII, and the nucleic acid construct containing the target gene was gel-purified, removing any other fragments (such as the ampicillin resistance gene fragment) from the puc57 vector backbone. The recovered fragment was transformed into Aspergillus oryzae NBRC4177 or Aspergillus niger ATCC1015 strains in which orotidine-5′-phosphate decarboxylase was inactivated. Transformants containing the pyrG gene were selected using CD transformation medium lacking uridine and uracil. After five days of growth at 30°C, the number of transformants obtained using different selection markers, such as the parent or mutant orotidine-5′-phosphate decarboxylase, was counted. Twenty transformants obtained from the same construct were repurified twice by conidia. Spores from these transformants were inoculated into shake flasks containing 50 ml of YPM medium and cultured at 30°C, 200 rpm, for five days. After the shake flasks were completed, the culture broth was centrifuged to obtain the supernatant, which was then assayed for fungal amylase activity (see GB 1886.174-2016). The average total enzyme activity of 20 transformants was used as a standard to compare the differences in enzyme activity brought about by different selection markers, such as the parent or mutant orotidine-5'-phosphate decarboxylase of Aspergillus nidulans. The results are shown in Figures 2 and 3. As shown in Figures 2 and 3, the activity of fungal amylases integrated into Aspergillus oryzae and Aspergillus niger strains using the orotidine-5'-phosphate decarboxylase mutant as a selection marker was significantly improved. For the parent sequence, the use of the mutant selection marker resulted in increases in fungal amylase activity of 121% to 436%.

[0231] 4.2 Analysis of gene expression differences of the above fungal amylase strains using qPCR

[0232] The strains derived from Aspergillus oryzae and Aspergillus niger were selected and cultured in MY medium at 30°C for 2 days under the same conditions for RNA extraction. RNA extraction was performed using a polysaccharide and polyphenol plant total RNA extraction kit (TSP412, Qingke Biotechnology). The extracted RNA was reverse transcribed using a reverse transcription kit. ⅢRT SuperMix for qPCR (Qingke Biotechnology) was used for reverse transcription amplification. The final cDNA was used as a qPCR template using ArtiCan CEO SYBR qPCR Mix (Qingke Biotechnology) was used for amplification. β-actin was used as an internal reference gene, and the transcriptional differences of the fungal amylase gene between different strains were compared using the ΔΔCt method. The results are shown in Figure 4. The primer sequences are as follows:

[0233] Primer amyF-qPCR: 5'-CTGATCTCGATACCACCAAG-3' (SEQ ID NO: 57)

[0234] Primer amyR-qPCR: 5'-GTCGTTGGTGTAAGAAGCGA-3' (SEQ ID NO: 58)

[0235] Primer actin-F: 5'-TCTGGTGGTACTACCATGTACC-3' (SEQ ID NO: 59)

[0236] Primer actin-R: 5'-CTCGTCGTACTCCTGCTTGG-3' (SEQ ID NO: 60)

[0237] The results in Figure 4 show that the fungal amylase mRNA transcript levels of the different nucleic acid constructs were comparable. Compared to the PamyB-amyB-pyrG WT, the use of the orotidine-5′-phosphate decarboxylase mutant as a selection marker significantly enhanced the transcription level of the fungal amylase gene. The enhanced transcription level was mainly due to the increase in the copy number of the gene expressing the fungal amylase. Due to the amino acid sequence mutation of the orotidine-5′-phosphate decarboxylase, the mutant's activity was significantly reduced compared to the parent. When the orotidine-5′-phosphate decarboxylase mutant was used as a selection marker, a higher number of copies of the orotidine-5′-phosphate decarboxylase mutant was required to ensure normal growth of the strain with inactivated orotidine-5′-phosphate decarboxylase on plates without uridine or uracil. This also led to an increase in the copy number of the fungal amylase gene integrated into Aspergillus oryzae.

[0238] Example 5 Orotidine-5′-phosphate decarboxylase mutant screening marker promoter truncation further improves protein expression level

[0239] Using the plasmid PamyB-pyrG H64A constructed in Example 3 as the target, the promoter expressing the pyrG H64A encoding gene was truncated to 200 bp, 150 bp, 100 bp, and 50 bp, respectively. The nucleotide sequences corresponding to the truncated promoters are SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, and SEQ ID NO: 64, respectively. Thus, new combined mutants PamyB-pyrG H64A200, PamyB-pyrG H64A150, PamyB-pyrG H64A100, and PamyB-pyrG H64A50 were formed. The mutant construction process was similar to that of Example 3. The amyB gene sequence was isolated by specific PCR amplification using the upstream primer amyF and the downstream primer amyR. The target fragment was double-digested with SpeI and XhoI and ligated into the above-mentioned vector to obtain a vector expressing the fungal amylase gene amyB. The plasmid, which had been sequenced correctly, was linearized using the restriction endonuclease HindIII, and the nucleic acid construct fragment containing the target gene was gel-purified. The recovered fragment was transformed into Aspergillus oryzae NBRC4177 or Aspergillus niger ATCC1015 strains in which orotidine-5′-phosphate decarboxylase was inactivated. Twenty transformants obtained from the same construct were repurified twice by conidia, and spores of the transformant strains were inoculated into shake flasks containing 50 ml of YPM medium. After shaking, the culture broth was centrifuged to obtain the supernatant, which was then assayed for fungal amylase activity (see GB1886.174-2016). The average total enzyme activity of the 20 transformants was used as a standard to compare the enzyme activity differences induced by different selection markers, such as the parent or combined mutants of the orotidine-5′-phosphate decarboxylase of Aspergillus nidulans. The results are shown in Figure 5. Combination mutants derived from the orotidine-5′-phosphate decarboxylase selection marker promoter truncation and amino acid mutations further enhanced fungal amylase activity, with increases ranging from 486% to 663%.

[0240] Example 6 Expression of Brazzein in Aspergillus oryzae using the above nucleic acid construct

[0241] According to the Brazzein protein sequence published on GeneBank (GenBank: 2KGQ_A), its amino acid sequence is shown in SEQ ID NO: 65. The sequence was entrusted to Nanjing KingSher Biotechnology Co., Ltd. for codon optimization and gene synthesis. The gene synthesis target fragment was double-digested with SpeI and XhoI and then connected to the nucleic acid construct in Example 3. The ligation product was transformed into Escherichia coli Top10 competent cells using the chemical conversion heat shock method, coated with LB-A resistance plates, and inverted cultured at 37°C. After transformants appeared on the plate, single clones were picked and inoculated into LB-A resistance test tubes and cultured at 37°C. The recombinant transformants were verified by bacterial liquid PCR, and the plasmids of the correct transformants were extracted and sequenced to obtain a vector expressing Brazzein sweet protein.

[0242] The correctly sequenced plasmid was linearized using the restriction endonuclease HindIII, and the nucleic acid construct fragment containing the target gene was gel-purified, thereby removing other fragments (such as the ampicillin resistance gene fragment) from the puc57 vector backbone. The recovered fragment was transformed into the Aspergillus oryzae strain NBRC4177 in which orotidine-5′-phosphate decarboxylase was inactivated. Transformants containing the pyrG gene were selected using CD transformation medium lacking uridine and uracil. Twenty transformants obtained from the same construct were re-purified twice by conidia. Spores of the transformant strains were inoculated into shake flasks containing 50 ml of YPM medium and cultured at 30°C, 200 rpm for 5 days. After the shaking period, the culture broth was centrifuged to obtain the supernatant, which was then assayed for Brazzein protein concentration by HPLC using a sodium ion column (8.0 mm × 75 mm, 8 μm). The average protein concentration of 20 transformants was used as a standard to compare the differences in protein concentration brought about by different screening markers such as the parent or mutant of Aspergillus nidulans orotidine-5'-phosphate decarboxylase, and the Brazzein protein concentration expressed by the nucleic acid construct derived from the parent was normalized to 1.00. The results are shown in Table 5. As can be seen from the results in Table 5, the expression level of the Brazzein sweet protein integrated into Aspergillus oryzae using the orotidine-5'-phosphate decarboxylase mutant as a screening marker was significantly increased. For the parent sequence, the use of the mutant screening marker resulted in a 1.26- to 3.47-fold increase in the expression level of the Brazzein sweet protein.

[0243] Table 5 Differences in protein concentration of Brazzein expressed in Aspergillus oryzae by different nucleic acid constructs

[0244] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. A polynucleotide construct comprising: a first polynucleotide encoding a selectable marker; and one or more second polynucleotides encoding a target polypeptide; Among them, wherein the selectable marker is selected from key enzymes related to the survival of a host cell; the selectable marker encoded by the first polynucleotide has a lower expression level and / or lower enzyme activity compared to the selectable marker encoded by the wild-type coding gene.

2. The polynucleotide construct according to claim 1, wherein, There is at least one of the following changes in the first polynucleotide compared to the wild-type coding gene of the selectable marker: i) The promoter is truncated; ii) One or more nucleotides in the coding region are substituted; preferably the substituted sites are related to the substrate-binding property and / or catalytic activity property of the selectable marker.

3. The polynucleotide construct according to claim 1 or 2, wherein, The selectable marker is selected from key enzymes or mutants thereof related to one or more of the nucleotide biosynthesis pathway, amino acid biosynthesis pathway, vitamin synthesis pathway, carbon metabolism pathway, and nitrogen metabolism pathway; preferably the selectable marker is selected from key enzymes or mutants thereof encoded by the amdS, niaD, argB, and pyrG genes.

4. The polynucleotide construct according to claim 1, wherein, The first polynucleotide encodes orotidine-5'-phosphate decarboxylase or a mutant thereof, and there is at least one of the following changes a) - b) in the first polynucleotide compared to the wild-type coding gene of orotidine-5'-phosphate decarboxylase: a) The promoter is truncated; b) One or more nucleotides in the coding region are substituted; preferably the substituted sites are related to the substrate-binding property and / or catalytic activity property of orotidine-5'-phosphate decarboxylase; preferably the first polynucleotide contains the changes in a) and b).

5. The polynucleotide construct according to claim 4, wherein, The promoter in the first polynucleotide is truncated from the 5' end to a length of 50 - 200 bp; preferably the nucleotide sequence of the promoter is as shown in any one of SEQ ID NOs: 61 - 64; or the nucleotide sequence of the promoter has at least 90% identity with the sequence shown in any one of SEQ ID NOs: 61 - 64 and can reduce the expression level and / or enzyme activity of orotidine-5'-phosphate decarboxylase.

6. The polynucleotide construct according to claim 4 or 5, wherein, Relative to the amino acid positions of SEQ ID NO: 2, the orotidine-5'-phosphate decarboxylase mutant encoded by the first polynucleotide contains at least one mutation among S38, D40, K62, H64, T102, L155, M158, Q225, Y227, T212, and I242, and the orotidine-5'-phosphate decarboxylase mutant has a lower expression level and / or lower enzyme activity compared to the orotidine-5'-phosphate decarboxylase parent.

7. The polynucleotide construct according to claim 6, wherein, The orotidine-5'-phosphate decarboxylase mutant contains at least one of the following mutations: S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, and I242A.

8. The polynucleotide construct according to claim 6, wherein, The orotidine-5'-phosphate decarboxylase mutant contains the following mutations: S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, I242A, L155A_M158A, or Q225A_Y227F.

9. The polynucleotide construct according to claim 1, wherein, The target polypeptide is aminopeptidase, amylase, glucoamylase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, α-galactosidase, β-galactosidase, glucoamylase, α-glucosidase, β-glucosidase, laccase, lipase, mannosidase, mutanase, glucose oxidase, pectinolytic enzyme, peroxidase, phytase, polyphenol oxidase, protease, ribonuclease, transglutaminase, xylanase, β-xylosidase, proline-specific protease, trehalase, pullulanase, phospholipase, mannanase, lysozyme, thaumatin, lactoferrin, lactoglobulin or bovine serum albumin; preferably, the target polypeptide is fungal amylase or Brazzein thaumatin.

10. A recombinant expression vector containing at least one copy of the polynucleotide construct according to any one of claims 1 to 9.

11. The recombinant expression vector according to claim 10, which is capable of integrating the polynucleotide construct into the genome of a host cell.

12. A host cell containing more than one copy of the polynucleotide construct according to any one of claims 1 to 9.

13. The host cell according to claim 12, which has a functional defect that can be complemented by the selectable marker.

14. An orotidine-5'-phosphate decarboxylase mutant, relative to the amino acid positions of SEQ ID NO: 2, the orotidine-5'-phosphate decarboxylase mutant contains at least one mutation in S38, D40, K62, H64, T102, L155, M158, Q225, Y227, T212, I242, and compared with the orotidine-5'-phosphate decarboxylase parent, the orotidine-5'-phosphate decarboxylase mutant has a lower expression level and / or lower enzyme activity.

15. The orotidine-5'-phosphate decarboxylase mutant according to claim 14, wherein, The orotidine-5'-phosphate decarboxylase mutant contains at least one of the following mutations: S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, I242A; Preferably, the orotidine-5'-phosphate decarboxylase mutant contains the following mutations: S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, I242A, L155A_M158A, or Q225A_Y227F.

16. An isolated nucleic acid encoding the orotidine-5'-phosphate decarboxylase mutant according to claim 14 or 15.

17. The isolated nucleic acid according to claim 16, further comprising a promoter for driving the expression of the orotidine-5'-phosphate decarboxylase mutant, and the promoter is truncated compared to the natural promoter, preferably the promoter is truncated from the 5' end to a length of 50 to 200 bp; more preferably the nucleotide sequence of the promoter is as shown in any one of SEQ ID NOs: 61 to 64; or the nucleotide sequence of the promoter has at least 90% identity with the sequence shown in any one of SEQ ID NOs: 61 to 64 and can reduce the expression level and / or enzyme activity of orotidine-5'-phosphate decarboxylase.

18. Use of the polynucleotide construct according to any one of claims 1 to 9, or the recombinant expression vector according to claim 10 or 11, or the host cell according to claim 12 or 13, or the orotidine-5'-phosphate decarboxylase mutant according to claim 14 or 15, or the isolated nucleic acid according to claim 16 or 17 in increasing the expression level and / or enzyme activity of the target polypeptide.

19. A method for producing a target polypeptide, comprising: Culturing the host cell according to claim 12 or 13; and optionally recovering the target polypeptide.

Citation Information

Patent Citations

  • Improved selection in fungi

    CN104395454A

  • Saccharifying enzyme high-yield strain gene knockout recombinant bacteria with low trans-glycoside enzyme background as well as construction method and application thereof

    CN105969675A

  • Bacterial strain capable of increasing yield of organic acid as well as construction method and application of bacterial strain

    CN113265417A

  • Simultaneous Site-Specific Integrations of Multiple Gene-Copies in Filamentous Fungi

    US20140120625A1

  • DNA sequences, vectors, and fusion polypeptides for secretion of polypeptides in filamentous fungi

    US6265204B1