Lipid nanoparticle (LNP) compositions and methods for delivering therapeutic agents to tumor cells
Lipid nanoparticle compositions that inhibit sEV secretion via Rab27a targeting enhance tumor delivery and therapeutic efficacy by overcoming the sEV defense mechanism, addressing the challenge of nanoparticle accumulation in tumor tissues.
Patent Information
- Application Number
- PCT/US2024/061678
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-26
- Filing Date
- 2024-12-23
- Publication Date
- 2025-07-03
AI Technical Summary
Existing nanoparticle-based drug delivery systems face challenges in achieving high accumulation in tumor tissues due to the defense mechanism exerted by cancer cell-derived small extracellular vesicles (sEVs), which bind to nanoparticles and traffic them to liver Kupffer cells for degradation, limiting the efficacy of cancer therapy.
The use of lipid nanoparticle (LNP) compositions that encapsulate an agent to reduce or inhibit sEV secretion, combined with therapeutic mRNA, to enhance tumor accumulation and delivery by targeting Rab27a, a gene that controls sEV secretion, thereby overcoming the sEV defense system.
This approach significantly improves the delivery of therapeutic agents to tumor cells, enhancing therapeutic efficacy by increasing nanoparticle accumulation and reducing liver clearance, thus improving cancer treatment outcomes.
Smart Images

Figure IMGF000094_0001 
Figure IMGF000095_0001 
Figure 00000109_0000
Abstract
Description
[0001]Attorney Docket No.046483-7443WO1(03814) TITLE OF THE INVENTION Lipid Nanoparticle (LNP) Compositions and Methods for Delivering Therapeutic Agents to Tumor Cells STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with government support under TR002776 awarded by the National Institutes of Health. The government has certain rights in the invention. CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Patent Application No.63 / 614,821, filed December 26, 2023, which is incorporated herein by reference in its entirety. SEQUENCE LISTING The XML file named “046483-7443WO1 - Sequence Listing.xml” created on December 19, 2024, comprising 4.7 Kbytes, is hereby incorporated by reference in its entirety. BACKGROUND Nanoparticle-based drug delivery systems have shown great promise for disease treatment in the clinic. In the context of cancer therapy, it is desired that nanoparticles deliver drugs / genes specifically to tumor tissues for cancer cell killing or tumor microenvironment modulation. However, studies have shown that only 0.7% (median) of the injected nanoparticles can reach solid tumors, which is one of the reasons for the low clinical translation of nanoparticles for cancer therapy. To improve the tumor accumulation of nanoparticles, several strategies have been explored. For example, studies focused on the optimization of the size, shape, surface chemistry and stiffness of nanoparticles to improve tumor accumulation through the passive mechanism of enhanced permeability and retention (EPR) or through the active mechanism of ligand based targeting. Others have demonstrated that affecting the identity and quantity of serum proteins - 1 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) deposited on the nanoparticle surface (protein corona) can affect the bio-distribution and tumor accumulation of nanoparticles. In addition, many studies have focused on developing strategies to decrease nanoparticle hepatic clearance to improve circulation time and enhance accumulation in target tissues. For example, studies have shown that depleting or saturating liver Kupffer cells (i.e., the major cell type that internalize nanoparticles) enhances circulation half-life and accumulation of nanoparticles in the tumor. Although the above strategies have been very encouraging, improved nanoparticle accumulation in tumor tissues remains marginal, therefore limiting the potential of nanoparticles and their clinical efficacy. There is thus a need in the art for compositions and methods for delivering therapeutic agents to tumor cells. The present disclosure addresses this need. BRIEF SUMMARY In one aspect, the disclosure provides a lipid nanoparticle (LNP) composition comprising an agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) and at least one mRNA, wherein the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) and the therapeutic mRNA are at least partially encapsulated in the lipid nanoparticle. In certain embodiments, the LNP comprises at least one ionizable lipid. In certain embodiments, the LNP comprises at least one helper lipid. In certain embodiments, the LNP comprises cholesterol and / or a modified derivative thereof. In certain embodiments, the LNP comprises at least one polymer conjugated lipid. In certain embodiments, the LNP comprises an agent that reduces or inhibits secretion of small extracellular vesicles (sEVs). In certain embodiments, the LNP comprises at least one therapeutic mRNA. In certain embodiments, the LNP comprises the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) and the at least one therapeutic mRNA are at least partially encapsulated in the LNP. In another aspect, the disclosure provides a pharmaceutical composition comprising the LNP of the disclosure and at least one pharmaceutically acceptable carrier. In another aspect, the disclosure provides a method for treating, preventing, and / or ameliorating cancer in a subject, the method comprising administering to the subject the LNP of the disclosure or the pharmaceutical composition of the disclosure. - 2 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) In another aspect, the disclosure provides a method for delivering a therapeutic agent to a tumor cell in a subject, the method comprising administering to the subject the LNP of the disclosure or the pharmaceutical composition of the disclosure. In another aspect, the disclosure provides a method for treating, preventing, and / or ameliorating cancer in a subject, the method comprising administering to the subject at least one agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) and at least one therapeutic agent. In another aspect, the disclosure provides a method for delivering a therapeutic agent to a tumor cell in a subject, the method comprising administering to the subject at least one agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) and at least one therapeutic agent. BRIEF DESCRIPTION OF THE FIGURES The drawings illustrate generally, by way of example, but not by way of limitation, various embodiments of the present application. FIGs.1A-1L: Rab27a knock out in cancer cells promotes the accumulation of lipid nanoparticles (LNP) in tumor tissues. A tumor model was constructed by s.c. injection of either wild type (WT) or Rab27a knockout (KO) MC38 cells to the right flank of mice. To ensure that tumors can continue to grow after Rab27a KO to a similar volume as the WT tumors, an anti- CD8 antibody was used to deplete CD8+T cells in MC38 KO tumor-bearing mice. LNPs labeled with a near infrared dye DiR were i.v. injected (0.25 mg / kg, RNA dose) into tumor bearing mice. 24h post-LNP injection, mice were euthanized and the distribution of LNPs in different organs and tumors was observed using IVIS (FIG.1A). FIGs.1B-1D: quantification of the fluorescence signals in the liver (FIG.1B), spleen (FIG.1C), and tumor (FIG.1D) in different groups. One- way analysis of variance (ANOVA) with Tukey’s post hoc test was used to analyze statistical differences (n=5). FIGs.1E-1H: DiR+Kupffer cells (FIG.1E), CD31+endothelial cells (FIG. 1F), CD19+B cells (FIG.1G), and EpCAM+tumor cells (FIG.1H) in 10000 total cells were quantified. One-way ANOVA with Tukey’s post hoc test was used to analyze statistical differences (n=5). FIG.1I: LNPs delivering mRNA encoding Cre recombinase were prepared and labeled with DiD dye. LNPs were i.v. injected into Cre loxP tdTomato mice at day 0. The mice were euthanized at day 3. Mice livers and tumors were collected for an - 3 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) immunofluorescence assay. The liver Kupffer cells were stained using a F4 / 80 antibody (green) and LNP distribution in different cells was examined by observing tdTomato fluorescence (FIG. 1I). FIG.1J: quantification of the overlap of the green signal (Kupffer cells) and red signal (LNP) using Image-pro plus 6.0 software. One-way ANOVA with Tukey’s post hoc test was used to analyze statistical differences (n=5). FIG.1K: distribution of LNPs in tumor tissues. Blue: nucleus; Green: EpCAM+tumor cells; Red: LNP-DiD. FIG.1L: quantification of the overlap of green signal (tumor cells) and the red signal (LNP) using Image-pro plus 6.0 software. Data are shown as mean ± s.d. (n=3), comparison was performed between WT tumor and Rab27a KO tumor with CD8+T cell depletion. One-way ANOVA with Tukey’s post hoc test was used to analyze statistical differences (n=5). FIGs.2A-2L: Binding of LNP to small extracellular vesicles (sEV) promotes the delivery of LNPs to liver Kupffer cells. FIG.2A: CD206 expression in liver Kupffer cells from MC38 tumor-bearing mice that received the indicated treatments. FIG.2B: CD206 expression in Kupffer cells from YUMM1.7 tumor-bearing mice that received the indicated treatments. One- way ANOVA with Tukey’s post hoc test was used to analyze statistical differences (n=5). FIG. 2C: Liver cells were incubated with sEVs (labeled with DiR), LNPs (labeled with DiR), or sEVs pre-mixed with LNPs (where only LNPs were labeled with DiR). After 2 h, the DiR signal in Kupffer cells was analyzed using flow cytometry. FIG.2D: Quantification of DiR+Kupffer cells in (FIG.2C). Comparison was performed between LNP-only and LNPs pre-mixed with sEVs. One-way ANOVA with Tukey’s post hoc test was used to analyze statistical differences (n=5). FIG.2E: Percentage of LNPs bound to sEVs from MC38 cells or YUMM1.7 cells. FIG.2F: Representative TEM images showing LNPs directly bound to sEVs from MC38 cells (left panel) or YUMM1.7 cells (right panel). FIG.2G: A pull-down assay showing LNP directly binding to sEVs characterized by high levels of exosomal markers including CD63, Hrs, TSG101, adhesion molecule ICAM-1, and CD47. FIG.2H: t-distributed stochastic neighbor embedding (tSNE) visualization plot of single cell RNA-sequencing data from healthy mouse liver cells (n = 983; sequenced at a median depth of 1.2 M reads per cell and with an average number of 1563 detected genes per cell). FIGs.2I-2J: Four groups of labeled nanoparticles were prepared and i.t. injected to Rab27a KO MC38 tumors: 1) LNPs labeled with DiR, 2) sEVs labeled with DiR, 3) LNPs labeled with DiR and then mixed with sEVs, and 4) LNPs labeled with DiR and then conjugated to sEVs via click chemistry. After 24 h, mice were euthanized and the biodistribution - 4 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) of the particles in both livers and tumors were analyzed using IVIS (data is shown in FIG.27A) and quantified in FIG.2I and FIG.2J, respectively. FIG.2K: Flow cytometry analysis of SIRP-α expression in macrophages / Kupffer cells from mouse blood, spleen, or liver. FIG.2L: Quantification of FIG.2K. Data are shown as mean ± s.d. (n=3). One-way ANOVA with Tukey’s post hoc test was used to analyze statistical differences. FIGs.3A-3K: Small extracellular vesicles act as a defense system against lipid nanoparticle (LNP)-based mRNA delivery. FIG.3A: Wild type (WT) or Rab27a KO MC38 cells were treated with LNPs encapsulating eGFP mRNA for 24 h. eGFP expression in cells was measured using flow cytometry. FIG.3B: Rab27a KO MC38 cells were treated with LNPs encapsulating eGFP mRNA in the presence or absence of sEVs. eGFP expression levels were determined using flow cytometry. FIGs.3C-3F: MC38, YUMM1.7, B16-F10, and MW9 cells were treated with LNPs encapsulating luciferase mRNA in the presence of different concentrations of sEVs, respectively. It was next evaluated whether overcoming the sEV barrier by delivering siRNA targeting Rab27a can enhance delivery of functional mRNA to tumor cells and tumor spheroids. FIG.3G: WT MC38 cells were incubated with different doses (0, 10, 20, or 30 nM) of LNPs encapsulating siRab27a for 24 h before the addition of fresh media containing LNPs encapsulating eGFP mRNA. After another 24 h, eGFP expression in cells was determined using confocal microscopy. FIG.3H: MC38, YUMM1.7, B16-F10, and MW9 cells were first treated with different doses of LNPs (encapsulating siRab27a) for 24 h and then the media was replaced with fresh media containing LNPs encapsulating luciferase mRNA. After another 24 h, the luciferase expression in the cells was analyzed. Data are shown as mean ± s.d. (n=3), statistical analysis was performed using one-way ANOVA with Tukey’s post hoc test. FIGs.3I- 3K: MC38 tumor spheroids were constructed and pretreated with PBS or LNPs encapsulating siRab27a for 24 h. After that, the media was replaced with fresh media containing DiD-labeled LNPs, and tumor spheroids were cultured for another 24 h. The penetration of DiD-labeled LNPs in tumor spheroids was characterized using confocal z-stacking mode (FIG.3I). The ratio of DiD signals in deep tumor (DT) spheroids to that in shallow tumor (ST) spheroids were quantified in FIG.3J. The ratio of DiD signal to GFP signal in deep tumor in PBS and siRab27a-LNP pretreated groups were compared (FIG.3K). Data are shown as mean ± s.d. (n=3), statistical analysis was performed using one-way ANOVA with Tukey’s post hoc test. - 5 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) FIGs.4A-4H: Rab27a knockdown enhances LNP tumor delivery and the antitumor efficacy of PTEN mRNA. FIG.4A: 1 x 106YUMM1.7 cells were s.c. injected into the right flank of mice at day 0. At day 7, tumor volume reached 50 mm3. Mice were then treated with 0, 3, or 5 injections of LNP (0.25mg / kg, RNA dose) co-encapsulating siRab27a and scrambled mRNA with 2 day intervals for each injection.48 h after the last injection (day 17), LNP labeled with DiR (LNP-DiR) was i.v. injected. Distribution of LNP-DiR in major organs and tumors was observed using IVIS 24h post-LNP-DiR injection (FIG.4B). FIG.4C: quantification of DiR signal in tumor tissues for different treatment groups. Comparisons were performed between 0 and 5 LNP pre-treatments using one-way ANOVA with Tukey’s post hoc test (n=5). FIG.4D: YUMM1.7 tumor cells were s.c. injected into the right flank of mice at day 0. After tumor sizes reached about 50 mm3, mice were treated with either LNP co-encapsulating mouse siRab27a and scrambled mRNA; LNP co-encapsulating scrambled siRNA and mouse PTEN mRNA (mPTEN); or LNP co-encapsulating siRab27a and mPTEN (FIG.4D). These LNPs were i.v. injected (0.25 mg / kg, RNA dose) into mice at days 7, 9, 11, 13, and 15 (FIG.4D). PBS injections at different time points were used as a control group. FIGs.4E-4F display tumor growth curves (FIG.4E), and survival curves (FIG.4F), respectively. Comparison in FIG.4E was performed between the PBS group and the siRab27a+mPTEN group (n=10). Statistical differences were calculated using a Mantel–Cox two-sided log-rank test. FIGs.4G-4H: immunohistochemistry (IHC, FIG. 4G) and western blot analysis (FIG.4H) of the expression levels of Rab27a and PTEN in tumor tissues collected from different groups at day 23. FIGs.5A-5K: Rab27a knock down enhances the antitumor efficacy of a STING mRNA. 1x106MC38 cells were s.c. injected into the right flank of mice at day 0. The tumor volume reached 50 mm3at day 7. Mice were then treated with 0.25 mg / kg of the following LNPs: 1) LNP co-encapsulating siRab27a and scrambled mRNA; 2) LNP co-encapsulating scrambled siRNA and mSTING-miR122; or 3) LNP co-encapsulating siRab27a and mSTING-miR122 (FIG.5A). These LNPs were i.v. injected into mice at days 7, 9, 11, 13, and 15 (FIG.5A). PBS injections to mice at different time points were used as a control group. FIG.5B: tumor growth curves during the treatment period, respectively. Data are shown as mean ± s.d. (n=10), statistics in FIG.5B was performed using two tailed unpaired Student’s t test. FIGs.5C-5D: the animal experiment was repeated and tumor tissues collected from different groups at day 20. The concentrations of mouse cytokines such as IFN-β (FIG.5C) and TNF-α (FIG.5D) in tumor - 6 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) tissues were measured using ELISA kits. Data are shown as mean ± SD (n=10), statistics in FIGs.5E-5F was performed using one-way ANOVA with Tukey’s post hoc test. FIGs.5E-5I: RNA-sequencing data of tumor tissues collected from different groups. FIG.5E: Volcano plots of differentially expressed genes (DEGs) with LNP co-encapsulating siRab27a and mSTING- miR122 treatment compared with PBS treatment. FIGs.5F-5I: Heatmap of selected differentially expressed genes (P<0.05, one-way ANOVA) in response to treatment with LNP co- encapsulating scrambled siRNA and mSTING-miR122 or LNP co-encapsulating siRab27a and mSTING-miR122 (n = 5 biologically independent samples). FIG.5J: mouse survival curves. Statistics were calculated using a log-rank test. FIG.5K: immunohistochemistry of tumor tissue shows the expression of STING in tumor tissues from different groups. FIGs.6A-6M: Cancer cell-derived extracellular vesicles act as a defense system against different nanoparticles and cancer therapeutics. FIGs.6A-6B: liposomes labeled with FITC were incubated with WT or Rab27a KO MC38 cells for 24 h. Then, the MFI of cells was determined using flow cytometry (FIG.6A). FIG.6B: Rab27a KO MC38 cells were treated with liposomes in the presence of different amounts of sEVs for 24 h and the MFI of cells was measured. FIGs. 6C-6D: Fluorescent dye-labeled PLGA NPs were incubated with WT or Rab27a KO MC38 cells for 24 h. Then, the MFI of cells was determined (FIG.6C). FIG.6D: Rab27a KO MC38 cells were treated with PLGA NPs in the presence of different amounts of sEVs for 24 h and the MFI of cells was measured. FIGs.6E-6F: Fluorescent dye-labeled polystyrene (PS) NPs were incubated with WT or Rab27a KO MC38 cells for 24 h. Then, the MFI of cells was determined (FIG.6E). FIG.6F: Rab27a KO MC38 cells were treated with PS NPs in the presence of different amounts of sEVs for 24 h and the MFI of cells was measured. FIGs.6G-6H: a lentivirus delivering the Luciferase gene was used as a model virus to mimic oncolytic virus particles infecting WT or Rab27a KO MC38 cells. The Luciferase signal in the cells after 24h post- lentivirus treatment was determined (FIG.6G). FIG.6H: Rab27a KO MC38 cells were treated with lentivirus particles in the presence of different amounts of sEVs for 24 h. Luciferase expression in cells was determined. FIG.6I-6J: WT or Rab27a KO MC38 cells were treated with a fluorophore-conjugated anti-EGFR antibody for 30 min and then washed with PBS. The level of antibody binding to cell surfaces was determined (FIG.6I). Rab27a KO MC38 cells were treated with fluorophore-conjugated anti-EGFR antibody in the presence of different amounts of sEVs for 30 min. Then, binding of the antibody to cells was measured (FIG.6J). FIGs.6K-6L: - 7 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) WT or Rab27a KO MC38 cells were treated with a fluorophore-conjugated anti-PD-L1 antibody for 30 min and then washed with PBS. The levels of antibody binding to cell surfaces were determined (FIG.6K). Rab27a KO MC38 cells were treated with fluorophore-conjugated anti- PD-L1 antibody in the presence of different amounts of sEVs for 30 min. After that, antibody binding to cells was measured (FIG.6L). Data in FIGs.6A-6L are shown as mean ± s.d. (n=3), statistical differences were calculated using one-way ANOVA with Tukey’s post hoc test. FIG. 6M: Schematic illustration of the mechanism of the cancer cell sEVs-mediated defense system. Cancer cells secrete large amounts of sEVs in the tumor microenvironment, which then could bind to nanoparticles, oncolytic virus, or certain therapeutic antibodies that are entering tumor tissue and traffic them to liver Kupffer cells for degradation. FIGs.7A-7E: flow cytometry assay investigating the distribution of LNPs in different tissues. The number of DiR cells in 10000 total liver cells (FIG.7A), the number of DiR cells in 10000 total spleen cells (FIG.7B), and the number of DiR cells in 10000 total tumor cells (FIG. 7C) were quantified. Data was plotted as mean ± s.d. (n= 5), one way ANOVA with Tukey’s post hoc test was used to analyze statistical differences (FIG.7D), flow gating strategy for analyzing the flow data for liver cells. FIG.7E: the number of DiR hepatocytes in 10000 total liver cells. Data was plotted as mean ± s.d. (n=5), one way ANOVA with Tukey’s post hoc test was used to analyze statistical differences. FIGs.8A-8D: effects of T cell depletion on LNP biodistribution. FIGs.8A-8B: in order to assess if enhanced LNP accumulation in the Rab27a KO tumor is a result of CD8+T cell depletion, a MC38 WT tumor model was constructed and the distribution of LNPs in mice with or without CD8+T cell depletion was analyzed. FIGs.8C-8D: the results showed that there is no significant difference in mice with or without CD8+T cell depletion. Moreover, a comparison of LNP distribution in WT MC38 tumor bearing mice and Rab27a KO tumor bearing mice where both groups were depleted of CD8+T cell s was conducted. Data were shown as mean ± s.d. (n= 3), one way ANOVA with Tukey’s post hoc test was used to analyze statistical differences. FIGs.9A-9E: Flow cytometry assay investigating the distribution of LNPs in spleen. FIG.9A: flow gating strategy for analyzing the spleen cell data. The numbers of DiR+CD3+(FIG.9B), DiR+CD11c+(FIG.9C), DiR+CD19+(FIG.9D), or DiR+F4 / 80+(FIG.9E) cells in 10000 total spleen cells were determined. Data were shown as mean ± s.d. (n= 5), one way ANOVA with Tukey’s post hoc test was used to analyze statistical differences. - 8 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) FIGs.10A-10D: flow cytometry assay investigating the distribution of LNPs in blood cells. FIG.10A: flow gating strategy for analyzing blood cell flow cytometry data. The numbers of DiR+F4 / 80+(FIG.10B), DiR+CD19+(FIG.10C), or DiR+CD3+(FIG.10D) cells in 10000 total blood cells were determined data were shown as mean ± s.d. (n=5), one way ANOVA with Tukey’s post hoc test was used to analyze statistical differences. FIGs.11A-11E: Flow cytometry assay investigating the bio distribution of LNPs in tumors. FIG.11A: flow gating strategy for analyzing tumor cell data. The numbers of 80 DiR+F4 / 80+(FIG.11B), DiR+CD3+(FIG.11C), DiR+CD11+(FIGs.11C-11D), or DiR+CD19+(FIG.11E) cells in 10000 total tumor cells were determined. Data were shown in mean ± s.d. (n= 5), one way ANOVA with Tukey’s post hoc test was used to analyze statistical differences. FIGs.12A-12E: biodistribution of LNPs in the liver LNPs encapsulating mRNA encoding Cre recombinase were prepared. FIG.12A: LNPs (0.25 mg / kg) were i.v. injected to Cre loxP tdTomato mice at day 0 and were euthanized at day 3. Mouse livers were then collected for an immunofluorescence assay (FIG.12B). Liver endothelial cells were stained using an anti- CD31 antibody (green), and LNP distribution in different cells was observed by the appearance of tdTomato fluorescence (FIG.12B). Blue: nucleus; Green: CD31+endothelial cells; Red: tdTomato. FIGs.12C-12D: quantification of the overlap of green signal (endothelial cells) and the red signal (LNP) using Image-pro plus 6.0 software. Data were shown as mean ± s.d. (n= 3), one way ANOVA with Tukey’s post hoc test was used to analyze statistical differences. FIG. 12E: quantification of the overlap of green signal (Kupffer cells) and the red signal (LNP) in FIG.1A using Image pro plus 6.0 software In FIG.12D and FIG.12E, the more red and green overlap represent the more endothelial cell and Kupffer cell delivery, respectively. FIGs.13A-13G: knockout of Rab27a in cancer cells promotes the accumulation of lipid nanoparticles (LNPs) in YUMM1.7 tumors. Firstly, a tumor model was constructed by s.c. injection of either wild type YUMM1.7 (WT) or Rab27a knockout MC38 (KO) cells in to the right flank of mice. An anti-CD8 antibody was used to deplete CD8+T cells in mice bearing YUMM1.7 tumors to ensure that tumor growth of Rab27a KO and WT tumors can be compared. LNPs labeled with DiR were i.v. injected (0.25 mg / kg) to mice.24h post LNP injection, mice were euthanized and the distribution of LNPs in different tissues was observed using IVIS (FIG. 13A). FIGs.13B-13D: statistics of the fluorescence signals in liver (FIG.13B), spleen (FIG. 13C), and tumor (FIG.13D) in different groups. Comparisons were performed between WT - 9 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) tumor and KO tumor with CD8+T cell depletion. Data shown as mean ± s.d. (n=5), one way ANOVA with Tukey’s post hoc test was used. FIGs.13E-13G: the number of DiR cells in 10000 total liver cells (FIG.13E), the number of DiR cells in 10000 total spleen cells (FIG.13F), and the number of DiR cells in 10000 total tumor cells (FIG.13G) were 116 quantified. Data were shown as mean ± s.d. (n=6), one way ANOVA with Tukey’s post hoc test was used to analyze statistical differences. FIGs.14A-14H: biodistribution of LNPs in mouse liver and spleen. DiR-labeled LNPs were i.v. injected to YUMM1.7 tumor bearing mice.24 h post LNP injection, mice were euthanized and the distribution of LNPs in the livers and spleens were determined. The numbers of DiR+F4 / 80+(FIG.14A), DiR+CD31c+(FIG.14B), DiR+CD19+(FIG.14C), or DiR+hepatocytes (FIG.14D) in 10000 total liver cells were determined. The number of DiR+CD3+(FIG.14E), DiR+CD11c+(FIG.14F), DiR+CD19+(FIG.14G), or DiR+F4 / 80+(FIG.14H) cells in 10000 total spleen cells were determined. Data were shown as mean ± s.d. (n=6), one way ANOVA with Tukey’s post hoc test was used to analyze statistical differences. FIGs.15A-15H: Biodistribution of LNPs in mouse blood and tumors. DiR labeled LNPs were i.v. injected in to YUMM1.7 tumor bearing mice.24 h post LNP injection, mice were euthanized and the distribution of LNPs in blood cells and tumors was determined. The number of DiR+F4 / 80+(FIG.15A), DiR+CD19+(FIG.15B), or DiR+CD3+(FIG.15C) cells in 10000 total blood cells were determined by flow cytometry. Data were shown as mean ± s.d. (n=5), one way ANOVA with Tukey’s post hoc test was used for statistical analysis. The number of DiR+F4 / 80+(FIG.15D), DiR+CD3+(FIG.15E), DiR+CD11c+(FIG.15F), DiR+CD19+(FIG. 15G) or DiR+TRP1+(FIG.15H) cells in 10000 total tumor cells were determined. Data were shown as mean ± s.d. (n=6), one way ANOVA with Tukey’s post hoc test was used to analyze statistical differences. FIGs.16A-16F: Immunofluorescence assay investigating the biodistribution of LNPs in the liver. LNPs encapsulating mRNA encoding Cre recombinase were prepared. FIG.16A: LNPs (0.25 mg / kg) were i.v. injected in to Cre loxP tdTomato mice at day 0 and mice were euthanized at day 3. Then, mouse livers were collected for an immunofluorescence assay. The liver Kupffer cells were stained using an anti F4 / 80 antibody (green), and the LNP distribution in different cells can be observed by the appearance of tdTomato fluorescence. Blue: nucleus; Green: F4 / 80+Kupffer cells; Red: tdTomato. FIGs.16B-16C: quantification of the overlap of green signal - 10 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) (endothelial cells) and red signal (LNP) using Image pro plus 6.0 software. Data were shown as mean ± s.d. (n= 3), one way ANOVA with Tukey’s post hoc test was used to analyze statistical differences. Figs.16D-16F: The distribution of LNPs in liver endothelial cells was also investigated. Liver endothelial cells were stained using an anti CD31 antibody (green), and the LNP distribution in different cells can be observed by the appearance of tdTomato fluorescence (FIG.16D). Blue: nucleus; Green: CD31+endothelial cells; Red: tdTomato. FIGs.16E-16F: quantification of green signal (endothelial cells) and the red signal (LNP) overlap using Image pro plus 6.0 software. Data were shown as mean ± s.d. (n= 3), one way ANOVA with Tukey’s post hoc test was used to analyze statistical differences. FIGs.17A-17B: Biodistribution of LNPs in YUMM1.7 tumor tissues. LNPs encapsulating mRNA encoding Cre recombinase were prepared and labeled with DiD dye. FIG. 17A: LNPs (0.25 mg / kg) were i.v. injected in to Cre loxP tdTomato mice at day 0 and mice were euthanized at day 3. After that, mouse livers were collected for an immunofluorescence assay (FIG.17A). Blue: nucleus; Green: EpCAM+tumor cells; Red: LNP-DiD. FIG.17B: quantification of the overlap of green signal (tumor cells) and the red signal (LNP) using image pro plus 6.0 software. Comparisons were performed between WT tumor treated with LNP and KO tumor with CD8+T cell depletion treated with LNP. Data were shown as mean ± s.d. (n= 3), one way ANOVA with Tukey’s post hoc test was used to analyze statistical differences. FIGs.18A-18H: Rab27a knock out in cancer cells promotes the accumulation of lipid nanoparticles (LNP) in tumor tissues. A tumor model was constructed by s.c. injection of either wild type (WT) or Rab27a KO MC38 cells to the right flank of mice. To ensure that tumors can continue to grow after Rab27a KO to a similar volume as the WT tumors, an anti-CD8 antibody was used to deplete CD8+T cells in MC38 KO tumor bearing mice. LNPs labeled with DiR were i.v. injected (0.25 mg / kg , RNA dose ) into tumor bearing mice.24 h post LNP injection, mice were euthanized and the distribution of LNPs in different tissues was determined using IVIS (FIG.18A). FIGs.18B-18D: quantification of the fluorescence signals in the liver (FIG.18B), spleen (FIG.18C), and tumor (FIG.18D) in different groups. FIGs.18E-18H: WT or Rab27a knockout (KO) MC38 tumor bearing mice were treated as mentioned above.48 h post LNP injection, mice were euthanized and the distribution of LNPs in different organs and tumors was observed using IVIS (FIG.18E). FIGs.18F-18F: quantification of the fluorescence signals in the liver (FIG.18F), spleen (FIG.18G), and tumor (FIG.18H) in different groups. The data in FIGs. - 11 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) 18B, 18D, and 18F-18H are shown as mean ± s.d. (n=3), one way ANOVA with Tukey’s post hoc test was used to analyze statistical differences. FIGs.19A-19D: Investigation of the liver toxicity and Kupffer cell infiltration levels in different groups. It was investigated if the enhanced LNP uptake by liver Kupffer cells is a result of liver damage and increased Kupffer cell infiltration. FIGs.19A-19B: Mice blood was collected 24 h post LNPs injection and the levels of alanine transaminase (ALT, FIG.19A) and aspartate transaminase (AST, FIG.19B) in the serum were determined. FIG.19C: Immunofluorescence images of the liver tissues showing the infiltration of Kupffer cells in the liver. Blue: nucleus; red: F4 / 80+. Scale bar: 100 μm. FIG.19D: quantification of FIG.19C. Data are shown as mean ± s.d. (n=3), statistical differences are calculated using one way ANOVA with Tukey’s post hoc test. FIGs.20A-20B: Uptake of sEV or LNP by liver cells. Mouse liver was harvested and single cell suspension was prepared. The cells were incubated with similar numbers of sEV (labeled with DiR) or LNP (labeled with DiR) for 2 h and their by different liver cells were investigated by flow cytometry. Data were shown as mean ± s.d. (n= 3), two tailed unpaired student’s t test was used to analyze statistical differences. FIGs.21A-21D: Binding of LNP to s EV after co-incubation. LNPs and sEVs were mixed in PBS buffer at a 1:1 ratio for 30 min and were observed using TEM. TEM images for sEV s and LNPs are shown in FIGs.21A-21B. In order to further analyze the interaction between sEVs and LNPs, a pull down experiment was performed (FIGs.21C-21D). LNPs labeled with azide groups were mixed with sEVs (from YUMM1.7 cells) for 30 min and then magnetic beads with surface modification of DBCO were added to the mixture. After 10 min, the magnetic beads were collected using a magnetic rack and washed three times with PBS. Particles that were captured by the magnetic beads were then collected and analyzed using western blot to assess if sEV markers could be detected (FIG.21E). FIGs.22A-22C: LNP uptake is mediated by ICAM-1 on sEVs. Tumor sEVs were collected and adhesion associated surface markers were blocked with antibodies for integrin α4, integrin α5, integrin β1, integrin β3, integrin β4, integrin β5, CD51, CD66a, CD102, ICAM-1 or ICAM-4. Then, sEVs were incubated with DiR labeled LNPs for 2 h. Free antibodies were then removed and particles were added to primary liver cells. After a 24 h incubation, the levels of DiR Kupffer cells in each treatment group were determined using flow cytometry. FIG.22A: - 12 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) flow cytometry gating strategy for analyzing liver cell data. FIG.22B: representative flow cytometry dot plots of the uptake of LNPs by F4 / 80+liver Kupffer cells. Rat IgG was used as a control. FIG.22C: Quantification of LNP uptake level based on the flow cytometry data. Data are shown as mean ± s.d. (n= 3), one way ANOVA with Tukey’s post hoc test was used to analyze statistical differences. FIGs.23A-23D: LNP uptake by Kupffer cells is mediated by ICAM-1 on the sEVs surface. FIG.23A: Mouse liver cells were collected and incubated with LNPs, a LNP s sEVs mixture, or a LNP sEVs mixture in which sEVs were collected from a Icam-1 KO tumor cell line. FIG.23B: Quantification of FIG.23A. FIGs.23C-23D: LNPs conjugated to sEVs further increase LNP Kupffer cell uptake. Data are shown as mean ± s.d. (n=3), one way ANOVA with Tukey’s post hoc test was used to analyze statistical differences. FIGs.24A-24F: CD11b and CD18 expression in various mouse liver cells analyzed by single cell RNA sequencing. FIG.24A: t-distributed stochastic neighbor embedding (tSNE) visualization of single cell expression of CD11b in healthy mouse liver cells. FIG.24B: Violin plot of CD11b expression in all identified clusters. FIG.24C: tSNE visualization of single cell expression of CD18 in healthy mouse liver cells (n = 983; sequenced at a median depth of 1.2 M reads per cell and with an average number of 1563 detected genes per cell). FIG.24D: Violin plot of CD18 expression in all identified clusters. FIG.24E: Single cell RNA sequencing data showing CD11b+CD18+cell ratios in different liver cell types. FIG.24F: flow cytometry quantification of the CD11b+CD18+cell ratios in B cells, endothelial cells, hepatocytes, Kupffer cells, and NK cells. Data in FIG.24F are shown as mean ± s.d. (n=3). FIGs.25A-25B: CD11b expression in various human liver cells analyzed by single cell RNA sequencing. FIG.25A: Ranking of CD11b expression levels in different human liver cells such as Kupffer cells, neutrophils, vascular endothelial cells, plasma cells, sinusoid endothelial cells, cholangiocytes, hepatocytes, T cells, hepatic stellate cells, erythroid cells, and NK cells. FIG.25B: t-distributed stochastic neighbor embedding (tSNE) visualization plot of CD11b expression in human liver cells from healthy human liver. Numbers and colors highlight transcriptional clusters as related to different subpopulations. FIGs.26A-26B: CD18 expression in various human liver cells analyzed by single cell RNA sequencing. FIG.26A: Ranking of CD18 expression levels in different liver cells such as Kupffer cells, neutrophils, vascular endothelial cells, plasma cells, sinusoid endothelial cells, - 13 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) cholangiocytes, hepatocytes, T cells, hepatic stellate cells, erythroid cells, and NK cells. FIG. 26B: t-distributed stochastic neighbor embedding (tSNE) visualization plot of CD18 expression in various human liver cell clusters. Numbers and colors highlight transcriptional clusters as related to different subpopulations. FIGs.27A-27D: sEVs influence LNP trafficking to liver Kupffer cells. Four groups of particles were prepared and i.t. injected into Rab27a KO MC38 tumors: 1) LNPs labeled with DiR, 2) sEVs labeled with DiR, 3) LNPs labeled with DiR and then mixed with sEVs, and 4) LNPs labeled with DiR and then conjugated with sEVs through click chemistry. After 24 h, mice were euthanized and the distribution of particles in both livers and tumors were analyzed using IVIS (FIG.27A). It was investigated if LNPs that were s.c. injected in to healthy mice also trafficked to livers (FIG.27B), DiR labeled LNPs were subcutaneously administered in to healthy mice After 24 h, the biodistribution of LNPs in major organs and the injection site tissue was investigated using IVIS (FIG.27B). FIG.27C: WT MC38 tumor model was constructed and LNPs labeled with DiR were i.t. injected into the mice.24 h post LNPs injection, mice major organs were collected and the biodistribution of LNPs in different tissues were observed using IVIS. FIG.27D: Rab27a KO MC38 tumor cells were injected into mice and anti CD8 antibody was used to deplete CD8+T cell to allow tumor growth. M ice were i.v. injected with 5 × 1010MC38 cell derived sEVs After 30 min, DiR labeled LNPs were i.v. injected. Mice major organs were collected 24 h post LNPs injection and the biodistribution of LNPs in different tissues was analyzed (FIG.27D). FIG.28A-28G: sEVs influence LNP trafficking to liver Kupffer cells. Four groups of particles were prepared and i.t. injected into Rab27a KO MC38 tumors: 1) LNPs labeled with DiR, 2) sEVs labeled with DiR, 3) LNPs labeled with DiR and then mixed with sEVs, and 4) LNPs labeled with DiR and then conjugated with sEVs through click chemistry. After 24 h, mice 330 were euthanized and particle distribution in the liver was determined using flow cytometry. FIG.28A: gating strategy for the flow experiment. FIGs.28B-28G: biodistribution of LNPs in F4 / 80+liver Kupffer cells (FIGs.28B-28C), CD31+endothelial cells (FIGs.28D-28E), and CD19+B cells (FIGs.28F-28G) was investigated. FIGs.29A-29C: SIRP-α expression in different cell types in human tissues. Ranking of SIRP-α expression levels in different cell types in many tissues / organs such as adipose subcutaneous, heart muscle, kidney, prostate, skeletal muscle, skin, stomach, testis and liver. - 14 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) FIGs.30A-30B: SIRP-α expression in tumor cells. FIG.30A: SIRP expression in MC38, YUMM1.7, B16 F10, and WM9 cells was analyzed by flow cytometry. FIG.30B: SIRP-α expression in various human cancers was analyzed using TCGA dataset. FIGs.31A-31E: Comparison of sEV secretion by normal cells and tumor cells, and evaluation of the effect of microvesicles on LNP cellular uptake. Mouse primary macrophages, T cells, B cells, liver Kupffer cells, endothelial cells, and hepatocytes were sorted and cultured in FBS free media for 24 h. sEV concentrations in different cell culture media were determined using a nanoparticle tracking system (FIG.31A, left panel). Human primary T cells, monocytes, and NIH3T3 cells were treated with PBS or an exosome inhibitor GW4869 for 24 h. The cells were treated with LNPs encapsulating mRNA encoding luciferase for 24 h and the luciferase expression was measured (FIG.31A, right panel). FIGs.31B-3C: Rab27a KO cell lines MC38 or YUMM1.7 were treated with MV inhibitor Y27632 for 24 h to inhibit MVs secretion. DiO labelled LNPs were then added to the cell culture medium and cells were cultured for another 24 h. Then, LNP uptake levels in cells were determined using flow cytometry (FIGs.31B-31C). Moreover, sEV and MV secretion levels were also compared in WT MC38 and YUMM1.7 cells after cells were cultured for 48 h (FIGs.31D-31E). It was found that these tumor cells secreted substantially more sEVs than MVs. These results demonstrate that the defense system is restricted to tumor cells. Moreover, sEVs, but not MVs contribute to this tumor cell defense. FIGs.32A-32D: Evaluation if the sEV mediated LNP uptake inhibition resulted from the saturation of the endocytosis capacity of cells. First, particle number was quantified for a sEV stock solution and a LNP (with similar size as sEVs) stock solution.5 × 109sEVs or LNPs were labeled with the same amount of DiO and were added to MC38 Rab27a KO cells. After 24 h incubation, the uptake of sEV-DiO or LNP-DiO by the cells was quantified using flow cytometry (FIG.32A). FIG.32B: quantification of the mean fluorescence intensity of FIG.32A. FIG.32C: in order to demonstrate if the addition of sEVs competing with LNPs or saturating the endocytosis capacity of cancer cells, MC38 Rab27a KO cells were cultured in 1 mL medium containing 5 × 109sEVs or 5 × 109LNPs. Then, 5 × 109LNPs labeled with DiO were added to the cell culture medium. After 24 h incubation, the taken up of LNP-DiO by MC38 Rab27a KO cells were quantified using flow cytometry (FIG.32C). FIG.32D: quantification of FIG.32C. Data in FIG.32B and FIG.32D are shown as mean ± s.d. (n=3), statistical differences were calculated using one way ANOVA with Tukey’s post hoc test. - 15 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) FIGs.33A-33C: LNP sEV binding mediated size increase did not inhibit LNPs uptake by MC38 and Kupffer cells. FIG.33A: luciferase mRNA encapsulated LNPs were synthesized with 66 nm (normal size), 93 nm, and 125 nm in diameter. These particles with equivalent number were added to MC38 cells. After 24 h, the expression of luciferase by the cells was quantified using a luciferase 1000 assay. FIG.33B: 66, 93, and 125 nm LNPs were added to primary Kupffer cells, after 24 h, the expression of luciferase by the cells was quantified. FIG.33C: in order to compare the effect of size increase and ICAM-1 expression on the increased LNP uptake, LNPs encapsulating luciferase mRNA (LNP Luc) were conjugated with either LNPs encapsulating GFP mRNA (LNP GFP), or sEVs. These complexes were added into Kupffer cells. LNP Luc conjugated to sEVs pre-treated with ICAM-1 antibody was used as a control. After 24 h, the luciferase expression in the cells was determined. Data in FIG.33A and FIG.33D are shown as mean ± s.d. (n=3), statistical differences were calculated using one way ANOVA with Tukey’s post hoc test. FIGs.34A-34D: Normal cell sEVs also bind to LNPs and induce LNP uptake inhibition. FIG 34A: Representative TEM images showing LNPs bound to sEVs from NIH3T3 cells. FIG. 34B: NIH3T3 or MC38 cells were treated with LNPs (encapsulating mRNA encoding luciferase) in the presence of different amounts of sEVs for 24 h and the luciferase expression in the cells was measured. FIG.34C: flow cytometry histogram showing the expression of SIRP-α in NIH3T3 and MC38 cells. FIG.34D: quantification of the mean fluorescence intensity in FIG. 34C. Data in FIG.34A and FIG.34D shown as mean ± s.d. (n=3), statistical differences were calculated using one way ANOVA with Tukey’s post hoc test (FIG.34B) or two tailed unpaired students t test (FIG.34D). FIGs.35A-35D: LNP s encapsulating siRab27a induce Rab27a Knockdown, which enhance the delivery efficiency of mPTEN encapsulated LNPs into cancer cells. FIGs.35A-35B: LNPs encapsulating siRab27a with different doses were used to treat MC38 cells. The siRab27a LNP induced Rab27a knockdown was detected (FIGs.35A-35B). FIG.35C: Rab27a Knockdown greatly decreased sEVs secretion by the cells. Data are shown as mean ± s.d. n=3). FIG.35D: Knockdown of Rab27a by siRab27a LNP increased the delivery efficacy of a LNP encapsulating mRNA encoding PTEN in YUMM1.7 cells. FIGs.36A-36L: LNPs encapsulating siRab27a enhance the delivery efficiency of mSTING LNPs into MC38 cells. FIG.36A: Western blot analysis of the expression of Rab27a, - 16 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) cleaved caspase 3, and STING in MC38 cells after treatment with nanoparticles for 24 h. FIGs. 36A-36D: qPCR analysis of the expression of IFN-β, CXCL10, and CXCL5 in MC38 cells, respectively. Data are shown as mean ± s.d. (n=3). Statistical analysis was performed using one way ANOVA with Tukey’s post hoc test. FIG.36E: MC38 cell viability after treatment with different doses of mSTING LNPs. FIGs.36G-36K: RNA Sequencing data demonstrates activation of the STING pathway in cells treated with mSTING LNPs. FIG.36F: KEGG enrichment analysis of the pathways between mSTING LNPs treatment and PBS treatment. FIGs.36G-36K: Heatmap of selected differentially expressed genes (P <0.05, one way ANOVA with Tukey’s post hoc test) in response to treatment with mSTING LNPs or PBS (n = 4 biologically independent samples). FIG.36L: Mountain plots of the TNF signaling pathway, chemokine signaling pathway, Toll like receptor signaling pathway, NOD-like receptor signaling pathway, cytokine-cytokine receptor interaction, p53 signaling pathway, apoptosis, and autophagy pathways. Stick plots at the bottom represent the posit ion in the ranked list of genes. FIGs.37A-37C: DiD labeled LNPs penetration in tumor spheroids collected on days 5, 8, and 11. GFP expressing WT MC38 tumor cells were used to construct the tumor spheroids. Tumor spheroids (with similar size) were collected on day 5, 8, and 11 of initial cell seeding and were treated with DiD labeled LNPs (66 nm) for 24 h. After that, the tumor spheroids were washed with PBS and observed under confocal microscopy. Images were collected using the z stack mode with a step of 16 μm in between each slice. Scale bar: 100 μm. FIGs.38A-38F: The effect of LNP size and Rab27a expression on the penetration of LNPs into tumor spheroids. GFP expressing WT MC38 or Rab27a KO 453 MC38 cells were used to construct tumor spheroids. Tumor spheroids were collected on day 11 of initial seeding and were treated with DiD labeled LNPs (with sizes of 66 nm, 93 nm or 125 nm) for 24 h. After that, the tumor spheroids were washed with PBS and observed under confocal microscopy. Images were collected using the z-stack mode with a step of 16 μm in between each slice. Scale bar: 100 μm. FIGs.39A-39H: Knockdown of Rab27a decreases sEV concentrations in the tumor and improves tumor accumulation of LNPs. The YUMM1.7 WT tumor model was constructed and LNPs that coencapsulated siRab27a and a scrambled mRNA were injected 0, 3, or 5 times (0.25 mg / kg for each injection).24 h after the last injection, mice were euthanized and tumor tissues were collected. The total RNA in each sample was extracted and the abundance of Rab27a - 17 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) mRNA in different groups was quantified using real time (RT) PCR (FIGs.39A-39C). Next, the ratio of tumor cell derived sEVs in sEVs collected from the tumor tissue was investigated.1 × 1010of sEVs collected from MC38 cells and sEVs collected from the MC38 tumor tissue were incubated with the same dose of anti-EpCAM-PE antibody for 40 min. After that, free antibody was removed by centrifuge and the pellet was resuspended in 1 mL PBS. The fluorescence intensity of the mixture was measured using a fluorescence spectrophotometer. The ratio of tumor cell derived sEVs (R1) in all sEVs was calculated using the indicated equation. The results showed that 88.9% of the sEVs in the tumor tissue are from tumor cells. FIG.39D: investigation of the ratio of tumor cell derived sEVs in sEVs collected from the tumor tissue using another method. Tumor cells were metabolically labeled with excess amount of azide group to ensure that sEVs released from tumor cells are labeled with azide group. Azide modified MC38 cells were used to construct the tumor model. After 14 days of tumor model construction, tumor tissues were collected and the total sEVs in the tumor tissue were isolated. Tumor released sEVs were collected using a pull down experiment. The total sEVs number and tumor released sEVs number were determined using a nanoparticle tracking (NTA) system and the ratio of tumor cell derived sEVs (R2) in all sEVs was calculated using the indicated equation. FIG.39E: The results in FIGs.39B-39E demonstrate that most sEVs in the tumor tissue are from tumor cells. FIG. 39F: Tumor tissues collected from the experiment showed in FIG.4B were digested and the concentration of sEVs in tumor tissues was determined. Data are shown as mean ± s.d. (n= 3), one way ANOVA with Tukey’s post hoc test was used to analyze statistical differences. YUMM1.7 tumor cells were s.c. injected into the right flank of mice at day 0. After tumor sizes reached about 50 mm3, mice were treated with either LNP co-encapsulating mouse siRab27a and scrambled mRNA; LNP co-encapsulating scrambled siRNA and mouse PTEN mRNA (mPTEN); or LNP co-encapsulating siRab27a and mPTEN. These LNPs were i.v. injected (0.25 mg / kg) into mice at days 7, 9, 11, 13, and 15. PBS injections at different time points were used as a control group. FIG.39G: when tumor volume in the PBS group reached 1500 mm3(day 23), all the mice were imaged. FIG.39H: mice body weight curves. FIGs.40A-40B: LNPs co-encapsulating siRab27a and mPTEN improve tumor growth inhibition in vivo. Changes in the expression levels of anti-apoptotic protein Bcl 2, tumor proliferation marker Ki67, and apoptotic protein activated caspase 3 were investigated in tumor tissues (FIG.40A). The tumor inhibition experiment was reperformed and mice were euthanized - 18 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) at day 23. Tumor tissues were collected, sectioned and stained with Bcl-2, Ki67, or activated caspase 3 antibodies before imaging. FIG.40B: H&E staining of major mouse organs collected from the PBS group and the mPTEN + siRab27a group at day 60 is displayed. FIGs.41A-41H: LNPs encapsulating mSTING induce tumor growth inhibition in mice 1 x 106MC38 cells were s.c. injected into the right flank of mice at day 0. When the tumor size reached 50 mm3at day 7, mice were treated with 0.25 mg / kg of the following LNPs: 1) LNP co- encapsulating siRab27a and scrambled mRNA; 2) LNP co-encapsulating scrambled siRNA and mSTING; 3) LNP co-encapsulating siRab27a and mSTING. These LNPs were planned to be i.v. injected into mice at days 8, 10, 12, 14, and 16. After injection of LNPs on day 12, mice receiving LNP co-encapsulating siRab27a and STING mRNA showed significant tumor growth inhibition (FIG.41A), but the body weight of mice was greatly decreased compared to PBS treated mice, which indicated the endpoint of the experiment (FIG.41B). Concentrations of cytokines IFN-β, IL-6, and IL-12p70 were measured. FIGs.41C-41E: Since most of the nanoparticles are located in the liver, it has been proposed herein that the nanoparticles could induce liver damage, which may be one reason for body weight loss. ALT and AST levels in mouse blood were also determined FIGs.41F-41G). Data is presented as mean s.d. (n=5). One way ANOVA with Tukey’s post hoc test was used statistical differences. Livers were collected and an H&E staining assay was performed (FIG.41H). FIGs.42A-42D: STING miR122 mRNA is less toxic to liver hepatocytes compared to STING mRNA. First, the cytotoxicity of LNP encapsulating mSTING and LNP encapsulating mSTING miR-122 were compared in a mouse hepatocyte cell line (FIG.42A) and MC38 colon cancer cell line (FIG.42B). The liver toxicity of mSTING miR-122 loaded LNPs in mice was also tested. mSTING miR-122 loaded LNPs were i.v. injected in to healthy C57 / BL6 mice. After 24 h, mouse livers were collected and H&E staining was conducted to evaluate the liver toxicity caused by nanoparticles (FIGs.42C-42D). FIGs.43A-43G: Individual tumor growth curves of mice that received different LNP treatments.1 x 106MC38 cells were s.c. injected into the right flank of mice at day 0. The tumor volume reached 50 mm3at day 7. Mice were then treated with 0.25 mg / kg of the following LNPs: 1) LNP co-encapsulating siRab27a and scrambled mRNA; 2) LNP co-encapsulating scrambled siRNA and mSTING miR-122; or 3) LNP coencapsulating siRab27a and mSTING miR-122. These LNPs were i.v. injected into mice at days 7, 9, 11, 13, and 15. PBS injections to - 19 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) mice at different time points were used as a control group. Mice images on day 20 (FIG.43A), and body weigh curve (FIG.43B) during the tumor inhibition experiment. FIGs.43C-43F: individual tumor growth curves in different groups. FIG.43G: Tumor inhibition experiment was reperformed and mice were euthanized at day 20. Tumor tissues were collected, sectioned and stained with Bcl-2, Ki67, or activated caspase 3 antibodies before imaging. FIGs.44A-44F: LNPs delivering siRab27a and mSTING miR-122 do not induce systemic toxicity.1 x 106MC38 cells were s.c. injected into the right flank of mice at day 0. At day 8, the tumor size reached 50 mm3. Mice were then treated with the following LNPs: 1) LNP co-encapsulating siRab27a and scrambled mRNA; 2) LNP co-encapsulating scrambled siRNA and mSTING-miR122; or 3) LNP co-encapsulating siRab27a and mSTING-miR122. These LNPs were i.v. injected (0.25 mg / kg) into mice at days 7, 9, 11, 13, and 15. PBS injections into mice at different time points were used as a control group. When tumor sizes in the PBS group reached 1500 mm3(day 20), mice were euthanized and ALT (FIG.44A), AST (FIG.44B), IL 6 (FIG.44C), and IL 12p70 (FIG.44D) in mouse blood were measured. FIG.44E: H&E staining of mouse livers collected from different groups. FIG.44F: H&E staining of major mouse organs collected from the PBS group and the STING miR122 + siRab27a group at day 50. Data in a FIG.44D was shown as mean ± s.d. (n=5). One way ANOVA was used to determine statistical differences. FIGs.45A-45H: Investigation of the effect of sEVs on the uptake of gold and silica nanoparticles by cancer cells. FIG.45A: gold nanoparticles labeled with FITC were incubated with WT or Rab27a KO MC38 cells for 24 h. The uptake of the gold nanoparticles by these cells was determined. FIG.45B: Rab27a KO MC38 cells were treated with gold nanoparticles in the presence of different amounts of sEVs for 24 h and uptake of the nanoparticles by the cells were measured (FIG.45B). FIGs.45C-45D: silica nanoparticles labeled with FITC were incubated with WT or Rab27a KO MC38 cells for 24 h. Then, the MFI of cells was determined (FIG.45C). FIG.45D: Rab27a KO MC38 cells were treated with silica nanoparticles in the presence of different amounts of sEVs for 24 h. Then the MFI of cells was measured. FIGs.45E-45F: investigation of the interactions between sEVs and gold / silica nanoparticles using a fluorescence resonance energy transfer (FRET) experiment. Gold nanoparticles (NPs) and silica NPs were labeled with Cy3 dye to obtain gold NPs Cy3 and silica NPs Cy3, respectively. sEVs were labeled with Cy5 dye to obtain sEVs Cy5. Cy3 labeled NPs were mixed with sEVs Cy5. Based - 20 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) on Förster’s theory, if Cy3 labeled NPs can bind to sEVs Cy5 and the distance of the two dyes are close enough, then Cy5 emission peak (670 nm) can be detected with excitation wavelength of 488 nm (excitation wavelength for Cy3 but not Cy5) In contrast, if the gold NPs Cy3 does not bind to sEVs Cy5, only the Cy3 peak can be detected using 488 nm laser as excitation. FIG.45E: fluorescence spectra of gold NPs Cy3, sEVs Cy5, a mixture of gold NPs Cy3 and sEVs Cy5, or a mixture of gold NPs Cy3 and sEVs Cy5 in the presence of glycerol to decrease the van der Waals interactions between gold NPs Cy3 and sEVs Cy5. FIG.45F: fluorescence spectra of silica NPs Cy3, sEVs Cy5, a mixture of silica NPs Cy3 and sEVs Cy5, or a mixture of silica NPs Cy3 and sEVs Cy5 in the presence of glycerol to decrease the van der Waals interactions between silica NPs Cy3 and sEVs Cy5. Similarly, FIGs.45G-45H show the FRET effect between PLGA NPs Cy3 and sEVs Cy5, and PS NPs Cy3 and sEVs Cy5, respectively. DETAILED DESCRIPTION OF THE INVENTION Reference will now be made in detail to certain embodiments of the disclosed subject matter, examples of which are illustrated in part in the accompanying drawings. While the disclosed subject matter will be described in conjunction with the enumerated claims, it will be understood that the exemplified subject matter is not intended to limit the claims to the disclosed subject matter. Throughout this document, values expressed in a range format should be interpreted in a flexible manner to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. For example, a range of "about 0.1% to about 5%" or "about 0.1% to 5%" should be interpreted to include not just about 0.1% to about 5%, but also the individual values (e.g., 1%, 2%, 3%, and 4%) and the sub-ranges (e.g., 0.1% to 0.5%, 1.1% to 2.2%, 3.3% to 4.4%) within the indicated range. The statement "about X to Y" has the same meaning as "about X to about Y," unless indicated otherwise. Likewise, the statement "about X, Y, or about Z" has the same meaning as "about X, about Y, or about Z," unless indicated otherwise. In this document, the terms "a," "an," or "the" are used to include one or more than one unless the context clearly dictates otherwise. The term "or" is used to refer to a nonexclusive "or" unless otherwise indicated. The statement "at least one of A and B" or "at least one of A or - 21 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) B" has the same meaning as "A, B, or A and B." In addition, it is to be understood that the phraseology or terminology employed herein, and not otherwise defined, is for the purpose of description only and not of limitation. Any use of section headings is intended to aid reading of the document and is not to be interpreted as limiting; information that is relevant to a section heading may occur within or outside of that particular section. All publications, patents, and patent documents referred to in this document are incorporated by reference herein in their entirety, as though individually incorporated by reference. In the methods described herein, the acts can be carried out in any order, except when a temporal or operational sequence is explicitly recited. Furthermore, specified acts can be carried out concurrently unless explicit claim language recites that they be carried out separately. For example, a claimed act of doing X and a claimed act of doing Y can be conducted simultaneously within a single operation, and the resulting process will fall within the literal scope of the claimed process. Description Nanoparticles have shown great promise for drug delivery applications, with many products in the clinic and several lead candidates under development. However, for their application in cancer therapy, achieving high nanoparticle accumulation in the tumor is challenging. The complex tumor microenvironment is a factor that may affect the accumulation of nanoparticles in tumors. Solid tumors are characterized by acidic pH, altered metabolic status, dense extracellular matrix, solid stress, and abnormal vascular structures. These factors have been taken into consideration in improving nanoparticle design for tumor accumulation. However, another important feature of the tumor microenvironment is that there is a large amount of small extracellular vesicles (sEVs). These sEVs, mostly from tumor cells, were found to promote tumor progression by enhancing tumor cell metastasis, improving resistance to therapeutics through sEV-based cell-to-cell communications, and inactivating immune cells via the loaded RNA / proteins in sEVs. The high level of sEVs in solid tumors is a neglected factor that may affect nanoparticle accumulation because of their similarity to some therapeutic nanoparticles in composition and morphology. Most importantly, sEV concentration in tumor tissue is much higher than the surrounding healthy tissues and blood, so the high sEV gradient - 22 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) between tumors and healthy tissue may act as a biological barrier for nanoparticle penetration and accumulation. In one aspect, the present disclosure describes the discovery that cancer cell-derived sEVs act as a defense system against nanoparticle tumor delivery. Cancer cells secrete large amounts of sEVs in the tumor microenvironment, and these sEVs can then bind to the nanoparticles that enter tumor tissues and traffic them to liver Kupffer cells for degradation. The present disclosure further describes the discovery that knockdown of Rab27a (i.e., a gene that controls sEV secretion) can decrease sEV levels in tumors, improve nanoparticle accumulation, and enhance the therapeutic outcome of functional mRNAs. Taken together, these results demonstrate that overcoming this intrinsic defense mechanism through the delivery of small interfering RNA (siRNA) targeting Rab27a can improve the delivery of therapeutic nanoparticles to tumors and improve tumor treatment. Further, the present disclosure describes the finding that the sEVs from cancer cells can affect the delivery of many other nanoparticles such as gold nanoparticles, silica nanoparticles, liposomes, and other cancer therapeutics such as oncolytic virus and antibody-based therapeutics. Overcoming the defense system in the tumor tissue may improve the efficacy of many nanoparticle-based drug / gene delivery systems in the clinic or in pre-clinical studies. Definitions The term "about" as used herein can allow for a degree of variability in a value or range, for example, within 10%, within 5%, or within 1% of a stated value or of a stated limit of a range, and includes the exact stated value or range. The term “antigen” or “Ag” as used herein is defined as a molecule that provokes an adaptive immune response. This immune response may involve either antibody production, or the activation of specific immunogenically-competent cells, or both. The skilled artisan will understand that any macromolecule, including virtually all proteins or peptides, can serve as an antigen. Furthermore, antigens can be derived from recombinant or genomic DNA or RNA. A skilled artisan will understand that any DNA or RNA, which comprises a nucleotide sequences or a partial nucleotide sequence encoding a protein that elicits an adaptive immune response therefore encodes an “antigen” as that term is used herein. Furthermore, one skilled in the art will understand that an antigen need not be encoded solely by a full length nucleotide sequence of a - 23 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) gene. It is readily apparent that the present disclosure includes, but is not limited to, the use of partial nucleotide sequences of more than one gene and that these nucleotide sequences are arranged in various combinations to elicit the desired immune response. Moreover, a skilled artisan will understand that an antigen need not be encoded by a “gene” at all. It is readily apparent that an antigen can be generated synthesized or can be derived from a biological sample. Such a biological sample can include, but is not limited to a tissue sample, a tumor sample, a cell or a biological fluid. The term “anionic lipid” refers to any lipid that is negatively charged at physiological pH. These lipids include phosphatidylglycerol, cardiolipin, diacylphosphatidylserine, diacylphosphatidic acid, N-dodecanoylphosphatidylethanolamines, N- succinylphosphatidylethanolamines, N-glutarylphosphatidylethanolamines, lysylphosphatidylglycerols, palmitoyloleyolphosphatidylglycerol (POPG), and other anionic modifying groups joined to neutral lipids. The term “cationic lipid” refers to any of a number of lipid species that carry a net positive charge at a selected pH, such as physiological pH (e.g., pH of about 7.0). It has been found that cationic lipids comprising alkyl chains with multiple sites of unsaturation, e.g., at least two or three sites of unsaturation, are particularly useful for forming lipid particles with increased membrane fluidity. A number of cationic lipids and related analogs, which are also useful in the present disclosure, have been described in U.S. Patent Publication Nos. 20060083780 and 20060240554; U.S. Pat. Nos.5,208,036; 5,264,618; 5,279,833; 5,283,185; 5,753,613; and 5,785,992; and PCT Publication No. WO 96 / 10390, the disclosures of which are herein incorporated by reference in their entirety for all purposes. Non-limiting examples of cationic lipids are described in detail herein. In some cases, the cationic lipids comprise a protonatable tertiary amine (e.g., pH titratable) head group, C18 alkyl chains, ether linkages between the head group and alkyl chains, and 0 to 3 double bonds. Such lipids include, e.g., DSDMA, DLinDMA, DLenDMA, and DODMA. A “disease” is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal’s health continues to deteriorate. In contrast, a “disorder” in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal’s state of health is less favorable than it would be - 24 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal’s state of health. A disease or disorder is “alleviated” if the severity of a symptom of the disease or disorder, the frequency with which such a symptom is experienced by a patient, or both, is reduced. As used herein, the terms “effective amount,” “pharmaceutically effective amount” and “therapeutically effective amount” refer to a nontoxic but sufficient amount of an agent to provide the desired biological result. That result may be reduction and / or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system. An appropriate therapeutic amount in any individual case may be determined by one of ordinary skill in the art using routine experimentation. In particular, in the case of a mRNA, and “effective amount” or “therapeutically effective amount” of a therapeutic nucleic acid as relating to a mRNA is an amount sufficient to produce the desired effect, e.g., mRNA-directed expression of an amount of a protein that causes a desirable biological effect in the organism within which the protein is expressed. For example, in some embodiments, the expressed protein is an active form of a protein that is normally expressed in a cell type within the body, and the therapeutically effective amount of the mRNA is an amount that produces an amount of the encoded protein that is at least 50% (e.g., at least 60%, or at least 70%, or at least 80%, or at least 90%) of the amount of the protein that is normally expressed in the cell type of a healthy individual. For example, in some embodiments, the expressed protein is a protein that is normally expressed in a cell type within the body, and the therapeutically effective amount of the mRNA is an amount that produces a similar level of expression as observed in a healthy individual in an individual with aberrant expression of the protein (i.e., protein deficient individual). Suitable assays for measuring the expression of an mRNA or protein include, but are not limited to dot blots, Northern blots, in situ hybridization, ELISA, immunoprecipitation, enzyme function, as well as phenotypic assays known to those of skill in the art. The term “encode” as used herein refers to the product specified (e.g., protein and RNA) by a given sequence of nucleotides in a nucleic acid (i.e., DNA and / or RNA), upon transcription or translation of the DNA or RNA, respectively. In certain embodiments, the term “encode” refers to the RNA sequence specified by transcription of a DNA sequence. In certain - 25 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) embodiments, the term “encode” refers to the amino acid sequence (e.g., polypeptide or protein) specified by translation of mRNA. In certain embodiments, the term “encode” refers to the amino acid sequence specified by transcription of DNA to mRNA and subsequent translation of the mRNA encoded by the DNA sequence. In certain embodiments, the encoded product may comprise a direct transcription or translation product. In certain embodiments, the encoded product may comprise post-translational modifications understood or reasonably expected by one skilled in the art. The term “fully encapsulated” indicates that the active agent or therapeutic agent in the lipid particle is not significantly degraded after exposure to serum or a nuclease or protease assay that would significantly degrade free DNA, RNA, or protein. In a fully encapsulated system, preferably less than about 25% of the active agent or therapeutic agent in the particle is degraded in a treatment that would normally degrade 100% of free active agent or therapeutic agent, more preferably less than about 10%, and most preferably less than about 5% of the active agent or therapeutic agent in the particle is degraded. In the context of nucleic acid therapeutic agents, full encapsulation may be determined by an OLIGREEN® assay. OLIGREEN® is an ultra-sensitive fluorescent nucleic acid stain for quantitating oligonucleotides and single-stranded DNA or RNA in solution (available from Invitrogen Corporation; Carlsbad, Calif.). “Fully encapsulated” also indicates that the lipid particles are serum stable, that is, that they do not rapidly decompose into their component parts upon in vivo administration. The term “helper lipid” as used herein refers to a lipid capable of increasing the effectiveness of delivery of lipid-based particles such as cationic lipid-based particles to a target, preferably into a cell. The helper lipid can be neutral, positively charged, or negatively charged. In certain embodiments, the helper lipid is neutral or negatively charged. Non-limiting examples of helper lipids include 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-di-(9Z- octadecenoyl)-sn-glycero-3-phosphoethanolamine (DOPE), 1-palmitoyl-2-oleoyl-sn-glycero- 3phosphocholin (POPC) and 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC). The term “immune cell,” as used herein refers to any cell involved in the mounting of an immune response. Such cells include, but are not limited to, T cells, B cells, NK cells, antigen- presenting cells (e.g., dendritic cells and macrophages), monocytes, neutrophils, eosinophils, basophils, and the like. The term “independently selected from” as used herein refers to referenced groups being - 26 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) the same, different, or a mixture thereof, unless the context clearly indicates otherwise. Thus, under this definition, the phrase “X1, X2, and X3are independently selected from noble gases” would include the scenario where, for example, X1, X2, and X3are all the same, where X1, X2, and X3are all different, where X1and X2are the same but X3is different, and other analogous permutations. The term “ionizable lipid” as used herein refers to a lipid (e.g., a cationic lipid) having at least one protonatable or deprotonatable group, such that the lipid is positively charged at a pH at or below physiological pH (e.g., pH 7.4), and neutral at a second pH, preferably at or above physiological pH. It will be understood by one of ordinary skill in the art that the addition or removal of protons as a function of pH is an equilibrium process, and that the reference to a charged or neutral lipid refers to the nature of the predominant species and does not require that all of the lipid be present in the charged or neutral form. Generally, ionizable lipids have a pKa of the protonatable group in the range of about 4 to about 7. The term “local delivery,” as used herein, refers to delivery of an active agent or therapeutic agent such as a messenger RNA directly to a target site within an organism. For example, an agent can be locally delivered by direct injection into a disease site such as a tumor or other target site such as a site of inflammation or a target organ such as the liver, heart, pancreas, kidney, and the like. The term “lipid” refers to a group of organic compounds that include, but are not limited to, esters of fatty acids and are characterized by being insoluble in water, but soluble in many organic solvents. They are usually divided into at least three classes: (1) “simple lipids,” which include fats and oils as well as waxes; (2) “compound lipids,” which include phospholipids and glycolipids; and (3) “derived lipids” such as steroids. The terms “conjugated lipid” and “polymer conjugated lipid” are used interchangeably herein to refer to a lipid which is conjugated to one or more polymeric groups, which inhibits aggregation of lipid particles. Such lipid conjugates include, but are not limited to, polyamide oligomers (e.g., ATTA-lipid conjugates), PEG-lipid conjugates, such as PEG coupled to dialkyloxypropyls, PEG coupled to diacylglycerols, PEG coupled to cholesterol, PEG coupled to phosphatidylethanolamines, PEG conjugated to ceramides (e.g., U.S. Pat. No.5,885,613, the disclosure of which is herein incorporated by reference in its entirety for all purposes), cationic PEG lipids, and mixtures thereof. PEG can be conjugated directly to the lipid or may be linked to - 27 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) the lipid via a linker moiety. Any linker moiety suitable for coupling the PEG to a lipid can be used including, e.g., non-ester containing linker moieties and ester-containing linker moieties. In preferred embodiments, non-ester containing linker moieties are used. An example of a polymer conjugated lipid is a pegylated lipid. The term “pegylated lipid” refers to a molecule comprising both a lipid portion and a polyethylene glycol portion. Pegylated lipids are known in the art and include 1-(monomethoxy-polyethyleneglycol)-2,3-dimyristoylglycerol (PEG-s- DMG), DSPE- PEG-DBCO, DOPE-PEG-Azide, DSPE-PEG-Azide, DPPE-PEG-Azide, DSPE-PEG-Carboxy- NHS, DOPE-PEG-Carboxylic Acid, DSPE-PEG-Carboxylic acid and the like. As used herein, “lipid encapsulated” can refer to a lipid particle that provides an active agent or therapeutic agent, such as a nucleic acid (e.g., a protein cargo), with full encapsulation, partial encapsulation, or both. In a preferred embodiment, the nucleic acid is fully encapsulated in the lipid particle (e.g., to form an SPLP, pSPLP, SNALP, or other nucleic acid-lipid particle). The term “lipid nanoparticle” refers to a particle having at least one dimension on the order of nanometers (e.g., 1-1,000 nm) which includes one or more lipids and / or additional agents. The term “lipid particle” is used herein to refer to a lipid formulation that can be used to deliver an active agent or therapeutic agent, such as a nucleic acid (e.g., mRNA), to a target site of interest. In the lipid particle of the disclosure, which is typically formed from a cationic lipid, a non-cationic lipid, and a conjugated lipid that prevents aggregation of the particle, the active agent or therapeutic agent may be encapsulated in the lipid, thereby protecting the agent from enzymatic degradation. The term “neutral lipid” refers to any of a number of lipid species that exist either in an uncharged or neutral zwitterionic form at a selected pH. At physiological pH, such lipids include, for example, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, cephalin, cholesterol, cerebrosides, and diacylglycerols. The term “non-cationic lipid” refers to any amphipathic lipid as well as any other neutral lipid or anionic lipid. The term “nucleic acid” as used herein refers to a polymer containing at least two deoxyribonucleotides or ribonucleotides in either single- or double-stranded form and includes DNA and RNA. DNA may be in the form of, e.g., antisense molecules, plasmid DNA, pre- condensed DNA, a PCR product, vectors (Pl, PAC, BAC, YAC, artificial chromosomes), - 28 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) expression cassettes, chimeric sequences, chromosomal DNA, or derivatives and combinations of these groups. RNA may be in the form of siRNA, asymmetrical interfering RNA (aiRNA), microRNA (miRNA), mRNA, tRNA, rRNA, tRNA, viral RNA (vRNA), and combinations thereof. Nucleic acids include nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, and which have similar binding properties as the reference nucleic acid. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2’-O-methyl ribonucleotides, and peptide-nucleic acids (PNAs). Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res., 19:5081 (1991); Ohtsuka et al., J. Biol. Chem., 260:2605-2608 (1985); Rossolini et al., Mal. Cell. Probes, 8:91-98 (1994)). As used herein, the term “nucleic acid” includes any oligonucleotide or polynucleotide, with fragments containing up to 60 nucleotides generally termed oligonucleotides, and longer fragments termed polynucleotides. In particular embodiments, oligonucleotides of the disclosure are from about 15 to about 60 nucleotides in length. Nucleic acid may be administered alone in the lipid particles of the disclosure, or in combination (e.g., co-administered) with lipid particles of the disclosure comprising peptides, polypeptides, or small molecules such as conventional drugs. In other embodiments, the nucleic acid may be administered in a viral vector. “Nucleotides” contain a sugar deoxyribose (DNA) or ribose (RNA), a base, and a phosphate group. Nucleotides are linked together through the phosphate groups. “Bases” include purines and pyrimidines, which further include natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural analogs, and synthetic derivatives of purines and pyrimidines, which include, but are not limited to, modifications which place new reactive groups such as, but not limited to, amines, alcohols, thiols, carboxylates, and alkyl halides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly - 29 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res., 19:5081 (1991); Ohtsuka et al., J. Biol. Chem., 260:2605-2608 (1985); Rossolini et al., Mol. Cell. Probes, 8:91-98 (1994)). The terms “patient,” “subject,” or “individual” are used interchangeably herein, and refer to any animal, or cells thereof whether in vitro or in situ, amenable to the methods described herein. In a non-limiting embodiment, the patient, subject or individual is a human. As used herein, the term “pharmaceutically acceptable” refers to a material, such as a carrier or diluent, which does not abrogate the biological activity or properties of the compound, and is relatively non-toxic, i.e., the material may be administered to an individual without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained. As used herein, the language “pharmaceutically acceptable salt” refers to a salt of the administered compounds prepared from pharmaceutically acceptable non-toxic acids or bases, including inorganic acids or bases, organic acids or bases, solvates, hydrates, or clathrates thereof. Suitable pharmaceutically acceptable acid addition salts may be prepared from an inorganic acid or from an organic acid. Examples of inorganic acids include hydrochloric, hydrobromic, hydriodic, nitric, carbonic, sulfuric (including sulfate and hydrogen sulfate), and phosphoric acids (including hydrogen phosphate and dihydrogen phosphate). Appropriate organic acids may be selected from aliphatic, cycloaliphatic, aromatic, araliphatic, heterocyclic, carboxylic and sulfonic classes of organic acids, examples of which include formic, acetic, propionic, succinic, glycolic, gluconic, lactic, malic, tartaric, citric, ascorbic, glucuronic, maleic, malonic, saccharin, fumaric, pyruvic, aspartic, glutamic, benzoic, anthranilic, 4-hydroxybenzoic, phenylacetic, mandelic, embonic (pamoic), methanesulfonic, ethanesulfonic, benzenesulfonic, pantothenic, trifluoromethanesulfonic, 2-hydroxyethanesulfonic, p-toluenesulfonic, sulfanilic, cyclohexylaminosulfonic, stearic, alginic, β-hydroxybutyric, salicylic, galactaric and galacturonic acid. Suitable pharmaceutically acceptable base addition salts of compounds described herein - 30 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) include, for example, ammonium salts, metallic salts including alkali metal, alkaline earth metal and transition metal salts such as, for example, calcium, magnesium, potassium, sodium and zinc salts. Pharmaceutically acceptable base addition salts also include organic salts made from basic amines such as, for example, N,N’-dibenzylethylene-diamine, chloroprocaine, choline, diethanolamine, ethylenediamine, meglumine (N-methylglucamine) and procaine. All of these salts may be prepared from the corresponding compound by reacting, for example, the appropriate acid or base with the compound. As used herein, the term “pharmaceutically acceptable carrier” or “pharmaceutically acceptable excipient” means a pharmaceutically acceptable material, composition or carrier, such as a liquid or solid filler, stabilizer, dispersing agent, suspending agent, diluent, excipient, thickening agent, solvent or encapsulating material, involved in carrying or transporting a compound described herein within or to the patient such that it may perform its intended function. Typically, such compounds are carried or transported from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation, including the compound(s) described herein, and not injurious to the patient. Some examples of materials that may serve as pharmaceutically acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; surface active agents; alginic acid; pyrogen-free water; isotonic saline; Ringer’s solution; ethyl alcohol; phosphate buffer solutions; and other non-toxic compatible substances employed in pharmaceutical formulations. As used herein, “pharmaceutically acceptable carrier” also includes any and all coatings, antibacterial and antifungal agents, and absorption delaying agents, and the like that are compatible with the activity of the compound(s) described herein, and are physiologically acceptable to the patient. Supplementary active compounds may also be incorporated into the compositions. The “pharmaceutically acceptable carrier” may further include a pharmaceutically acceptable salt of the compound(s) described - 31 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) herein. Other additional ingredients that may be included in the pharmaceutical compositions used with the methods or compounds described herein are known in the art and described, for example in Remington’s Pharmaceutical Sciences (Genaro, Ed., Mack Publishing Co., 1985, Easton, PA), which is incorporated herein by reference. The terms “peptide,” “polypeptide,” and “protein” are used interchangeably herein, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein’s or peptide’s sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. “Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof. By the term “specifically binds,” as used herein with respect to an antibody, is meant an antibody which recognizes a specific antigen, but does not substantially recognize or bind other molecules in a sample. For example, an antibody that specifically binds to an antigen from one species may also bind to that antigen from one or more other species. But, such cross-species reactivity does not itself alter the classification of an antibody as specific. In another example, an antibody that specifically binds to an antigen may also bind to different allelic forms of the antigen. However, such cross reactivity does not itself alter the classification of an antibody as specific. In some instances, the terms “specific binding” or “specifically binding,” can be used in reference to the interaction of an antibody, a protein, or a peptide with a second chemical species, to mean that the interaction is dependent upon the presence of a particular structure (e.g., an antigenic determinant or epitope) on the chemical species; for example, an antibody recognizes and binds to a specific protein structure rather than to proteins generally. If an antibody is specific for epitope “A”, the presence of a molecule containing epitope A (or free, unlabeled A), in a reaction containing labeled “A” and the antibody, will reduce the amount of labeled A bound to the antibody. - 32 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) The term “substantially” as used herein refers to a majority of, or mostly, as in at least about 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%, or at least about 99.999% or more, or 100%. The term “substantially free of” as used herein can mean having none or having a trivial amount of, such that the amount of material present does not affect the material properties of the composition including the material, such that the composition is about 0 wt% to about 5 wt% of the material, or about 0 wt% to about 1 wt%, or about 5 wt% or less, or less than, equal to, or greater than about 4.5 wt%, 4, 3.5, 3, 2.5, 2, 1.5, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1, 0.01, or about 0.001 wt% or less. The term “substantially free of” can mean having a trivial amount of, such that a composition is about 0 wt% to about 5 wt% of the material, or about 0 wt% to about 1 wt%, or about 5 wt% or less, or less than, equal to, or greater than about 4.5 wt%, 4, 3.5, 3, 2.5, 2, 1.5, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1, 0.01, or about 0.001 wt% or less, or about 0 wt%. A “therapeutic” treatment is a treatment administered to a subject who exhibits signs of pathology, for the purpose of diminishing or eliminating those signs. The terms “treat,” “treating” and “treatment,” as used herein, means reducing the frequency or severity with which symptoms of a disease or condition are experienced by a subject by virtue of administering an agent or compound to the subject. Lipids Ionizable Lipids and / or Cationic Lipids Non-limiting, exemplary cationic lipids or ionizable lipids include: (6Z,9Z,28Z,31Z)- heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (DLinMC3DMA), [(4- hydroxybutyl)azanediyl]di(hexane-6,1-diyl) bis(2-hexyldecanoate) (ALC-0315), heptadecan-9-yl 8-{(2-hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino}octanoate (SM-102), 1,1′-[[2-[4-[2-[[2- [bis(2-hydroxydodecyl)amino]ethyl](2-hydroxydodecyl)amino]ethyl]-1- piperazinyl]ethyl]imino]bis-2-dodecanol (C12-200), 1,2-dilinoleyloxy-N,N- dimethylaminopropane (DLinDMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-K-C2-DMA; “XTC2”), 2,2-dilinoleyl-4-(3- 45 dimethylaminopropyl)- 1,3]-dioxolane (D Lin-K-C3-D MA), 2,2-dilinoleyl-4-(4-dimethylaminobutyl)-[1,3]-dioxolane (DLin-K-C4-DMA), 2,2-dilinoleyl-5- dimethylaminomethyl-[1,3]-dioxane (DLin-K6-DMA), 2,2-dilinoleyl-4-Nmethylpepiazino-[1,3]- - 33 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) dioxolane (DLin-K-MPZ), 2,2-dili-noleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K- DMA), 1,2-dilinoleylcarbamoyloxy-3-dimethylaminopropane (D Lin-C-DAP), 1,2-dilinoleyoxy- 3-(dimethylaminoacetoxypropane (DLin-DAC), 1-2dilinoleyoxy-3-morpholinopropane (DLin- MA), 1,2-dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1,2-dilinoleylthio-3- dimethylaminopropane (DLin-2-DMAP), 1,2-dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl), 1,2- dilinoleyloxy-3-(N-methylpiperazino)propane (D Lin-MPZ), 3-(N,N-dilinoleylamino)-1,2- propanediol (D LinAP), 3-(N,N-dioleylamino)-1,2-propanedio (DOAP), 1,2-dilinoleyloxo-3-(2- N,N-dimethylamino)ethoxypropane (D Lin-EG-D MA), N,N-dioleyl-N,N-dimethylanrmonium chloride (DODAC), 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA), 1,2-distearyloxy- N,N-dimethylaminopropane (DSD MA), N-(1-(2,3-dioleyloxy)propyl)-N,N,N- trimethylammonium chloride (DOTMA), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(1-(2,3-dioleoyloxy)propyl)-N,N, N-trimethylammonium chloride (DOTAP), 3-(N- (N’,N’dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol), N-(l,2-dimyristyloxyprop-3-yl)- N,N-dimethyl-N-hydroxyethyl anrmonium bromide (DMRIE), 2,3-dioleyloxy-N-[2 (spermine- carboxamidoethyl]-N,N-dimethy 1-1-propanaminiumtrifluoroacetate (DOSPA), dioctadecylamidoglycyl spermine (DOGS), 3-dimethylamino-2-(cholest-5-en-3-beta-oxybutan- 4-oxy)-1-(cis,cis-9,12-octadecadienoxy)propane (CLinDMA), 2-[5’-(cholest-5-en-3-beta-oxy)- 3’-oxapentoxy)-3-dimethyl-1-(cis,cis-9’,1-2’-octadecadienoxy) propane (CpLinDMA), N,N- dimethyl-3,4-dioleyloxybenzylamine (DMOBA), 1,2-N,N’dioleylcarbamyl-3- dimethylaminopropane (DOcarbDAP), 1,2-N,N’-dilinoleylcarbamyl-3-dimethylaminopropane (DLincarbDAP), or mixtures thereof. In certain embodiments, the cationic lipid is DLinDMA, DLin-K-C2-DMA (“XTC2”), or mixtures thereof. The ionizable lipids are not limited to those recited herein, and can further include ionizable lipids known to those skilled in the art, or described in PCT Application No. PCT / US2020 / 056255 and / or PCT Application No. PCT / US2020 / 056252, the disclosures of which are herein incorporated by reference in its entirety. The synthesis of cationic lipids such as DLin-K-C2-DMA (“XTC2”), DLin-K-C3-DMA, DLin-K-C4-DMA, DLin-K6-DMA, and DLin-K-MPZ, as well as additional cationic lipids, is described in U.S. Application Publication No. US 2011 / 0256175, the disclosure of which is herein incorporated by reference in its entirety for all purposes. The synthesis of cationic lipids - 34 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) such as DLin-K-DMA, DLin-CDAP, DLin-DAC, DLin-MA, DLinDAP, DLin-S-DMA, DLin-2- DMAP, DLin-TMA.Cl, DLin-TAP.Cl, DLin-MPZ, DLinAP, DOAP, and DLin-EG-DMA, as well as additional cationic lipids, is described in PCT Application No. PCT / US08 / 88676, filed December 31, 2008, the disclosure of which is herein incorporated by reference in its entirety for all purposes. The synthesis of cationic lipids such as CLinDMA, as well as additional cationic lipids, is described in U.S. Patent Publication No.20060240554, the disclosure of which is herein incorporated by reference in its entirety for all purposes. Non-cationic Lipid In the nucleic acid-lipid particles of the present disclosure, the non-cationic lipid may comprise, e.g., one or more anionic lipids and / or neutral lipids. In some embodiments, the non- cationic lipid comprises one of the following neutral lipid components: (1) cholesterol or a derivative thereof (2) a phospholipid; or (3) a mixture of a phospholipid and cholesterol or a derivative thereof. Examples of cholesterol derivatives include, but are not limited to, cholestanol, cholestanone, cholestenone, coprostanol, cholesteryl-2’-hydroxyethyl ether, cholesteryl-4’- hydroxybutyl ether, and mixtures thereof. The synthesis of cholesteryl-2’-hydroxyethyl ether is known to one skilled in the art and described in U.S. Patent Nos.8,058,069, 8,492,359, 8,822,668, 9,364,435, 9,504,651, and 11,141,378, all of which are hereby incorporated herein in their entireties for all purposes. Non-limiting examples of non-cationic lipids include phospholipids such as lecithin, phosphatidylethanolamine, lysolecithin, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, egg sphingomyelin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebrosides, dicetylphosphate, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), ioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), palmitoyloleyolphosphatidylglycerol (POPG), dioleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-l-carboxylate DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphatidylethanolamine (DMPE), distearoylphosphatidylethanolamine (DSPE), - 35 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) monomethylphosphatidylethanolamine, dimethylphosphatidylethanolamine, dielaidoylphosphatidylethanolamine (DEPE), stearoyloleoylphosphatidylethanolamine (SOPE), lysophosphatidylcholine, dilinoleoylphosphatidylcholine, and mixtures thereof. Other diacylphosphatidylcholine and diacylphosphatidylethanolamine phospholipids can also be used. The acyl groups in these lipids can be, for example, acyl groups derived from fatty acids having C10-C24carbon chains, e.g., lauroyl, myristoyl, palmitoyl, stearoyl, or oleoyl. Additional examples of non-cationic lipids include sterols such as cholesterol and derivatives thereof such as cholestanol, cholestanone, cholestenone, coprostanol, cholesteryl-2’- hydroxyethyl ether, cholesteryl-4’-hydroxybutyl ether, and mixtures thereof. In certain embodiments, the phospholipid is DPPC, DSPC, or mixtures thereof. Conjugated Lipid (Polymer Conjugated Lipid) In the lipid nanoparticles of the present disclosure, the conjugated lipid that inhibits aggregation of particles may comprise, e.g., one or more of the following: a polyethyleneglycol (PEG) lipid conjugate, a polyamide (ATTA)-lipid conjugate, a cationic-polymer-lipid conjugates (CPLs), or mixtures thereof. In some embodiments, the nucleic acid-lipid particles comprise either a PEG-lipid conjugate or an ATTA-lipid conjugate. PEG is a linear, water-soluble polymer of ethylene PEG repeating units with two terminal hydroxyl groups. PEGs are classified by their molecular weights; for example, PEG 2000 has an average molecular weight of about 2,000 daltons, and PEG 5000 has an average molecular weight of about 5,000 daltons. PEGs are commercially available from Sigma Chemical Co. and other companies and include, for example, the following: monomethoxypolyethylene glycol (MePEGOH), monomethoxypolyethylene glycolsuccinate (MePEGS), monomethoxypolyethylene glycolsuccinimidyl succinate (MePEG-S-NHS), monomethoxypolyethylene glycolamine (MePEG-NH2), monomethoxypolyethylene glycoltresylate (MePEG-TRES), and monomethoxypolyethylene glycolimidazolylcarbonyl (MePEG-IM). Other PEGs such as those described in U.S. Patent Nos.6,774,180 and 7,053,150 (e.g., mPEG (20 KDa) amine) are also useful for preparing the PEG-lipid conjugates of the present disclosure. The disclosures of these patents are herein incorporated by reference in their entirety for all purposes. In addition, monomethoxypolyethyleneglycolacetic acid (MePEG- CH2COOH) is particularly useful for preparing PEG-lipid conjugates including, e.g., PEG-DAA - 36 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) conjugates. In certain embodiments, the PEG-lipid conjugate or ATTA-lipid conjugate is used together with a CPL. The conjugated lipid that inhibits aggregation of particles may comprise a PEG-lipid including, e.g., a PEG-diacylglycerol (DAG), a PEG dialkyloxypropyl (DAA), a PEG- phospholipid, a PEG-ceramide (Cer), or mixtures thereof. The PEGDAA conjugate may be PEG- dilauryloxypropyl (C12), a PEG-dimyristyloxypropyl (C14), a PEG-dipalmityloxypropyl (C16), a PEG-distearyloxypropyl (C18), or mixtures thereof. Additional PEG-lipid conjugates suitable for use in the disclosure include, but are not limited to, mPEG2000-l,2-diO-alkyl-sn3-carbomoylglyceride (PEG-C-DOMG). The synthesis of PEG-C-DOMG is described in PCT Application No. PCT / US08 / 88676, filed December 31, 2008, the disclosure of which is herein incorporated by reference in its entirety for all purposes. Yet additional PEG-lipid conjugates suitable for use in the disclosure include, without limitation, l-[8’-(l,2-dimyristoyl-3-propanoxy)-carboxamido-3’,6’-dioxaoctanyl] carbamoyl-methyl- poly(ethylene glycol) (2 KPEG-DMG). The synthesis of 2 KPEG-DMG is described in U.S. Patent No.7,404,969, the disclosure of which is herein incorporated by reference in its entirety for all purposes. The PEG moiety of the PEG-lipid conjugates described herein may comprise an average molecular weight ranging from about 550 daltons to about 10,000 daltons. In certain instances, the PEG moiety has an average molecular weight of from about 750 daltons to about 5,000 daltons (e.g., from about 1,000 daltons to about 5,000 daltons, from about 1,500 daltons to about 3,000 daltons, from about 750 daltons to about 3,000 daltons, from about 750 daltons to about 2,000 daltons, etc.). In some embodiments, the PEG moiety has an average molecular weight of about 2,000 daltons or about 750 daltons. In addition to the foregoing, it will be readily apparent to those of skill in the art that other hydrophilic polymers can be used in place of PEG. Examples of suitable polymers that can be used in place of PEG include, but are not limited to, polyvinylpyrrolidone, polymethyloxazoline, polyethyloxazoline, polyhydroxypropyl methacrylamide, polymethacrylamide and polydimethylacrylamide, polylactic acid, polyglycolic acid, and derivatized celluloses such as hydroxymethylcellulose or hydroxyethylcellulose. In addition to the foregoing components, the particles (e.g., LNP) of the present disclosure can further comprise cationic poly(ethylene glycol) (PEG) lipids or CPLs (e.g., Chen - 37 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) et al., Bioconj. Chem., 11:433-437 (2000)). Suitable SPLPs and SPLP-CPLs for use in the present disclosure, and methods of making and using SPLPs and SPLP-CPLs, are disclosed, e.g., in U.S. Patent No.6,852,334 and PCT Publication No. WO 00 / 62813, the disclosures of which are herein incorporated by reference in their entirety for all purposes. In certain instances, the conjugated lipid that inhibits aggregation of particles (e.g., PEG- lipid conjugate) may comprise from about 0.1 mol% to about 2 mol%, from about 0.5 mol% to about 2 mol%, from about 1 mol% to about 2 mol%, from about 0.6 mol% to about 1.9 mol%, from about 0.7 mol% to about 1.8 mol%, from about 0.8 mol% to about 1.7 mol%, from about 1 mol% to about 1.8 mol%, from about 1.2 mol% to about 1.8 mol%, from about 1.2 mol% to about 1.7 mol%, from about 1.3 mol% to about 1.6 mol%, from about 1.4 mol% to about 1.5 mol%, or about 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2 mol% (or any fraction thereof or range therein) of the total lipid present in the particle. In the lipid nanoparticles of the present disclosure, the active agent or therapeutic agent may be fully encapsulated within the lipid portion of the particle, thereby protecting the active agent or therapeutic agent from enzymatic degradation. In some embodiments, a nucleic acid- lipid particle comprising a nucleic acid such as a messenger RNA (i.e., mRNA) is fully encapsulated within the lipid portion of the particle, thereby protecting the nucleic acid from nuclease degradation. In certain instances, the nucleic acid in the nucleic acid-lipid particle is not substantially degraded after exposure of the particle to a nuclease at 37° C. for at least about 20, 30, 45, or 60 minutes. In certain other instances, the nucleic acid in the nucleic acid-lipid particle is not substantially degraded after incubation of the particle in serum at 37° C. for at least about 30, 45, or 60 minutes or at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, or 36 hours. In other embodiments, the active agent or therapeutic agent (e.g., nucleic acid such as siRNA) is complexed with the lipid portion of the particle. One of the benefits of the formulations of the present disclosure is that the lipid particle compositions are substantially non-toxic to mammals such as humans. Lipid Nanoparticle (LNP) Compositions In one aspect, the present disclosure provides a lipid nanoparticle (LNP) composition comprising an agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) and at least one mRNA. In certain embodiments, the agent that reduces or inhibits secretion of small - 38 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) extracellular vesicles (sEVs) and the therapeutic mRNA are at least partially encapsulated in the lipid nanoparticle. In certain embodiments, the lipid nanoparticle (LNP) composition comprises at least one ionizable lipid. In certain embodiments, the lipid nanoparticle (LNP) composition comprises at least one helper lipid. In certain embodiments, the lipid nanoparticle (LNP) composition comprises cholesterol and / or a modified derivative thereof. In certain embodiments, the lipid nanoparticle (LNP) composition comprises at least one polymer conjugated lipid. In certain embodiments, the lipid nanoparticle (LNP) composition comprises an agent that reduces or inhibits secretion of small extracellular vesicles (sEVs). In certain embodiments, the lipid nanoparticle (LNP) composition comprises at least one therapeutic mRNA. In certain embodiments, the agent and the at least one therapeutic mRNA are at least partially encapsulated in the LNP. In certain embodiments, the at least one ionizable lipid comprises less than about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or about 80 mol% of the LNP. In certain embodiments, the at least one ionizable lipid comprises about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or about 80 mol% of the LNP. In certain embodiments, the at least one ionizable lipid comprises greater than about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or about 80 mol% of the LNP. In certain embodiments, the at least one ionizable lipid comprises about 50 mol% of the LNP. In certain embodiments, the at least one ionizable lipid is D-Lin-MC3-DMA. In certain embodiments, the at least one helper lipid comprises less than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or about 20 mol% of the LNP. In certain embodiments, the at least one helper lipid comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or about 20 mol% of the LNP. In certain embodiments, the at least one helper lipid comprises greater than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or about 20 mol% of the LNP. In certain embodiments, the at least one helper lipid comprises - 39 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) about 10 mol% of the LNP. In certain embodiments, the at least one helper lipid is diastearoylphosphatidylcholine (DSPC). In certain embodiments, the cholesterol and / or a modified derivative thereof comprises less than about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or about 70 mol% of the LNP. In certain embodiments, the cholesterol and / or a modified derivative thereof comprises about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or about 70 mol% of the LNP. In certain embodiments, the cholesterol and / or a modified derivative thereof comprises greater than about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or about 70 mol% of the LNP. In certain embodiments, the cholesterol and / or a modified derivative thereof comprises about 38.5 mol% of the LNP. In certain embodiments, the cholesterol and / or a modified derivative thereof is cholesterol. In certain embodiments, the polymer conjugated lipid comprises less than about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or about 10 mol% of the LNP. In certain embodiments, the polymer conjugated lipid comprises about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or about 10 mol% of the LNP. In certain embodiments, the polymer conjugated lipid comprises greater than about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, - 40 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or about 10 mol% of the LNP. In certain embodiments, the polymer conjugated lipid comprises about 1.5 mol% of the LNP. In certain embodiments, the polymer conjugated lipid is 1,2-dimyristoyl-rac-glycero-3- methoxypolyethylene glycol-2000 (DMG-PEG 2000). In certain embodiments, the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) is a small interfering RNA (siRNA). In certain embodiments, the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) is a small molecule. In certain embodiments, the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) is a proteolysis targeting chimera (PROTAC). In certain embodiments, the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) is a gene editing complex. In certain embodiments, the agent that reduces secretion of small extracellular vesicles (sEVs) comprises mRNA encoding a gene editing complex and a small guiding RNA (sgRNA). In certain embodiments, the gene editing complex is CRISPR-associated protein 9 (Cas9). In certain embodiments, the sgRNA is a Cas9 guiding RNA. In certain embodiments, the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) at least partially inhibits or interferes with the expression, activity, or synthesis of at least one selected from the group consisting of Rab27a, Rab27b, Rab31, Rab8a, Rab8b, Alix, HRS, Rabin8, MADD, Sec3, Sec5, Sec6, Sec8, Sec10, Sec15, Exo70, Exo84, RalA, RalB, TSG101, and ceramide. In certain embodiments, the agent is a small interfering RNA (siRNA). In certain embodiments, the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) is a Rab27a-targeted small interfering RNA (siRab27a). In certain embodiments, the therapeutic mRNA encodes PTEN, or a modified derivative thereof. In certain embodiments, the therapeutic mRNA encodes STING, or a modified derivative thereof. In certain embodiments, the at least one therapeutic mRNA and the siRab27a have a mass ratio of about 25:0.01 to about 0.01:25 (mRNA:siRNA w / w). In certain embodiments, the at least one therapeutic mRNA and the siRab27a have a mass ratio of about 1:1. In certain embodiments, the LNP has a mass ratio of (a)+(b)+(c)+(d):(e)+(f) of about 10:1. - 41 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) In certain embodiments, the therapeutic mRNA encodes a chimeric antigen receptor (CAR). In certain embodiments, the CAR is specific for binding to a surface antigen of a tumor cell. In certain embodiments, the CAR is specific for binding to a surface antigen of a pathogenic cell. In certain embodiments, the surface antigen is selected from the group consisting of CD1, CD2, CD3, CD5, CD7, CD8, CD16, CD19, CD20, CD22, CD25, CD26, CD27, CD28, CD30, CD33, CD38, CD39, CD40L, CD44, CD45, CD62L, CD69, CD73, CD80, CD83, CD86, CD95, CD103, CD119, CD123, CD126, CD150, CD153, CD154, CD161, CD183, CD223, CD254, CD275, CD45RA, CXCR3, CXCR5, FasL, IL18R1, CTLA-4, OX40, GITR, LAG3, ICOS, PD- 1, leu-12, TCR, TLR1, TLR2, TLR3, TLR4, TLR6, NKG2D, CCR, CCR1, CCR2, CCR4, CCR6, CCR7, k light chain, ROR1, ErbB2, ErbB3, ErbB4, EGFR vIII, carcinoembryonic antigen, EGP2, EGP40, mesothelin, TAG72, PSMA, NKG2D ligands, B7-H6, IL13R-α2, MUC1, VEGF-A, Tem8, FAP, EphA2, HER2, MUC16, CA9, GD2, GD3, HMW-MAA, CD171, Lewis Y, G250 / CALX, HLA-AI MAGE A1, HAL-A2 NY-ESO-1, PSC1, folate receptor-α, 8H9, NCAM, VEGF, 5T4, Fetal AchR, NKG2D ligands, TEM1, and TEM8. Pharmaceutical Compositions In another aspect, the present disclosure provides a pharmaceutical composition comprising the lipid nanoparticle (LNP) of the present disclosure and at least one pharmaceutically acceptable carrier. In certain embodiments, the composition further comprises at least one adjuvant. In certain embodiments, the composition is a vaccine. Such a pharmaceutical composition may consist of at least one composition of the invention, in a form suitable for administration to a subject, or the pharmaceutical composition may comprise at least one composition, and one or more pharmaceutically acceptable carriers, one or more additional ingredients, or any combinations of these. At least one composition of the invention may be present in the pharmaceutical composition in the form of a physiologically acceptable salt, such as in combination with a physiologically acceptable cation or anion, as is well known in the art. In certain embodiments, the pharmaceutical compositions useful for practicing the method of the invention may be administered to deliver a dose of between 1 ng / kg / day and 100 mg / kg / day. In other embodiments, the pharmaceutical compositions useful for practicing the - 42 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) invention may be administered to deliver a dose of between 1 ng / kg / day and 1,000 mg / kg / day. The relative amounts of the active ingredient, the pharmaceutically acceptable carrier, and any additional ingredients in a pharmaceutical composition of the invention will vary, depending upon the identity, size, and condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, the composition may comprise between 0.1% and 100% (w / w) active ingredient. Pharmaceutical compositions that are useful in the methods of the invention may be suitably developed for nasal, inhalational, oral, rectal, vaginal, pleural, peritoneal, parenteral, topical, transdermal, pulmonary, intranasal, buccal, ophthalmic, epidural, intrathecal, intravenous, or another route of administration. A composition useful within the methods of the invention may be directly administered to the brain, the brainstem, or any other part of the central nervous system of a mammal or bird. Other contemplated formulations include projected nanoparticles, microspheres, liposomal preparations, coated particles, polymer conjugates, resealed erythrocytes containing the active ingredient, and immunologically-based formulations. In certain embodiments, the compositions of the invention are part of a pharmaceutical matrix, which allows for manipulation of insoluble materials and improvement of the bioavailability thereof, development of controlled or sustained release products, and generation of homogeneous compositions. By way of example, a pharmaceutical matrix may be prepared using hot melt extrusion, solid solutions, solid dispersions, size reduction technologies, molecular complexes (e.g., cyclodextrins, and others), microparticulate, and particle and formulation coating processes. Amorphous or crystalline phases may be used in such processes. The route(s) of administration will be readily apparent to the skilled artisan and will depend upon any number of factors including the type and severity of the disease being treated, the type and age of the veterinary or human patient being treated, and the like. The formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology and pharmaceutics. In general, such preparatory methods include the step of bringing the active ingredient into association with a carrier or one or more other accessory ingredients, and then, if necessary or desirable, shaping or packaging the product into a desired single-dose or multi-dose unit. As used herein, a "unit dose" is a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient - 43 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) is generally equal to the dosage of the active ingredient that would be administered to a subject or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage. The unit dosage form may be for a single daily dose or one of multiple daily doses (e.g., about 1 to 4 or more times per day). When multiple daily doses are used, the unit dosage form may be the same or different for each dose. Although the descriptions of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions suitable for ethical administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions of the invention is contemplated include, but are not limited to, humans and other primates, mammals including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, and dogs. In certain embodiments, the compositions of the invention are formulated using one or more pharmaceutically acceptable excipients or carriers. In certain embodiments, the pharmaceutical compositions of the invention comprise a therapeutically effective amount of at least one compound of the invention and a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers, which are useful, include, but are not limited to, glycerol, water, saline, ethanol, recombinant human albumin (e.g., RECOMBUMIN®), solubilized gelatins (e.g., GELOFUSINE®), and other pharmaceutically acceptable salt solutions such as phosphates and salts of organic acids. Examples of these and other pharmaceutically acceptable carriers are described in Remington's Pharmaceutical Sciences (1991, Mack Publication Co., New Jersey). The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), recombinant human albumin, solubilized gelatins, suitable mixtures thereof, and vegetable oils. The proper fluidity may be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms may be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, - 44 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) and the like. In many cases, isotonic agents, for example, sugars, sodium chloride, or polyalcohols such as mannitol and sorbitol, are included in the composition. Prolonged absorption of the injectable compositions may be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate or gelatin. Formulations may be employed in admixtures with conventional excipients, i.e., pharmaceutically acceptable organic or inorganic carrier substances suitable for oral, parenteral, nasal, inhalational, intravenous, subcutaneous, transdermal enteral, or any other suitable mode of administration, known to the art. The pharmaceutical preparations may be sterilized and if desired mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure buffers, coloring, flavoring, and / or fragrance- conferring substances and the like. They may also be combined where desired with other active agents, e.g., other analgesic, anxiolytics or hypnotic agents. As used herein, "additional ingredients" include, but are not limited to, one or more ingredients that may be used as a pharmaceutical carrier. The composition of the invention may comprise a preservative from about 0.005% to 2.0% by total weight of the composition. The preservative is used to prevent spoilage in the case of exposure to contaminants in the environment. Examples of preservatives useful in accordance with the invention include but are not limited to those selected from the group consisting of benzyl alcohol, sorbic acid, parabens, imidurea and any combinations thereof. One such preservative is a combination of about 0.5% to 2.0% benzyl alcohol and 0.05-0.5% sorbic acid. The composition may include an antioxidant and a chelating agent that inhibit the degradation of the compound. Antioxidants for some compounds are BHT, BHA, alpha- tocopherol and ascorbic acid in the exemplary range of about 0.01% to 0.3%, or BHT in the range of 0.03% to 0.1% by weight by total weight of the composition. The chelating agent may be present in an amount of from 0.01% to 0.5% by weight by total weight of the composition. Exemplary chelating agents include edetate salts (e.g. disodium edetate) and citric acid in the weight range of about 0.01% to 0.20%, or in the range of 0.02% to 0.10% by weight by total weight of the composition. The chelating agent is useful for chelating metal ions in the composition that may be detrimental to the shelf life of the formulation. While BHT and disodium edetate are exemplary antioxidant and chelating agent, respectively, for some compounds, other suitable and equivalent antioxidants and chelating agents may be substituted - 45 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) therefore as would be known to those skilled in the art. Liquid suspensions may be prepared using conventional methods to achieve suspension of the active ingredient in an aqueous or oily vehicle. Aqueous vehicles include, for example, water, and isotonic saline. Oily vehicles include, for example, almond oil, oily esters, ethyl alcohol, vegetable oils such as arachis, olive, sesame, or coconut oil, fractionated vegetable oils, and mineral oils such as liquid paraffin. Liquid suspensions may further comprise one or more additional ingredients including, but not limited to, suspending agents, dispersing or wetting agents, emulsifying agents, demulcents, preservatives, buffers, salts, flavorings, coloring agents, and sweetening agents. Oily suspensions may further comprise a thickening agent. Known suspending agents include, but are not limited to, sorbitol syrup, hydrogenated edible fats, sodium alginate, polyvinylpyrrolidone, gum tragacanth, gum acacia, and cellulose derivatives such as sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethyl cellulose. Known dispersing or wetting agents include, but are not limited to, naturally-occurring phosphatides such as lecithin, condensation products of an alkylene oxide with a fatty acid, with a long chain aliphatic alcohol, with a partial ester derived from a fatty acid and a hexitol, or with a partial ester derived from a fatty acid and a hexitol anhydride (e.g., polyoxyethylene stearate, heptadecaethyleneoxycetanol, polyoxyethylene sorbitol monooleate, and polyoxyethylene sorbitan monooleate, respectively). Known emulsifying agents include, but are not limited to, lecithin, acacia, and ionic or non-ionic surfactants. Known preservatives include, but are not limited to, methyl, ethyl, or n-propyl para-hydroxybenzoates, ascorbic acid, and sorbic acid. Known sweetening agents include, for example, glycerol, propylene glycol, sorbitol, sucrose, and saccharin. Liquid solutions of the active ingredient in aqueous or oily solvents may be prepared in substantially the same manner as liquid suspensions, the primary difference being that the active ingredient is dissolved, rather than suspended in the solvent. As used herein, an "oily" liquid is one which comprises a carbon-containing liquid molecule and which exhibits a less polar character than water. Liquid solutions of the pharmaceutical composition of the invention may comprise each of the components described with regard to liquid suspensions, it being understood that suspending agents will not necessarily aid dissolution of the active ingredient in the solvent. Aqueous solvents include, for example, water, and isotonic saline. Oily solvents include, for example, almond oil, oily esters, ethyl alcohol, vegetable oils such as arachis, olive, - 46 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) sesame, or coconut oil, fractionated vegetable oils, and mineral oils such as liquid paraffin. A pharmaceutical composition of the invention may also be prepared, packaged, or sold in the form of oil-in-water emulsion or a water-in-oil emulsion. The oily phase may be a vegetable oil such as olive or arachis oil, a mineral oil such as liquid paraffin, or a combination of these. Such compositions may further comprise one or more emulsifying agents such as naturally occurring gums such as gum acacia or gum tragacanth, naturally-occurring phosphatides such as soybean or lecithin phosphatide, esters or partial esters derived from combinations of fatty acids and hexitol anhydrides such as sorbitan monooleate, and condensation products of such partial esters with ethylene oxide such as polyoxyethylene sorbitan monooleate. These emulsions may also contain additional ingredients including, for example, sweetening or flavoring agents. Methods for impregnating or coating a material with a chemical composition are known in the art, and include, but are not limited to methods of depositing or binding a chemical composition onto a surface, methods of incorporating a chemical composition into the structure of a material during the synthesis of the material (i.e., such as with a physiologically degradable material), and methods of absorbing an aqueous or oily solution or suspension into an absorbent material, with or without subsequent drying. Methods for mixing components include physical milling, the use of pellets in solid and suspension formulations and mixing in a transdermal patch, as known to those skilled in the art. Administration / Dosing The regimen of administration may affect what constitutes an effective amount. The therapeutic formulations may be administered to the patient either prior to or after the onset of a disease or disorder. Further, several divided dosages, as well as staggered dosages may be administered daily or sequentially, or the dose may be continuously infused, or may be a bolus injection. Further, the dosages of the therapeutic formulations may be proportionally increased or decreased as indicated by the exigencies of the therapeutic or prophylactic situation. Administration of the compositions of the present disclosure to a patient, such as a mammal, such as a human, may be carried out using known procedures, at dosages and for periods of time effective to treat a disease or disorder contemplated herein. An effective amount of therapeutic (i.e., composition) necessary to achieve a therapeutic effect may vary according to - 47 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) factors such as the activity of the particular therapeutic employed; the time of administration; the rate of excretion of the composition; the duration of the treatment; other drugs, compounds or materials used in combination with the composition; the state of the disease or disorder, age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well-known in the medical arts. Dosage regimens may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. A non-limiting example of an effective dose range for a therapeutic composition of the disclosure is from about 0.01 mg / kg to 100 mg / kg of body weight / per day of active agent (i.e., nucleic acid). One of ordinary skill in the art would be able to study the relevant factors and make the determination regarding the effective amount of the therapeutic composition without undue experimentation. The composition may be administered to an animal as frequently as several times daily, or it may be administered less frequently, such as once a day, once a week, once every two weeks, once a month, or even less frequently, such as once every several months or even once a year or less. It is understood that the amount of composition dosed per day may be administered, in non-limiting examples, every day, every other day, every 2 days, every 3 days, every 4 days, or every 5 days. For example, with every other day administration, a 5 mg per day dose may be initiated on Monday with a first subsequent 5 mg per day dose administered on Wednesday, a second subsequent 5 mg per day dose administered on Friday, and so on. The frequency of the dose is readily apparent to the skilled artisan and depends upon a number of factors, such as, but not limited to, type and severity of the disease being treated, and type and age of the animal. Actual dosage levels of the active ingredients in the pharmaceutical compositions of this disclosure may be varied so as to obtain an amount of the active ingredient that is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient. A medical doctor, e.g., physician or veterinarian, having ordinary skill in the art may readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds of the disclosure employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired - 48 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) effect is achieved. In particular embodiments, it is especially advantageous to formulate the compound in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the patients to be treated; each unit containing a predetermined quantity of therapeutic composition to produce the desired therapeutic effect in association with the required pharmaceutical vehicle. The dosage unit forms of the disclosure are dictated by and directly dependent on (a) the unique characteristics of the therapeutic composition and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding / formulating such a therapeutic composition for the treatment of a disease or disorder in a patient. In certain embodiments, the compositions of the disclosure are administered to the patient in dosages that range from one to five times per day or more. In other embodiments, the compositions of the disclosure are administered to the patient in range of dosages that include, but are not limited to, once every day, every two days, every three days to once a week, and once every two weeks. It will be readily apparent to one skilled in the art that the frequency of administration of the various combination compositions of the disclosure will vary from subject to subject depending on many factors including, but not limited to, age, disease or disorder to be treated, gender, overall health, and other factors. Thus, the disclosure should not be construed to be limited to any particular dosage regime and the precise dosage and composition to be administered to any patient will be determined by the attending physician taking all other factors about the patient into account. The amount of active agent of the composition(s) of the disclosure for administration may be in the range of from about 1 µg to about 7,500 mg, about 20 µg to about 7,000 mg, about 40 µg to about 6,500 mg, about 80 µg to about 6,000 mg, about 100 µ g to about 5,500 mg, about 200 µ g to about 5,000 mg, about 400 µ g to about 4,000 mg, about 800 µ g to about 3,000 mg, about 1 mg to about 2,500 mg, about 2 mg to about 2,000 mg, about 5 mg to about 1,000 mg, about 10 mg to about 750 mg, about 20 mg to about 600 mg, about 30 mg to about 500 mg, about 40 mg to about 400 mg, about 50 mg to about 300 mg, about 60 mg to about 250 mg, about 70 mg to about 200 mg, about 80 mg to about 150 mg, and any and all whole or partial increments there-in-between. In some embodiments, the dose of active agent (i.e., nucleic acid) present in the - 49 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) composition of the disclosure is from about 0.5 µg and about 5,000 mg. In some embodiments, a dose of active agent present in the composition of the disclosure used in compositions described herein is less than about 5,000 mg, or less than about 4,000 mg, or less than about 3,000 mg, or less than about 2,000 mg, or less than about 1,000 mg, or less than about 800 mg, or less than about 600 mg, or less than about 500 mg, or less than about 200 mg, or less than about 50 mg. Similarly, in some embodiments, a dose of a second compound as described herein is less than about 1,000 mg, or less than about 800 mg, or less than about 600 mg, or less than about 500 mg, or less than about 400 mg, or less than about 300 mg, or less than about 200 mg, or less than about 100 mg, or less than about 50 mg, or less than about 40 mg, or less than about 30 mg, or less than about 25 mg, or less than about 20 mg, or less than about 15 mg, or less than about 10 mg, or less than about 5 mg, or less than about 2 mg, or less than about 1 mg, or less than about 0.5 mg, and any and all whole or partial increments thereof. In certain embodiments, the present disclosure is directed to a packaged pharmaceutical composition comprising a container holding a therapeutically effective amount of the composition of the disclosure, alone or in combination with a second pharmaceutical agent; and instructions for using the compound to treat, prevent, or reduce one or more symptoms of a disease or disorder in a patient. The term "container" includes any receptacle for holding the pharmaceutical composition or for managing stability or water uptake. For example, in certain embodiments, the container is the packaging that contains the pharmaceutical composition, such as liquid (solution and suspension), semisolid, lyophilized solid, solution and powder or lyophilized formulation present in dual chambers. In other embodiments, the container is not the packaging that contains the pharmaceutical composition, i.e., the container is a receptacle, such as a box or vial that contains the packaged pharmaceutical composition or unpackaged pharmaceutical composition and the instructions for use of the pharmaceutical composition. Moreover, packaging techniques are well known in the art. It should be understood that the instructions for use of the pharmaceutical composition may be contained on the packaging containing the pharmaceutical composition, and as such the instructions form an increased functional relationship to the packaged product. However, it should be understood that the instructions may contain information pertaining to the compound's ability to perform its intended function, e.g., treating, preventing, or reducing a disease or disorder in a patient. - 50 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) Administration Routes of administration of any of the compositions of the disclosure include inhalational, oral, nasal, rectal, parenteral, sublingual, transdermal, transmucosal (e.g., sublingual, lingual, (trans)buccal, (trans)urethral, vaginal (e.g., trans- and perivaginally), (intra)nasal, and (trans)rectal), intravesical, intrapulmonary, intraduodenal, intragastrical, intrathecal, epidural, intrapleural, intraperitoneal, subcutaneous, intramuscular, intradermal, intra-arterial, intravenous, intrabronchial, inhalation, and topical administration. Suitable compositions and dosage forms include, for example, tablets, capsules, caplets, pills, gel caps, troches, emulsions, dispersions, suspensions, solutions, syrups, granules, beads, transdermal patches, gels, powders, pellets, magmas, lozenges, creams, pastes, plasters, lotions, discs, suppositories, liquid sprays for nasal or oral administration, dry powder or aerosolized formulations for inhalation, compositions and formulations for intravesical administration and the like. It should be understood that the formulations and compositions that would be useful in the present disclosure are not limited to the particular formulations and compositions that are described herein. Parenteral Administration As used herein, "parenteral administration" of a pharmaceutical composition includes any route of administration characterized by physical breaching of a tissue of a subject and administration of the pharmaceutical composition through the breach in the tissue. Parenteral administration thus includes, but is not limited to, administration of a pharmaceutical composition by injection of the composition, by application of the composition through a surgical incision, by application of the composition through a tissue-penetrating non-surgical wound, and the like. In particular, parenteral administration is contemplated to include, but is not limited to, subcutaneous, intravenous, intraperitoneal, intramuscular, intrasternal injection, and kidney dialytic infusion techniques. Formulations of a pharmaceutical composition suitable for parenteral administration comprise the active ingredient combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous administration. Injectable formulations - 51 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) may be prepared, packaged, or sold in unit dosage form, such as in ampules or in multidose containers containing a preservative. Injectable formulations may also be prepared, packaged, or sold in devices such as patient-controlled analgesia (PCA) devices. Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Such formulations may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents. In certain embodiments of a formulation for parenteral administration, the active ingredient is provided in dry (i.e., powder or granular) form for reconstitution with a suitable vehicle (e.g., sterile pyrogen-free water) prior to parenteral administration of the reconstituted composition. The pharmaceutical compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution. This suspension or solution may be formulated according to the known art, and may comprise, in addition to the active ingredient, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein. Such sterile injectable formulations may be prepared using a non-toxic parenterally acceptable diluent or solvent, such as water or 1,3-butanediol, for example. Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or di-glycerides. Other parentally-administrable formulations which are useful include those which comprise the active ingredient in microcrystalline form in a recombinant human albumin, a fluidized gelatin, in a liposomal preparation, or as a component of a biodegradable polymer system. Compositions for sustained release or implantation may comprise pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt. Methods In one aspect, the present disclosures provides a method for treating, preventing, and / or ameliorating cancer in a subject, the method comprising administering to the subject at least one lipid nanoparticle (LNP) of the present disclosure, or a pharmaceutical composition thereof. - 52 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) In another aspect, the present disclosure provides a method for delivering a therapeutic agent to a tumor cell in a subject, the method comprising administering to the subject at least one lipid nanoparticle (LNP) of the present disclosure, or a pharmaceutical composition thereof. In another aspect, the present disclosure provides a method for treating, preventing, and / or ameliorating cancer in a subject, the method comprising administering to the subject at least one agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) and at least one therapeutic agent. In certain embodiments, the subject has a solid tumor. In another aspect, the present disclosure provides a method for delivering a therapeutic agent to a tumor cell in a subject, the method comprising administering to the subject at least one agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) and at least one therapeutic agent. In certain embodiments, the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) is a small interfering RNA (siRNA). In certain embodiments, the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) is a small molecule. In certain embodiments, the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) is a proteolysis targeting chimera (PROTAC). In certain embodiments, the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) is a gene editing complex. In certain embodiments, the agent that reduces secretion of small extracellular vesicles (sEVs) comprises mRNA encoding a gene editing complex and a small guiding RNA (sgRNA). In certain embodiments, the gene editing complex is CRISPR-associated protein 9 (Cas9). In certain embodiments, the sgRNA is a Cas9 guiding RNA. In certain embodiments, the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) at least partially inhibits or interferes with the expression, activity, or synthesis of at least one selected from the group consisting of Rab27a, Rab27b, Rab31, Rab8a, Rab8b, Alix, HRS, Rabin8, MADD, Sec3, Sec5, Sec6, Sec8, Sec10, Sec15, Exo70, Exo84, RalA, RalB, TSG101, and ceramide. In certain embodiments, the agent is a small interfering RNA (siRNA). In certain embodiments, the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) is a Rab27a-targeted small interfering RNA (siRab27a). In certain embodiments, the therapeutic agent is at least one selected from the group consisting of a nanoparticle and viral vector. In certain embodiments, the nanoparticle at least - 53 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) partially encapsulates a nucleic acid. In certain embodiments, the nanoparticle at least partially encapsulates a small molecule drug. In certain embodiments, the nanoparticle at least partially encapsulates a polypeptide. In certain embodiments, the nanoparticle at least partially encapsulates an antibody. In certain embodiments, the viral vector at least partially encapsulates a nucleic acid. In certain embodiments, the viral vector at least partially encapsulates a small molecule drug. In certain embodiments, the viral vector at least partially encapsulates a polypeptide. In certain embodiments, the viral vector at least partially encapsulates an antibody. In certain embodiments, the nanoparticle is associated with a nucleic acid. In certain embodiments, the nanoparticle is associated with a small molecule drug. In certain embodiments, the nanoparticle is associated with a polypeptide. In certain embodiments, the nanoparticle is associated with an antibody. In certain embodiments, the viral vector associated is with a nucleic acid. In certain embodiments, the viral vector is associated with a small molecule drug. In certain embodiments, the viral vector is associated with a polypeptide. In certain embodiments, the viral vector is associated with an antibody. In certain embodiments, the association comprises absorption. In certain embodiments, the association comprises adsorption. In certain embodiments, the association comprises a covalent bond. In certain embodiments, the nanoparticle is a lipid nanoparticle. In certain embodiments, the nanoparticle is a liposome nanoparticle. In certain embodiments, the nanoparticle is a gold nanoparticle. In certain embodiments, the nanoparticle is a silica nanoparticle. In certain embodiments, the nucleic acid comprises mRNA. In certain embodiments, the mRNA encodes PTEN, or a modified derivative thereof. In certain embodiments, the mRNA encodes STING, or a modified derivative thereof. In certain embodiments, the mRNA encodes a chimeric antigen receptor (CAR). In certain embodiments, the CAR is specific for binding to a surface antigen of a pathogenic cell or tumor cell. In certain embodiments, the surface antigen is selected from the group consisting of CD1, CD2, CD3, CD5, CD7, CD8, CD16, CD19, CD20, CD22, CD25, CD26, CD27, CD28, CD30, CD33, CD38, CD39, CD40L, CD44, CD45, CD62L, CD69, CD73, CD80, CD83, CD86, CD95, CD103, CD119, CD123, CD126, CD150, CD153, CD154, CD161, CD183, CD223, CD254, CD275, CD45RA, CXCR3, CXCR5, FasL, IL18R1, CTLA-4, OX40, GITR, LAG3, ICOS, PD- - 54 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) 1, leu-12, TCR, TLR1, TLR2, TLR3, TLR4, TLR6, NKG2D, CCR, CCR1, CCR2, CCR4, CCR6, CCR7, k light chain, ROR1, ErbB2, ErbB3, ErbB4, EGFR vIII, carcinoembryonic antigen, EGP2, EGP40, mesothelin, TAG72, PSMA, NKG2D ligands, B7-H6, IL13R-α2, MUC1, VEGF-A, Tem8, FAP, EphA2, HER2, MUC16, CA9, GD2, GD3, HMW-MAA, CD171, Lewis Y, G250 / CALX, HLA-AI MAGE A1, HAL-A2 NY-ESO-1, PSC1, folate receptor-α, 8H9, NCAM, VEGF, 5T4, Fetal AchR, NKG2D ligands, TEM1, and TEM8. In certain embodiments, the cancer is selected from the group consisting of breast cancer, lung cancer, colorectal cancer, prostate cancer, ovarian cancer, pancreatic cancer, liver cancer, kidney cancer, bladder cancer, gastric cancer, esophageal cancer, brain tumor, thyroid cancer, bone cancer, soft tissue sarcoma, skin cancer, cervical cancer, testicular cancer, and endometrial cancer. In certain embodiments, the subject is further administered at least one additional agent or therapy useful for treating, preventing, and / or ameliorating cancer in a subject. In certain embodiments, the at least one additional agent is selected from the group consisting of a small molecule anti-cancer agent and an antibody anti-cancer agent. In certain embodiments, the subject is a mammal. In certain embodiments, the mammal is a human. Small molecule therapeutic agents In various embodiments, the agent is a therapeutic agent. In various embodiments, the therapeutic agent is a small molecule. When the therapeutic agent is a small molecule, a small molecule may be obtained using standard methods known to the skilled artisan. Such methods include chemical organic synthesis or biological means. Biological means include purification from a biological source, recombinant synthesis and in vitro translation systems, using methods well known in the art. In certain embodiments, a small molecule therapeutic agents comprises an organic molecule, inorganic molecule, biomolecule, synthetic molecule, and the like. Combinatorial libraries of molecularly diverse chemical compounds potentially useful in treating a variety of diseases and conditions are well known in the art, as are method of making the libraries. The method may use a variety of techniques well-known to the skilled artisan including solid phase synthesis, solution methods, parallel synthesis of single compounds, synthesis of chemical mixtures, rigid core structures, flexible linear sequences, deconvolution - 55 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) strategies, tagging techniques, and generating unbiased molecular landscapes for lead discovery vs. biased structures for lead development. In some embodiments of the disclosure, the therapeutic agent is synthesized and / or identified using combinatorial techniques. In a general method for small library synthesis, an activated core molecule is condensed with a number of building blocks, resulting in a combinatorial library of covalently linked, core- building block ensembles. The shape and rigidity of the core determines the orientation of the building blocks in shape space. The libraries can be biased by changing the core, linkage, or building blocks to target a characterized biological structure (“focused libraries”) or synthesized with less structural bias using flexible cores. In some embodiments of the disclosure, the therapeutic agent is synthesized via small library synthesis. The small molecule and small molecule compounds described herein may be present as salts even if salts are not depicted, and it is understood that the disclosure embraces all salts and solvates of the therapeutic agents depicted here, as well as the non-salt and non-solvate form of the therapeutic agents, as is well understood by the skilled artisan. In some embodiments, the salts of the therapeutic agents of the disclosure are pharmaceutically acceptable salts. Where tautomeric forms may be present for any of the therapeutic agents described herein, each and every tautomeric form is intended to be included in the present disclosure, even though only one or some of the tautomeric forms may be explicitly depicted. For example, when a 2-hydroxypyridyl moiety is depicted, the corresponding 2-pyridone tautomer is also intended. The disclosure also includes any or all of the stereochemical forms, including any enantiomeric or diastereomeric forms of the therapeutic agents described. The recitation of the structure or name herein is intended to embrace all possible stereoisomers of therapeutic agents depicted. All forms of the therapeutic agents are also embraced by the disclosure, such as crystalline or non-crystalline forms of the therapeutic agent. Compositions comprising a therapeutic agents of the disclosure are also intended, such as a composition of substantially pure therapeutic agent, including a specific stereochemical form thereof, or a composition comprising mixtures of therapeutic agents of the disclosure in any ratio, including two or more stereochemical forms, such as in a racemic or non-racemic mixture. The disclosure also includes any or all active analog or derivative, such as a prodrug, of any therapeutic agent described herein. In certain embodiments, the therapeutic agent is a prodrug. In certain embodiments, the small molecules described herein are candidates for - 56 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) derivatization. As such, in certain instances, the analogs of the small molecules described herein that have modulated potency, selectivity, and solubility are included herein and provide useful leads for drug discovery and drug development. Thus, in certain instances, during optimization new analogs are designed considering issues of drug delivery, metabolism, novelty, and safety. In some instances, small molecule therapeutic agents described herein are derivatives or analogs of known therapeutic agents, as is well known in the art of combinatorial and medicinal chemistry. The analogs or derivatives can be prepared by adding and / or substituting functional groups at various locations. As such, the small molecules described herein can be converted into derivatives / analogs using well known chemical synthesis procedures. For example, all of the hydrogen atoms or substituents can be selectively modified to generate new analogs. Also, the linking atoms or groups can be modified into longer or shorter linkers with carbon backbones or hetero atoms. Also, the ring groups can be changed so as to have a different number of atoms in the ring and / or to include hetero atoms. Moreover, aromatics can be converted to cyclic rings, and vice versa. For example, the rings may be from 5-7 atoms, and may be carbocyclic or heterocyclic. The term “derivative” as used herein refers to a chemical compound or molecule made from a parent compound or molecule by one or more chemical reactions. As such, an analog can be a structure having a structure similar to that of the small molecule therapeutic agents described herein or can be based on a scaffold of a small molecule therapeutic agents described herein, but differing from it in respect to certain components or structural makeup, which may have a similar or opposite action metabolically. An analog or derivative of any of a small molecule inhibitor in accordance with the present disclosure can be used to treat a disease or disorder. In certain embodiments, the small molecule therapeutic agents described herein can independently be derivatized, or analogs prepared therefrom, by modifying hydrogen groups independently from each other into other substituents. That is, each atom on each molecule can be independently modified with respect to the other atoms on the same molecule. Any traditional modification for producing a derivative / analog can be used. For example, the atoms and substituents can be independently comprised of hydrogen, an alkyl, aliphatic, straight chain aliphatic, aliphatic having a chain hetero atom, branched aliphatic, substituted aliphatic, cyclic aliphatic, heterocyclic aliphatic having one or more hetero atoms, aromatic, heteroaromatic, - 57 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) polyaromatic, polyamino acids, peptides, polypeptides, combinations thereof, halogens, halo- substituted aliphatics, and the like. Additionally, any ring group on a compound can be derivatized to increase and / or decrease ring size as well as change the backbone atoms to carbon atoms or hetero atoms. Anti-Cancer Agents In some embodiments, the at least one additional agent is an anti-cancer agent. Any suitable anti-cancer agent may be used in the compositions and methods of the present disclosure. The selection of a suitable anti-cancer agent may depend upon, among other things, the type of cancer to be treated and the nanoparticle compositions of the present disclosure. In certain embodiments, the anti-cancer agent may be effective for treating one or more of pancreatic cancer, esophageal cancer, rectal cancer, colon cancer, prostate cancer, kidney cancer, liver cancer, breast cancer, ovarian cancer, and stomach cancer. Examples of anti-cancer agents include, but are not limited to, chemotherapeutic agents, antiproliferative agents, anti-tumor agents, checkpoint inhibitors, and anti-angiogenic agents. For example, In some embodiments, the anti-cancer agent is gemcitabine, doxorubicin, 5-Fu, tyrosine kinase inhibitors, sorafenib, trametinib, rapamycin, fulvestrant, ezalutamide, or paclitaxel. Chemotherapeutic agents include cytotoxic agents (e.g., 5-fluorouracil, cisplatin, carboplatin, methotrexate, daunorubicin, doxorubicin, vincristine, vinblastine, oxorubicin, carmustine (BCNU), lomustine (CCNU), cytarabine USP, cyclophosphamide, estramucine phosphate sodium, altretamine, hydroxyurea, ifosfamide, procarbazine, mitomycin, busulfan, cyclophosphamide, mitoxantrone, carboplatin, cisplatin, interferon alfa-2a recombinant, paclitaxel, teniposide, and streptozoci), cytotoxic alkylating agents (e.g., busulfan, chlorambucil, cyclophosphamide, melphalan, or ethylesulfonic acid), alkylating agents (e.g., asaley, AZQ, BCNU, busulfan, bisulphan, carboxyphthalatoplatinum, CBDCA, CCNU, CHIP, chlorambucil, chlorozotocin, cis-platinum, clomesone, cyanomorpholinodoxorubicin, cyclodisone, cyclophosphamide, dianhydrogalactitol, fluorodopan, hepsulfam, hycanthone, iphosphamide, melphalan, methyl CCNU, mitomycin C, mitozolamide, nitrogen mustard, PCNU, piperazine, piperazinedione, pipobroman, porfiromycin, spirohydantoin mustard, streptozotocin, teroxirone, tetraplatin, thiotepa, triethylenemelamine, uracil nitrogen mustard, and Yoshi-864), antimitotic agents (e.g., allocolchicine, Halichondrin M, colchicine, colchicine derivatives, dolastatin 10, - 58 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) maytansine, rhizoxin, paclitaxel derivatives, paclitaxel, thiocolchicine, trityl cysteine, vinblastine sulfate, and vincristine sulfate), plant alkaloids (e.g., actinomycin D, bleomycin, L-asparaginase, idarubicin, vinblastine sulfate, vincristine sulfate, mitramycin, mitomycin, daunorubicin, VP-16- 213, VM-26, navelbine and taxotere), biologicals (e.g., alpha interferon, BCG, G-CSF, GM-CSF, and interleukin-2), topoisomerase I inhibitors (e.g., camptothecin, camptothecin derivatives, and morpholinodoxorubicin), topoisomerase II inhibitors (e.g., mitoxantron, amonafide, m-AMSA, anthrapyrazole derivatives, pyrazoloacridine, bisantrene HCL, daunorubicin, deoxydoxorubicin, menogaril, N,N-dibenzyl daunomycin, oxanthrazole, rubidazone, VM-26 and VP-16), and synthetics (e.g., hydroxyurea, procarbazine, o,p'-DDD, dacarbazine, CCNU, BCNU, cis- diamminedichloroplatimun, mitoxantrone, CBDCA, levamisole, hexamethylmelamine, all-trans retinoic acid, gliadel and porfimer sodium). Antiproliferative agents are compounds that decrease the proliferation of cells. Antiproliferative agents include alkylating agents, antimetabolites, enzymes, biological response modifiers, miscellaneous agents, hormones and antagonists, androgen inhibitors (e.g., flutamide and leuprolide acetate), antiestrogens (e.g., tamoxifen citrate and analogs thereof, toremifene, droloxifene and roloxifene), Additional examples of specific antiproliferative agents include, but are not limited to levamisole, gallium nitrate, granisetron, sargramostim strontium-89 chloride, filgrastim, pilocarpine, dexrazoxane, and ondansetron. The inhibitors of the invention can be administered alone or in combination with other anti-tumor agents, including cytotoxic / antineoplastic agents and anti-angiogenic agents. Cytotoxic / anti-neoplastic agents are defined as agents which attack and kill cancer cells. Some cytotoxic / anti-neoplastic agents are alkylating agents, which alkylate the genetic material in tumor cells, e.g., cis-platin, cyclophosphamide, nitrogen mustard, trimethylene thiophosphoramide, carmustine, busulfan, chlorambucil, belustine, uracil mustard, chlomaphazin, and dacabazine. Other cytotoxic / anti-neoplastic agents are antimetabolites for tumor cells, e.g., cytosine arabinoside, fluorouracil, methotrexate, mercaptopuirine, azathioprime, and procarbazine. Other cytotoxic / anti-neoplastic agents are antibiotics, e.g., doxorubicin, bleomycin, dactinomycin, daunorubicin, mithramycin, mitomycin, mytomycin C, and daunomycin. There are numerous liposomal formulations commercially available for these compounds. Still other cytotoxic / anti-neoplastic agents are mitotic inhibitors (vinca alkaloids). These include vincristine, vinblastine and etoposide. Miscellaneous cytotoxic / anti-neoplastic - 59 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) agents include taxol and its derivatives, L-asparaginase, anti-tumor antibodies, dacarbazine, azacytidine, amsacrine, melphalan, VM-26, ifosfamide, mitoxantrone, and vindesine. Anti-angiogenic agents are well known to those of skill in the art. Suitable anti- angiogenic agents for use in the methods and compositions of the present disclosure include anti- VEGF antibodies, including humanized and chimeric antibodies, anti-VEGF aptamers and antisense oligonucleotides. Other known inhibitors of angiogenesis include angiostatin, endostatin, interferons, interleukin 1 (including alpha and beta) interleukin 12, retinoic acid, and tissue inhibitors of metalloproteinase-1 and -2. (TIMP-1 and -2). Small molecules, including topoisomerases such as razoxane, a topoisomerase II inhibitor with anti-angiogenic activity, can also be used. Other anti-cancer agents that can be used in combination with the disclosed compounds include, but are not limited to: acivicin; aclarubicin; acodazole hydrochloride; acronine; adozelesin; aldesleukin; altretamine; ambomycin; ametantrone acetate; aminoglutethimide; amsacrine; anastrozole; anthramycin; asparaginase; asperlin; azacitidine; azetepa; azotomycin; batimastat; benzodepa; bicalutamide; bisantrene hydrochloride; bisnafide dimesylate; bizelesin; bleomycin sulfate; brequinar sodium; bropirimine; busulfan; cactinomycin; calusterone; caracemide; carbetimer; carboplatin; carmustine; carubicin hydrochloride; carzelesin; cedefingol; chlorambucil; cirolemycin; cisplatin; cladribine; crisnatol mesylate; cyclophosphamide; cytarabine; dacarbazine; dactinomycin; daunorubicin hydrochloride; decitabine; dexormaplatin; dezaguanine; dezaguanine mesylate; diaziquone; docetaxel; doxorubicin; doxorubicin hydrochloride; droloxifene; droloxifene citrate; dromostanolone propionate; duazomycin; edatrexate; eflornithine hydrochloride; elsamitrucin; enloplatin; enpromate; epipropidine; epirubicin hydrochloride; erbulozole; esorubicin hydrochloride; estramustine; estramustine phosphate sodium; etanidazole; etoposide; etoposide phosphate; etoprine; fadrozole hydrochloride; fazarabine; fenretinide; floxuridine; fludarabine phosphate; fluorouracil; fluorocitabine; fosquidone; fostriecin sodium; gemcitabine; gemcitabine hydrochloride; hydroxyurea; idarubicin hydrochloride; ifosfamide; ilmofosine; interleukin II (including recombinant interleukin II, or rIL2), interferon alfa-2a; interferon alfa-2b; interferon alfa-n1; interferon alfa-n3; interferon beta-I a; interferon gamma-I b; iproplatin; irinotecan hydrochloride; lanreotide acetate; letrozole; leuprolide acetate; liarozole hydrochloride; lometrexol sodium; lomustine; losoxantrone hydrochloride; masoprocol; maytansine; mechlorethamine - 60 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) hydrochloride; megestrol acetate; melengestrol acetate; melphalan; menogaril; mercaptopurine; methotrexate; methotrexate sodium; metoprine; meturedepa; mitindomide; mitocarcin; mitocromin; mitogillin; mitomalcin; mitomycin; mitosper; mitotane; mitoxantrone hydrochloride; mycophenolic acid; nocodazole; nogalamycin; ormaplatin; oxisuran; paclitaxel; pegaspargase; peliomycin; pentamustine; peplomycin sulfate; perfosfamide; pipobroman; piposulfan; piroxantrone hydrochloride; plicamycin; plomestane; porfimer sodium; porfiromycin; prednimustine; procarbazine hydrochloride; puromycin; puromycin hydrochloride; pyrazofurin; riboprine; rogletimide; safingol; safingol hydrochloride; semustine; simtrazene; sparfosate sodium; sparsomycin; spirogermanium hydrochloride; spiromustine; spiroplatin; streptonigrin; streptozocin; sulofenur; talisomycin; tecogalan sodium; tegafur; teloxantrone hydrochloride; temoporfin; teniposide; teroxirone; testolactone; thiamiprine; thioguanine; thiotepa; tiazofurin; tirapazamine; toremifene citrate; trestolone acetate; triciribine phosphate; trimetrexate; trimetrexate glucuronate; triptorelin; tubulozole hydrochloride; uracil mustard; uredepa; vapreotide; verteporfin; vinblastine sulfate; vincristine sulfate; vindesine; vindesine sulfate; vinepidine sulfate; vinglycinate sulfate; vinleurosine sulfate; vinorelbine tartrate; vinrosidine sulfate; vinzolidine sulfate; vorozole; zeniplatin; zinostatin; zorubicin hydrochloride. Other anti-cancer drugs include, but are not limited to: 20-epi-1,25 dihydroxyvitamin D3; 5- ethynyluracil; abiraterone; aclarubicin; acylfulvene; adecypenol; adozelesin; aldesleukin; ALL- TK antagonists; altretamine; ambamustine; amidox; amifostine; aminolevulinic acid; amrubicin; amsacrine; anagrelide; anastrozole; andrographolide; angiogenesis inhibitors; antagonist D; antagonist G; antarelix; anti-dorsalizing morphogenetic protein-1; antiandrogen, prostatic carcinoma; antiestrogen; antineoplaston; antisense oligonucleotides; aphidicolin glycinate; apoptosis gene modulators; apoptosis regulators; apurinic acid; ara-CDP-DL-PTBA; arginine deaminase; asulacrine; atamestane; atrimustine; axinastatin 1; axinastatin 2; axinastatin 3; azasetron; azatoxin; azatyrosine; baccatin III derivatives; balanol; batimastat; BCR / ABL antagonists; benzochlorins; benzoylstaurosporine; beta lactam derivatives; beta-alethine; betaclamycin B; betulinic acid; bFGF inhibitor; bicalutamide; bisantrene; bisaziridinylspermine; bisnafide; bistratene A; bizelesin; breflate; bropirimine; budotitane; buthionine sulfoximine; calcipotriol; calphostin C; camptothecin derivatives; canarypox IL-2; capecitabine; carboxamide- amino-triazole; carboxyamidotriazole; CaRest M3; CARN 700; cartilage derived inhibitor; carzelesin; casein kinase inhibitors (ICOS); castanospermine; cecropin B; cetrorelix; chlorins; - 61 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) chloroquinoxaline sulfonamide; cicaprost; cis-porphyrin; cladribine; clomifene analogues; clotrimazole; collismycin A; collismycin B; combretastatin A4; combretastatin analogue; conagenin; crambescidin 816; crisnatol; cryptophycin 8; cryptophycin A derivatives; curacin A; cyclopentanthraquinones; cycloplatam; cypemycin; cytarabine ocfosfate; cytolytic factor; cytostatin; dacliximab; decitabine; dehydrodidemnin B; deslorelin; dexamethasone; dexifosfamide; dexrazoxane; dexverapamil; diaziquone; didemnin B; didox; diethylnorspermine; dihydro-5-azacytidine; dihydrotaxol, 9-; dioxamycin; diphenyl spiromustine; docetaxel; docosanol; dolasetron; doxifluridine; droloxifene; dronabinol; duocarmycin SA; ebselen; ecomustine; edelfosine; edrecolomab; eflornithine; elemene; emitefur; epirubicin; epristeride; estramustine analogue; estrogen agonists; estrogen antagonists; etanidazole; etoposide phosphate; exemestane; fadrozole; fazarabine; fenretinide; filgrastim; finasteride; flavopiridol; flezelastine; fluasterone; fludarabine; fluorodaunorunicin hydrochloride; forfenimex; formestane; fostriecin; fotemustine; gadolinium texaphyrin; gallium nitrate; galocitabine; ganirelix; gelatinase inhibitors; gemcitabine; glutathione inhibitors; hepsulfam; heregulin; hexamethylene bisacetamide; hypericin; ibandronic acid; idarubicin; idoxifene; idramantone; ilmofosine; ilomastat; imidazoacridones; imiquimod; immunostimulant peptides; insulin-like growth factor-1 receptor inhibitor; interferon agonists; interferons; interleukins; iobenguane; iododoxorubicin; ipomeanol, 4-; iroplact; irsogladine; isobengazole; isohomohalicondrin B; itasetron; jasplakinolide; kahalalide F; lamellarin-N triacetate; lanreotide; leinamycin; lenograstim; lentinan sulfate; leptolstatin; letrozole; leukemia inhibiting factor; leukocyte alpha interferon; leuprolide+estrogen+progesterone; leuprorelin; levamisole; liarozole; linear polyamine analogue; lipophilic disaccharide peptide; lipophilic platinum compounds; lissoclinamide 7; lobaplatin; lombricine; lometrexol; lonidamine; losoxantrone; lovastatin; loxoribine; lurtotecan; lutetium texaphyrin; lysofylline; lytic peptides; maitansine; mannostatin A; marimastat; masoprocol; maspin; matrilysin inhibitors; matrix metalloproteinase inhibitors; menogaril; merbarone; meterelin; methioninase; metoclopramide; MIF inhibitor; mifepristone; miltefosine; mirimostim; mismatched double stranded RNA; mitoguazone; mitolactol; mitomycin analogues; mitonafide; mitotoxin fibroblast growth factor-saporin; mitoxantrone; mofarotene; molgramostim; monoclonal antibody, human chorionic gonadotrophin; monophosphoryl lipid A+myobacterium cell wall sk; mopidamol; multiple drug resistance gene inhibitor; multiple tumor suppressor 1- based therapy; mustard anticancer agent; mycaperoxide B; mycobacterial cell wall extract; - 62 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) myriaporone; N-acetyldinaline; N-substituted benzamides; nafarelin; nagrestip; naloxone+pentazocine; napavin; naphterpin; nartograstim; nedaplatin; nemorubicin; neridronic acid; neutral endopeptidase; nilutamide; nisamycin; nitric oxide modulators; nitroxide antioxidant; nitrullyn; O6-benzylguanine; octreotide; okicenone; oligonucleotides; onapristone; ondansetron; ondansetron; oracin; oral cytokine inducer; ormaplatin; osaterone; oxaliplatin; oxaunomycin; paclitaxel; paclitaxel analogues; paclitaxel derivatives; palauamine; palmitoylrhizoxin; pamidronic acid; panaxytriol; panomifene; parabactin; pazelliptine; pegaspargase; peldesine; pentosan polysulfate sodium; pentostatin; pentrozole; perflubron; perfosfamide; perillyl alcohol; phenazinomycin; phenylacetate; phosphatase inhibitors; picibanil; pilocarpine hydrochloride; pirarubicin; piritrexim; placetin A; placetin B; plasminogen activator inhibitor; platinum complex; platinum compounds; platinum-triamine complex; porfimer sodium; porfiromycin; prednisone; propyl bis-acridone; prostaglandin J2; proteasome inhibitors; protein A-based immune modulator; protein kinase C inhibitor; protein kinase C inhibitors, microalgal; protein tyrosine phosphatase inhibitors; purine nucleoside phosphorylase inhibitors; purpurins; pyrazoloacridine; pyridoxylated hemoglobin polyoxyethylene conjugate; raf antagonists; raltitrexed; ramosetron; ras farnesyl protein transferase inhibitors; ras inhibitors; ras- GAP inhibitor; retelliptine demethylated; rhenium Re 186 etidronate; rhizoxin; ribozymes; RII retinamide; rogletimide; rohitukine; romurtide; roquinimex; rubiginone B1; ruboxyl; safingol; saintopin; SarCNU; sarcophytol A; sargramostim; Sdi 1 mimetics; semustine; senescence derived inhibitor 1; sense oligonucleotides; signal transduction inhibitors; signal transduction modulators; single chain antigen binding protein; sizofuran; sobuzoxane; sodium borocaptate; sodium phenylacetate; solverol; somatomedin binding protein; sonermin; sparfosic acid; spicamycin D; spiromustine; splenopentin; spongistatin 1; squalamine; stem cell inhibitor; stem- cell division inhibitors; stipiamide; stromelysin inhibitors; sulfinosine; superactive vasoactive intestinal peptide antagonist; suradista; suramin; swainsonine; synthetic glycosaminoglycans; tallimustine; tamoxifen methiodide; tauromustine; tazarotene; tecogalan sodium; tegafur; tellurapyrylium; telomerase inhibitors; temoporfin; temozolomide; teniposide; tetrachlorodecaoxide; tetrazomine; thaliblastine; thiocoraline; thrombopoietin; thrombopoietin mimetic; thymalfasin; thymopoietin receptor agonist; thymotrinan; thyroid stimulating hormone; tin ethyl etiopurpurin; tirapazamine; titanocene bichloride; topsentin; toremifene; totipotent stem cell factor; translation inhibitors; tretinoin; triacetyluridine; triciribine; trimetrexate; triptorelin; - 63 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) tropisetron; turosteride; tyrosine kinase inhibitors; tyrphostins; UBC inhibitors; ubenimex; urogenital sinus-derived growth inhibitory factor; urokinase receptor antagonists; vapreotide; variolin B; vector system, erythrocyte gene therapy; velaresol; veramine; verdins; verteporfin; vinorelbine; vinxaltine; vitaxin; vorozole; zanoterone; zeniplatin; zilascorb; and zinostatin stimalamer. In some embodiments, the anti-cancer drug is 5-fluorouracil, taxol, or leucovorin. In some embodiments, the anti-cancer agent may be a prodrug form of an anti-cancer agent. As used herein, the term “prodrug form” and its derivatives is used to refer to a drug that has been chemically modified to add and / or remove one or more substituents in such a manner that, upon introduction of the prodrug form into a subject, such a modification may be reversed by naturally occurring processes, thus reproducing the drug. The use of a prodrug form of an anti-cancer agent in the compositions, among other things, may increase the concentration of the anti-cancer agent in the compositions of the present disclosure. In certain embodiments, an anti- cancer agent may be chemically modified with an alkyl or acyl group or some form of lipid. The selection of such a chemical modification, including the substituent(s) to add and / or remove to create the prodrug, may depend upon a number of factors including, but not limited to, the particular drug and the desired properties of the prodrug. One of ordinary skill in the art, with the benefit of this disclosure, will recognize suitable chemical modifications. Nucleic acid therapeutic agents In certain embodiments, the therapeutic agent of the present disclosure comprises mRNA. In certain embodiments, the mRNA comprises an in vitro transcribed (IVT) RNA molecule. For example, in certain embodiments, the composition of the disclosure comprises an IVT RNA molecule which encodes an agent. In certain embodiments, the IVT RNA molecule of the present composition is a nucleoside-modified mRNA molecule. In certain embodiments, the agent is for targeting an immune cell to a pathogen or a tumor cell of interest. In certain embodiments, the IVT RNA molecule encodes a chimeric antigen receptor (CAR). In some embodiments, the CAR is specific for binding to one or more antigens. In some embodiments, the antigen comprises at least one viral antigen, a bacterial antigen, a fungal antigen, a parasitic antigen, an influenza antigen, a tumor-associated antigen, a tumor-specific antigen, or any combination thereof. However, the present disclosure is not limited to any particular agent or combination of - 64 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) agents. In certain embodiments, the composition comprises an adjuvant. In certain embodiments, the composition comprises a nucleic acid molecule encoding an adjuvant. In certain embodiments, the composition comprises a nucleoside-modified RNA encoding an adjuvant. In certain embodiments, the composition comprises at least one RNA molecule encoding a combination of at least two agents. In certain embodiments, the composition comprises a combination of two or more RNA molecules encoding a combination of two or more agents. In certain embodiments, the present disclosure provides a method for inducing an immune response in a subject. For example, the method can be used to provide immunity in the subject against a virus, bacteria, fungus, parasite, cancer, or the like. In some embodiments, the method comprises administering to the subject a composition comprising one or more LNP molecule formulated for in vivo targeting of an immune cell comprising one or more RNA encoding at least one antigen, an adjuvant, or a combination thereof. In certain embodiments, the present disclosure provides a method for gene editing of an immune cell of a subject. For example, the method can be used to provide one or more component of a gene editing system (e.g., a component of a CRISPR system) to an immune cell of a subject. In some embodiments, the method comprises administering to the subject a composition comprising one or more ionizable LNP molecule formulated for targeted T cell delivery comprising one or more nucleoside-modified RNA molecule for gene editing. In certain embodiments, the method comprises administration of the composition to a subject. In certain embodiments, the method comprises administering a plurality of doses to the subject. In some embodiments, the method comprises administering a single dose of the composition, where the single dose is effective in delivery of the target therapeutic agent. In other related aspects, the therapeutic agent is an isolated nucleic acid. In certain embodiments, the isolated nucleic acid molecule is one of a DNA molecule or an RNA molecule. In certain embodiments, the isolated nucleic acid molecule is a cDNA, mRNA, siRNA, shRNA or miRNA molecule. In certain embodiments, the isolated nucleic acid molecule encodes a therapeutic peptide such a thrombomodulin, endothelial protein C receptor (EPCR), anti- thrombotic proteins including plasminogen activators and their mutants, antioxidant proteins including catalase, superoxide dismutase (SOD) and iron-sequestering proteins. In some embodiments, the therapeutic agent is an siRNA, miRNA, shRNA, or an antisense molecule, which inhibits a targeted nucleic acid including those encoding proteins that are involved in - 65 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) aggravation of the pathological processes. In certain embodiments, the nucleic acid comprises a promoter / regulatory sequence such that the nucleic acid is capable of directing expression of the nucleic acid. Thus, the disclosure encompasses expression vectors and methods for the introduction of exogenous nucleic acid into cells with concomitant expression of the exogenous nucleic acid in the cells such as those described, for example, in Sambrook et al. (2012, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York), and in Ausubel et al. (1997, Current Protocols in Molecular Biology, John Wiley & Sons, New York) and as described elsewhere herein. In certain embodiments, the therapeutic agent comprises siRNA. In certain embodiments, the siRNA is used to decrease the level of a targeted protein. RNA interference (RNAi) is a phenomenon in which the introduction of double-stranded RNA (dsRNA) into a diverse range of organisms and cell types causes degradation of the complementary mRNA. In the cell, long dsRNAs are cleaved into short 21-25 nucleotide small interfering RNAs, or siRNAs, by a ribonuclease known as Dicer. The siRNAs subsequently assemble with protein components into an RNA-induced silencing complex (RISC), unwinding in the process. Activated RISC then binds to complementary transcript by base pairing interactions between the siRNA antisense strand and the mRNA. The bound mRNA is cleaved and sequence specific degradation of mRNA results in gene silencing. See, for example, U.S. Patent No.6,506,559; Fire et al., 1998, Nature 391(19):306-311; Timmons et al., 1998, Nature 395:854; Montgomery et al., 1998, TIG 14 (7):255-258; David R. Engelke, Ed., RNA Interference (RNAi) Nuts & Bolts of RNAi Technology, DNA Press, Eagleville, PA (2003); and Gregory J. Hannon, Ed., RNAi A Guide to Gene Silencing, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2003). Soutschek et al. (2004, Nature 432:173-178) describe a chemical modification to siRNAs that aids in intravenous systemic delivery. Optimizing siRNAs involves consideration of overall G / C content, C / T content at the termini, Tm and the nucleotide content of the 3’ overhang. See, for instance, Schwartz et al., 2003, Cell, 115:199-208 and Khvorova et al., 2003, Cell 115:209-216. Therefore, the present disclosure also includes methods of decreasing levels of PTPN22 using RNAi technology. In certain embodiments, the therapeutic agent may comprise one or more components of a CRISPR-Cas system, where a guide RNA (gRNA) targeted to a gene encoding a target molecule, and a CRISPR-associated (Cas) peptide form a complex to induce mutations within - 66 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) the targeted gene. In certain embodiments, the therapeutic agent comprises a gRNA or a nucleic acid molecule encoding a gRNA. In certain embodiments, the therapeutic agent comprises a Cas peptide or a nucleic acid molecule encoding a Cas peptide. In certain embodiments, the therapeutic agent comprises a miRNA or a mimic of a miRNA. In certain embodiments, the agent comprises a nucleic acid molecule that encodes a miRNA or mimic of a miRNA. MiRNAs are small non-coding RNA molecules that are capable of causing post- transcriptional silencing of specific genes in cells by the inhibition of translation or through degradation of the targeted mRNA. A miRNA can be completely complementary or can have a region of noncomplementarity with a target nucleic acid, consequently resulting in a “bulge” at the region of non-complementarity. A miRNA can inhibit gene expression by repressing translation, such as when the miRNA is not completely complementary to the target nucleic acid, or by causing target RNA degradation, which is believed to occur only when the miRNA binds its target with perfect complementarity. The disclosure also can include double-stranded precursors of miRNA. A miRNA or pri-miRNA can be 18- 100 nucleotides in length, or from 18-80 nucleotides in length. Mature miRNAs can have a length of 19-30 nucleotides, or 21-25 nucleotides, particularly 21, 22, 23, 24, or 25 nucleotides. MiRNA precursors typically have a length of about 70-100 nucleotides and have a hairpin conformation. miRNAs are generated in vivo from pre- miRNAs by the enzymes Dicer and Drosha, which specifically process long pre- miRNA into functional miRNA. The hairpin or mature microRNAs, or pri-microRNA agents featured in the disclosure can be synthesized in vivo by a cell-based system or in vitro by chemical synthesis. In various embodiments, the agent comprises an oligonucleotide that comprises the nucleotide sequence of a disease-associated miRNA. In certain embodiments, the oligonucleotide comprises the nucleotide sequence of a disease-associated miRNA in a pre -microRNA, mature or hairpin form. In other embodiments, a combination of oligonucleotides comprising a sequence of one or more disease-associated miRNAs, any pre -miRNA, any fragment, or any combination thereof is envisioned. MiRNAs can be synthesized to include a modification that imparts a desired characteristic. For example, the modification can improve stability, hybridization thermodynamics with a target nucleic acid, targeting to a particular tissue or cell -type, or cell - 67 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) permeability, e.g., by an endocytosis-dependent or -independent mechanism. Modifications can also increase sequence specificity, and consequently decrease off-site targeting. Methods of synthesis and chemical modifications are described in greater detail below. If desired, miRNA molecules may be modified to stabilize the miRNAs against degradation, to enhance half-life, or to otherwise improve efficacy. Desirable modifications are described, for example, in U.S. Patent Publication Nos.20070213292, 20060287260, 20060035254. 20060008822. and 2005028824, each of which is hereby incorporated by reference in its entirety. For increased nuclease resistance and / or binding affinity to the target, the single- stranded oligonucleotide agents featured in the disclosure can include 2’-O-methyl, 2’-fluorine, 2’-O- methoxyethyl, 2’-O-aminopropyl, 2’-amino, and / or phosphorothioate linkages. Inclusion of locked nucleic acids (LNA), ethylene nucleic acids (ENA), e.g., 2’-4’-ethylene- bridged nucleic acids, and certain nucleotide modifications can also increase binding affinity to the target. The inclusion of pyranose sugars in the oligonucleotide backbone can also decrease endonucleolytic cleavage. An oligonucleotide can be further modified by including a 3’ cationic group, or by inverting the nucleoside at the 3’-terminus with a 3 -3’ linkage. In another alternative, the 3 ‘- terminus can be blocked with an aminoalkyl group. Other 3’ conjugates can inhibit 3’-5’ exonucleolytic cleavage. While not being bound by theory, a 3’ may inhibit exonucleolytic cleavage by sterically blocking the exonuclease from binding to the 3’ end of the oligonucleotide. Even small alkyl chains, aryl groups, or heterocyclic conjugates or modified sugars (D-ribose, deoxyribose, glucose, and so forth) can block 3’-5’-exonucleases. In certain embodiments, the miRNA includes a 2’-modified oligonucleotide containing oligodeoxynucleotide gaps with some or all internucleotide linkages modified to phosphorothioates for nuclease resistance. The presence of methylphosphonate modifications increases the affinity of the oligonucleotide for its target RNA and thus reduces the IC5Q. This modification also increases the nuclease resistance of the modified oligonucleotide. It is understood that the methods and reagents of the present disclosure may be used in conjunction with any technologies that may be developed to enhance the stability or efficacy of an inhibitory nucleic acid molecule. miRNA molecules include nucleotide oligomers containing modified backbones or non- natural internucleoside linkages. Oligomers having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the - 68 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) backbone. For the purposes of this disclosure, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone are also considered to be nucleotide oligomers. Nucleotide oligomers that have modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, methyl and other alkyl phosphonates including 3’-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriest- ers, and boranophosphates. Various salts, mixed salts and free acid forms are also included. A miRNA described herein, which may be in the mature or hairpin form, may be provided as a naked oligonucleotide. In some cases, it may be desirable to utilize a formulation that aids in the delivery of a miRNA or other nucleotide oligomer to cells (see, e.g., U.S. Patent Nos.5,656,611, 5,753,613, 5,785,992, 6,120,798, 6,221,959, 6,346,613, and 6,353,055, each of which is hereby incorporated by reference). In some examples, the miRNA composition is at least partially crystalline, uniformly crystalline, and / or anhydrous (e.g., less than 80, 50, 30, 20, or 10% water). In another example, the miRNA composition is in an aqueous phase, e.g., in a solution that includes water. The aqueous phase or the crystalline compositions can be incorporated into a delivery vehicle, e.g., a liposome (particularly for the aqueous phase), or a particle (e.g., a microparticle as can be appropriate for a crystalline composition). Generally, the miRNA composition is formulated in a manner that is compatible with the intended method of administration. A miRNA composition can be formulated in combination with another agent, e.g., another therapeutic agent or an agent that stabilizes an oligonucleotide agent, e.g., a protein that complexes with the oligonucleotide agent. Still other agents include chelators, e.g., EDTA (e.g., to remove divalent cations such as Mg), salts, and RNAse inhibitors (e.g., a broad specificity RNAse inhibitor). In certain embodiments, the miRNA composition includes another miRNA, e.g., a second miRNA composition (e.g., a microRNA that is distinct from the first). Still other preparations can include at least three, five, ten, twenty, fifty, or a hundred or more different oligonucleotide species. In certain embodiments, the composition comprises an oligonucleotide composition that mimics the activity of a miRNA. In certain embodiments, the composition comprises oligonucleotides having nucleobase identity to the nucleobase sequence of a miRNA, and are thus designed to mimic the activity of the miRNA. In certain embodiments, the oligonucleotide - 69 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) composition that mimics miRNA activity comprises a double-stranded RNA molecule which mimics the mature miRNA hairpins or processed miRNA duplexes. In certain embodiments, the oligonucleotide shares identity with endogenous miRNA or miRNA precursor nucleobase sequences. An oligonucleotide selected for inclusion in a composition of the present disclosure may be one of a number of lengths. Such an oligonucleotide can be from 7 to 100 linked nucleosides in length. For example, an oligonucleotide sharing nucleobase identity with a miRNA may be from 7 to 30 linked nucleosides in length. An oligonucleotide sharing identity with a miRNA precursor may be up to 100 linked nucleosides in length. In certain embodiments, an oligonucleotide comprises 7 to 30 linked nucleosides. In certain embodiments, an oligonucleotide comprises 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 28, 29, or 30 linked nucleotides. In certain embodiments, an oligonucleotide comprises 19 to 23 linked nucleosides. In certain embodiments, an oligonucleotide is from 40 up to 50, 60, 70, 80, 90, or 100 linked nucleosides in length. In certain embodiments, an oligonucleotide has a sequence that has a certain identity to a miRNA or a precursor thereof. Nucleobase sequences of mature miRNAs and their corresponding stem-loop sequences described herein are the sequences found in miRBase, an online searchable database of miRNA sequences and annotation. Entries in the miRBase Sequence database represent a predicted hairpin portion of a miRNA transcript (the stem-loop), with information on the location and sequence of the mature miRNA sequence. The miRNA stem-loop sequences in the database are not strictly precursor miRNAs (pre-miRNAs), and may in some instances include the pre-miRNA and some flanking sequence from the presumed primary transcript. The miRNA nucleobase sequences described herein encompass any version of the miRNA, including the sequences described in Release 10.0 of the miRBase sequence database and sequences described in any earlier Release of the miRBase sequence database. A sequence database release may result in the re-naming of certain miRNAs. A sequence database release may result in a variation of a mature miRNA sequence. The compositions of the present disclosure encompass oligomeric compound comprising oligonucleotides having a certain identity to any nucleobase sequence version of a miRNAs described herein. In certain embodiments, an oligonucleotide has a nucleobase sequence at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identical to the miRNA over a region of 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 - 70 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) nucleobases. Accordingly, in certain embodiments the nucleobase sequence of an oligonucleotide may have one or more non-identical nucleobases with respect to the miRNA. In certain embodiments, the composition comprises a nucleic acid molecule encoding a miRNA, precursor, mimic, or fragment thereof. For example, the composition may comprise a viral vector, plasmid, cosmid, or other expression vector suitable for expressing the miRNA, precursor, mimic, or fragment thereof in a desired mammalian cell or tissue. Polypeptide therapeutic agents In other related aspects, the therapeutic agent includes an isolated peptide that modulates a target. For example, in certain embodiments, the peptide of the disclosure inhibits or activates a target directly by binding to the target thereby modulating the normal functional activity of the target. In certain embodiments, the peptide of the disclosure modulates the target by competing with endogenous proteins. In certain embodiments, the peptide of the disclosure modulates the activity of the target by acting as a transdominant negative mutant. The variants of the polypeptide therapeutic agents may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, (ii) one in which there are one or more modified amino acid residues, e.g., residues that are modified by the attachment of substituent groups, (iii) one in which the polypeptide is an alternative splice variant of the polypeptide of the present disclosure, (iv) fragments of the polypeptides and / or (v) one in which the polypeptide is fused with another polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification (for example, His-tag) or for detection (for example, Sv5 epitope tag). The fragments include polypeptides generated via proteolytic cleavage (including multi-site proteolysis) of an original sequence. Variants may be post-translationally, or chemically modified. Such variants are deemed to be within the scope of those skilled in the art from the teaching herein. CAR agents In certain embodiments, the mRNA molecule of the disclosure encodes a chimeric antigen receptor (CAR). In certain embodiments, the CAR comprises an antigen binding domain. In certain embodiments, the antigen binding domain is a targeting domain, wherein the targeting - 71 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) domain directs the T cell expressing the CAR to a specific cell or tissue of interest. For example, In certain embodiments, the targeting domain comprises an antibody, antibody fragment, or peptide that specifically binds to an expressed on a pathogenic organism or a tumor cell thereby directing the T cell expressing the CAR to a cell or tissue expressing the antigen. In certain embodiments, the disclosure relates to an immune cell targeted LNP comprising an agent, wherein the agent comprises a nucleic acid sequence encoding a chimeric antigen receptor (CAR). In certain embodiments, agent comprises an mRNA molecule encoding a CAR. In certain embodiments, the agent comprises a modified nucleoside mRNA molecule encoding a CAR. In various embodiments, the CAR can be a “first generation,” “second generation,” “third generation,” “fourth generation” or “fifth generation” CAR (see, for example, Sadelain et al., Cancer Discov.3(4):388-398 (2013); Jensen et al., Immunol. Rev.257:127-133 (2014); Sharpe et al., Dis. Model Mech.8(4):337-350 (2015); Brentjens et al., Clin. Cancer Res.13:5426-5435 (2007); Gade et al., Cancer Res.65:9080-9088 (2005); Maher et al., Nat. Biotechnol.20:70-75 (2002); Kershaw et al., J. Immunol.173:2143-2150 (2004); Sadelain et al., Curr. Opin. Immunol. (2009); Hollyman et al., J. Immunother.32:169-180 (2009)). “First generation” CARs for use in the disclosure comprise an antigen binding domain, for example, a single-chain variable fragment (scFv), fused to a transmembrane domain, which is fused to a cytoplasmic / intracellular domain of the T cell receptor chain. “First generation” CARs typically have the intracellular domain from the CD3ζ-chain, which is the primary transmitter of signals from endogenous T cell receptors (TCRs). “First generation” CARs can provide de novo antigen recognition and cause activation of both CD4+ and CD8+ T cells through their CD3ζ chain signaling domain in a single fusion molecule, independent of HLA-mediated antigen presentation. “Second-generation” CARs for use in the disclosure comprise an antigen binding domain, for example, a single-chain variable fragment (scFv), fused to an intracellular signaling domain capable of activating T cells and a co-stimulatory domain designed to augment T cell potency and persistence (Sadelain et al., Cancer Discov.3:388-398 (2013)). CAR design can therefore combine antigen recognition with signal transduction, two functions that are physiologically borne by two separate complexes, the TCR heterodimer and the CD3 complex. “Second generation” CARs include an intracellular domain from various co-stimulatory molecules, for - 72 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) example, CD28, 4-1BB, ICOS, OX40, and the like, in the cytoplasmic tail of the CAR to provide additional signals to the cell. “Second generation” CARs provide both co-stimulation, for example, by CD28 or 4-1BB domains, and activation, for example, by a CD3ζ signaling domain. Preclinical studies have indicated that “Second Generation” CARs can improve the anti-tumor activity of T cells. For example, robust efficacy of “Second Generation” CAR modified T cells was demonstrated in clinical trials targeting the CD19 molecule in patients with chronic lymphoblastic leukemia (CLL) and acute lymphoblastic leukemia (ALL) (Davila et al., Oncoimmunol.1(9):1577-1583 (2012)). “Third generation” CARs provide multiple co-stimulation, for example, by comprising both CD28 and 4-1BB domains, and activation, for example, by comprising a CD3ζ activation domain. “Fourth generation” CARs provide co-stimulation, for example, by CD28 or 4-1BB domains, and activation, for example, by a CD3ζ signaling domain in addition to a constitutive or inducible chemokine component. “Fifth generation” CARs provide co-stimulation, for example, by CD28 or 4-1BB domains, and activation, for example, by a CD3ζ signaling domain, a constitutive or inducible chemokine component, and an intracellular domain of a cytokine receptor, for example, IL-2Rβ. In various embodiments, the CAR can be included in a multivalent CAR system, for example, a DualCAR or “TandemCAR” system. Multivalent CAR systems include systems or cells comprising multiple CARs and systems or cells comprising bivalent / bispecific CARs targeting more than one antigen. In the embodiments disclosed herein, the CARs generally comprise an antigen binding domain, a transmembrane domain and an intracellular domain, as described above. In a particular non-limiting embodiment, the antigen-binding domain is an scFv specific for binding to a surface antigen of a target cell of interest (e.g., a pathogen or tumor cell.) Combinations In certain embodiments, the composition of the present disclosure comprises a combination of agents described herein. In certain embodiments, a composition comprising a combination of agents described herein has an additive effect, wherein the overall effect of the - 73 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) combination is approximately equal to the sum of the effects of each individual agent. In other embodiments, a composition comprising a combination of agents described herein has a synergistic effect, wherein the overall effect of the combination is greater than the sum of the effects of each individual agent. A composition comprising a combination of agents comprises individual agents in any suitable ratio. For example, In certain embodiments, the composition comprises a 1:1 ratio of two individual agents. However, the combination is not limited to any particular ratio. Rather any ratio that is shown to be effective is encompassed. EXAMPLES Various embodiments of the present application can be better understood by reference to the following Examples which are offered by way of illustration. The scope of the present application is not limited to the Examples given herein. Materials and Methods Chemicals and antibodies DLin-MC3-DMA was purchased from MedChem Express.1,1'-Dioctadecyl-3,3,3',3'- Tetramethylindotricarbocyanine Iodide (DiR) was bought from Invitrogen.1,2-distearoyl-sn- glycero-3-phosphocholine (DSPC), cholesterol, and 1,2-dimyristoyl-rac-glycero-3- methoxypolyethylene glycol-2000 (DMG-PEG 2000) were purchased from Avanti Polar Lipids. Anti-mouse F4 / 80 (Catalog: 123110), anti-mouse CD19 (Catalog: 115538), anti-mouse CD3 (Catalog: 317306), anti-mouse CD31 (Catalog: 102410), anti-mouse CD11c (Catalog: 117310), anti-mouse PD-L1 (Catalog: 124312), anti-mouse EGFR (Catalog: MA5-13070) were purchased from ThermoFisher. Anti-mouse EpCAM (Catalog: NBP2-33078 PECy55), was obtained from NOVUS Biologicals. Anti-mouse TRP1 antibody (Catalog: ab178676) was ordered from Abcam. Live / Dead Fixable Aqua Dead Cell Stain Kit was obtained from Thermo Fisher (Catalog: L34957). PLentipuro3 / TO / V5-GW / EGFP-Firefly Luciferase plasmid was purchased from Addgene (Plasmid #119816). Polystyrene nanoparticles with COOH groups on the surface were purchased from Phosphorex (Catalog: 103). Cell lines and animals - 74 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) The murine melanoma cell line YUMM1.7 was obtained from Yale University. The WM9 cell line was obtained from The Wistar Institute. The MC38 and B16-F10 cell lines were obtained from ATCC. All cell lines tested negative for mycoplasma. C57BL / 6j mice (female, 6-8 weeks) were ordered from Jackson laboratory and housed in a specific-pathogen-free animal facility. Ai14 mice (female, 6-8 weeks) were from Jackson laboratory. Construction of Rab27a and Icam-1 knockout cell lines The guide RNA targeting murine Rab27a (sgRNA 1, 5’- CCAAGGCCAAGAACTTGATG-3’ (SEQ ID NO:1), sgRNA 2, 5’- CATCAAGTTCTTGGCCTTGG-3’ (SEQ ID NO:2) (synthesized by Genewiz)) and murine Icam-1 (sgRNA 1, 5’-GAAGGCTTCTCTGGGATGGA-3’ (SEQ ID NO:3), sgRNA 2, 5’- GCAGGAAGGCTTCTCTGGGA-3’ (SEQ ID NO:4)) were annealed and cloned into lentiCRISPR-v2-Puro vector (Addgene, Catalog#: 52961) as previously described. The plasmid was co-transfected with lentiviral packaging plasmids into 293T cells. After 72 h, lentiviral supernatants were collected and filtered before infecting cells. Cells with successful Rab27a knock out were selected using 2 μg / mL puromycin. Monoclonal knockout cells were isolated using a limited dilution method and identified by western blotting. Collection of small extracellular vesicles To collect small extracellular vesicles (sEVs), tumor cells were incubated for 48-72 hours in RPMI1640 or DMEM medium supplemented with 10% sEV-depleted FBS. After that, supernatants were collected for sEVs isolation using a standard differential centrifugation protocol described in previous studies. Briefly, the supernatants were centrifuged at 2,000 g for 20 min at 4 °C and the pellet (containing dead cells and cell debris) was removed. Supernatants were then obtained, and microvesicles (MVs) were pelleted by centrifugation at 16,500 g for 40 min at 4 °C. Supernatants were then collected and further centrifuged at 100,000 g for 2 h at 4 °C to collect sEVs. The resuspended sEVs were further purified by centrifugation at 100,000 g for 2 h and then resuspended in PBS. The concentration and size of purified sEVs were determined using a NanoSight NS300 (Malvern Instruments). - 75 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) Evaluation of the uptake of LNPs or sEVs by MC38 cells The particle number of a sEV stock solution and a LNP (with similar size as sEVs) stock solution was first quantified.5×109sEVs or LNPs were labeled with the same amount of DiO and were added to MC38 Rab27a KO cells. After 24 h incubation, the uptake of sEV-DiO or LNP-DiO by the cells was quantified using flow cytometry. In order to demonstrate if the addition of sEVs competing with LNPs or saturating the endocytosis capacity of cancer cells, MC38 Rab27a KO cells were cultured in 1 mL medium containing 5×109sEVs or 5×109LNPs. Then, to the cell culture medium, 5×109LNPs labeled with DiO (LNP-DiO) were added. After 24 h incubation, the uptake of LNP-DiO by MC38 Rab27a KO cells was quantified using flow cytometry. Determining the ratio of cancer cell-derived sEVs in the tumor tissue The ratio of the tumor cell-derived sEVs in sEVs collected from tumor tissues were investigated.1×1010of sEVs collected from MC38 cells and sEVs collected from the MC38 tumor tissue were incubated with the same dose of anti-EPCAM-PE antibody for 40 min. After that, free antibody was removed by centrifuge and the pellet was resuspended in 1 mL PBS. The fluorescence intensity (PE) of the mixture was measured using a fluorescence spectrophotometer. The ratio of tumor cell derived sEVs (R1) was calculated using Eq.1: R1=F2 / F1 (Eq.1) Where F1 represents the fluorescence intensity of the tumor cell-derived sEVs, and F2 represents the fluorescence intensity of the tumor tissue-derived sEVs. The ratio of tumor cell-derived sEVs was further investigated using a pull-down experiment. Firstly, tumor cells were metabolically labeled with excess amount of azide group following a published method. This is to ensure that sEVs released from tumor cells are labeled with azide group. Azide-modified MC38 cells were used to construct the tumor model. After 14 days of tumor model construction, tumor tissues were collected and the total sEVs in the tumor tissue were isolated. Tumor-released sEVs were collected using a pull-down experiment described in FIG.21C. The total sEVs number and tumor-released sEVs number were determined using a nanoparticle tracking (NTA) system and the ratio of tumor cell derived sEVs (R2) in all sEVs was calculated using Eq.2: R2=Number of bead pull-down sEVs / Number of total sEVs (Eq.2) - 76 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) Flow cytometry Liver, spleen, or tumor tissues were cut into 3×3×3 mm cube and were enzymatically dissociated with 1 mg / mL type IV collagenase, 50 U / mL RNase, and 50 U / mL DNase I for 40 min at 37 °C to obtain single-cell suspensions. Live / Dead Fixable Aqua Dead Cell Stain Kit (Thermo Fisher, Catalog#: L34957) was used to exclude dead cells. Cellular surface staining was performed for 30 min on ice. Cells were washed with PBS 3 times and the stained cells were analyzed using flow cytometry (FACS LSR II). Synthesis of mRNAs Codon optimized firefly Luciferase sequence, Cre recombinase sequence, mouse phosphatase and tensin homolog (PTEN) sequence, or mutated mouse stimulator of interferon genes (STING, R283S), and miR-122-STING were cloned into an mRNA production plasmid (optimized 3’ and 5’ UTR and containing a 101 polyA tail), in vitro transcribed in the presence of 1-methyl pseudouridine modified nucleoside, co-transcriptionally capped using the CleanCapTMtechnology (TriLink), and cellulose purified to remove double-stranded RNAs. Purified mRNAs were precipitated in ethanol, washed, re-suspended in nuclease-free water, and subjected to quality control (electrophoresis, dot blot, endotoxin content). All mRNAs were stored at -80 °C until use. Preparation of lipid nanoparticles, gold nanoparticles, silica nanoparticles, PLGA nanoparticles, PS nanoparticles, and liposomes DLin-MC3-DMA, DSPC, cholesterol, DMG-PEG 2000 were mixed at a molar ratio of 50 / 10 / 38.5 / 1.5 and dissolved in ethanol. mRNA was dissolved in citrate buffer (pH=3). The ethanol phase containing lipids was mixed with the aqueous phase in a microfluidic chip device at a flow rate ratio of 1:3. After that, LNPs were dialyzed against 1 × PBS in a dialysis cassette (MWCO 20kDa) for 2 h to remove ethanol and citrate buffer. LNPs were subsequently filtered through a 0.22 μM membrane and stored at 4 °C until use. mRNA encapsulation efficiency was determined using a Quant-iT RiboGreen RNA assay. An mRNA encoding fire-fly Luciferase was used to formulate the lipid nanoparticle when evaluating the effect of tumor-derived EVs on the cellular uptake of LNPs. For the synthesis of 93 nm and 125 nm LNPs, ethanol phase and - 77 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) citrate buffer phase were mixed using a microfluidic chip device at a flow rate ratio of 1:3. The mixtures were kept at room temperature for 30 or 90 min, respectively, before adding to dialysis cassettes (MWCO 20kDa). For a typical DiR / DiD labeling process, 1 mL of LNPs was added to a 1.5 mL tube containing 2 μL of DiR / DiD dissolved in DMSO (1 mg / mL). After pipette mixing and incubation at 25 °C for 30 min, the mixture were loaded on a 2 mL centrifugal filter device (MWCO: 10 kDa) and washed with PBS for three times. In this way free DiR / DiD dye can be removed and the dye cannot be detached from LNPs. Gold nanoparticles were synthesized following a previously reported seed-growth method.15 nm gold nanoparticles were first synthesized as seeds.0.1 mL of HAuCl4•3H2O solution in 10 mL water was heated to boiling before a sodium citrate solution (0.3 mL) was added. The mixture was kept boiling for another 30 minutes and was allowed to cool to room temperature. For preparing the 56.6 nm gold nanoparticles, 4.5 mL of 15 nm gold nanoparticle seed solution was mixed with 4.88 mL of HAuCl4•3H2O solution (10 mmol / L) and the mixture was diluted to 300 mL with ultrapure water. Then, 200 mL of ascorbic acid solution (0.4 mM) was added drop-wise to the above solution.56.6 nm gold NPs in purple red were obtained. A FITC modification method was used to prepare the fluorescent gold nanoparticles for investigating the cellular uptake of the gold nanoparticles by cells. Silica nanoparticles were synthesized following a previously reported method. Pluronic F127 (0.025 g) was mixed with N-cetyltrimethylammonium bromide (CTAB, 0.25 g) and dissolved in 120 mL of ultrapure water. Then, 875 μL of 2 M NaOH solution was added. The temperature was adjusted to 80 °C. After 15 min of stirring, 1.25 mL TEOS was added drop-wise to the mixture. The mixture was stirred for another 2 h until a blue-white colloidal solution was obtained. The nanoparticles were filtered and washed 5 times with methanol. FITC was doped in the silica nanoparticles to make it fluorescent when evaluating the cell uptake of the nanoparticles. FITC-loaded PLGA NPs were assembled through a nanoprecipitation method.1 mL of the PLGA polymer and FITC in acetonitrile was quickly added to 50 mL PBS, resulting in the formation of PLGA nanoparticles. The nanoparticles were centrifuged and washed three times with PBS before use. Polystyrene nanoparticles were labeled with amine functionalized rhodamine B using the EDC NHS chemistry the reported in the literature. - 78 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) Liposome nanoparticles were synthesized using a thin-film evaporation method. DPPC, cholesterol, DSPE-PEG-2000 with molar ratio of 55:40:5 was dissolved in chloroform in a round-bottom flask. The organic solvent was evaporated under reduced pressure (1 mbar) over night. After that, 1x PBS was added to the lipid film and the flask was sonicated for 6 min. Finally, the particles were purified using centrifugal filters with molecular weight cut-off of 10 kDa. Fluorescein isothiocyanate isomer I (FITC)-labeled DSPE-PEG-2000 was used to prepare the fluorescent liposome. Characterization of the nanoparticles The size and polydispersity index of LNPs, gold nanoparticles, silica nanoparticles, PLGA nanoparticles, PS nanoparticles, and liposomes were determined using Malvern NanoZS 90. Conjugation of LNP with sEV Firstly, azide-modified LNPs were prepared by using the protocol mentioned before except DOPE-azide was used to replace DOPE. Then, sEVs were labeled with DSPE-PEG- DBCO by incubating sEVs with 0.1% (w / w) DSPE-PEG-DBCO for 2 h. After that, free DSPE- PEG-DBCO was removed by dialysis (MWCO 20000 Da) and sEV-DBCO was obtained. The LNP-sEV conjugation was prepared by mixing LNP-azide and sEV-DBCO (at a 1:1 particle number) and incubating in PBS (room temperature) for 1 h. The azide-DBCO click chemistry can induce fast conjugation of the two particles. Generation of tumor spheroids 96-well round-bottom microplates were treated with 5% (v / v) Synperonic® F-108 for 12 h to create a low attachment well plate. Prior to cell seeding, the F-108 solution was removed from each well and the wells were washed three times with PBS. MC38 cells were then seeded into the coated wells at a density of 5000 cell. The 96-well plates were placed in cell incubator at 37 °C, and 5% CO2 atmosphere with 95% air humidity. After 11 days of incubation, the tumor spheroids were collected for confocal experiments. IVIS imaging - 79 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) The IVIS scan was collected on a PerkinElmer Lumina III IVIS system. Images were collected under the defined DiR channel (excitation: 710 nm, emission: 760 nm) using the auto exposure mode. Auto ROI function of the LivingImage 4.5 software was used to quantify the fluorescence level. Average fluorescence intensity in each tissue was used to prepare the figures. Processing of single-cell RNA-sequencing data Healthy mouse liver single-cell RNA sequencing data was obtained from a previous report. Sequences from the NovaSeq were de-multiplexed using bcl2fastq version 2.19.0.316. Reads were aligned using the mm10plus genome using STAR version 2.5.2b with parameters TK. Gene counts were produced using HTSEQ version 0.6.1p1 with default parameters, except ‘stranded’ was set to ‘false’, and ‘mode’ was set to ‘intersection-nonempty’. Sequences from the microfluidic droplet platform were de-multiplexed and aligned using CellRanger version 2.0.1, available from 10x Genomics using default parameters. RNA-sequencing MC38 cancer cells were treated with PBS, LNPs encapsulating siRab27a and a control mRNA, LNPs encapsulating a control siRNA and STING mRNA, and LNPs encapsulating siRab27a and STING mRNA for 24 h. After that, cells were collected and total RNA was extracted using an invitrogen PureLink RNA Mini Kit. RNA was stored in a -80 °C freezer until use. Sequencing and data analysis was performed in Novogen Co.. DEGSeq R package (1.20.0) was used to analyze the differentially expressed genes. The Benjamini & Hochberg method was used to adjust the P-values. Significantly differential expressed genes were determined by setting the threshold of corrected P-value of 0.05 and log2 (Fold change) of 1. For MC38 tumor tissue sequencing, MC38 tumor-bearing mice were i.v. injected with either PBS, a LNP encapsulating siRab27a and a control mRNA, a LNP encapsulating a control siRNA and STING mRNA, or a LNP encapsulating siRab27a and STING mRNA. Intravenous injections were performed on days 8, 10, 12, 14, and 16.5 injections in total were performed. On day 20, mice were euthanized and tumor tissues in different treatment groups were collected. Total RNA in tumor tissues was extracted using an invitrogen™ PureLink™ RNA Mini Kit and sequencing was performed in Novogen Co. with methods as mentioned above. - 80 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) Immunofluorescence sample preparation For immunofluorescence sample preparation, a transcardiac perfusion was performed by slowly injection of 50 mL 10% neutral buffered formalin into the left ventricle. After that, mice organs and tumors were collected. Statistics Statistical analysis was performed using a GraphPad prism 7.0 software. Error bars represent mean ± standard deviation (s.d.). For calculating the statistical differences between two groups, one-way ANOVA with Tukey’s post hoc test was used. Kaplan–Meier method-based log-rank test was used to calculate the P values in animal survival experiments. Example 1: Rab27a knockout promotes the accumulation of lipid nanoparticles in tumors Studies have shown that there are high concentrations of small extracellular vesicles (sEVs) in many solid tumors such as melanoma, colon, and pancreatic cancers, with malignant cells representing the major source of sEVs in the tumor microenvironment. It has been demonstrated that Rab27a is a gene that controls sEV release from cells, and that knockout of Rab27a greatly decreased sEV secretion. In order to investigate the effect of sEVs on nanoparticle delivery to the tumor, a Rab27a knock out was first prepared in a mouse colon cancer cell line, MC38 (MC38 Rab27a KO), and a mouse melanoma cell line, YUMM1.7 (YUMM1.7 Rab27a KO). Next, a mouse colon cancer model was generated by subcutaneous (s.c.) injection of either wild type (WT) or Rab27a KO MC38 cells. The mouse melanoma model was constructed by s.c. injection of WT or Rab27a KO YUMM1.7 cells. It was shown that tumor sEVs exert suppressive effects on anti-tumor immunity. It was found that Rab27a KO decreased tumor growth in immune competent mice, consistent with previous observation. Seeking to compare nanoparticle accumulation in WT and Rab27a KO tumors with similar tumor volumes, an anti-CD8 antibody was used to deplete CD8+T cells to ensure that tumor growth is not affected with Rab27a KO. This method was used in Rab27a KO tumor-bearing mice to enable chronic lymphocytic leukemia (CLL) growth. Since lipid nanoparticles delivering genes have shown great success for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) vaccines in the clinic, and encouraging results from clinical trials - 81 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) for cancer therapy have been observed, a lipid nanoparticle (LNP) was chosen as a model particle for this study. LNPs were synthesized, labeled with a near infrared dye (DiR), and intravenously (i.v.) administered to investigate tumor accumulation in WT and Rab27a KO tumors. Mice were euthanized 24 hours post administration. Major organs (i.e., heart, lung, liver, kidney, and spleen) and tumors were collected, in vivo imaging system (IVIS), flow cytometry, and immunofluorescence experiments were performed to examine LNP distribution in both the MC38 colon cancer model (FIGs.1A-1L, 7A-7E, 8A-8D, 9A-9E, 10A-10D, 11A-11E, and 12A- 12E) and the YUMM1.7 melanoma model (FIGs.13A-13G, 14A-14H, 15A-15H, 16A-16F, 17A-17B). It was found that WT tumor-bearing mice displayed a typical distribution pattern in the liver and spleen, and negligible fluorescence was detected in the tumor (FIG.1A and FIGs. 13A-13G). In contrast, Rab27a KO tumor bearing CD8+T cell depleted mice showed significantly increased DiR signal in the tumor tissue compared to the control (WT tumor treated with LNP) (FIGs.1B-1D and FIGs.13B-13D). A slightly decreased DiR signal was also found in the livers of mice bearing Rab27a KO tumors compared to that of the WT tumor-bearing mice (FIG.1B and FIG.13B). To rule out the role of CD8+T cell depletion on enhanced LNP tumor accumulation, WT MC38 tumor-bearing mice were treated with anti-CD8 Ab, and no difference was observed in DiR accumulation between immunocompetent (WT) and CD8+T cell depleted mice (FIGs.8A-8D). These results demonstrate that the observed nanoparticle accumulation in the Rab27a KO tumor is not a result of CD8+T cell depletion. Instead, Rab27a KO leads to increased LNP delivery to tumors. Flow cytometry was next performed to investigate nanoparticle tropism and measure cell specific uptake (FIGs.1E-1H, FIGs.9A-9E, 10A-10D, and 11A-11E, FIGs.13E- 13G, and FIGs.14A-14H and 15A-15H). LNP distribution in liver Kupffer cells was significantly decreased in Rab27a KO tumor-bearing mice compared to the mice bearing WT tumor (FIG.1E and FIG.14A). However, LNP distribution in CD31+endothelial cells (FIG.1F and FIG.14B). CD19+B cells (FIG.1G and FIG.14C) and hepatocytes (FIG.1E and FIG.14D) remained unaffected. LNP distribution was also analyzed in both blood and spleen, and no difference was found between WT and Rab27a KO CD8+depleted tumor-bearing mice (FIGs.9A-9E, 10A- 10D, 14E-14H, FIGs and 15A-15C). However, LNP distribution in tumor tissues showed that - 82 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) Rab27a KO greatly increased LNP uptake in F4 / 80+macrophages, CD3+T cells, and CD11c+dendritic cells (DCs) (FIGs.11A-11E and 15D-15G). Most importantly, the distribution of LNPs in tumor cells was increased around 8.1-fold after Rab27a KO in the MC38 colon cancer model and about 10-fold in the YUMM1.7 melanoma model (FIG.1H and FIG.15H). Collectively, these results indicate that the inhibition of sEV secretion by Rab27a KO significantly increased LNP uptake by cells in the tumor tissue, and simultaneously decreased uptake by Kupffer cells. The biodistribution of LNPs in WT or Rab27a KO MC38 and YUMM1.7 tumor-bearing Ai14 mice that express Lox-Stop-Lox tdTomato was further investigated (FIGs.1I-1J, 12A-12E, 16A-16F, and 17A-17B). Cre recombinase mRNA (Cre mRNA) was encapsulated in LNPs and i.v. injected to the mice at day 0. Successful delivery of LNPs to cells can induce the expression of Cre recombinase and thus turn on the tdTomato reporter. The results showed that most of the LNPs from different groups were mainly delivered to liver hepatocytes (FIGs.1I-1J, FIG.12A- 12E, and FIG.16A-16F). In the livers of WT tumor-bearing mice, there is also strong LNP uptake by Kupffer cells (FIG.1I and FIGs.16A-16F). However, in the Rab27a KO tumor- bearing mice, the LNP signal in Kupffer cells was decreased (FIGs.1I-1J and FIG.16A), consistent with the biodistribution of DiR-labeled LNPs (FIG.1E and FIG.13E). It was also found that the LNP distribution in the Rab27a KO tumor tissues was significantly higher than that of the WT tumor tissues (FIGs.1K-1L and FIGs.17A-17B). In order to further confirm the role of Rab27a KO in the decreased LNP accumulation in the liver, the IVIS imaging experiment was repeated and the biodistribution of LNPs was analyzed in different tissues 24 and 48 h post LNPs injection (FIGs.18A-18H). It was found that the biodistribution pattern was not changed. It was further demonstrated that the alanine transaminase (ALT), aspartate transferase (AST) levels in the blood, and Kupffer cell infiltration level in the liver are similar among different groups (FIGs.19A-19D). These results demonstrate the KO of Rab27a in tumor cells and the use of anti-CD8 in mice are not the reasons that lead to the bio-distribution shift in various groups. Altogether, these results further demonstrate that Rab27a KO in tumor cells decreased LNP uptake by Kupffer cells, and enhanced LNP delivery to tumor cells. Example 2: sEVs bind to LNPs and traffic them to liver Kupffer cells - 83 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) In vivo biodistribution experiments demonstrated that sEV levels in tumor tissue affect LNP accumulation in tumors. However, the possible mechanism underlying this was unknown and warranted investigation. It was speculated that tumor sEVs may affect the phagocytic capability of Kupffer cells. To measure this, the expression levels of the phagocytosis marker CD206 were measured on Kupffer cells. However, no significant difference in CD206 expression on Kupffer cells in WT and Rab27a KO MC38 tumor-bearing mice was found, suggesting that tumor sEVs did not affect the phagocytic capability of Kupffer cells (FIGs.2A- 2B). Whether sEVs affect LNP uptake by Kupffer cells was next explored. Firstly, primary liver cells were mixed with sEVs or LNPs for 2 h and then uptake was analyzed by different cells using flow cytometry (FIGs.20A-20B). It was found that many sEVs were taken up specifically by Kupffer cells (FIG.20B) but LNP uptake by Kupffer cells was limited (FIG.20B). However, mixing LNPs with sEVs before incubation with cells greatly increased LNP uptake by Kupffer cells (FIGs.2C-2D). These results indicate potential physical interactions between sEVs and LNPs. In order to observe the physical interactions between sEVs and LNPs, a transmission electron microscope (TEM) experiment was performed (FIGs.21A-21B). It was found that about 20% of LNPs were bound to sEVs upon LNP incubation with sEVs for 30 min (FIGs.2E-2F). A pull-down experiment was performed to further explore the presence of physical interactions between LNPs and sEVs. sEV proteins were detected by western blot in the magnetic bead solution binding LNPs, suggesting that LNPs can bind to sEVs after co-incubation (FIGs.21C- 21E and FIG.2G). Van der Waals interactions between sEVs and LNPs may be responsible for the increased interactions between the two particles. The uptake of sEVs by cells is primarily attributed to receptor-mediated endocytosis, which relies on sEV surface adhesion molecules. Since it has been demonstrated herein that there are physical interactions between sEVs and LNPs, it is possible that the uptake of LNPs by Kupffer cells is affected by certain surface molecules on sEVs. Thus, antibodies were used to block adhesion molecules on sEVs that are known to bind cells such as α4, α5, β1, β3, β4, and β5 integrins, CD51, CD66a, CD102, ICAM-1, and ICAM-4 to investigate their effects on the cellular uptake of LNPs by Kupffer cells (FIGs.22A-22C). It was found that using an antibody to block ICAM-1 greatly decreased LNP uptake by Kupffer cells (FIGs.22B-22C). Moreover, while sEVs can greatly improve LNP uptake by Kupffer cells, sEVs from an Icam-1 KO tumor - 84 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) cell line reversed this effect (FIGs.23A-23B). It was also found that chemical conjugation of LNPs and sEVs can further enhance LNP delivery to Kupffer cells (FIGs.23C-23D). These results further demonstrate that the binding of sEVs to LNPs can aid in the trafficking of LNPs to liver Kupffer cells through receptor-mediated uptake. Next, the reason behind Kupffer cell-specific uptake of LNPs was investigated. Since sEVs uptake is mainly mediated by ICAM-1, the expression of Mac-1 subunits CD11b and CD18 in different primary liver cells were examined (Mac-1 can recognize ICAM-1 and initiate cell uptake). Single cell RNA sequencing data (FIG.2H and FIGs.24A-24E) showed that liver Kupffer cells displayed the highest number of CD11b+CD18+cells whereas the CD11b+CD18+cell population in other liver cells, like hepatocytes and B cells, was lower (FIG.24E). Moreover, a flow cytometry experiment also confirmed that Kupffer cells displayed the highest expression of CD11b+CD18+cells (FIG.24F). Human CD11b and CD18 expression was also analyzed in human liver cells and it was found that the CD11b and CD18 expression pattern in the human liver is similar to that of the mouse liver FIGs.25A-25B and 26A-26B). Collectively, these results suggest that LNPs bind to sEVs and that the LNP-sEV complex can be delivered to liver Kupffer cells through the interactions between ICAM-1 expressed on sEVs and Mac-1 expressed on Kupffer cells. In order to further validate the mechanism underlying LNP trafficking to Kupffer cells, an additional IVIS experiment was conducted (FIG.27A and FIGs.2I-2J). DiR-labeled LNPs were administered via intratumoral (i.t.) injection into Rab27a KO MC38 tumors and their biodistribution was analyzed by ex vivo imaging of various tissues (FIG.27A). It was found that only a small portion of LNPs (~20%) trafficked to the liver after i.t. injection of LNPs (FIG.21A and FIGs.2I-2J). However, when injecting sEVs (a particle number similar to the injected LNPs) directly into the tumor, about 75% of the sEVs trafficked to the liver (FIGs.2I-2J and FIG.27A). These results indicate that sEVs are more favorable for liver accumulation compared to LNPs. Moreover, it was found that after pre-incubating LNPs (labeled with DiR) with sEVs for 30 min before intratumoral injection, about 50% of the LNPs trafficked to the liver (FIGs.2I-2J and FIG.27A). In mice bearing WT tumor, the liver accumulation of LNPs was also about 50% (FIG.27C). It was reasoned that this is a result of the formation of the LNP-sEV complex in the tumor tissue. Moreover, when chemically conjugating sEVs to LNPs, about 65% of LNPs trafficked to the liver (FIGs.2I-2J, 27A, and 28A-28G). In contrast, when LNPs were injected - 85 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) s.c. into healthy mice (without tumor bearing), LNPs primarily remained at the injection site and did not traffic to the liver (FIG.27B). Compared to i.v. injection of LNPs (FIG.1A, lower right panel; FIG.13A, fourth panel), i.t. injections leads to more LNP accumulation in the tumor and less trafficking to the liver in mice bearing Rab27a KO tumor (FIG.27A, second panel). However, introducing cancer sEVs, by simply mixing or chemically conjugation with LNPs, can greatly increase the trafficking of the i.t. administrated LNPs to liver (FIG.27A, lower two panels). These results provide further support for the connection between the physical interactions between LNPs and sEVs, and the increase in trafficking from the tumor to the liver. There are several variations of Mac1 positive macrophages in different tissues. However, enhanced uptake of LNPs by liver macrophages (Kupffer cells) specifically was observed (FIG. 1E, FIG.3E, and FIG.4B), and exploration the mechanism underlying this phenomenon was explored. Studies have demonstrated that sEVs express the “don’t eat me” signal CD47 and that the recognition of CD47 on sEVs by the signal-regulatory protein alpha (SIRP-α) on macrophages can significantly inhibit phagocytosis of sEVs. Although it was found that SIRPα was highly expressed on blood and splenic macrophages, the expression of SIRPα on liver Kupffer cells is low (FIG.2K-2L). Analysis of single-cell RNA-seq data confirmed low SIRP-α expression on Kupffer cells compared to other tissue resident macrophages (FIGs.29A-29C). These results indicate that lower SIRPα expression on liver macrophages can be attributed to the delivery of LNPs by sEVs to liver macrophages (Kupffer cells). Example 3: Tumor cell-derived sEVs act as a defense system to alter lipid nanoparticle uptake in vitro The effect of sEVs on LNP delivery to tumor cells was next investigated in vitro. Uptake of LNPs by WT and Rab27a KO MC38 cells was compared and it was found that Rab27a KO greatly improved LNP cellular uptake (FIG.3A). It was also found that supplementing sEVs to Rab27a KO cells substantially decreased LNP uptake (FIG.3B) and that this uptake by cells is sEV-dose dependent (FIG.3C). The effect of sEVs on LNP uptake by other Rab27a deficient tumor cells was also tested (FIGs.3D-3F). LNP uptake by YUMM1.7 Rab27a KO, B16-F10 Rab27a KO, and WM9 Rab27a knockdown cells was also attenuated when sEVs were introduced into the cell culture medium (FIG.3D-3F). These results demonstrate that sEVs secreted by tumor cells can inhibit LNP uptake by cancer cells and that this mechanism is - 86 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) applicable to many tumor cell lines. High levels of SIRPα were detected in the MC38, YUMM1.7, B16-F10, and WM9 tumor cell lines (FIG.31A) and many human tumors (FIG. 31B). sEVs binding to LNPs may therefore be responsible for decreased LNP uptake by cancer cells. Combined with the TEM and pull-down assay results suggesting that physical interactions between sEVs and LNPs exist (FIGs.2E-2F and FIGs.21A-21D), it has been hypothesized that both sEV binding to LNP and the CD47-SIRPα interaction decreases LNP uptake by cancer cells. It was next explored whether this tumor defense system also exists in normal cells. It was found that sEV secretion in primary mouse cells such as endothelial cells, hepatocytes, Kupffer cells, macrophages, monocytes, T cells, and B cells is much lower than that of tumor cell lines such as MC38, YUMM1.7, WM9, and B16-F10 (FIG.31A) and inhibition of sEV secretion using the sEV inhibitor (GW4869) did not lead to the increased LNP uptake by normal cells (FIG.31A), indicating that normal cells may not have such a defense system. It was also investigated if microvesicles (MVs) may have similar functions to sEVs in terms of inhibiting LNP uptake. Y27632 was used to inhibit MV secretion / formation and whether MV inhibition can improve LNP cellular uptake was studied. The results (FIGs.31B-31C) showed that MV- inhibition did not affect LNP uptake. This is likely due to the difference in concentration between MV and sEV in cell culture medium (FIGs.31B-31C). The potential mechanisms underlying sEVs-mediated LNP uptake inhibition were next further investigated. It was found that when treating cancer cells with equivalent number of sEVs and LNPs, cancer cells uptake more LNPs than sEVs (FIGs.32A-32B). This is because the CD47 molecule expressed on sEVs can be recognized by SIRP-α that expressed on cancer cells, which thus inhibited the uptake of LNPs (FIGs.32A-32B). Moreover, it was also investigated if the added sEVs competing with LNPs or saturating the endocytosis capacity of cancer cells. MC38 cells were pretreated with equivalent number of LNPs or sEVs (without labeling), and the same number of LNP-DiO was added. After 24 h, the uptake of LNP-DiO by the cells was determined (FIGs.32C-32D). If sEVs inhibit the uptake of LNPs by MC38 cells through competing with LNPs or saturating the endocytosis capacity of the cells, then the same number of LNPs pretreatment should have similar effect. However, the results showed that LNP- pretreatment only slightly decreased the uptake of LNP-DiO by the cells (FIGs.32C-32D) while sEVs pretreatment greatly decreased LNP-DiO uptake by MC38 cells (FIGs.32C-32D). - 87 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) Moreover, blockade of the sEV surface marker CD47 greatly reversed sEVs-mediated LNP uptake inhibition (FIGs.32C-32D). Altogether, these results demonstrate that sEV-mediated LNP uptake inhibition is mainly mediated by the “don’t eat me” signal (CD47) expressing on sEVs. Considering sEVs bind to LNPs resulted in nanocomplexes with larger sizes, the effect of size increase on the uptake of the particles by MC38 cells was further investigated. Consistent with reported literature, it was found that with the increase of the size of LNPs, the uptake of LNPs by MC38 cells was increased (FIG.33A). These results demonstrate that size increase of LNPs is not a reason that leads to decreased uptake by tumor cells. The effect of size increase in the uptake of LNPs by Kupffer cells was also investigated. The results showed that the uptake of larger LNPs (125 nm and 93 nm) by Kupffer cells is higher than that of regular size (66 nm) LNPs (FIG.33B). Moreover, in order to compare the effect of size increase and ICAM-1 expression on the increased LNP uptake, LNPs encapsulating luciferase mRNA (LNP-Luc) were conjugated with either LNPs encapsulating GFP mRNA (LNP-GFP), or sEVs. These complexes were then added into Kupffer cells. It was found that the conjugation of LNP-Luc to sEVs greatly increased the uptake of LNP-Luc by Kupffer cells whereas the conjugation of LNP-Luc to LNP-GFP only slightly increased the uptake of LNP-Luc (FIG.33C). However, the blockade of ICAM-1-Mac-1 interactions using ICAM-1 antibody greatly decreased the uptake of the LNP- Luc-sEVs conjugation (FIG.33C). These results demonstrate that both the increased size and the ICAM-1-Mac-1 interactions play important roles in the increased LNP uptake by Kupffer cells. Moreover, it was found that even though normal cell sEVs can also bind to LNPs (FIG.34A), these sEVs only lead to moderate LNP uptake inhibition (FIG.34B). This is because the lower expression of SIRP-α on normal cells compared to MC38 tumor cells (FIGs.34C-34D). These results demonstrate that sEVs-mediated defense system is restricted to cancer cells as their high expression of CD47. Next, it was assessed if delivery of siRNA targeting Rab27a (siRab27a) can decrease sEV levels and thus improve nanoparticle delivery to tumor cells. WT MC38 cells were treated with different concentrations of siRab27a-LNPs for 24 h before treated with LNPs encapsulating mRNA encoding eGFP. The data showed that Rab27a knockdown (FIGs.35A-35B) greatly decreased sEVs secretion (FIG.35C) and increased eGFP and luciferase expression (FIGs.3G- 3H). Phosphatase and tensin homolog deleted on chromosome 10 (PTEN) is a tumor suppressor - 88 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) for various tumors. Knockdown of Rab27a also enhanced the delivery efficiency of LNPs encapsulating mRNA encoding PTEN (mPTEN) in YUMM1.7 cells (FIG.35D) and a mRNA encoding the stimulator of interferon genes (mSTING) in MC38 cells (FIG.36A). These results demonstrate that siRNA-mediated knockdown of Rab27a to decrease sEV secretion can substantially improve in vitro LNP transfection. As the delivery of siRab27a decreases the expression of sEVs by cancer cells and improves functional mRNA delivery to cells, whether siRab27a delivery can improve the penetration of LNPs in a tumor spheroid model was investigated (FIGs.3J-3K). WT MC38 tumor spheroids were constructed following a reported method. Tumor spheroids were treated with either a scrambled mRNA-loaded LNP or siRab27a-LNP. After 24 h, LNPs labeled with DiD dye were added.24 h post-DiD LNP-treatment, the distribution of the nanoparticles in the spheroid was observed (FIGs.3J-3K). It was found that siRab27a-LNP pre-treatment substantially improved the penetration of LNP-mRNA as demonstrated by the stronger DiD signal in the center of spheroid (FIGs.3J-3K and FIGs.37A-37C). It was also investigated if the improved LNP penetration is a result of the increase in nanoparticle size. LNPs were prepared with sizes of 66 nm, 93 nm, and 125 nm and their penetration in WT and Rab27a KO tumor spheroids was investigated (FIGs.38A-38F). In Rab27a KO MC38 tumor spheroids, increasing the size of LNPs from 66 nm to 125 nm leads to slightly decreased LNP penetration (FIGs.38A- 38C). However, in WT MC38 tumor spheroids (contains higher concentrations of sEVs), the penetration of LNPs with different sizes are significantly lower (FIGs.38D-38F). These results indicate that both the increase of the particle size and the high sEVs concentration may facilitate the sEV-LNP complex to exit tumor and enter the blood circulation. Collectively, the data show that inhibition of sEV secretion by siRab27a improves the delivery of LNP-mRNA into tumor cells and enhance tumor penetration of LNPs in a tumor spheroid model. Example 4: Lipid nanoparticles co-delivering Rab27a siRNA and PTEN mRNA inhibit tumor growth Next, it was investigated whether the decrease of sEV levels in tumor tissue could improve LNP accumulation in tumors and thus improve the tumor inhibition capacity of therapeutic mRNA. Prior to evaluating the antitumor efficacy of a combination of siRab27a and functional mRNA, whether LNP co-delivering siRab27a and a scrambled mRNA can - 89 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) knockdown the Rab27a gene and decrease sEVs concentration in tumor tissue was first investigated. A YUMM1.7 WT tumor mouse model was constructed and 0, 3, or 5 pre-injections of LNP that deliver siRab27a and a scrambled mRNA were performed. This was performed to induce different levels of Rab27a silencing to evaluate their effect on the biodistribution of LNP- DiR.24 h after the last injection, LNP labeled with DiR was i.v. injected (FIG.4A). The distribution of LNP was observed using IVIS 24 h post LNP injection (FIG.4B). Mice with no pre-injections of siRab27a-loaded LNP showed very low DiR signal at the tumor site (FIG.4B). However, mice treated with 3 and 5 pre-injections of siRab27a-loaded LNP showed significantly increased DiR signal in the tumor (FIG.4C). Rab27a expression levels in tumor tissue were further investigated by western blot (FIG.39A). It was first quantified that more than 80% of the sEVs in the tumor tissue are from tumor cells (FIGs.39B-39E). It was also found that mice treated with 3 and 5 pre-injections of siRab27a-loaded LNP showed substantially decreased Rab27a and sEV levels in tumor tissue (FIG.39F). PTEN is a tumor suppressor that is mutated or expressed at low levels in many tumors, and is a promising target for cancer treatment. PTEN is not expressed in the YUMM1.7 cell line, which contributes to the high malignancy of this cancer cell line. It was investigated if co- delivery of siRab27a and mRNA encoding PTEN (mPTEN) can enhance the antitumor efficacy of mPTEN. After tumor sizes reached about 50 mm3, mice were treated with: 1) LNPs co- encapsulating siRab27a and scrambled mRNA; 2) LNPs co-encapsulating scrambled siRNA and mPTEN; or 3) LNPs co-encapsulating siRab27a and mPTEN (FIG.4D). LNPs were i.v. injected into mice at days 7, 9, 11, 13, and 15 (FIG.4D). PBS injections into mice at different time points were used as a control. Once tumor growth in the PBS group reached 1500 mm3at day 23, all mice were imaged (FIG.39G). Tumor growth in mice that received LNPs co-encapsulating siRab27a and scrambled mRNA was comparable to that of PBS-treated mice (FIG.4E). Tumor growth in mice treated with LNPs co-encapsulating scrambled siRNA and mPTEN showed moderate tumor growth inhibition (FIG.4E and FIG.39G). However, tumor growth in mice treated with LNPs co-encapsulating siRab27a and mPTEN showed the greatest tumor growth inhibition without inducing toxicity characterized by maintained mouse body weight (FIG.39H). Importantly, mice receiving LNPs co-encapsulating siRab27a and mPTEN significantly extended mouse survival (FIG.4F). This animal experiment was repeated and PTEN expression was observed in tumor tissues using immunohistochemistry (IHC) staining and western blotting - 90 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) (FIGs.4G-4H). Rab27a expression greatly decreased in tumor tissues collected from mice treated with LNPs co-encapsulating siRab27a and mPTEN (FIGs.4G-4H). Moreover, LNP treatment also increased PTEN expression and the apoptotic protein caspase-3 in tumor tissue (FIG.40A). In addition, the expression of proliferation marker Ki67 and anti-apoptotic protein bcl-2 were also decreased in the tumor tissues from mice that received LNPs co-encapsulating siRab27a and mPTEN. Importantly, it was found that this treatment induced negligible toxicity to major mouse organs after LNP treatment (FIG.40B), indicating the safety of this co-delivery strategy. Example 5: Lipid nanoparticles co-delivering Rab27a siRNA and mRNA expressing mutated STING inhibits tumor growth After demonstrating that knockdown of tumor-derived sEVs can improve the antitumor efficacy of mPTEN, it was examined if this co-delivery strategy can be used to improve the therapeutic outcome of another cancer therapeutic modality. Recently, STING has attracted increasing attention for cancer immunotherapy due to its potential for treating many cancers in the clinic. However, most current studies focus on the development of STING agonists to activate STING in tumors for inducing antitumor immune responses. There are several limitations in the use of these STING agonists for cancer immunotherapy.1) most STING agonists are not stable and are easily degraded; 2) many STING agonists are very hydrophilic and thus do not readily cross the cell membrane barrier; 3) some tumors do not express STING or only express very low levels of STING, and STING agonists cannot induce strong immune responses in these tumors. Using an LNP to deliver mRNA encoding an activated STING could overcome these challenges. However, tumor accumulation of this particle is also a problem. Here it was assessed whether sEVs knock down can enhance the delivery of LNPs encapsulating a mRNA encoding STING to tumor tissues for cancer immunotherapy. First, a constitutively activated STING (R283S) mRNA (mSTING) was constructed. It was found that the successful delivery of mSTING to cells can effectively activate downstream signals (e.g., IFN-β, TNF-α, and CXCL10) (FIGs.36B-36K) and induce tumor cell death (FIG.36F). Next, the antitumor efficacy of the mSTING-loaded LNP was tested in a MC38 mouse colon cancer model (FIGs. 41A-41H). However, it was found that even though the injection of mSTING-loaded LNPs induced significant tumor growth inhibition, mice displayed rapid body weight loss and elevated - 91 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) cytokine levels in the blood indicating toxicity. Moreover, off target effects in the liver with the constitutively active STING (FIGs.41A-41H) were also observed. A recent study included miRNA-122 (miR-122) binding sites to the 3’ UTR region of an mRNA to decrease target gene expression in the liver. A miRNA-122 binding site was designed in the 3’ UTR of the STING mRNA (mSTING-miR-122), and it was found that hepatocyte cell toxicity can be greatly decreased compared to LNP delivering the original mSTING (FIG.42A). However, compared with the original mSTING, mSTING-miR-122 showed similar cytotoxicity towards MC38 cancer cells (FIG.42B). These data indicate that the liver cell toxicity caused by mSTING can be decreased when incorporating the miR-122 binding site into the mSTING. A MC38 tumor model was then constructed, and the antitumor efficacy and toxicity of mSTING- miR-122-encapsulated LNP was investigated in vivo. Mice were treated with different groups of LNPs: 1) LNPs co-encapsulating siRab27a and scrambled mRNA; 2) LNPs co-encapsulating scrambled siRNA and mSTING-miR-122; or 3) LNPs co-encapsulating siRab27a and mSTING- miR-122 (FIG.5A). LNPs were i.v. injected into mice at days 8, 10, 12, 14, and 16. PBS injections into mice at different time points were used as a control. Once the tumor volume in the PBS group reached 1500 mm3at day 20, all mice were imaged (FIG.43A). No significant body weight change was detected during the treatment (FIG.43B). Tumor growth in mice treated with LNPs co-encapsulating siRab27a and scrambled mRNA was comparable to that of the PBS- treated mice (FIG.5B). LNPs co-encapsulating scrambled siRNA and mSTING-miR-122 showed moderate tumor growth inhibition (FIG.5B). However, LNPs co-encapsulating siRab27a and mSTING-miR-122 showed the greatest tumor growth suppression (FIG.5B). Moreover, the combination of siRab27a with mSTING-miR-122 enhanced the expression of IFN-β and TNF-α in tumor tissue (FIGs.5C-5D). RNA-sequencing (FIGs.5E-5I) data showed that LNPs co-encapsulating siRab27a and mSTING-miR-122 significantly increased the expression of interferon (IFN) and IFN-stimulated genes (ISG) (FIG.5F), leukocyte chemokine genes (FIG.5G), pro-inflammatory cytokine genes (FIG.5H), and cell apoptosis genes (FIG.5I) compared to LNPs co-encapsulating scrambled siRNA and mSTING-miR-122. Most importantly, treatment using LNPs co-encapsulating siRab27a and mSTING-miR-122 significantly extended mice survival (FIG.5J and FIGs.43C-34F). These results demonstrate the high anti-tumor efficacy and low toxicity of LNPs co-encapsulating siRab27a and mSTING- miR-122. Rab27a and STING expression in tumor tissue were determined by - 92 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) immunohistochemistry (IHC). These results showed that LNPs co-encapsulating siRab27a and mSTING-miR-122 greatly increased the expression of STING (FIG.5K) in tumor tissue, which led to enhanced tumor cell death. In addition, Ki67 and bcl-2 expression levels were decreased while caspase-3 expression was increased in tumor tissues collected from the mice that received LNPs co-encapsulating siRab27a and mSTING-miR-122 (FIG.43G). In all, the LNP-based siRab27a and mSTING-miR-122 co-delivery strategy substantially activated the STING pathway in tumor and greatly improved the antitumor efficacy of STING mRNA while not inducing significant toxicity in mice. Limited toxicity was observed in mice treated with LNP co-encapsulating siRab27a and mSTING-miR-122 (FIGs.44A-44F). The liver enzymes aspartate aminotransferase (AST), alanine transaminase (ALT), and various blood cytokines in the mice that received LNPs co- encapsulating siRab27a and mSTING-miR-122 were comparable to that of the PBS-treated mice (FIGs.44A-44D), indicating limited hepatocyte damage by LNPs encapsulating mSTING-miR- 122. H&E staining of mouse livers and major organs further demonstrated that LNP encapsulating mSTING-miR-122 is a safer option for in vivo cancer immunotherapy applications. Example 6: sEVs secreted by tumor cells act as a defense system against the delivery of other nanoparticles and cancer therapeutics Finally, it was examined whether this defense system is applicable to other nanoparticle- based delivery systems and cancer therapy modalities. Liposomes, poly(lactic-co-glycolic acid (PLGA) nanoparticles, and polystyrene (PS) nanoparticles were synthesized and characterized (Table 1). Table 1. Characterization data for certain exemplary nanoparticles (NPs) Nanoparticles Size PDI Zeta potential - 93 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) Polystyrene (PS) NPs 57.3 ± 18.5 0.212 -16.9 mV r Rab27a KO MC38 cells for 24h. Uptake of liposomes by cells was determined using flow cytometry. It was found that the internalization of liposomes by Rab27a KO cells is higher than that of the WT cells (FIG.6A). Moreover, when adding sEVs to the cell culture media, the uptake of liposomes by Rab27a KO cells was decreased in a sEV-dose dependent manner (FIG. 6B). Similarly, the effect of sEVs on the cellular uptake of FITC-labeled PLGA nanoparticles (FIG.6C) and PS nanoparticles (FIG.6E) by the WT and Rab27a KO cells was investigated. Additionally, the effects of extrinsically added sEVs on cellular uptake of these nanoparticles were examined (FIGs.6D-6F). Similar to what was observed in the cells treated with liposomes, sEVs also significantly decreased the internalization of both PLGA and PS nanoparticles by cancer cells (FIGs.6C-6F). In addition to lipid and polymer-based organic nanoparticles, the effect of cancer cell sEVs on the uptake of inorganic nanoparticles such as gold nanoparticles and silica nanoparticles was also investigated (FIGs.45A-45D) as these nanoparticles are widely used in the literature for drug delivery applications. These results demonstrate that sEVs also inhibited the uptake of gold and silica nanoparticles by the cells (FIGs.45A-45D). The binding of gold, silica, PLGA, or PS nanoparticles to cancer cell sEVs is a mechanism that induced the inhibition of the uptake of these nanoparticles by MC38 cells, as determined using a fluorescence resonance energy transfer (FRET) experiment (FIGs.45E-45H). Altogether, these results demonstrate that sEVs secreted by cancer cells act as a defense system against various nanoparticles. Since oncolytic virus (OVs) therapy and antibody therapies have shown great success in the clinic, it was examined whether the sEV defense system affects the ability of these therapeutics to reach tumor cells. In order to mimic OVs-mediated tumor cell infection, a lentiviral construct that delivers a luciferase reporter was used as a model virus to evaluate the effect of sEVs on the functions of viral-based cancer therapeutics. Viral particles were incubated with WT or Rab27a KO MC38 cells for 24h. After that, the expression of luciferase by the cells was determined. As shown in FIG.6G, expression of luciferase by Rab27a KO cells is much higher than that of the WT cells. Moreover, when adding sEVs to the cell culture media, luciferase expression by Rab27a KO cells were decreased and this decrease was dependent on - 94 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) the dose of sEVs (FIG.6H). Even though an actual oncolytic virus was not used for this experiment, most viruses share similar cell entry mechanisms, and thus it is reasoned that the results would be similar to that of an actual oncolytic virus. These results demonstrate that the sEV-based defense system is also applicable to viral-based cancer therapeutics. The influence of sEVs on antibody-based cancer therapeutics was also investigated. Anti- epidermal growth factor receptor (EGFR) antibody is widely used in the clinic for the treatment of many cancers including colon cancer. The antibody needs to first bind to cancer cell surface receptor EGFR, which subsequently activates downstream cell apoptosis-associated pathways. Anti-EGFR-FITC antibody was incubated with WT or Rab27a KO MC38 cells for 0.5 h and the cells were washed three times with PBS. After that, the level of anti-EGFR-FITC binding to cell surface was determined using flow cytometry. As shown in FIG.6I, the FITC signal from Rab27a KO cells is much higher than that of the WT cells. Moreover, when adding sEVs to the cell culture media, FITC signal on Rab27a KO cells were decreased and the decrease is also dependent on sEV dose (FIG.6J). Similarly, it was found that anti-PD-L1 antibody binding to MC38 cancer cell surfaces can also be attenuated by the sEVs that are released by cancer cells (FIGs.6K-6L). Above all, these results demonstrate that the sEVs secreted by cancer cells act as a defense system against many cancer therapeutics including nanoparticles, viruses, and antibody therapies (FIG.6M). Sequence Listing SEQ ID NO:1 CCAAGGCCAAGAACTTGATG SEQ ID NO:2 CATCAAGTTCTTGGCCTTGG SEQ ID NO:3 GAAGGCTTCTCTGGGATGGA SEQ ID NO:4 GCAGGAAGGCTTCTCTGGGA - 95 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) Enumerated Embodiments The following exemplary embodiments are provided, the numbering of which is not to be construed as designating levels of importance: Embodiment 1 provides a lipid nanoparticle (LNP) composition comprising an agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) and at least one mRNA, wherein the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) and the therapeutic mRNA are at least partially encapsulated in the lipid nanoparticle. Embodiment 2 provides a lipid nanoparticle (LNP) composition comprising: (a) at least one ionizable lipid; (b) at least one helper lipid; (c) cholesterol and / or a modified derivative thereof; (d) at least one polymer conjugated lipid; (e) an agent that reduces or inhibits secretion of small extracellular vesicles (sEVs); and (f) at least one therapeutic mRNA; wherein the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) and the at least one therapeutic mRNA are at least partially encapsulated in the LNP. Embodiment 3 provides the LNP of Embodiment 2, wherein the at least one ionizable lipid comprises about 20 mol% to about 80 mol% of the LNP, optionally wherein the at least one ionizable lipid comprises about 50 mol% of the LNP. Embodiment 4 provides the LNP of Embodiment 2 or 3, wherein the at least one ionizable lipid is D-Lin-MC3-DMA. Embodiment 5 provides the LNP of any one of Embodiments 2-4, wherein the at least one helper lipid comprises about 1 to about 20 mol% of the LNP, optionally wherein the at least one helper lipid comprises about 10 mol% of the LNP. Embodiment 6 provides the LNP of any one of Embodiments 2-5, wherein the at least one helper lipid is diastearoylphosphatidylcholine (DSPC). Embodiment 7 provides the LNP of any one of Embodiments 2-6, wherein the cholesterol and / or a modified derivative thereof comprises about 10 mol% to about 70 mol% of the LNP, - 96 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) optionally wherein the cholesterol and / or a modified derivative thereof comprises about 38.5 mol% of the LNP. Embodiment 8 provides the LNP of any one of Embodiments 2-7, wherein the cholesterol and / or a modified derivative thereof is cholesterol. Embodiment 9 provides the LNP of any one of Embodiments 2-8, wherein the polymer conjugated lipid comprises about 0.1 mol% to about 10 mol% of the LNP, optionally wherein the polymer conjugated lipid comprises about 1.5 mol% of the LNP. Embodiment 10 provides the LNP of any one of Embodiments 2-9, wherein the polymer conjugated lipid is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG 2000). Embodiment 11 provides the LNP of any one of Embodiments 1-10, wherein the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) is selected from the group consisting of a small interfering RNA (siRNA), a small molecule, a proteolysis targeting chimera (PROTAC), and a gene editing complex or nucleic acids thereof, optionally wherein the nucleic acids comprise an mRNA encoding CRISPR-associated protein 9 (Cas9) and sgRNA, optionally wherein the sgRNA is a Cas9 guiding RNA. Embodiment 12 provides the LNP of any one of Embodiments 1-11, wherein the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) at least partially inhibits or interferes with the expression, activity, or synthesis of at least one selected from the group consisting of Rab27a, Rab27b, Rab31, Rab8a, Rab8b, Alix, HRS, Rabin8, MADD, Sec3, Sec5, Sec6, Sec8, Sec10, Sec15, Exo70, Exo84, RalA, RalB, TSG101, and ceramide. Embodiment 13 provides the LNP of any one of Embodiments 1-12, wherein the agent is a small interfering RNA (siRNA). Embodiment 14 provides the LNP of any one of Embodiments 1-13, wherein the agent is a Rab27a-targeted small interfering RNA (siRab27a). Embodiment 15 provides the LNP of any one of Embodiments 1-14, wherein the therapeutic mRNA encodes at least one selected from the group consisting of PTEN and STING, or a modified derivative thereof. Embodiment 16 provides the LNP of Embodiment 14 or 15, wherein the at least one therapeutic mRNA and the siRab27a have a mass ratio of about 25:0.01 to about 0.01:25 - 97 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) (mRNA:siRNA w / w), optionally wherein the at least one therapeutic mRNA and the siRab27a have a mass ratio of about 1:1 (mRNA:siRNA w / w). Embodiment 17 provides the LNP of any one of Embodiments 1-16, wherein the therapeutic mRNA encodes a chimeric antigen receptor (CAR). Embodiment 18 provides the LNP of Embodiment 17, wherein the CAR is specific for binding to a surface antigen of a pathogenic cell or tumor cell. Embodiment 19 provides the LNP of Embodiment 18, wherein the surface antigen is selected from the group consisting of CD1, CD2, CD3, CD5, CD7, CD8, CD16, CD19, CD20, CD22, CD25, CD26, CD27, CD28, CD30, CD33, CD38, CD39, CD40L, CD44, CD45, CD62L, CD69, CD73, CD80, CD83, CD86, CD95, CD103, CD119, CD123, CD126, CD150, CD153, CD154, CD161, CD183, CD223, CD254, CD275, CD45RA, CXCR3, CXCR5, FasL, IL18R1, CTLA-4, OX40, GITR, LAG3, ICOS, PD-1, leu-12, TCR, TLR1, TLR2, TLR3, TLR4, TLR6, NKG2D, CCR, CCR1, CCR2, CCR4, CCR6, CCR7, k light chain, ROR1, ErbB2, ErbB3, ErbB4, EGFR vIII, carcinoembryonic antigen, EGP2, EGP40, mesothelin, TAG72, PSMA, NKG2D ligands, B7-H6, IL13R-α2, MUC1, VEGF-A, Tem8, FAP, EphA2, HER2, MUC16, CA9, GD2, GD3, HMW-MAA, CD171, Lewis Y, G250 / CALX, HLA-AI MAGE A1, HAL-A2 NY-ESO-1, PSC1, folate receptor-α, 8H9, NCAM, VEGF, 5T4, Fetal AchR, NKG2D ligands, TEM1, and TEM8. Embodiment 20 provides the LNP of any one of Embodiments 2-19, wherein the LNP has a mass ratio of (a)+(b)+(c)+(d):(e)+(f) of about 10:1. Embodiment 21 provides a pharmaceutical composition comprising the LNP of any one of Embodiments 1-20 and at least one pharmaceutically acceptable carrier. Embodiment 22 provides a method for treating, preventing, and / or ameliorating cancer in a subject, the method comprising administering to the subject the LNP of any one of Embodiments 1-20 or the pharmaceutical composition of Embodiment 21. Embodiment 23 provides a method for delivering a therapeutic agent to a tumor cell in a subject, the method comprising administering to the subject the LNP of any one of Embodiments 1-20 or the pharmaceutical composition of Embodiment 21. Embodiment 24 provides a method for treating, preventing, and / or ameliorating cancer in a subject, the method comprising administering to the subject at least one agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) and at least one therapeutic agent. - 98 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) Embodiment 25 provides the method of Embodiment 22 or 24, wherein the subject has a solid tumor. Embodiment 26 provides a method for delivering a therapeutic agent to a tumor cell in a subject, the method comprising administering to the subject at least one agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) and at least one therapeutic agent. Embodiment 27 provides the method of any one of Embodiments 24-26, wherein the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) is at least one selected from the group consisting of a small interfering RNA (siRNA), a small molecule, a proteolysis targeting chimera (PROTAC), and a gene editing complex or nucleic acids thereof, optionally wherein the nucleic acids comprise an mRNA encoding CRISPR-associated protein 9 (Cas9) and sgRNA, optionally wherein the sgRNA is a Cas9 guiding RNA. Embodiment 28 provides the method of any one of Embodiments 24-27, wherein the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) at least partially inhibits or interferes with the expression, activity, or synthesis of at least one selected from the group consisting of Rab27a, Rab27b, Rab31, Rab8a, Rab8b, Alix, HRS, Rabin8, MADD, Sec3, Sec5, Sec6, Sec8, Sec10, Sec15, Exo70, Exo84, RalA, RalB, TSG101, and ceramide. Embodiment 29 provides the method of any one of Embodiments 24-28, wherein the agent is a small interfering RNA (siRNA). Embodiment 30 provides the method of any one of Embodiments 24-29, wherein the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) is a Rab27a- targeted small interfering RNA (siRab27a). Embodiment 31 provides the method of any one of Embodiments 24-30, wherein the therapeutic agent is at least one selected from the group consisting of a nanoparticle and viral vector. Embodiment 32 provides the method of Embodiment 31, wherein at least one of the following applies: (a) the nanoparticle or viral vector at least partially encapsulates a nucleic acid, small molecule drug, polypeptide, or antibody; and (b) the nanoparticle or viral vector is associated with a nucleic acid, small molecule drug, polypeptide, or antibody. - 99 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) Embodiment 33 provides the method of Embodiment 32, wherein the association comprises absorption, adsorption, or a covalent bond. Embodiment 34 provides the method of any one of Embodiments 31-33, wherein the nanoparticle is selected from the group consisting of a lipid nanoparticle, liposome nanoparticle, gold nanoparticle, and silica nanoparticle. Embodiment 35 provides the method of any one of Embodiments 31-34, wherein the nucleic acid comprises mRNA. Embodiment 36 provides the method of Embodiment 35, wherein the mRNA encodes at least one selected from the group consisting of PTEN and STING, or a modified derivative thereof. Embodiment 37 provides the method of Embodiment 35, wherein the mRNA encodes a chimeric antigen receptor (CAR). Embodiment 38 provides the method of Embodiment 37, wherein the CAR is specific for binding to a surface antigen of a pathogenic cell or tumor cell. Embodiment 39 provides the method of Embodiment 38, wherein the surface antigen is selected from the group consisting of CD1, CD2, CD3, CD5, CD7, CD8, CD16, CD19, CD20, CD22, CD25, CD26, CD27, CD28, CD30, CD33, CD38, CD39, CD40L, CD44, CD45, CD62L, CD69, CD73, CD80, CD83, CD86, CD95, CD103, CD119, CD123, CD126, CD150, CD153, CD154, CD161, CD183, CD223, CD254, CD275, CD45RA, CXCR3, CXCR5, FasL, IL18R1, CTLA-4, OX40, GITR, LAG3, ICOS, PD-1, leu-12, TCR, TLR1, TLR2, TLR3, TLR4, TLR6, NKG2D, CCR, CCR1, CCR2, CCR4, CCR6, CCR7, k light chain, ROR1, ErbB2, ErbB3, ErbB4, EGFR vIII, carcinoembryonic antigen, EGP2, EGP40, mesothelin, TAG72, PSMA, NKG2D ligands, B7-H6, IL13R-α2, MUC1, VEGF-A, Tem8, FAP, EphA2, HER2, MUC16, CA9, GD2, GD3, HMW-MAA, CD171, Lewis Y, G250 / CALX, HLA-AI MAGE A1, HAL-A2 NY-ESO-1, PSC1, folate receptor-α, 8H9, NCAM, VEGF, 5T4, Fetal AchR, NKG2D ligands, TEM1, and TEM8. Embodiment 40 provides the method of any one of Embodiments 22, 24-25, and 27-39, wherein the cancer is selected from the group consisting of breast cancer, lung cancer, colorectal cancer, prostate cancer, ovarian cancer, pancreatic cancer, liver cancer, kidney cancer, bladder cancer, gastric cancer, esophageal cancer, brain tumor, thyroid cancer, bone cancer, soft tissue sarcoma, skin cancer, cervical cancer, testicular cancer, and endometrial cancer. - 100 - 51385799.3 Attorney Docket No.046483-7443WO1(03814) Embodiment 41 provides the method of any one of Embodiments 22-40, wherein the subject is further administered at least one additional agent or therapy useful for treating, preventing, and / or ameliorating cancer in a subject. Embodiment 42 provides the method of Embodiment 41, wherein the at least one additional agent is selected from the group consisting of a small molecule anti-cancer agent and an antibody anti-cancer agent. Embodiment 43 provides the method of any one of Embodiments 22-42, wherein the subject is a mammal. Embodiment 44 provides the method of Embodiment 43, wherein the mammal is a human. The terms and expressions employed herein are used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the embodiments of the present application. Thus, it should be understood that although the present application describes specific embodiments and optional features, modification and variation of the compositions, methods, and concepts herein disclosed may be resorted to by those of ordinary skill in the art, and that such modifications and variations are considered to be within the scope of embodiments of the present application. - 101 - 51385799.3
Claims
Attorney Docket No.046483-7443WO1(03814) CLAIMS What is claimed is:
1. A lipid nanoparticle (LNP) composition comprising an agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) and at least one mRNA, wherein the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) and the therapeutic mRNA are at least partially encapsulated in the lipid nanoparticle.
2. The lipid nanoparticle (LNP) of claim 1, wherein the composition comprises: (a) at least one ionizable lipid; (b) at least one helper lipid; (c) cholesterol and / or a modified derivative thereof; (d) at least one polymer conjugated lipid; (e) an agent that reduces or inhibits secretion of small extracellular vesicles (sEVs); and (f) at least one therapeutic mRNA; wherein the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) and the at least one therapeutic mRNA are at least partially encapsulated in the LNP.
3. The LNP of claim 2, wherein the at least one ionizable lipid comprises about 20 mol% to about 80 mol% of the LNP, optionally wherein the at least one ionizable lipid comprises about 50 mol% of the LNP.
4. The LNP of claim 2 or 3, wherein the at least one ionizable lipid is D-Lin-MC3-DMA.
5. The LNP of any one of claims 2-4, wherein the at least one helper lipid comprises about 1 to about 20 mol% of the LNP, optionally wherein the at least one helper lipid comprises about 10 mol% of the LNP.
6. The LNP of any one of claims 2-5, wherein the at least one helper lipid is diastearoylphosphatidylcholine (DSPC). - 102 - 51385799.3Attorney Docket No.046483-7443WO1(03814) 7. The LNP of any one of claims 2-6, wherein the cholesterol and / or a modified derivative thereof comprises about 10 mol% to about 70 mol% of the LNP, optionally wherein the cholesterol and / or a modified derivative thereof comprises about 38.5 mol% of the LNP.
8. The LNP of any one of claims 2-7, wherein the cholesterol and / or a modified derivative thereof is cholesterol.
9. The LNP of any one of claims 2-8, wherein the polymer conjugated lipid comprises about 0.1 mol% to about 10 mol% of the LNP, optionally wherein the polymer conjugated lipid comprises about 1.5 mol% of the LNP.
10. The LNP of any one of claims 2-9, wherein the polymer conjugated lipid is 1,2- dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG 2000).
11. The LNP of any one of claims 1-10, wherein the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) is selected from the group consisting of a small interfering RNA (siRNA), a small molecule, a proteolysis targeting chimera (PROTAC), and a gene editing complex or nucleic acids thereof, optionally wherein the nucleic acids comprise an mRNA encoding CRISPR-associated protein 9 (Cas9) and sgRNA, optionally wherein the sgRNA is a Cas9 guiding RNA.
12. The LNP of any one of claims 1-11, wherein the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) at least partially inhibits or interferes with the expression, activity, or synthesis of at least one selected from the group consisting of Rab27a, Rab27b, Rab31, Rab8a, Rab8b, Alix, HRS, Rabin8, MADD, Sec3, Sec5, Sec6, Sec8, Sec10, Sec15, Exo70, Exo84, RalA, RalB, TSG101, and ceramide.
13. The LNP of any one of claims 1-12, wherein the agent is a small interfering RNA (siRNA). - 103 - 51385799.3Attorney Docket No.046483-7443WO1(03814) 14. The LNP of any one of claims 1-13, wherein the agent is a Rab27a-targeted small interfering RNA (siRab27a).
15. The LNP of any one of claims 1-14, wherein the therapeutic mRNA encodes at least one selected from the group consisting of PTEN and STING, or a modified derivative thereof.
16. The LNP of claim 14 or 15, wherein the at least one therapeutic mRNA and the siRab27a have a mass ratio of about 25:0.01 to about 0.01:25 (mRNA:siRNA w / w), optionally wherein the at least one therapeutic mRNA and the siRab27a have a mass ratio of about 1:1 (mRNA:siRNA w / w).
17. The LNP of any one of claims 1-16, wherein the therapeutic mRNA encodes a chimeric antigen receptor (CAR).
18. The LNP of claim 17, wherein the CAR is specific for binding to a surface antigen of a pathogenic cell or tumor cell.
19. The LNP of claim 18, wherein the surface antigen is selected from the group consisting of CD1, CD2, CD3, CD5, CD7, CD8, CD16, CD19, CD20, CD22, CD25, CD26, CD27, CD28, CD30, CD33, CD38, CD39, CD40L, CD44, CD45, CD62L, CD69, CD73, CD80, CD83, CD86, CD95, CD103, CD119, CD123, CD126, CD150, CD153, CD154, CD161, CD183, CD223, CD254, CD275, CD45RA, CXCR3, CXCR5, FasL, IL18R1, CTLA-4, OX40, GITR, LAG3, ICOS, PD-1, leu-12, TCR, TLR1, TLR2, TLR3, TLR4, TLR6, NKG2D, CCR, CCR1, CCR2, CCR4, CCR6, CCR7, k light chain, ROR1, ErbB2, ErbB3, ErbB4, EGFR vIII, carcinoembryonic antigen, EGP2, EGP40, mesothelin, TAG72, PSMA, NKG2D ligands, B7-H6, IL13R-α2, MUC1, VEGF-A, Tem8, FAP, EphA2, HER2, MUC16, CA9, GD2, GD3, HMW-MAA, CD171, Lewis Y, G250 / CALX, HLA-AI MAGE A1, HAL-A2 NY-ESO-1, PSC1, folate receptor-α, 8H9, NCAM, VEGF, 5T4, Fetal AchR, NKG2D ligands, TEM1, and TEM8.
20. The LNP of any one of claims 2-19, wherein the LNP has a mass ratio of (a)+(b)+(c)+(d):(e)+(f) of about 10:
1. - 104 - 51385799.3Attorney Docket No.046483-7443WO1(03814) 21. A pharmaceutical composition comprising the LNP of any one of claims 1-20 and at least one pharmaceutically acceptable carrier.
22. A method for treating, preventing, and / or ameliorating cancer in a subject, the method comprising administering to the subject the LNP of any one of claims 1-20 or the pharmaceutical composition of claim 21.
23. A method for delivering a therapeutic agent to a tumor cell in a subject, the method comprising administering to the subject the LNP of any one of claims 1-20 or the pharmaceutical composition of claim 21.
24. A method for treating, preventing, and / or ameliorating cancer in a subject, the method comprising administering to the subject at least one agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) and at least one therapeutic agent.
25. The method of claim 22 or 24, wherein the subject has a solid tumor.
26. A method for delivering a therapeutic agent to a tumor cell in a subject, the method comprising administering to the subject at least one agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) and at least one therapeutic agent.
27. The method of any one of claims 24-26, wherein the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) is at least one selected from the group consisting of a small interfering RNA (siRNA), a small molecule, a proteolysis targeting chimera (PROTAC), and a gene editing complex or nucleic acids thereof, optionally wherein the nucleic acids comprise an mRNA encoding CRISPR-associated protein 9 (Cas9) and sgRNA, optionally wherein the sgRNA is a Cas9 guiding RNA.
28. The method of any one of claims 24-27, wherein the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) at least partially inhibits or interferes with the - 105 - 51385799.3Attorney Docket No.046483-7443WO1(03814) expression, activity, or synthesis of at least one selected from the group consisting of Rab27a, Rab27b, Rab31, Rab8a, Rab8b, Alix, HRS, Rabin8, MADD, Sec3, Sec5, Sec6, Sec8, Sec10, Sec15, Exo70, Exo84, RalA, RalB, TSG101, and ceramide.
29. The method of any one of claims 24-28, wherein the agent is a small interfering RNA (siRNA).
30. The method of any one of claims 24-29, wherein the agent that reduces or inhibits secretion of small extracellular vesicles (sEVs) is a Rab27a-targeted small interfering RNA (siRab27a).
31. The method of any one of claims 24-30, wherein the therapeutic agent is at least one selected from the group consisting of a nanoparticle and viral vector.
32. The method of claim 31, wherein at least one of the following applies: (a) the nanoparticle or viral vector at least partially encapsulates a nucleic acid, small molecule drug, polypeptide, or antibody; and (b) the nanoparticle or viral vector is associated with a nucleic acid, small molecule drug, polypeptide, or antibody.
33. The method of claim 32, wherein the association comprises absorption, adsorption, or a covalent bond.
34. The method of any one of claims 31-33, wherein the nanoparticle is selected from the group consisting of a lipid nanoparticle, liposome nanoparticle, gold nanoparticle, and silica nanoparticle.
35. The method of any one of claims 31-34, wherein the nucleic acid comprises mRNA.
36. The method of claim 35, wherein the mRNA encodes at least one selected from the group consisting of PTEN and STING, or a modified derivative thereof. - 106 - 51385799.3Attorney Docket No.046483-7443WO1(03814) 37. The method of claim 35, wherein the mRNA encodes a chimeric antigen receptor (CAR).
38. The method of claim 37, wherein the CAR is specific for binding to a surface antigen of a pathogenic cell or tumor cell.
39. The method of claim 38, wherein the surface antigen is selected from the group consisting of CD1, CD2, CD3, CD5, CD7, CD8, CD16, CD19, CD20, CD22, CD25, CD26, CD27, CD28, CD30, CD33, CD38, CD39, CD40L, CD44, CD45, CD62L, CD69, CD73, CD80, CD83, CD86, CD95, CD103, CD119, CD123, CD126, CD150, CD153, CD154, CD161, CD183, CD223, CD254, CD275, CD45RA, CXCR3, CXCR5, FasL, IL18R1, CTLA-4, OX40, GITR, LAG3, ICOS, PD-1, leu-12, TCR, TLR1, TLR2, TLR3, TLR4, TLR6, NKG2D, CCR, CCR1, CCR2, CCR4, CCR6, CCR7, k light chain, ROR1, ErbB2, ErbB3, ErbB4, EGFR vIII, carcinoembryonic antigen, EGP2, EGP40, mesothelin, TAG72, PSMA, NKG2D ligands, B7-H6, IL13R-α2, MUC1, VEGF-A, Tem8, FAP, EphA2, HER2, MUC16, CA9, GD2, GD3, HMW- MAA, CD171, Lewis Y, G250 / CALX, HLA-AI MAGE A1, HAL-A2 NY-ESO-1, PSC1, folate receptor-α, 8H9, NCAM, VEGF, 5T4, Fetal AchR, NKG2D ligands, TEM1, and TEM8.
40. The method of any one of claims 22, 24-25, and 27-39, wherein the cancer is selected from the group consisting of breast cancer, lung cancer, colorectal cancer, prostate cancer, ovarian cancer, pancreatic cancer, liver cancer, kidney cancer, bladder cancer, gastric cancer, esophageal cancer, brain tumor, thyroid cancer, bone cancer, soft tissue sarcoma, skin cancer, cervical cancer, testicular cancer, and endometrial cancer.
41. The method of any one of claims 22-40, wherein the subject is further administered at least one additional agent or therapy useful for treating, preventing, and / or ameliorating cancer in a subject.
42. The method of claim 41, wherein the at least one additional agent is selected from the group consisting of a small molecule anti-cancer agent and an antibody anti-cancer agent. - 107 - 51385799.3Attorney Docket No.046483-7443WO1(03814) 43. The method of any one of claims 22-42, wherein the subject is a mammal.
44. The method of claim 43, wherein the mammal is a human. - 108 - 51385799.3
Citation Information
Patent Citations
Anisamide-containing lipids and compositions and methods of use thereof
WO2023107920A1