Methods of producing rejuvenated human somatic cells, compositions, and methods of use

Transient overexpression of OSKM genes using temperature-sensitive Sendai virus vectors in human somatic cells rejuvenates cells by reversing age-associated changes without losing identity, offering a clinically viable solution for cell rejuvenation.

WO2025151477A1PCT designated stage expired Publication Date: 2025-07-17THE J DAVID GLADSTONE INSTITUTES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/010677
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-01-09
Filing Date
2025-01-08
Publication Date
2025-07-17

AI Technical Summary

Technical Problem

Existing methods for rejuvenating human somatic cells, such as induced pluripotent stem cell (iPSC) reprogramming, result in the loss of original cell identity and function, and previous transient reprogramming methods achieve modest epigenetic rejuvenation compared to complete iPSC reprogramming.

Method used

Transiently overexpressing four genes, OCT4, SOX2, KLF4, and CMYC (OSKM), using temperature-sensitive Sendai virus (SeV) vectors in human somatic cells, followed by terminating reprogramming before forming induced pluripotent stem cells, thereby rejuvenating the cells without losing their identity.

Benefits of technology

The method effectively rejuvenates human somatic cells by reversing age-associated changes, achieving significant epigenetic rejuvenation without forming stem cell markers, and can be completely removed from cells by changing the culture temperature, making it suitable for clinical applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000049_0001
    Figure IMGF000049_0001
  • Figure 00000077_0000
    Figure 00000077_0000
  • Figure 00000077_0001
    Figure 00000077_0001
Patent Text Reader

Abstract

Methods for rejuvenating cells and cell functions utilize modified vectors which overexpress four genes, OCT4, SOX2, KLF4, CMYC (OSKM) or combinations thereof. Compositions include modified virus vectors.
Need to check novelty before this filing date? Find Prior Art

Description

METHODS OF PRODUCING REJUVENATED HUMAN SOMATIC CELLS, COMPOSITIONS, AND METHODS OF USECROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority under 35 U.S.C. § 119(e) to U.S. Provisional Application No. 63 / 619,038, filed January 9, 2024. The entire contents of this application are incorporated herein by reference in its entirety.FIELD

[0002] Embodiments are directed to methods for rejuvenating cells. Compositions for use in the methods include temperature sensitive vectors.BACKGROUND

[0003] Aging is the gradual decline in cell and tissue function over time that occurs in almost all organisms and is associated with a variety of molecular hallmarks such as telomere attrition, genetic instability, epigenetic and transcriptional alterations, and an accumulation of misfolded proteins (Lopez-Otin et al. (2022) Multi omic rejuvenation of human cells by maturation phase transient reprogramming. eLife 11 :e71624). This leads to perturbed nutrient sensing, mitochondrial dysfunction, and increased incidence of cellular senescence, which impacts overall cell function and intercellular communication, promotes exhaustion of stem cell pools, and causes tissue dysfunction (Lopez-Otin et al., (2013) “The hallmarks of aging” Cell 153: 1194-1217. doi.org / 10.1016 / j. cell.2013.05.039). The progression of some aging related changes, such as transcriptomic and epigenetic ones, can be measured highly accurately and as such they can be used to construct “aging clocks” that predict chronological age with high precision in humans (Horvath S.O., et al. (2018) “Epigenetic clock for skin and blood cells applied to Hutchinson Gilford Progeria Syndrome and ex vivo studies”. Aging 10: 1758-1775. doi.org / 10.18632 / aging.101508; Fleischer JG et al., (2018) “Predicting age from the transcriptome of human dermal fibroblasts” Genome Biology 19:221. doi.org / 10.1186 / sl3059-018-1599-6) and in other mammals (Stubbs T. M., et al. (2017) “Multi-tissue DNA methylation age predictor in mouse.” Genome Biology 18:68. doi.org / 10.1186 / sl3059-017-1203-5; Thompson M. J. et al. (2018) “A multi-tissue full lifespan epigenetic clock for m ce” Aging 10:2832-2854. doi.org / 10.18632 / aging.101590). Since transcriptomic and epigenetic changes are reversible at least in principle, this raises theintriguing question of whether molecular attributes of aging can be reversed and cells phenotypically rejuvenated (Manukyan M., Singh P.B. (2012) Epigenetic rejuvenation Genes to Cells 17:337-343. / doi.org / 10.1111 / j.1365-2443.2012.01595.x).

[0004] Induced pluripotent stem cell (iPSC) reprogramming is the process by which almost any somatic cell can be converted into an embryonic stem cell-like state. Intriguingly, iPSC reprogramming reverses many age-associated changes, including telomere attrition and oxidative stress. Notably, the epigenetic clock is reset back to approximately 0, suggesting reprogramming can reverse aging associated epigenetic alterations (Horvath S (2013) “DNA methylation age of human tissues and cell types”, Genome Biology 14:R115. doi.org / 10.1186 / gb-2013-14-10-rl l5). However, iPSC reprogramming also results in the loss of original cell identity and therefore function. By contrast, transient reprogramming approaches where the Yamanaka factors (Oct4, Sox2, Klf4, and c-Myc) are expressed for short periods of time may be able to achieve rejuvenation without loss of cell identity. Reprogramming can be performed in vivo (Abad M. et al., (2013) “Reprogramming in vivo produces teratomas and iPS cells with totipotency features”, Nature 502:340-345. doi.org / 10.1038 / naturel2586), and indeed, cyclical expression of the Yamanaka factors in vivo can extend lifespan in progeroid mice and improves cellular function in wild-type mice (Ocampo A. etal., (2016) “In Vivo Amelioration of Age-Associated Hallmarks by Partial Reprogramming”, Cell 167: 1719-1733. doi.org / 10.1016 / j. cell.2016.11.052). An alternative approach for reprogramming in vivo also demonstrated reversal of aging-associated changes in retinal ganglion cells and was capable of restoring vision in a glaucoma mouse model (Lu Y et al., (2020) “Reprogramming to recover youthful epigenetic information and restore vision”, Nature 588: 124-129. doi.org / 10.1038 / s41586-020-2975-42020). More recently, in vitro transient reprogramming has been shown to reverse multiple aspects of aging in human fibroblasts and chondrocytes Sarkar T. J., et al. (2020) “Transient non-integrative expression of nuclear reprogramming factors promotes multifaceted amelioration of aging in human cells”, Nature Communications 11 : 1-12. doi.org / 10.1038 / s41467-020-15174-3). Nevertheless, the extent of epigenetic rejuvenation achieved by previous transient reprogramming methods has been modest (~3 years) compared to the drastic reduction achieved by complete iPSC reprogramming.SUMMARY

[0005] Embodiments are directed to rejuvenation of cell function by transiently overexpressing four genes, OCT4, SOX2, KLF4, and CMYC (OSKM), into human somatic cells using a temperature-sensitive Sendai virus (SeV) vectors.

[0006] Accordingly, in certain aspects, a method of rejuvenating a cell comprises reprogramming the cell by infecting the cell with one or more temperature sensitive vectors, wherein the one or more temperature sensitive vectors comprise at least one reprogramming factor comprising OCT4, SOX2, KLF4, CMYC or combinations thereof, incubating the infected cells at a permissive temperature for two or more days wherein the infected cells transiently express one or more reprogramming factors; terminating reprogramming of the cells prior to the step of forming induced pluripotent stem cells (iPS), thereby, rejuvenating the cell. In certain embodiments, the temperature sensitive vector is a virus vector. In certain embodiments, the virus vector is a Sendai virus vector. In certain embodiments, the Sendai virus vector is modified. In certain embodiments, the modified Sendai virus vector is lacking an F gene. In certain embodiments, the modified Sendai virus vector comprises one or more point mutations in the Sendai virus P gene. In certain embodiments, the modified Sendai virus vector further comprises a micro RNA (miRNA) sequence inserted after the Sendai virus vector P gene. In certain embodiments, the miRNA sequence comprises tcaccattgctaaagtgcaattcgattcaccattgctaaagtgcaatt (SEQ ID NO: 1). In certain embodiments, the modified Sendai virus vector further comprises one or more selectable markers. In certain embodiments, the reprogramming is terminated by incubating the transfected cells at a non- permissive temperature following incubation at the permissive temperature. In certain embodiments, the rejuvenated cells do not express stem cell markers. In certain embodiments, the stem cell markers comprise: Oct4, Nanog, Tra-1-60, SOX2, or SSEA4. In certain embodiments, the cell comprises: immune cells, fibroblasts, endothelial cells, epithelial cells, myocytes, neural cells, brain cells, modified cells or combinations thereof. In certain embodiments, the cells are isolated from a subject. In certain embodiments, the cells are isolated from one or more sources comprising: autologous, allogeneic, haplotype matched, haplotype mismatched, haplo-identical, xenogeneic, cell lines or combinations thereof. In certain embodiments, immune cells comprise: T cells, B cells, natural killer (NK) cells, or myeloid-derived cells. In certain embodiments, the modified cells comprise chimeric antigen receptor T cells (CAR-T cells) or chimeric antigen receptor natural killer cells (CAR- NK cells). In certain embodiments, the cells are infected using the method of spinoculation.

[0007] In another aspect, a method of rejuvenating a cytotoxic T lymphocyte (CTL) comprises stimulating isolated CTLs at least two days before reprogramming the CTLs, reprogramming the CTLs by infecting the CTL with one or more temperature sensitive vectors, wherein the one or more temperature sensitive vectors comprise at least one reprogramming factor comprising OCT4, SOX2, KLF4, CMYC, or combinations thereof, incubating the transfected cells at a permissive temperature for two or more days wherein the infected CTLs transiently express one or more reprogramming factors; terminating reprogramming of the CTLs prior to the step of forming induced pluripotent stem cells (iPS), thereby, rejuvenating the CTL. In certain embodiments, the temperature sensitive vector is a virus vector. In certain embodiments, the virus vector is a Sendai virus vector. In certain embodiments, the Sendai virus vector is modified. In certain embodiments, the modified Sendai virus vector is lacking an F gene. In certain embodiments, the modified Sendai virus vector comprises one or more point mutations in the Sendai virus P gene. In certain embodiments, the modified Sendai virus vector further comprises a micro RNA (miRNA) sequence inserted after the Sendai virus vector P gene. In certain embodiments, the miRNA sequence comprises tcaccattgctaaagtgcaattcgattcaccattgctaaagtgcaatt (SEQ ID NO: 1). In certain embodiments, the modified Sendai virus vector further comprises one or more selectable markers. In certain embodiments, the reprogramming is terminated by incubating the transfected cells at a non-permissive temperature following incubation at the permissive temperature. In certain embodiments, the CTLs are cultured up to eleven days on a coated tissue culture dish. In certain embodiments, the culture medium comprises IL-7 and IL-15. In certain embodiments, the rejuvenated CTLs express stem cell markers during reprogramming comprising: Oct4, Nanog, Tra-1-60, SOX2, or SSEA4. In certain embodiments, the rejuvenated CTLs do not express stem cell comprising: Oct4, Nanog, Tra-1-60, SOX2, or SSEA4. In certain embodiments, the CTLs transiently lose expression of CD8 during reprogramming. In certain embodiments, the CTLs are infected using the method of spinoculation.

[0008] In another aspect, a method of rejuvenating a fibroblast comprises reprogramming the fibroblast by transfecting the fibroblast with one or more temperature sensitive vectors, wherein the one or more temperature sensitive vectors comprise at least one reprogramming factor comprising OCT4, SOX2, KLF4, CMYC or combinations thereof, incubating the transfected fibroblasts at a permissive temperature for two or more days wherein the infected fibroblasts transiently express one or more reprogramming factors;terminating reprogramming of the cells prior to the step of forming induced pluripotent stem cells (iPS), thereby, rejuvenating the cell. In certain embodiments, the temperature sensitive vector is a virus vector. In certain embodiments, the virus vector is a Sendai virus vector. In certain embodiments, the Sendai virus vector is modified. In certain embodiments, the modified Sendai virus vector is lacking an F gene. In certain embodiments, the modified Sendai virus vector comprises one or more point mutations in the Sendai virus P gene. In certain embodiments, the modified Sendai virus vector further comprises a micro RNA (miRNA) sequence inserted after the Sendai virus vector P gene. In certain embodiments, the miRNA sequence comprises tcaccattgctaaagtgcaattcgattcaccattgctaaagtgcaatt (SEQ ID NO: 1). In certain embodiments, the modified Sendai virus vector further comprises one or more selectable markers. In certain embodiments, the reprogramming is terminated by incubating the transfected cells at a non-permissive temperature following incubation at the permissive temperature. In certain embodiments, the fibroblasts are cultured on a coated tissue culture dish. In certain embodiments, the rejuvenated fibroblasts do not express stem cell markers. In certain embodiments, the stem cell markers comprise: Oct4, Nanog, Tra-1-60, SOX2, or SSEA5. In certain embodiments, the fibroblasts are infected using the method of spinoculation.

[0009] In another aspect, a modified Sendai virus vector wherein the Sendai virus vector is a temperature sensitive vector is a virus vector comprising nucleic acid sequences encoding OCT4, SOX2, KLF4, CMYC (OSKM) or combinations thereof. In certain embodiments, the modified Sendai virus vector lacks an F gene. In certain embodiments, the modified Sendai virus vector comprises one or more point mutations in the Sendai virus P gene. In certain embodiments, the modified Sendai virus vector further comprises a micro RNA (miRNA) sequence inserted 3’ to the Sendai virus vector P gene or is inserted distal to the 3’ end of the P gene. In certain embodiments, the miRNA sequence comprises tcaccattgctaaagtgcaattcgattcaccattgctaaagtgcaatt (SEQ ID NO: 1).

[0010] In another aspect, a method of treating cancer, comprises administering to the subject, a rejuvenated cytotoxic T lymphocyte (CTL), wherein the rejuvenated CTL specifically targets the subject’s cancer cells. In certain embodiments, the rejuvenated CTLs are autologous. In certain embodiments, the rejuvenated CTLs are cultured ex vivo with a sample of the subject’s cancer. In certain embodiments, the CTLs are reinfused into the subject.

[0011] In another aspect, a method of rejuvenating one or more desired cell types in a subject comprises obtaining a biological sample from the subject, isolating the desired cell type from the biological sample, reprogramming the desired cell type by transforming the cell with one or more temperature sensitive vectors, wherein the one or more temperature sensitive vectors comprise at least one reprogramming factor comprising OCT4, SOX2, KLF4, CMYC or combinations thereof, incubating the cells at a permissive temperature for two or more days wherein the infected cells transiently express one or more reprogramming factors; terminating reprogramming of the cells prior to the step of forming induced pluripotent stem cells (iPS), thereby, rejuvenating the cell. In certain embodiments, the temperature sensitive vector is a modified Sendai virus vector. In certain embodiments, the modified Sendai virus vector is lacking an F gene. In certain embodiments, the modified Sendai virus vector comprises one or more point mutations in the Sendai virus P gene. In certain embodiments, the modified Sendai virus vector further comprises a micro RNA (miRNA) sequence inserted after the Sendai virus vector P gene. In certain embodiments, the miRNA sequence comprises tcaccattgctaaagtgcaattcgattcaccattgctaaagtgcaatt (SEQ ID NO: 1). In certain embodiments, the modified Sendai virus vector further comprises one or more selectable markers. In certain embodiments, the reprogramming is terminated by incubating the transfected cells at a non-permissive temperature following incubation at the permissive temperature. In certain embodiments, the rejuvenated cells do not express stem cell markers comprising Oct4, Nanog, Tra-1-60, SOX2, or SSEA. In certain embodiments, a cell comprises: immune cells, fibroblasts, endothelial cells, epithelial cells, myocytes, neural cells, brain cells or combinations thereof. In certain embodiments, the cells are isolated from a subject. In certain embodiments, the cells are isolated from one or more sources comprising: autologous, allogeneic, haplotype matched, haplotype mismatched, haplo- identical, xenogeneic, cell lines or combinations thereof. In certain embodiments, immune cells comprise: T cells, B cells, natural killer (NK) cells, or myeloid-derived cells. In certain embodiments, the fibroblasts are infected using the method of spinoculation.

[0012] In another aspect, the vectors embodied herein comprise one or more microRNAs. Examples include, without limitation miR-367, miR-302, miR-371, miR-372, miR-373, miR-512, miR-517, miR-518, miR-519, MiR-520, miR-525, miR-187, miR-299, miR-499, miR-628, and miR-888. In certain embodiments, the miRNA is miR-367T2, comprising a nucleic acid sequence TCACCATTGCTAAAGTGCAATTcgatTCACCATTGCTAAAGTGCAATT (SEQ ID NO:1). In certain embodiments, the miR-367T2 comprises one or more mutations. In certain embodiments, the the miR-367T2 comprises at least a 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, sequence identity to SEQ ID NO: 1. In certain embodiments, the the miR-367T2 comprises at least a 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, sequence identity to SEQ ID NO: 1. In certain embodiments, the the miR-367T2 comprises at least a 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, sequence identity to SEQ ID NO: 1. In certain embodiments, the the miR-367T2 comprises at least a 95%, 96%, 97%, 98%, or 99%, sequence identity to SEQ ID NO: 1.

[0013] In another aspect, the methods and compositions embodied herein rejuvenate exhausted T cells, thereby restoring the exhausted T cell functions and activity.

[0014] In another aspect, the methods and compositions embodied herein rejuvenate skin and cartilage cells prior to transplantation, for improving post- transplantation engraftment rates and proliferation.

[0015] Definitions

[0016] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the disclosure. Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., molecular genetics, immunology, oncology, chemistry, and biochemistry).

[0017] As used herein, the singular forms “a”, “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms “including”, “includes”, “having”, “has”, “with”, or variants thereof are used in either the detailed description and / or the claims, such terms are intended to be inclusive in a manner similar to the term “comprising.”

[0018] The term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, “about” can mean within 1 or more than 1 standard deviation, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value or range. Alternatively, particularly with respect tobiological systems or processes, the term can mean within an order of magnitude within 5- fold, and also within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated the term “about” meaning within an acceptable error range for the particular value should be assumed.

[0019] In the description and in the claims, phrases such as “at least one of’ or “one or more of’ may occur followed by a conjunctive list of elements or features. The term “and / or” may also occur in a list of two or more elements or features. Unless otherwise implicitly or explicitly contradicted by the context in which it is used, such a phrase is intended to mean any of the listed elements or features individually or any of the recited elements or features in combination with any of the other recited elements or features. For example, the phrases “at least one of A and B;” “one or more of A and B;” and “A and / or B” are each intended to mean “A alone, B alone, or A and B together.” A similar interpretation is also intended for lists including three or more items. For example, the phrases “at least one of A, B, and C”, “one or more of A, B, and C” and “A, B, and / or C” are each intended to mean “A alone, B alone, C alone, A and B together, A and C together, B and C together, or A and B and C together.” In addition, use of the term “based on,” above and in the claims is intended to mean, “based at least in part on,” such that an unrecited feature or element is also permissible.

[0020] As used in this specification and the appended claims, the term “or” is generally employed in its sense including “and / or” unless the content clearly dictates otherwise.

[0021] The term “chimeric antigen receptor” or “CAR” as used herein refers to an antigen-binding domain that is fused to an intracellular signaling domain capable of activating or stimulating an immune cell, and in certain embodiments, the CAR also comprises a transmembrane domain. In certain embodiments the CAR's extracellular antigen-binding domain is composed of a single chain variable fragment (scFv) derived from fusing the variable heavy and light regions of a murine or humanized monoclonal antibody. Alternatively, scFvs may be used that are derived from Fab's (instead of from an antibody, e.g., obtained from Fab libraries). In various embodiments, the scFv is fused to the transmembrane domain and then to the intracellular signaling domain. “First-generation” CARs include those that solely provide CD3(^ signals upon antigen binding, “Second-generation” CARs include those that provide both co-stimulation (e.g., CD28 or CD137) and activation (CD3Q. “Third-generation” CARs include those that provide multiple co-stimulation (e.g. CD28 and CD137) and activation(CD3Q. “Fourth generation” of CARs have been described as CAR T cells redirected for cytokine killing (TRUCKS) where the vector containing the CAR construct possesses a cytokine cassette. When the CAR is ligated, the CAR T cell deposits a pro-inflammatory cytokine into the tumor lesion. “Fifth generation” of CARs are mainly designed based on the second generation. However, these CAR-T cells contain a truncated cytoplasmic receptor (IL- 12) and a p-chain domain (IL-2Rp truncated intracellular interleukin 2|3 chain receptor) along with the transcription factor STAT3 / 5 binding motif (Tokarew et al., 2019. Teaching an Old Dog New Tricks: Next-Generation CAR T Cells. Br. J. Cancer 120, 26-37. doi: 10.1038 / s41416-018"0325-l). A CAR-T cell is a T cell that expresses a chimeric antigen receptor. The phrase “chimeric antigen receptor (CAR),” as used herein and generally used in the art, refers to a recombinant fusion protein that has an antigen-specific extracellular domain coupled to an intracellular domain that directs the cell to perform a specialized function upon binding of an antigen to the extracellular domain. The terms “artificial T-cell receptor,” “chimeric T-cell receptor,” and “chimeric immunoreceptor” may each be used interchangeably herein with the term “chimeric antigen receptor.”

[0022] As used herein, the terms “comprising,” “comprise” or “comprised,” and variations thereof, in reference to defined or described elements of an item, composition, apparatus, method, process, system, etc. are meant to be inclusive or open ended, permitting additional elements, thereby indicating that the defined or described item, composition, apparatus, method, process, system, etc. includes those specified elements— or, as appropriate, equivalents thereof— and that other elements can be included and still fall within the scope / definition of the defined item, composition, apparatus, method, process, system, etc.

[0023] As used herein, the term “cellular immune response” can be used interchangeably with the term “cell-mediated immune response” and refers to an immune response that does not predominantly involve antibodies. Instead, a cellular immune response involves the activation of different immune cells (e.g., phagocytes and antigen-specific cytotoxic T-lymphocytes) that produce various effector molecules (e.g., cytokines, perforin, granzymes) upon activation (e.g., via antigen stimulation). As used herein, the term “humoral immune response” refers to an immune response predominantly mediated by macromolecules found in extracellular fluids, such as secreted antibodies, complement proteins, and certain antimicrobial peptides. The term “antibody-mediated immune response” refers to an aspect of a humoral immune response that is mediated by antibodies.

[0024] As used herein, the term “expression vector” refers to a vector containing a nucleic acid sequence coding for at least part of a gene product capable of being transcribed. In some cases, when the transcription product is an mRNA molecule, this is in turn translated into a protein, polypeptide, or peptide.

[0025] The term “identical” or percent “identity,” in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (e.g, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identity over a specified region, e.g., of an entire polypeptide sequence or an individual domain thereof), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using a sequence comparison algorithm or by manual alignment and visual inspection. In embodiments, two sequences are 100% identical. In embodiments, two sequences are 100% identical over the entire length of one of the sequences (e.g., the shorter of the two sequences where the sequences have different lengths). In embodiments, identity may refer to the complement of a test sequence. In embodiments, the identity exists over a region that is at least about 10 to about 100, about 20 to about 75, about 30 to about 50 amino acids or nucleotides in length. In embodiments, the identity exists over a region that is at least about 50 amino acids or nucleotides in length, or more preferably over a region that is 100 to 500, 100 to 200, 150 to 200, 175 to 200, 175 to 225, 175 to 250, 200 to 225, 200 to 250 or more amino acids or nucleotides in length.

[0026] As used herein, the term “immune cells” refers to any cells of the immune system that are involved in mediating an immune response. Non-limiting examples of immune cells include a T lymphocyte, B lymphocyte, natural killer (NK) cell, macrophage, eosinophil, mast cell, dendritic cell, neutrophil, or combination thereof. In some aspects, an immune cell expresses CD3. In certain aspects, the CD3 -expressing immune cells are T cells (e.g., CD4+T cells or CD8+T cells). In some aspects, an immune cell that can be targeted with a targeting moiety (e.g., anti-CD3) comprises a naive CD4+T cell. In some aspects, an immune cell comprises a memory CD4+T cell. In some aspects, an immune cell comprises an effector CD4+T cell. In some aspects, an immune cell comprises a naive CD8+T cell. In some aspects, an immune cell comprises a memory CD8+T cell. In some aspects, an immune cell comprises an effector CD8+T cell. In some aspects, an immune cell is a dendritic cell. Incertain aspects, a dendritic cell comprises a plasmacytoid dendritic cell (pDC), a conventional dendritic cell 1 (cDCl), a conventional dendritic cell 2 (cDC2), inflammatory monocyte derived dendritic cells, Langerhans cells, dermal dendritic cells, lysozyme-expressing dendritic cells (LysoDCs), Kupffer cells, or any combination thereof.

[0027] An “immune response,” as used herein, refers to a biological response within a vertebrate against foreign agents, e.g., virus, or abnormal, e.g., cancerous cells, which response protects the organism against these agents and diseases caused by them. An immune response is mediated by the action of one or more cells of the immune system (for example, a T lymphocyte, B lymphocyte, natural killer (NK) cell, macrophage, eosinophil, mast cell, dendritic cell or neutrophil) and soluble macromolecules produced by any of these cells or the liver (including antibodies, cytokines, and complement) that results in selective targeting, binding to, damage to, destruction of, and / or elimination from the vertebrate's body of invading pathogens, cells or tissues infected with pathogens, cancerous or other abnormal cells, or, in cases of autoimmunity or pathological inflammation, normal human cells or tissues. An immune reaction includes, e.g., activation or inhibition of a T cell, e.g., an effector T cell, a Th cell, a CD4+cell, a CD8+T cell, or a Treg cell, or activation or inhibition of any other cell of the immune system, e.g., NK cell. Accordingly, an immune response can comprise a humoral immune response (e.g., mediated by B-cells), cellular immune response (e.g., mediated by T cells), or both humoral and cellular immune responses. In some aspects, an immune response is an “inhibitory” immune response. An “inhibitory” immune response is an immune response that blocks or diminishes the effects of a stimulus (e.g., antigen). In certain aspects, the inhibitory immune response comprises the production of inhibitory antibodies against the stimulus. In some aspects, an immune response is a “stimulatory” immune response. A “stimulatory” immune response is an immune response that results in the generation of effectors cells (e.g., cytotoxic T lymphocytes) that can destroy and clear a target antigen (e.g., tumor antigen or viruses). As used herein, the term “effector” T cells or “TEFF” cells refers to a T cell that can mediate the removal of a pathogen or cell without requiring further differentiation. Thus, effector T cells are distinguished from naive T cells and memory T cells, and these cells often have to differentiate and proliferate before becoming effector cells.

[0028] As used herein, the term “in combination” in the context of the administration of a therapy to a subject refers to the use of more than one therapy for therapeutic benefit.The term “in combination” in the context of the administration can also refer to the prophylactic use of a therapy to a subject when used with at least one additional therapy. The use of the term “in combination” does not restrict the order in which the therapies (e.g., a first and second therapy) are administered to a subject. A therapy can be administered prior to (e.g., 1 minute, 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), concomitantly with, or subsequent to (e.g., 1 minute, 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of a second therapy to a subject which had, has, or is susceptible to, for example, cancer. The therapies are administered to a subject in a sequence and within a time interval such that the therapies can act together. In a particular embodiment, the therapies are administered to a subject in a sequence and within a time interval such that they provide an increased benefit than if they were administered otherwise. Any additional therapy can be administered in any order with the other additional therapy.

[0029] As used herein, the term “memory” T cells refer to a subset of T cells that have previously encountered and responded to their cognate antigen. In some aspects, the term is synonymous with “antigen-experienced” T cells. In some aspects, memory T cells can be effector memory T cells or central memory T cells. In some aspects, the memory T cells are tissue-resident memory T cells. As used herein, the term “tissue-resident memory T cells” or “TRM cells” refers to a lineage of T cells that occupies tissues (e.g., skin, lung, gastrointestinal tract) without recirculating. TRM cells are transcriptionally, phenotypically and functionally distinct from central memory and effector memory T cells which recirculate between blood, the T cell zones of secondary lymphoid organs, lymph and nonlymphoid tissues. One of the roles of TRM cells is to provide immune protection against infection in extra lymphoid tissues.

[0030] A “naive” T cell refers to a mature T cell that remains immunologically undifferentiated (i.e., not activated). Following positive and negative selection in the thymus, T cells emerge as eitherCD4+or CD8+naive T cells. In their naive state, T cells express L- selectin (CD62L+), IL-7 receptor-a (IL-7R-a), and CD 132, but they do not express CD25, CD44, CD69, or CD45RO. As used herein, “immature” can also refer to a T cell whichexhibits a phenotype characteristic of either a naive T cell or an immature T cell, such as a TSCM cell or a TCM cell. For example, an immature T cell can express one or more of L- selectin (CD62L+), IL-7Ra, CD 132, CCR7, CD45RA, CD45RO, CD27, CD28, CD95, CXCR3, and LFA-1. Naive or immature T cells can be contrasted with terminal differentiated effector T cells, such as TEM cells and TEFF cells.

[0031] As used herein, “partial reprogramming” refers to a process of reprogramming without reaching a totipotent stem cell state or a pluripotent stem cell state (iPS cell). Thus, partial preprogramming is any reprogramming that is not complete reprogramming. “Partial” or “incomplete” or “transient” reprogramming is reprogramming that is not complete reprogramming, e.g., as compared to a cell that has been completely reprogrammed to an iPS cell. In certain embodiments, partial reprogramming is reprogramming carried out from about 1 to about 20 days. In certain embodiments, partial reprogramming is reprogramming carried out for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or about 25 days.

[0032] The terms “patient” or “individual” or “subject” are used interchangeably herein, and refers to a mammalian subject to be treated, with human patients being preferred. In some cases, the methods of the disclosure find use in experimental animals, in veterinary application, and in the development of animal models for disease, including, but not limited to, rodents including mice, rats, and hamsters, and primates.

[0033] As used herein, the term “permissive temperature” refers to any temperature at which the activity of a temperature-sensitive agent of the present disclosure is induced. Typically, a permissive temperature is not the normal body temperature of a subject. The normal body temperature of a human subject is about 37° C±0.5° C. Depending on the temperature-sensitive agent, a permissive temperature may be a temperature that is higher or lower than the normal body temperature of a subject. In some aspects, the permissive temperature for the temperature-sensitive agent ranges from 30° C. to 42° C. In some embodiments, the permissive temperature is from about 31° C to about 35° C., or 32° C. to 34° C. (33° C.±1.0° C ). In some preferred embodiments, the permissive temperature is 35° C.±0.5° C. It follows that in some embodiments, the non-permissive temperature for the temperature-sensitive self-replicating SeVs of the present disclosure is above 36° C. In some embodiments, the non-permissive temperature is 39° C.±0.5° C. In some embodiments, the non-permissive temperature is 38° C.±0.5° C.

[0034] “Percentage of sequence identity” is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. In embodiments, the percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.

[0035] For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. In embodiments, when using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Preferably, default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.

[0036] A “comparison window” refers to a segment of any one of the number of contiguous positions (e.g., least about 10 to about 100, about 20 to about 75, about 30 to about 50, 100 to 500, 100 to 200, 150 to 200, 175 to 200, 175 to 225, 175 to 250, 200 to 225, 200 to 250) in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. In embodiments, a comparison window is the entire length of one or both of two aligned sequences. In embodiments, two sequences being compared comprise different lengths, and the comparison window is the entire length of the longer or the shorter of the two sequences. In embodiments relating to two sequences of different lengths, the comparison window includes the entire length of the shorter of the two sequences. In embodiments relating to two sequences of different lengths, the comparison window includes the entire length of the longer of the two sequences.

[0037] Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by thesearch for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by manual alignment and visual inspection (see, e.g., Current Protocols in Molecular Biology (Ausubel et al., eds. 1995 supplement)).

[0038] Non-limiting examples of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., Nuc. Acids Res. 25:3389-3402 (1977) and Altschul et al., J. Mol. Biol. 215:403-410 (1990), respectively. BLAST and BLAST 2.0 may be used, with the parameters described herein, to determine percent sequence identity for nucleic acids and proteins. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (NCBI), as is known in the art. An exemplary BLAST algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always < 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. In embodiments, the NCBI BLASTN or BLASTP program is used to align sequences. In embodiments, the BLASTN or BLASTP program uses the defaults used by the NCBI. In embodiments, the BLASTN program (for nucleotide sequences) uses as defaults: a word size (W) of 28; an expectation threshold (E) of 10; max matches in a query range set to 0; match / mismatch scores of 1,-2; linear gap costs; the filter for low complexity regions used; and mask for lookup table only used. In embodiments, the BLASTP program (for amino acid sequences) uses as defaults: a word size(W) of 3; an expectation threshold (E) of 10; max matches in a query range set to 0; the BLOSUM62 matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89: 10915 (1992)); gap costs of existence: 11 and extension: 1; and conditional compositional score matrix adjustment.

[0039] As used herein, the term “pharmaceutically acceptable carrier” refers to an ingredient in a pharmaceutical formulation, other than an active ingredient, which is nontoxic to a subject. A pharmaceutically acceptable carrier includes, but is not limited to, a buffer, excipient, stabilizer, or preservative.

[0040] As used herein, the term “pharmaceutical formulation” or “pharmaceutical composition” refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the formulation would be administered. As used herein, the term “pluripotent” refers to the ability of a cell to form all lineages of the body or soma (i.e., the embryo proper but not the placenta). For example, an embryonic stem cell is a type of pluripotent stem cell that is available to form cells from each of the three germ layers: the ectoderm, the mesoderm and the endoderm. Pluripotency can be determined in part, by assessing the pluripotency characteristics of the cells. Pluripotency characteristics may include, but are not limited to: (i) pluripotent stem cell morphology; (ii) the potential for unlimited self-renewal; (iii) ability to differentiate to all three somatic lineages (ectoderm, mesoderm and endoderm); (iv) teratoma formation consisting of the three somatic lineages; and (v) formation of embryoid bodies consisting of cells from the three somatic lineages; (vi) expression of one or more pluripotent stem cell markers including, but not limited to SSEA1 (mouse only), SSEA3 / 4, SSEA5, TRA1-60 / 81, TRA2-54 (ALP), TRA1-85, GCTM-2, TG343, TRA2-49, CD340, CD326, Podoplanin, and TG30 (CD9); (vii) expression of certain other markers associated with somatic stem cells or early differentiated cells from embryonic stem cells, including, but not limited to, integrin a6pi, CD29, CD133 / prominin, CD140a, CD56, CD73, CD90, CD105, CD30 and / or LD50; (viii) expression of certain pluripotent genes including OCT4, NANOG, SOX2.

[0041] As used herein, a “rejuvenated cell” is one whose cellular functions have been restored. For example, a CTL may have lost its cytotoxic functions. Rejuvenation restores the cellular functions of the CTL allowing it to continue to mount an immune response. Partial reprogramming or cell rejuvenation is a method of using OSKM factors (or alternativereprogramming factors, in the wider context) to revert aged cells to a younger state without completing the reprogramming cycle, thus retaining their cellular identity. See, Simpson, D.J., Olova, N.N. & Chandra, T. Cellular reprogramming and epigenetic rejuvenation. Clin Epigenet 13, 170 (2021). doi.org / 10.1186 / sl3148-021-01158-7. See, also, Ji., S., etal. for a review of cell rejuvenation (Ji, S., Xiong, M., Chen, H. et al. Cellular rejuvenation: molecular mechanisms and potential therapeutic interventions for diseases. Sig Transduct Target Ther 8, 116 (2023). doi.org / 10.1038 / s41392-023-01343-5).

[0042] As used herein, “reprogramming” refers to the process of erasing and / or reestablishing epigenetic modifications acquired during mammalian cell development or in cell culture. For example, muscle cells can be reprogrammed to a neuron. Reprogramming is not intrinsically related to aging and rejuvenation (see e.g., Takahashi et al., Cell (2007) 131, 861-872).

[0043] As used herein, the term “reprogramming factors” refers to any protein, polypeptide, amino acid, mRNA, DNA or small molecule capable of erasing and / or reestablishing epigenetic modifications acquired during mammalian cell development or in cell culture. Reprogramming factors can alter the differentiational state of a cell. Such reprogramming factors can include, but are not limited to the transcription factors, OCT4 (or OCT3 / 4), SOX3, KLF4 and C-MYC, discovered by Yamanaka and colleagues (see, e.g., Takahashi and Yamanaka, 2006, Cell, 136, 364-377) which are referred to herein as “OSKM” or the “Yamanaka factors.” Reprogramming factors refers to other factors that might alter the differentiation state of a cell, or that might enhance or alter the efficiency of cell reprogramming. Such factors are known in the art. Exemplary reprogramming factors are described in Feng et al. 2009, Cell Stem Cell Review, 4:301-313.

[0044] “Single-chain Fv” also abbreviated as “sFv” or “scFv” are antibody fragments that comprise the VH and VL antibody domains connected into a single polypeptide chain. Preferably, the sFv polypeptide further comprises a polypeptide linker between the VH and VL domains which enables the sFv to form the desired structure for antigen binding. For a review of the sFv, see Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315 (1994). “Functional fragments” of the antibodies of the disclosure comprise a portion of an intact antibody, generally including the antigen binding or variable region of the intact antibody or the Fcregion of an antibody which retains or has modified FcR binding capability. Examples of antibody fragments include linear antibody, single-chain antibody molecules and multispecific antibodies formed from antibody fragments.

[0045] As used herein, “transiently expressing” or “transient expression” or the like means expression or causing expression of one or more of the Yamanaka factors so as to achieve partial reprogramming of one or more cells (i.e., where transformation to an iPS cell or totipotent cell is not achieved).

[0046] As used herein, the term “T cell” or “T-cell” refers to a type of lymphocyte that matures in the thymus. T cells play an important role in cell-mediated immunity and are distinguished from other lymphocytes, such as B cells, by the presence of a T-cell receptor on the cell surface. T-cells include all types of immune cells expressing CD3, including T-helper cells (CD4+cells), cytotoxic T-cells (CD8+cells), natural killer T-cells, T-regulatory cells (Treg), and gamma-delta T cells.

[0047] As used herein, the term “totipotent” refers to the ability of a cell to give rise to any cell type found in an embryo as well as extra-embryonic (placenta) cells.

[0048] As used herein, “treating” or “treatment” of a condition, disease or disorder or symptoms associated with a condition, disease or disorder refers to an approach for obtaining beneficial or desired results, including clinical results. Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of condition, disorder or disease, stabilization of the state of condition, disorder or disease, prevention of development of condition, disorder or disease, prevention of spread of condition, disorder or disease, delay or slowing of condition, disorder or disease progression, delay or slowing of condition, disorder or disease onset, amelioration or palliation of the condition, disorder or disease state, and remission, whether partial or total. “Treating” can also mean inhibiting the progression of the condition, disorder or disease, slowing the progression of the condition, disorder or disease temporarily, although in some instances, it involves halting the progression of the condition, disorder or disease permanently.

[0049] Where any nucleotide or amino acid sequence is specifically referred to by an Accession number, the sequence is incorporated herein by reference. Information associatedwith the accession number, such as identification of signal peptide, extracellular domain, transmembrane domain, promoter sequence and translation start, is also incorporated herein in its entirety by reference.

[0050] Ranges: throughout this disclosure, various aspects of the disclosure can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.

[0051] Any compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.BRIEF DESCRIPTION OF THE DRAWINGS

[0052] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.

[0053] FIG. 1 is a schematic representation showing the temperature-sensitive and infection-traceable SeV vectors. The schematic structure of the conventional SeV vectors (CytoTune-iPS 2.0) and the modified SeV vectors are shown. The SeV-KLF4 / TS vector in the CytoTune-2.0 was changed to SeV-KLF4 / TS12, added GFP to SeV-KOS / TS12 (SeV- KOS-GFP / TS12), and OFP to SeV-CMYC / TS15 (SeV-CMYC-OFP / TS15).

[0054] FIGS. 2A and 2B are images demonstrating that stimulation and spinoculation improve SeV vector infection efficiency. FIG. 2A: Representative phasecontrast and SeV-GFP image of CTLs on day 3 after SeV-GFP infection. Scale bars, 100 pm. FIG. 2B: Representative phase-contrast and SeV-GFP image of stimulated CTLs on day 3 after SeV-GFP infection and spinoculation. Scale bars, 100 pm.

[0055] FIGS. 3A-3D are FACS plots demonstrating the rapid removal of modified SeV vectors by increasing incubation temperature. FIG. 3A: GFP'OFP' CTLs before themodified SeV vectors infection. FIG. 3B: GFP and OFP expression in CTLs on day 2 after infection with the modified SeV vectors. FIG. 3C: GFP and OFP expression in CTLs that continue to be cultured at 35°C. (D) GFP and OFP expression in CTLs after one week of incubation at 37°C.

[0056] FIGS. 4A and 4B are phase-contrast images demonstrating that the modified SeV vectors can generate iPSCs. FIG. 4A: Representative phase-contrast image of HDF- derived iPSC on day 14 after infection with the modified SeV vectors and incubation at 35°C. Scale bars, 200 pm. FIG. 4B: Representative phase-contrast image of CTL-derived iPSC on day 14 after infection with the modified SeV vectors and incubation at 35°C. Scale bars, 200 pm.

[0057] FIGS. 5A and 5B are graphs demonstrating that IL-7 and IL- 15 improve CTL survival. FIG. 5A: Expansion fold change of stimulated CTLs of young and older origin cultured in IL-2 containing medium. FIG. 5B: Expansion fold change of stimulated CTLs of young and older origin cultured in IL-7 and IL-15 containing medium.

[0058] FIG. 6 is a schematic showing an experimental design for CTL rejuvenation. CTL rejuvenation protocol using CD3 / CD28 stimulated CTLs and the modified SeV vectors. Transient reprogramming was performed using NutriStem and iMatrix-511 at an incubation temperature of 35°C.

[0059] FIG. 7 is a series of phase contrast images demonstrating that OSKM+CTLs show morphological change during reprogramming. Representative phase-contrast image of CTLs on day 7,9, and 11 after infection with the modified SeV vectors and incubation at 35°C. Upper row: CTLs after SeV-OSKM infection, lower row: CTLs after SeV-Mock infection. Scale bars, 100 pm.

[0060] FIGS. 8A-8D are a series of FACS plots and graphs demonstrating that only GFP+OFP+CTLs can survive under iPSC culture conditions. FIG. 8A: GFP and OFP expression of CTLs on day 9 after SeV-OSKM infection. FIG. 8B: Percentage of GFP+OFP+cells in CTLs at day 7, 9, and 11 after SeV-OSKM infection. FIG. 8C: Percentage of GFP' OFP' cells in CTLs at day 7, 9, and 11 after SeV-OSKM infection. FIG. 8D: GFP and OFP expression of CTLs on day 9 after SeV-Mock infection.

[0061] FIGS. 9A-9D are a series of FACS plots and graphs demonstrating that OSKM+CTLs express pluripotency markers during reprogramming. FIG. 9A: TRA-1-60 andSSEA4 expression of GFP+OFP+CTLs on day 9 after SeV-OSKM infection. FIG. 9B: Percentage of TRA-l-60+SSEA4+cells in GFP+OFP+CTLs at day 7, 9, and 11 after SeV- OSKM infection. FIG. 9C: Percentage of TRA-1-60-SSEA4- cells in GFP+OFP+CTLs at day 7, 9, and 11 after SeV-OSKM infection. FIG. 9D: TRA-1-60 and SSEA4 expression of CTLs on day 9 after SeV-Mock infection.

[0062] FIGS. 10A-10D are a series of FACS plots and graphs demonstrating that OSKM+CTLs transiently lose their CD8a expression during reprogramming. FIG. 10A: CD4 and CD8a expression of GFP+OFP+CTLs on day 9 after SeV-OSKM infection. FIG. 10B: Percentage of CD4’CD8a’ cells in GFP+OFP+CTLs at day 7, 9, and 11 after SeV- OSKM infection. FIG. 10C: Percentage of CD4’CD8a+cells in GFP+OFP+CTLs at day 7, 9, and 11 after SeV-OSKM infection. FIG. 10D: CD4 and CD8a expression of CTLs on day 9 after SeV-Mock infection.

[0063] FIGS. 11A-11C are a series of FACS plots showing the cell sorting strategy of transiently reprogrammed CTLs. FIG. 11 A: GFP and OFP expression of CTLs on day 9 after SeV-OSKM infection. FIG. 11B: TRA-1-60 and SSEA4 expression of GFP+OFP+CTLs. TRA-l-60+SSEA4+cells were sorted as OSKM+TRA-1-60+SSEA4+cells, and TRA-1- 60’ SSEA4’ cells as OSKM+TRA-1-60’SSEA4’ cells. FIG. 11C: TRA-1-60 and SSEA4 expression of GFP’OFP’ CTLs.

[0064] FIG. 12 shows a series of phase contrast images and FACS plots demonstrating that the OSKM+CTLs returned to their original morphology after stopping reprogramming. The pictures in the upper row show a representative phase-contrast image of CTLs after 7 days of increasing the incubation temperature from 35 °C to 37°C. Lower row shows their GFP and OFP expression. Scale bars, 100 pm.

[0065] FIG. 13 shows a series of FACS plots demonstrating that OSKM+TRA-1-60’ SSEA4’ CTLs recover CD8a expression after stopping reprogramming. Upper row shows TRA-1-60 and SSEA4 expression of CTLs on day 9. Lower row shows CD4 and CD8a expression.

[0066] FIG. 14 is a series of graphs demonstrating that O SKM+TRA- 1-60’S SEA4’ CTLs show markedly higher cell proliferation after stopping reprogramming. Expansion fold change of CTLs after stopping reprogramming. The title of each graph is the date when thecells were sorted and stopped reprogramming. Cells were stimulated approximately every 2 weeks after the reprogramming was stopped.

[0067] FIG. 15 is a series of FACS plots demonstrating that OSKM+TRA-1-60‘SSEA' CTLs have a lower proportion of senescent CTLs. Differentiation markers (CD45RA and CCR7), senescence markers (CD57 and KLRG1), and exhaustion markers (TIM3 and LAG3) expression of CTLs 32 days after stopping reprogramming at day 9 after SeV infection.

[0068] FIG. 16 is a graph demonstrating that OSKM+TRA-1-60 SSEA4‘ CTLs show markedly higher cell proliferation after stopping reprogramming Expansion fold change of CTLs after stopping reprogramming at day 9 after SeV infection. Cells were stimulated every week after the reprogramming was stopped.

[0069] FIG. 17 is a series of FACS plots demonstrating that OSKM+TRA-1-60'SSEA' CTLs have a lower proportion of senescent CTLs. Differentiation markers (CD45RA and CCR7), senescence markers (CD57 and KLRG1), and exhaustion markers (TIM3 and LAG3) expression of CTLs 35 days after stopping reprogramming at day 9 after SeV infection.

[0070] FIG. 18 is a series of graphs demonstrating that O SKM+TRA- 1-60'S SEA4'CTLs show higher mitochondrial activity. FIG. 18A: Oxygen consumption rate (OCR) profiles measured by Seahorse of indicated cell lines. Oligomycin, FCCP and rotenone / antimycin were injected at indicated time points to evaluate mitochondrial capacity. n=6 for each point. FIG. 18B: Spare respiratory capacity of 6 clones each of CTLs analyzed by Seahorse. n= of each point and n=6 for each clone. **P<0.01, *** <0.001

[0071] FIG. 19 is a schematic showing an experimental design for HDF rejuvenation. HDF rejuvenation protocol using the modified SeV vectors. The SeV-infected HDFs are sorted on day 2 to select GFP+OFP+cells and on day 7 to select CD13+SSEA5‘ and CD13' SSEA5+cells. Transient reprogramming is performed using Nutristem and iMatrix-511 at an incubation temperature of 35°C.

[0072] FIGS. 20A-20D are a series of phase contrast images and FACS plots showing the Sorting SeV-infected HDFs on day 2 and day 7. FIG. 20A: GFP and OFP expression in HDFs on day 2 after infection with the modified SeV vectors. FIG. 20B: Representative phase-contrast image of GFP+OFP+HDFs on day 7. Scale bars, 200 pm. FIG.20C: Representative phase-contrast image of SeV-Mock infected HDF on day 7. Scale bars, 200 pm. FIG. 20D: CD13 and SSEA5 expression in GFP+OFP+HDFs on day 7.

[0073] FIG. 21 is a series of phase contrast of OSKM+HDFs showing morphological change. Representative phase-contrast images of HDFs on day 8 after the SeV-infection and incubation at 35°C (1 day after the 2nd sorting). Scale bars, 200 pm.

[0074] FIGS. 22A and 22B are plots demonstrating that senescent dermal fibroblasts show higher MFI ratio of SA-P-gal staining. FIG. 22A: SA- / 3 -gal intensity of HDF analyzed by CellEvent. The intensity was calculated as the ratio of unstained to stained MFI for CellEvent. FIG. 22B: SA-P-gal intensity re-measured by CellEvent after three passages of the sample in FIG. 22A.

[0075] FIG. 23 is a series of phase contrast images and plots demonstrating that OSKM+HDFs show lower MFI ratio of P-gal staining. Representative phase-contrast image and SA- / 3 -gal intensity analyzed by CellEvent for OSKM+CD13 SSEA5+,OSKM+CD13+SSEA5‘, and Mock-infected HDFs. Scale bars, 200 pm.

[0076] FIG. 24 is a graph demonstrating that OSKM+HDFs show lower IL-6 expression. qPCR result of GAPDH normalized IL-6 expression of OSKM+CD13 SSEA5+, OSKM+CD13+SSEA5‘, and Mock-infected HDFs. ****P<0.0001.

[0077] FIGS. 25A, 25B are a series of graphs and a schematic demonstrating that OSKM+CTLs showed high central memory population. FIG. 25A: Flow cytometry analysis showing the percentage of CTLs at each stage of differentiation on sequential days after day 2 post-infection with SeV-OSKM. Central memory is increasing day by day, which suggests that the CTL containing OSKM has the potential to rejuvenate. FIG. 25B: Flow cytometry analysis of the percentage of CTLs in each differentiation stage on day 5 post-infection with SeV vectors. Compared to the control groups infected with SeV-GFP or SeV-OFP, the SeV- OSKM group exhibited a higher percentage of central memory (CM) and naive (N) cells.

[0078] FIG. 26 shows a series of graphs and a plot demonstrating that SSEA4 and CD8a enable the classification of CTLs at different reprogramming stages. To examine the changes in cellular characteristics of CTLs during reprogramming, CD8a and SSEA4 expression was analyzed daily using flow cytometry up to day 9 after OSKM introduction. All analyzed cells were GFP+OFP+, indicating OSKM positivity. Group 1 decreased inproportion over time, Group 2 initially increased and then decreased, while Group 3 steadily increased. These findings demonstrate that CD8a and SSEA4 expression effectively visualize the progression of reprogramming.

[0079] FIG. 27 is a schematic showing a modified CTL partial reprogramming protocol. It was found that sorting CTLs on day 5 and raising the temperature to remove SeV would produce better results. To facilitate faster SeV removal, the incubator temperature is raised to 38°C after cell sorting, instead of 37°C.

[0080] FIG. 28 is a series of plots demonstrating an SeV-infected CTL sorting strategy. Cells infected with SeV-OSKM were selected, identified by GFP and OFP positivity, and further classified them into three groups based on CD8a and SSEA4 expression patterns. This sorting strategy allowed for a more detailed observation of cells at each stage of reprogramming.

[0081] FIG. 29 is a graph demonstrating that DNA methylation age decreased progressively with the advancement of reprogramming. DNA methylation age of each group on day 5 post-SeV infection was estimated using BLUP clock (Zhang, Q., Genome Med, 2019). DNA methylation age significantly decreased in every group. * <0.05, **P<0.01, *** <0.005, ****P<0.001.

[0082] FIG. 30 shows a plot and a series of graphs demonstrating that Grl remained Grl even after cell sorting and temperature elevation. Cells classified as Group 1 on day 5 post-SeV-OSKM infection were sorted, and their CD8a and SSEA4 expression patterns were monitored over the following six days. During the first two days (days 6 and 7), approximately 10% of the cells transitioned to Group 2, but nearly all cells remained in Group 1 thereafter. This indicates that very few cells advanced in reprogramming after sorting and temperature elevation, demonstrating the effective suppression of reprogramming progression by temperature elevation.

[0083] FIG. 31 shows a plot and a series of graphs demonstrating that many Gr2 cells transitioned to Gr3 after cell sorting and temperature elevation. Many cells in Group 2 transitioned to Group 3 even after temperature elevation, suggesting that halting reprogramming at the Group 2 stage is challenging once cells have reached this point.

[0084] FIG. 32 shows a plot and a series of graphs demonstrating that Gr3 remained Gr3 after cell sorting and temperature elevation. As expected, cells that had reached Group 3 rarely reverted to Group 2 or Group 1.

[0085] FIG. 33 is a series of plots demonstrating that Grl regained its original CTL characteristics. By day 7, Group 1 cells became SeV (GFP and OFP) negative, with nearly all cells exhibiting a CD8a SSEA4 phenotype. In contrast, more than half of the Group 2 cells retained SeV, and a higher proportion of CD8a and SSEA4+cells were observed.

[0086] FIG. 34 is a series of graphs demonstrating that Grl showed the highest level of cell proliferation among the groups. CTLs from any donor exhibited higher proliferative capacity in Group 1 compared to Group 2 or the control. The results showed a faster cell proliferation rate compared to the previous method, which stopped reprogramming on Day 9.

[0087] FIG. 35 is a series of graphs demonstrating that Grl secreted higher concentrations of IFNy and Perforin compared to the control. The secretion levels of IFNy and Perforin, key cytokines for CTL function, were compared 25 days after SeV infection following CD3 / CD28 stimulation. In CTLs from all four donors, Group 1 exhibited significantly higher secretion of these cytokines compared to the control. *P<0.05, **P<0.01, ***P<0.005, ****P<0.001.

[0088] FIG. 36 is a series of graphs demonstrating that Grl showed higher mitochondrial function compared to the control. Mitochondrial function was compared using the Seahorse assay (same as Figure 18). Group 1 exhibited higher OCR (oxygen consumption rate) and spare respiratory capacity compared to the control. * <0.05, **P<0.01, ***P<0.005, ****P<0.001.

[0089] FIG. 37 is a plot and a series of graphs demonstrating that reprogramming progression was characterized by the loss of CD13 and the induction of SSEA5. To examine the changes in cellular characteristics of HDFs during reprogramming, CD 13 and SSEA5 expression was analyzed daily using flow cytometry up to day 12 after OSKM introduction. All analyzed cells were GFP+OFP+, indicating OSKM positivity. Group 1 decreased in proportion over time, Group 2 initially increased and then decreased, and Group 3 steadily increased. These results demonstrate that CD13 and SSEA5 expression effectively visualize the progression of reprogramming.

[0090] FIG. 38 is a schematic representation of a modified HDF partial reprogramming protocol. Based on extensive optimization of conditions, cell sorting and temperature elevation are performed on day 7. The incubator temperature is raised to 38°C after cell sorting, instead of 37°C.

[0091] FIG. 39 is a series of photographs of HDFs and plots showing an SeV- infected HDF sorting strategy. Similar to the CTL protocol, HDFs were processed on day 7 by selecting GFP+OFP+cells, then sorting them into three groups (Grl, Gr2, and Gr3), and increasing the temperature to 38°C for SeV removal.

[0092] FIG. 40 is a graph demonstrating that DNA methylation age decreased progressively with the advancement of reprogramming. DNA methylation age of each group on day 5 post-SeV infection was estimated using Horvath’s clock (Horvath, S., Genome Biol, 2013). DNA methylation age significantly decreased in every group, and Group 3 showed the greatest decrease in DNA methylation age. *P<0.05, **P<0.01, ***P<0.005, ****P<0.001.

[0093] FIG. 41 is a series of photographs of OSKM+HDFs showing significant morphological change. Representative images of cell morphology for each group one day after sorting (day 8 post-SeV infection). As reprogramming progresses from Group 1 to Group 3, cell morphology shifts from the spindle-shaped bodies characteristic of the original HDFs to smaller, more rounded cell bodies.

[0094] FIG. 42 is a series of plots and photographs demonstrating that Grl cells were CD I 3 SSEA5 at day 7 after cell sorting. The cell morphology and the expression of GFP / OFP and CD13 / SSEA5 were compared and detected by flow cytometry across groups at day 7 after cell sorting. Although all groups contained a certain proportion of GFP / OFP- positive cells, Group 1 had the lowest percentage of GFP / OFP-positive cells, with nearly all cells being CD13+SSEA5 . In contrast, Groups 2 and 3 still contained a noticeable proportion of CD 13- cells.

[0095] FIG. 43 is a series of plots and photographs demonstrating that all groups fully regained the original characteristics of HDFs by day 21. 21 days after SeV infection (14 days after cell sorting and temperature elevation), all groups (Grl, Gr2, and Gr3) became SeV-negative, and all cells exhibited a CD13+SSEA5- phenotype. These results indicate that partial reprogramming is reversible under these experimental conditions.

[0096] FIG. 44 is a series of plots and photographs demonstrating that senescence- Associated (SA) P-gal intensity was lower in OSKM+HDFs than control. SA-Pgal intensity was compared using CellEvent on day 28 post-SeV infection (14 days after cell sorting and temperature elevation). All groups showed lower intensity than the control, with Group 1 exhibiting the lowest value.

[0097] FIG. 45 is a graph demonstrating that all groups showed relatively low IL-6 expression than control. Expression of the senescence marker IL-6 was quantified by qPCR on day 25 post-SeV infection. Notably, Groups 2 and 3 showed a significant reduction compared to the control.

[0098] FIG. 46 is a series of photographs showing iPSC generation from Human Aortic Endothelial Cell (HAEC). Since there were no prior reports of directly generating iPSCs from HAECs (likely due to the extreme difficulty of reprogramming), it was first tested whether iPSCs could be generated from HAECs using the vector described herein. Although the reprogramming efficiency was considerably lower compared to CTLs and HDFs, iPSCs were generated from all four donor-derived cells. This demonstrates the high gene delivery and reprogramming efficiency of the vector.

[0099] FIG. 47 is a plot and a series of graphs demonstrating that most human aortic endothelial cells (HAECs) did not become SSEA4-positive during the reprogramming process. CD31 and SSEA4 expression patterns were tracked in GFP+OFP+cells during the 12-day reprogramming process of HAECs using the pluripotency marker SSEA4 and the endothelial marker CD31. Reflecting the very low reprogramming efficiency, most cells advanced only to Group 2 and did not reach Group 3 (CD3 I SSEA4 ).

[0100] FIG. 48 is a schematic representation showing an HAEC partial reprogramming protocol. A protocol was developed largely similar to that used for HDFs. During the partial reprogramming process, only EC medium (a commercially available human endothelial cell culture medium) was used, with cell sorting and temperature elevation performed on day 7.

[0101] FIG. 49 is a series of photographs of HAEC cultures and plots showing the SeV-infected HAEC sorting strategy. Similar to the HDF protocol, GFP+OFP+cells were selected on day 7 post-SeV infection, and were classified into Grl, Gr2, and Gr3 based on CD31 and SSEA4 expression, replated them onto culture dishes, and started culturing at 38°C.

[0102] FIG. 50 is a series of photographs of OSKM+HAEC cultures demonstrating that DNA methylation age decreased progressively with the advancement of reprogramming. DNA methylation age of each group on day 5 post-SeV infection was estimated using Horvath’s clock (Horvath, S., Genome Biol, 2013). DNA methylation age significantly decreased in every group. * <0.05, ** <0.01, *** <0.005, ****P<0.001.

[0103] FIG. 51 is a series of photographs of 0SKM+HAEC cultures demonstrating the morphological changes. Representative images of cell morphology for each group one day after sorting (day 8 post-SeV infection). As reprogramming progresses from Group 1 to Group 2, the cells became smaller and more rounded in shape.

[0104] FIG. 52 is a series of plots demonstrating that Grl and Gr2 regained their original HAEC characteristics. The expression of GFP / OFP and CD31 / SSEA4 detected by flow cytometry across groups at day 7 after cell sorting was compared. Although all groups contained a certain proportion of GFP / OFP-positive cells, both Group 1 and Group 2 were entirely CD31+and SSEA4 , same as the control.

[0105] FIG. 53 is a series of plots demonstrating that all groups were SeV-negative by 14 days after sorting. By day 21 (14 days after sorting and temperature elevation), SeV was removed in HAECs. The expression of CD31 and SSEA4 remained unchanged from day 14.

[0106] FIG. 54 is a series of graphs demonstrating that OSKM+HAECs showed higher cell proliferation compared to the control. In HAECs from three out of four donors, OSKM+HAECs, particularly those in Group 2, exhibited higher proliferative capacity. This indicates that the OSKM introduction and their partial reprogramming improved the cellular function of HAECs.

[0107] FIG. 55 is a graph demonstrating that OSKM+HAECs showed lower senescence marker expression than control. On day 14 (7 days post-sorting and temperature elevation), IL-6 expression, representative senescence markers in HAECs, was quantified and compared using qPCR. In all donors, Groups 1 and 2 showed significantly lower IL-6 expression compared to the control.DETAILED DESCRIPTION

[0108] Provided herein, are methods to rejuvenate cell function by transiently overexpressing four genes, OCT4, SOX2, KLF4, and CMYC (OSKM), used to generate induced pluripotent stem cells (iPS cells), into human somatic cells using temperaturesensitive Sendai virus (SeV) vectors. Rejuvenated cells are obtained much faster than the conventional methods which rely on generating iPS cells and then differentiating the iPS cells to produce rejuvenated cells.

[0109] SeV vectors are an RNA minus-stranded viral vector with no risk of genome integration, and it has better gene introduction efficiency compared to other viral vectors. As disclosed herein, compositions include modified temperature- sensitive SeV vector for OSKM expression. This SeV vector set can be completely removed in about a week without affecting the cells by raising the cell culture temperature to 38°C, the typical cell culture temperature at any time. Furthermore, since temperature-sensitive SeV vectors are utilized, rejuvenated cells have no risk of tumor formation because the transgene can be completely removed by changing the cell culture temperature to 38°C. Therefore, this technology is considered feasible for clinical application.

[0110] Previous reports have attempted to rejuvenate human somatic cells by introducing OSKM using different vectors. The method using lentiviral vectors (DOI: 10.7554 / eLife.71624) is not suitable for clinical application because the viral genome is integrated into the host genome. In addition, this method has relatively low gene introduction efficiency depending on the cell type. The mRNA-based methods (D01: 10.1038 / s41467-020- 15174-3) require multiple transfection cycles, which is a complicated procedure, and frequent transfection is stressful for the cells. The method using commercially available SeV vector kit, (PCT / US2021 / 060650) is difficult to completely remove the SeV vectors after rejuvenation of the cells.

[0111] CELL REJUVENATION

[0112] Aging of mammalian species, such as humans or mice, has traditionally been regarded as an irreversible process. This is largely due to the commonly held belief that certain tissues, cells, and structures in these organisms are irreplaceable (Galkin F., et al., (2019). Reversibility of irreversible aging. Ageing Research Reviews, 49, 104-114). For example, most adult neurons terminally differentiate during development, remain in the body for the entire life of an organism, and cannot be naturally replaced. In some non-mammalian species or in young mammals, certain body parts or organs can be regenerated or regrown in almost identical structure as the lost tissue (e.g., axolotl extremities (Haas, B. J., & Whited, J. L. (2017). Advances in decoding axolotl limb regeneration. Trends in Genetics, 33(8), 553— 565. 10.1016 / j .tig.2017.05.006) and newborn murine heart tissue (Bryant, D. M. et al. (2015). A systematic analysis of neonatal mouse heart regeneration after apical resection. Journal of Molecular and Cellular Cardiology, 79, 315-318. 10.1016 / j.yjmcc.2014.12.011). However, adult humans lack sustained cross-tissue regenerative capacity.

[0113] This notion of irreversibility has recently been challenged by a series of findings. With the in vivo ectopic expression of Oct4, Sox2, and Klf4-three of the four Yamanaka reprogramming factors (Takahashi K., & Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell, 126(4), 663-676. 10.1016 / j.cell.2006.07.024) -axon regeneration after eye injury has been achieved. This strategy also allows mice to regain eyesight lost as a result of aging or glaucoma (Lu Y., et al. (2020). Reprogramming to recover youthful epigenetic information and restore vision. Nature, 588(7836), 124-129. 10.1038 / s41586-020-2975-42020). In addition, a drug cocktail has shown potential for thymus regeneration, further challenging the idea of unidirectional aging (Fahy, G. M., et al. (2019). Reversal of epigenetic aging and immunosenescent trends in humans. Aging Cell, 18(6), el3028. 10.1111 / acel.13028).

[0114] To recapitulate this effect without the introduction of complex microscopic procedures, scientists discovered four critical “reprogramming factors” (Yamanaka factors), which when expressed in somatic cells, could effectively reverse the developmental status to that of early embryos, generating induced pluripotent stem cells (iPSCs) (Takahashi, K., et al. (2007). Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell, 131(5), 861-872. 10.1016 / j .cell.2007.11.019; Takahashi et al., 2006). When epigenetic clocks were applied to iPSC samples, low epigenetic ages around zero were predicted (Horvath, S. (2013). DNA methylation age of human tissues and cell types. Genome Biology, 14(10), R115. 10.1186 / gb-2013-14-10-rl 15; Petkovich, D. A., et al. (2017). Using DNA methylation profiling to evaluate biological age and longevity interventions. Cell Metabolism, 25(4), 954-960 e956. 10.1016 / j. cmet.2017.03.016). Several clock models — Horvath mul titissue (Horvath S., 2013), Weidner 99 CpG (Lin, Q., et al. (2016). DNA methylation levels at individual age-associated CpG sites can be indicative for life expectancy. Aging, 8(2), 394- 401. 10.18632 / aging.100908), Skin & Blood (Horvath, S., et al. (2018). Epigenetic clock for skin and blood cells applied to Hutchinson Gilford Progeria Syndrome and ex vivo studies. Aging, 10(7), 1758-1775. 10.18632 / aging.101508), PhenoAge (Levine, M. E., et al. (2018). An epigenetic biomarker of aging for lifespan and healthspan. Aging, 10(4), 573-591. 10.18632 / aging.101414 [018), Hannum blood (Hannum, G., et al. (2013). Genome-wide methylation profiles reveal quantitative views of human aging rates. Molecular Cell, 49(2), 359-367. 10.1016 / j.molcel.2012.10.016), Weidner 3 CpG clock (Weidner, C., et al. (2014). Aging of blood can be tracked by DNA methylation changes at just three CpG sites. Genome Biology, 15(2), R24. 10.1186 / gb-2014-15-2-r24) — reported the application of epigeneticclocks to iPSC reprogramming (Olova, N., et al. (2019). Partial reprogramming induces a steady decline in epigenetic age before loss of somatic identity. Aging Cell, 18(1), el2877. 10.1111 / acel.12877). Almost all clocks showed considerable epigenetic age decreases compared with dermal fibroblasts used as the source of fully reprogrammed iPSCs. On the contrary, the clocks exhibited considerable variability in the actual epigenetic age of iPSCs, which ranged from -60 to 10 years. Similar characteristics were observed in mice. Five epigenetic clocks were applied to fibroblasts from adult mice and derived iPSCs (Meer, M. V., et al. (2018). A whole lifespan mouse multi-tissue DNA methylation clock. eLife, 7, e40675. 10.7554 / eLife.40675; Petkovich, D. A, et al. (2017). Using DNA methylation profiling to evaluate biological age and longevity interventions. Cell Metabolism, 25(4), 954- 960 e956. 10.1016 / j.cmet.2017.03.016). Three of these clocks showed a remarkable decrease in epigenetic age after reprogramming, while two clocks showed minimal changes. In the case of mice, clocks reported a range of epigenetic ages of the same iPSCs from -1.4 to 3 months. Taken together, most human and mouse clocks reach a general consensus in establishing age reversal that occurs as a result of reprogramming, although consistent predictions of age in these cells across different models remain a challenge.

[0115] Ultimately, these observations are in line with the fact that iPSCs can contribute to the whole new embryo, corroborating reprogramming as a key rejuvenation intervention (Kang, L., et al. (2009). iPS cells can support full-term development of tetrapioid blastocyst-complemented embryos. Cell Stem Cell, 5(2), 135-138.10.1016 / j.stem.2009.07.001). With this in mind, several studies have applied these approaches in vivo. By modulating transient expression of reprogramming factors in the whole body to avoid cells being fully reprogrammed to iPSCs, researchers were able to extend the lifespan of progeria mice and improve tissue repair (Ocampo, A., et al. (2016). In vivo amelioration of age-associated hallmarks by partial reprogramming. Cell, 167(7), 1719— 1733 el712. 10.1016 / j .cell.2016.11.052). A similar approach using adeno-associated virus (AAV) induction achieved the reversal of epigenetic age as well as neuronal regeneration in the retina (Lu, Y., et al, (2020). Reprogramming to recover youthful epigenetic information and restore vision. Nature, 588(7836), 124-129. 10.1038 / s41586-020-2975-4). It has also been reported that reprogramming factor expression in human muscle cells can enhance functional restoration of the muscle stem cell reservoir (Sarkar, T. J., et al. (2020). Transient non-integrative expression of nuclear reprogramming factors promotes multifaceted amelioration of aging in human cells. Nature Communications, 11(1), 1545. 10.1038 / s41467-020-15174-3). Together, these findings strongly support the idea that systemic rejuvenation may occur when reprogramming factors are expressed.

[0116] Reprogramming cells to pluripotency has shown that, in principle, age-related cellular phenotypes can be reversed, including in non-dividing, terminally differentiated cells (Aoi T, Yae K, Nakagawa M, Ichisaka T, Okita K, Takahashi K, Chiba T, Yamanaka S. Generation of pluripotent stem cells from adult mouse liver and stomach cells. Science. 2008;321 :699-702; Simpson, D.J., Olova, N.N. & Chandra, T. Cellular reprogramming and epigenetic rejuvenation. Clin Epigenet 13, 170 (2021). doi.org / 10.1186 / sl3148-021-01158- 7). However, this is based on dedifferentiation, turning cells into a stem-cell like state, as the underlying process. Dedifferentiation is also a process observed in oncogenesis. To avoid the risk of cancer induction another strategy was proposed: epigenetic rejuvenation- where an old cell is made young again without a change of cell identity, i.e. dedifferentiation (Singh PB, Zacouto F. Nuclear reprogramming and epigenetic rejuvenation. JBiosci. 2010;35:315-9; Manukyan M, Singh PB. Epigenetic rejuvenation. Genes Cells. 2012;17:337-431; Rando TA, Chang HY. Aging, rejuvenation, and epigenetic reprogramming: resetting the aging clock. Cell. 2012;148:46-57). Partially reprogrammed cells are such examples, which are isolated between days 3 and 15 during classical human OSKM-induced dedifferentiation and have not yet lost their somatic identity (Tanabe K, Nakamura M, Narita M, Takahashi K, Yamanaka S. Maturation, not initiation, is the major roadblock during reprogramming toward pluripotency from human fibroblasts. Proc Natl Acad Sci USA. 2013;110: 12172-9; Olova N, Simpson DJ, Marioni RE, Chandra T. Partial reprogramming induces a steady decline in epigenetic age before loss of somatic identity. Aging Cell. 2018;18:el2877). Therefore, partial reprogramming is a method of using OSKM factors (or alternative reprogramming factors, in the wider context) to revert aged cells to a younger state without completing the reprogramming cycle, thus retaining their cellular identity.

[0117] In general, the methods embodied herein, utilize a process of partial reprogramming to return the partially reprogrammed cells to a rejuvenated and functioning cell. In certain embodiments, partial reprogramming comprises the transient expression in the cells of reprogramming factors.

[0118] Accordingly, in certain embodiments, a method of rejuvenating a cell comprises reprogramming the cell by infecting the cell with one or more temperature sensitive vectors, wherein the one or more temperature sensitive vectors comprise at least one reprogramming factor comprising OCT4, SOX2, KLF4, CMYC or combinations thereof,incubating the infected cells at a permissive temperature for two or more days wherein the infected cells transiently express one or more reprogramming factors to partially reprogram the cells; terminating reprogramming of the cells prior to the step of forming induced pluripotent stem cells (iPS), thereby, rejuvenating the cell. Various assays, e.g., detection of biomarkers, cell metabolic assays, cell sorting, adherence to a tissue culture plate, etc., can be utilized so that the cells are monitored and not transformed into iPS cells or totipotent cells.

[0119] In certain embodiments, sorting of cells and raising the incubation temperature to remove SeV facilitates faster SeV removal. In certain embodiments the incubation temperature is raised from about 35°C to about 40°C after infection with the SeV vectors embodied herein. In certain embodiments, the incubation temperature is raised to 36°C after infection with the SeV vectors embodied herein. In certain embodiments, the incubation temperature is raised to 37°C after infection with the SeV vectors embodied herein. In certain embodiments, the temperature is raised to 38°C after infection with the SeV vectors embodied herein.

[0120] In certain embodiments, cells are sorted at least from about 1 day to about 20 days after infection (spinoculation) with the SeV vectors embodied herein. In certain embodiments, cells are sorted at least by about 1 day after infection (spinoculation) with the SeV vectors embodied herein. In certain embodiments, cells are sorted at least by about 2 days after infection (spinoculation) with the SeV vectors embodied herein. In certain embodiments, cells are sorted at least by about 3 days after infection (spinoculation) with the SeV vectors embodied herein. In certain embodiments, cells are sorted at least by about 4 days after infection (spinoculation) with the SeV vectors embodied herein. In certain embodiments, cells are sorted at least by about 5 days after infection (spinoculation) with the SeV vectors embodied herein. In certain embodiments, cells are sorted at least by about 6 days after infection (spinoculation) with the SeV vectors embodied herein. In certain embodiments, cells are sorted at least by about 7 days after infection (spinoculation) with the SeV vectors embodied herein. In certain embodiments, cells are sorted at least by about 8 days after infection (spinoculation) with the SeV vectors embodied herein. In certain embodiments, cells are sorted at least by about 9 days after infection (spinoculation) with the SeV vectors embodied herein. In certain embodiments, cells are sorted at least by about 10 days after infection (spinoculation) with the SeV vectors embodied herein. In certain embodiments, cells are sorted at least by about 11 days after infection (spinoculation) with the SeV vectors embodied herein. In certain embodiments, cells are sorted at least by about12 days after infection (spinoculation) with the SeV vectors embodied herein. In certain embodiments, cells are sorted at least by about 13 days after infection (spinoculation) with the SeV vectors embodied herein. In certain embodiments, cells are sorted at least by about 14 days after infection (spinoculation) with the SeV vectors embodied herein. In certain embodiments, cells are sorted at least by about 15 days after infection (spinoculation) with the SeV vectors embodied herein. In certain embodiments, cells are sorted at least by about 16 days after infection (spinoculation) with the SeV vectors embodied herein. In certain embodiments, cells are sorted at least by about 17 days after infection (spinoculation) with the SeV vectors embodied herein. In certain embodiments, cells are sorted at least by about 18 days after infection (spinoculation) with the SeV vectors embodied herein. In certain embodiments, cells are sorted at least by about 19 days after infection (spinoculation) with the SeV vectors embodied herein. In certain embodiments, cells are sorted at least by about 20 days after infection (spinoculation) with the SeV vectors embodied herein.

[0121] In certain embodiments, the cells are cultured from about 30°C to about 37°C for at least about 1 day to about 20 days after infection with the SeV vectors embodied herein. In certain embodiments, the cells are cultured at about 31°C for at least about 1 day to about 20 days after infection with the SeV vectors embodied herein. In certain embodiments, the cells are cultured at about 32°C for at least about 1 day to about 20 days after infection with the SeV vectors embodied herein. In certain embodiments, the cells are cultured at about 33 °C for at least about 1 day to about 20 days after infection with the SeV vectors embodied herein. In certain embodiments, the cells are cultured at about 34°C for at least about 1 day to about 20 days after infection with the SeV vectors embodied herein. In certain embodiments, the cells are cultured at about 35°C for at least about 1 day to about 20 days after infection with the SeV vectors embodied herein. In certain embodiments, the cells are cultured at about 36°C for at least about 1 day to about 20 days after infection with the SeV vectors embodied herein.

[0122] In certain embodiments, the cells are cultured at about 35°C for at least about 5 days after infection with the SeV vectors embodied herein. In certain embodiments, the cells are cultured at about 35°C for at least about 6 days after infection with the SeV vectors embodied herein. In certain embodiments, the cells are cultured at about 35°C for at least about 7 days after infection with the SeV vectors embodied herein. In certain embodiments, the cells are cultured at about 35°C for at least about 8 days after infection with the SeV vectors embodied herein. In certain embodiments, the cells are cultured at about 35°C for atleast about 9 days after infection with the SeV vectors embodied herein. In certain embodiments, the cells are cultured at about 35°C for at least about 10 days after infection with the SeV vectors embodied herein. In certain embodiments, the cells are cultured at about 35°C for at least about 11 days after infection with the SeV vectors embodied herein. In certain embodiments, the cells are cultured at about 35°C for at least about 12 days after infection with the SeV vectors embodied herein. In certain embodiments, the cells are cultured at about 35°C for at least about 13 days after infection with the SeV vectors embodied herein. In certain embodiments, the cells are cultured at about 35°C for at least about 14 days after infection with the SeV vectors embodied herein. In certain embodiments, the cells are cultured at about 35°C for at least about 15 days after infection with the SeV vectors embodied herein. In certain embodiments, the cells are cultured at about 35°C for at least about 16 days after infection with the SeV vectors embodied herein. In certain embodiments, the cells are cultured at about 35°C for at least about 17 days after infection with the SeV vectors embodied herein. In certain embodiments, the cells are cultured at about 35°C for at least about 18 days after infection with the SeV vectors embodied herein. In certain embodiments, the cells are cultured at about 35°C for at least about 19 days after infection with the SeV vectors embodied herein. In certain embodiments, the cells are cultured at about 35°C for at least about 20 days after infection with the SeV vectors embodied herein.

[0123] In certain embodiments, the present disclosure relates to the rejuvenation of cells from vertebrates and invertebrates. In certain embodiments, the vertebrate is a human. In certain embodiments, the vertebrate is a mammal.

[0124] In certain embodiments, the present disclosure relates to the rejuvenation of cells of the human body. The cells of the human body include: blood cells (red blood cells, white blood cells, platelets), muscle cells, nerve cells (neurons), skin cells, bone cells (osteoblasts, osteocytes), fat cells, epithelial cells, fibroblasts, endothelial cells, and sex cells (sperm and egg cells).

[0125] In certain embodiments, the present disclosure relates to the rejuvenation of human dermal fibroblasts (HDFs).

[0126] In certain embodiments, the present disclosure relates to the rejuvenation of human aortic endothelial cells (HAECs).

[0127] In certain embodiments, the present disclosure relates to the rejuvenation of mammalian or any cells from other animals.

[0128] In certain embodiments, the present disclosure relates to rejuvenating cells of the immune system. As used herein, the term “cells of the immune system” generally includes white blood cells (leukocytes) which are derived from hematopoietic stem cells (HSC) produced in the bone marrow and includes for example, lymphocytes (T cells, B cells, natural killer (NK) cells) and myeloid-derived cells (neutrophil, eosinophil, basophil, monocyte, macrophage, dendritic cells).

[0129] In certain embodiments, the present disclosure relates to a method of producing rejuvenated T cells. In various embodiments, the method comprises (i) stimulating the T cell (ii) contacting a population of T cells with at least one reprogramming factor for a period of time sufficient to achieve partial reprogramming wherein T cells are not transformed into iPS cells; and (iii) contacting the partially reprogrammed T cell with at least one T cell activating compound or agent and, optionally, one or more immunomodulating agent.

[0130] In certain embodiments, a T cell includes all types of immune cells expressing CD3, including T-helper cells (CD4+cells), cytotoxic T-cells (CD8+cells), natural killer T- cells (NK cells), T-regulatory cells (Treg), and gamma-delta T cells (Ty5 cells).

[0131] In certain embodiment, a method of rejuvenating a cytotoxic T lymphocyte (CTL) comprises stimulating isolated CTLs at least two days before reprogramming the CTLs, reprogramming the CTLs by infecting the CTL with one or more temperature sensitive vectors, wherein the one or more temperature sensitive vectors comprise at least one reprogramming factor comprising OCT4, SOX2, KLF4, CMYC, or combinations thereof, incubating the infected cells at a permissive temperature for two or more days to partially reprogram the CTLs; terminating reprogramming of the CTLs prior to the step of forming induced pluripotent stem cells (iPS), thereby, rejuvenating the CTL.

[0132] In certain embodiments, partial T cell reprogramming is a reprogramming process carried out until T cell rejuvenation is initiated. In another embodiment, partial T cell reprogramming is a reprogramming process that is carried out at least until the T cells begin to lose expression of one or more T cell markers and / or begin to express markers associated with a non-T cell lineage. In certain embodiments, partial T cell reprogramming is a process of reprogramming carried out for a period of time up to the time that the T cells can no longerbe returned to a cell expressing CD3, CD4 and / or CD8 by reactivation with a T cell activation agent.

[0133] In certain embodiments, partial reprogramming of a T cell is incomplete and / or partial and / or transient reprogramming compared to an iPS cell. A partially reprogrammed T cell refers to a T cell that has been reprogrammed by contacting the T cells with one or more reprogramming factors for a period of time such that the T cells form rejuvenated T cells. In certain embodiments, the rejuvenated T cells are loosely attached to the culture vessel surface. Rejuvenated T cells as described herein retain lineage stability e.g., return to the T cell lineage after stimulation (reactivation) with a T cell activation agent and optionally an immunomodulatory molecule (e.g. cytokines). In certain embodiments, the rejuvenated T cells are semi-adherent, loosely adherent, adherent, or strongly adherent (strongly attached).

[0134] In certain embodiments, when the rejuvenated T cells are contacted with a T cell activating agent (e.g., anti-CD3, anti-CD28, one or more cytokines such as IL-2, IL-7, IL- 15), the cells exhibit increased expansion potential as compared to control T cells. In certain embodiments, the culture medium comprises IL-7 and IL-15.

[0135] In certain embodiments, the partial reprogramming methods are carried out under conditions appropriate for maintenance of the isolated T cells and / or the partially reprogrammed T cells (Rejuvenated T cells). Conditions appropriate for the maintenance and proliferation of particular cell types will be apparent to the skilled artisan. Specialized culture medium may be obtained from commercial sources, or factors necessary or desirable for enhancing the proliferation may be added to standard culture medium. Additional factors and agents may also be added to culture medium, for example, to induce expression of inducible elements in said cells or to inhibit growth of cells which are sensitive to particular agents.

[0136] In certain embodiments, the isolated T cells are cultured in T cell culture medium (TCM) comprising commercially available media optimized for culture of T cells, such as iMatrix-511 silk (Amsbio, #AMS.892.021) coated plates, NutriStem hPSC XF Culture Medium for Human iPS and ES Cells (Reprocell, #01-0005). In certain embodiments, Immune Cell Seram Replacement (e.g., a T cell serum replacement) and / or other supplements such as L- Glutamine; GlutaMAX; and / or cytokines such as IL-2, IL-7, and / or IL-15 are added.

[0137] In certain embodiments, the partial reprogramming phase of the methods herein are carried out using media optimized for cell reprogramming, such as but not limited to STEMFIT media (Amsbio, Abington, UK), mTESR2 (Stem Cell Technologies), and ESSENTIAL 6 or 8 (Life Technologies); STEMPRO hESC SFM (Gibco); TESR, clone-R, dMEM F12, KSR. In another embodiment, the partial reprogramming is carried out in a media comprised of 50% T cell media and 50% stem cell media (e.g., STEMFIT or Essential 8, mTESR, TESR, clone-R, dMEM F 12, KSR), optionally with the addition of one or more cytokines, such as IL-2, IL-7 and / or IL-15. In certain embodiments, the partial reprogramming is carried out for a first period of time in a first media and then for a second period of time in a second media. For example, in certain embodiments, the first media is 50 / 50 media as noted, optionally with the addition or one or more cytokines, for a period of 1, 2, 3, 4, 5, 6, days or more followed by culturing the cells in a second media which is a stem cell media (e.g., STEMFIT of Essential 8) media for 1, 2, 3, 4, 5, 6, 7, 8, 9, or more days. In certain embodiments, the first media is 50 / 50 and is used for 1, 2, or 3 days and the second media is a stem cell media (e.g., STEMFIT or Essential 8) and is used starting at day 2, 3, or 4 until formation of Rejuvenated T cells and reactivation as described further herein. In certain embodiments of the partial reprogramming methods, the T cells are cultured for a first period of time in a first media and then cultured for a second period of time in a second media. In certain embodiments of the partial reprogramming phase of the methods herein the T cells contacted with the one or more reprogramming factors (e.g., one or more of KLF4, OCT3 / 4, SOX2, C-MYC and SV40) are cultured in appropriate media in a culture vessel coated with recombinant human Laminin511- E8 fragment, such as iMatrix.

[0138] In certain embodiments, the rejuvenated T cells are reactivated immediately following partial reprogramming using one or more T cell stimulation or activation agents and / or costimulatory agents in an appropriate T cell culture media. In certain embodiments of the present disclosure, the rejuvenated T cells are reactivated immediately following partial reprogramming in a T cell culture media supplemented with one or more cytokines, such as IL-2, IL-, IL- 15, IL-21, with or without one or more T cell activating agents and / or one or more costimulatory agents.

[0139] In certain embodiments, the rejuvenated T cells are reactivated with one or more T cell activating and / or costimulatory and / or immunomodulatory agents as described elsewhere herein in an appropriate medium for T cell culture, such as T cell culture medium(TCM) comprising commercially available media optimized for culture of T cells, such as TexMACS medium or OpTmizer Basal Medium, with the addition of one or more supplements such as OpTmizer Cell Supplement, in certain embodiments with the addition of Immune Cell Seram Replacement (e.g., T cell serum replacement) and other supplements such as L- Glutamine; GlutaMAX; cytokines such as IL-2, IL-7, and / or IL-15.

[0140] In certain embodiments, the rejuvenated T cells are contacted with a T cell activating agent, and / or a costimulatory agent, that provides a primary activation signal and an agent that provides a costimulatory signal. Agents that provide a primary activation signal are known in the art and include for example antibodies or antigen-binding fragments thereof or ligands, or target binding fragments thereof, that bind to the CD3 cell surface receptor (e.g., an anti-CD3 antibody) expressed on T cells. Agents that provide a costimulatory signal are known in the art and include, but are not limited to, antibodies or ligands that bind to CD28, OX-40, 4- 1BB / CD137, CD2, CD7, CD27, CD30, CD40, etc. In certain embodiments, the activating agents include one or more agents, e.g., ligand, which is capable of activating an intracellular signaling domain of a TCR complex. In some aspects, the agent turns on or initiates a primary TCR CD3 intracellular signaling cascade in a T cell, such as agents suitable to deliver a primary signal, e.g., to initiate activation of an IT AM-induced signal, such as those specific for a TCR component. In another embodiment, the activating agent is provided in combination with or at the same time as an agent that promotes a costimulatory signal. Suitable agents that promote a costimulatory signal are known in the art and include antibodies or ligands that promote signaling of CD28, OX-40, 4-1BB / CD137, CD2, CD7, CD27, CD30, CD40, inducible T cell costimulator (ICOS), lymphocyte function- associated antigen- 1 (LFA-1 (CD1 1 a / CD 18), CD247, CD276 (B7-H3), Ig alpha (CD79a), DAP- 10, Fc gamma receptor or any combination thereof. In certain embodiments, the stimulatory and costimulatory agents for the activation steps of the methods here comprise an anti-CD3, anti- CD28, anti-41-BB, or anti-CD27 antibody for example, bound to solid support such as a bead, and / or one or more cytokines. In certain embodiments, the agents comprise a ligand for an activating receptor or a costimulatory receptor, e.g., a peptide / MHC complex and / or the CD27 ligand (e.g., CD70 or trimerized versions thereof), CD80, CD86 and the like. Among the stimulating and costimulatory agents are anti-CD3 / anti-CD28 beads (e.g., DYNABEADS M-450 CD3 / CD28 T Cell Expander, and / or ExpACT beads). Optionally, the stimulation and / or activation may comprise adding anti-CD3 and / or anti CD28 antibody to the culture medium. In some embodiments, the stimulating agents include IL-2, IL-7 and / or IL-15.

[0141] In some embodiments, the activating and / or costimulatory agents herein may be coated or adsorbed onto one or more surfaces. Such surfaces include, for example, solid surfaces, porous surfaces, semi-porous surfaces, spherical surfaces, non-spherical surfaces, rod-like surfaces, and polymeric surfaces.

[0142] In certain embodiments, the rejuvenated T cells are redirected or reactivated with antigen or antigen expressing cells, such as viral antigens, tumor antigens, etc. In certain embodiments, the T cells are reactivated by co-culture with an antigen presenting cell. In certain embodiments, the activation media for the reactivation of the rejuvenated T cells may further comprise an immunomodulatory molecule such as a cytokine. Examples of immunomodulatory molecules are lymphokines, monokines, and traditional polypeptide hormones. Included among the cytokines are growth hormones such as human growth hormone, N-methionyl human growth hormone, and bovine growth hormone; parathyroid hormone; thyroxine; insulin; proinsulin; relaxin; prorelaxin; glycoprotein hormones such as follicle stimulating hormone (FSH), thyroid stimulating hormone (TSH), and luteinizing hormone (LH); hepatic growth factor (HGF); fibroblast growth factor (FGF); prolactin; placental lactogen; mullerian-inhibiting substance; mouse gonadotropin-associated peptide; inhibin; activin; vascular endothelial growth factor; integrin; thrombopoietin (TPO); nerve growth factors (NGFs) such as NGF-beta; platelet-growth factor; transforming growth factors (TGFs) such as TGF-alpha and TGF-beta; insulin-like growth factor-I and -II; erythropoietin (EPO); osteoinductive factors; interferons such as interferon- alpha, beta, and - gamma; colony stimulating factors (CSFs) such as macrophage-CSF (M-CSF); granulocyte - macrophage-CSF (GM-CSF); and granulocyte-CSF (G-CSF); interleukins (IFs) such as IE-1, IE-1 alpha, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-15; a tumor necrosis factor such as TNF-alpha or TNF-beta; and other polypeptide factors including LIF and kit ligand (KL). As used herein, the term cytokine includes proteins from natural sources or from recombinant cell culture, and biologically active equivalents of the native sequence cytokines.

[0143] In certain embodiments, the rejuvenated T cells are reinfused into a subject in need of treatment, such as for example, cancer. The rejuvenated and stimulated T cells specific for one or more tumor antigens or viral antigens are reinfused into the subject.

[0144] In certain embodiments, the rejuvenated T cells have one or more sternness properties including high epigenetic plasticity. Other advantageous phenotypic markers thatthe rejuvenated cells may acquire include expression of L-selectin (CD62L), IL-7Ra, CD 132, CCR7, CD45RA, CD45RO, CD27, CD28, CD95, CXCR3, TCF7 and LFA-1. In certain embodiments, the rejuvenated T cells acquire T memory stem cell expression markers, e.g., are memory T cells that express CD95, CD45RA, CCR7, and CD62L and are endowed with the stem cell-like ability to self-renew and the multipotent capacity to reconstitute the entire spectrum of memory and effector T cell subsets. In certain embodiments, the rejuvenated T cells are central memory T cells (TCM cells) which are memory T cells that express CD45RO, CCR7, and CD62L. In another embodiment, rejuvenated T cells have effector memory T cell markers such as expression of CD45RO but lack of expression of CCR7 and CD62L. In certain embodiments, the rejuvenated T cells herein have a stem-like phenotype and have an improved capacity for proliferation.

[0145] In certain embodiments, the rejuvenated T cells have characteristics of a naive T cell, "TN cells," which are T cells that express CD45RA, CCR7, and CD62L, but which do not express CD95.

[0146] In certain embodiments, the rejuvenated T cells may exhibit biological and phenotypic characteristics of younger T cells in terms of epigenetic signature, telomere length and functionality.

[0147] The rejuvenation of cells is not limited to T cells, but includes without limitation any immune cell, fibroblasts, myoblasts, epithelial cells, nerve cells, brain cells, endothelial cells, ocular cells (e.g., retina cells, rods and cones, retinal ganglion cells (RGCs)) and the like.

[0148] Accordingly, in certain embodiments, a method of rejuvenating a fibroblast comprises reprogramming the fibroblast by transfecting the fibroblast with one or more temperature sensitive vectors, wherein the one or more temperature sensitive vectors comprise at least one reprogramming factor comprising OCT4, SOX2, KLF4, CMYC or combinations thereof, incubating the transfected fibroblasts at a permissive temperature for two or more days to partially reprogram the fibroblasts; terminating reprogramming of the cells prior to the step of forming induced pluripotent stem cells (iPS), thereby, rejuvenating the fibroblast.

[0149] In another aspect, a method of rejuvenating one or more desired cell types in a subject comprises obtaining a biological sample from the subject, isolating the desired cell type from the biological sample, reprogramming the desired cell type by transforming the cellwith one or more temperature sensitive vectors, wherein the one or more temperature sensitive vectors comprise at least one reprogramming factor comprising OCT4, SOX2, KLF4, CMYC or combinations thereof, incubating the cells at a permissive temperature for two or more days to partially reprogram the cell; terminating reprogramming of the cells prior to the step of forming induced pluripotent stem cells (iPS), thereby, rejuvenating the cell.

[0150] CELL ISOLATION

[0151] The cells in some embodiments are primary cells, e.g., primary human cells. The samples include tissue, fluid, and other samples taken directly from the subject, as well as samples resulting from one or more processing steps, such as separation, centrifugation, genetic engineering (e.g. transduction with viral vector), washing, and / or incubation. The biological sample can be a sample obtained directly from a biological source or a sample that is processed. Biological samples include, but are not limited to, body fluids, such as blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine and sweat, tissue and organ samples, including processed samples derived therefrom.

[0152] In certain embodiments, the sample from which the cells are derived or isolated is blood or a blood-derived sample, or is or is derived from an apheresis or leukapheresis product. Exemplary samples include whole blood, peripheral blood mononuclear cells (PBMCs), leukocytes, bone marrow, thymus, tissue biopsy, tumor, leukemia, lymphoma, lymph node, gut associated lymphoid tissue, mucosa associated lymphoid tissue, spleen, other lymphoid tissues, liver, lung, stomach, intestine, colon, kidney, pancreas, breast, bone, prostate, cervix, testes, ovaries, tonsil, or other organ, and / or cells derived therefrom. Samples include, in the context of cell therapy, e.g., adoptive cell therapy, samples from autologous and allogeneic sources.

[0153] In certain embodiments, the cells are derived from cell lines, e.g., T cell lines. The cells in some embodiments are obtained from a xenogeneic source, for example, from mouse, rat, non-human primate, or pig.

[0154] In certain embodiments, isolation of the cells includes one or more preparation and / or non-affinity based cell separation steps. In some examples, cells are washed, centrifuged, and / or incubated in the presence of one or more reagents, for example, to remove unwanted components, enrich for desired components, lyse or remove cells sensitive to particular reagents. In some examples, cells are separated based on one or more property,such as density, adherent properties, size, sensitivity and / or resistance to particular components.

[0155] In some examples, cells from the circulating blood of a subject are obtained, e.g., by apheresis or leukapheresis. The samples, in some aspects, contain lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and / or platelets, and in some aspects contains cells other than red blood cells and platelets.

[0156] In certain embodiments, the blood cells collected from the subject are washed, e.g., to remove the plasma fraction and to place the cells in an appropriate buffer or media for subsequent processing steps. In some embodiments, the cells are washed with phosphate buffered saline (PBS). In some embodiments, the wash solution lacks calcium and / or magnesium and / or many or all divalent cations. In some aspects, a washing step is accomplished a semi-automated “flow-through” centrifuge (for example, the Cobe 2991 cell processor, Baxter) according to the manufacturer's instructions. In some aspects, a washing step is accomplished by tangential flow filtration (TFF) according to the manufacturer's instructions. In some embodiments, the cells are resuspended in a variety of biocompatible buffers after washing, such as, for example, Ca++ / Mg++free PBS. In certain embodiments, components of a blood cell sample are removed and the cells directly resuspended in culture media.

[0157] In certain embodiments, the methods include density-based cell separation methods, such as the preparation of white blood cells from peripheral blood by lysing the red blood cells and centrifugation through a Percoll or Ficoll gradient.

[0158] In certain embodiments, the isolation methods include the separation of different cell types based on the expression or presence in the cell of one or more specific molecules, such as surface markers, e.g., surface proteins, intracellular markers, or nucleic acid. In some embodiments, any known method for separation based on such markers may be used. In some embodiments, the separation is affinity- or immunoaffinity-based separation. For example, the isolation in some aspects includes separation of cells and cell populations based on the cells' expression or expression level of one or more markers, typically cell surface markers, for example, by incubation with an antibody or binding partner that specifically binds to such markers, followed generally by washing steps and separation ofcells having bound the antibody or binding partner, from those cells having not bound to the antibody or binding partner.

[0159] Such separation steps can be based on positive selection, in which the cells having bound the reagents are retained for further use, and / or negative selection, in which the cells having not bound to the antibody or binding partner are retained. In some examples, both fractions are retained for further use. In some aspects, negative selection can be useful where no antibody is available that specifically identifies a cell type in a heterogeneous population, such that separation is carried out based on markers expressed by cells other than the desired population.

[0160] The separation need not result in 100% enrichment or removal of a particular cell population or cells expressing a particular marker. For example, positive selection of or enrichment for cells of a particular type, such as those expressing a marker, refers to increasing the number or percentage of such cells, but need not result in a complete absence of cells not expressing the marker. Likewise, negative selection, removal, or depletion of cells of a particular type, such as those expressing a marker, refers to decreasing the number or percentage of such cells, but need not result in a complete removal of all such cells.

[0161] In some examples, multiple rounds of separation steps are carried out, where the positively or negatively selected fraction from one step is subjected to another separation step, such as a subsequent positive or negative selection. In some examples, a single separation step can deplete cells expressing multiple markers simultaneously, such as by incubating cells with a plurality of antibodies or binding partners, each specific for a marker targeted for negative selection. Likewise, multiple cell types can simultaneously be positively selected by incubating cells with a plurality of antibodies or binding partners expressed on the various cell types. For example, in some aspects, specific subpopulations of T cells, such as cells positive or expressing one or more markers, e.g., CD4+CD25+, FOXP3+and Helios+.

[0162] VECTORS

[0163] The reprogramming factors introduced into cells comprises any genetic construct or vector. In certain embodiments, the vector comprises adenovirus, adeno- associated virus (AAV), Sendai virus (SeV), herpes simplex virus, lentivirus, gammaretrovirus, retrovirus, alphavirus, flavivirus, rhabdovirus, measles virus, Newcastle disease virus, poxvirus, vaccinia virus, modified Ankara virus or vesicular stomatitis virus. In certain embodiments, the vector is a modified SeV. In certain embodiments, the vectorfurther comprises an inducible promoter, a cell specific promoter, a tissue specific promoter or a constitutive promoter. In certain embodiments, the vector further comprises one or more enhancer or regulatory sequences. In certain embodiments, the vector further comprises an inducible suicide gene. In certain embodiments, the vector further comprises a nucleic acid sequence encoding for one or more reprogramming factors.

[0164] In embodiments, a modified Sendai virus vector is a temperature sensitive vector is a virus vector comprising nucleic acid sequences encoding one or more reprogramming factors comprising OCT4, SOX2, KLF4, CMYC (OSKM) or combinations thereof. In certain embodiments, the modified SeV vector encodes reprogramming factors comprising OCT RNA such as OCT3 / 4, SOX RNA such as SOX2, KLF such as KLF4, and MYC such as c-MYC. In addition, the reprogramming factor may further include at least one factor selected from the group consisting of LIN28A, FOXH1, LIN28B, GLIS1, p53- dominant negative, p53-P275S, L-MYC, NANOG, DPPA2, DPPA4, DPPA5, ZIC3, BCL-2, E-RAS, TPT1, SALL2, NAC1, DAX1, TERT, ZNF206, FOXD3, REXI, UTTF1, KLF2, KLF5, ESRRB, miR-291-3p, miR-294, miR-295, NR5A1, NR5A2, TBX3, MBD3sh, TH2A, TH2B, and P53DD.

[0165] The Sendai viral vector may be a temperature-sensitive Sendai viral vector in which the stability of a viral nucleic acid decreases at a predetermined temperature or higher. The viral nucleic acid of the temperature-sensitive Sendai viral vector is stable below a predetermined temperature. The decrease in the stability of the viral nucleic acid may be at least one of decomposition of the viral nucleic acid and minimization of replication or proliferation of the viral nucleic acid. When the stability of the viral nucleic acid decreases, at least one of proliferation of the viral nucleic acid, the replication rate of the viral nucleic acid and the gene expression level decreases. The predetermined temperature is, for example, 36.5° C. or higher and 37.5° C. or lower, 36.6° C. or higher and 37.4° C. or lower, 36.7° C. or higher and 37.3° C. or lower, 36.8° C. or higher and 37.2° C. or lower, 36.9° C. or higher and 37.1° C. or lower, or 37° C or higher, 38°C or higher, or 39°C or higher, or 40°C or higher. The stability of the viral nucleic acid of the temperature-sensitive Sendai viral vector, that is, at least one of the proliferation, the replication rate and the gene expression level, is high at a temperature lower than a predetermined temperature, and low at a predetermined temperature or higher. For example, in the temperature-sensitive Sendai viral vector, the proliferation rate or the gene expression level in cells cultured at 37° C. is ’A or less, ’A or less, A or less, 1 / 10or less, or 1 / 20 or less with respect to the proliferation rate or the gene expression level in cells cultured at 32° C.

[0166] The Sendai virus encodes the N gene, P gene, M gene, F / HN gene, and L gene. The HN protein recognizes sialic acid on the cell surface when the Sendai virus attaches to cells and fixes virus particles to the cells. The F protein is cleaved and activated with extracellular proteases, and catalyzes the fusion of the fixed Sendai virus envelope and the cell membrane of target cells to establish infection. Along with its modified protein, that is, the P protein, the L protein catalyzes replication of viral nucleic acids in the cytoplasm after infection and transcription from the replicated multi-copy nucleic acids.

[0167] In certain embodiments, the modified Sendai virus vector lacks an F gene. When the F gene is deleted in the Sendai viral vector, it is possible to restrict production of infectious virus particles from transgenic cells. In addition, when a mutation is introduced into at least one of the L gene and P gene, it is possible to make the Sendai viral vector temperature sensitive. Examples of temperature-sensitive (TS) mutation of the Sendai virus include TS7 (Y942H / L1361C / L1558I mutation of the L protein), TS12 (D433A / R434A / K437A mutation of the P protein), TS13 (D433A / R434A / K437A mutation of the P protein and LI 5581 mutation of the L protein), TS14 (D433A / R434A / K437A mutation of the P protein and L1361C mutation of the L protein), and TS15 (D433A / R434A / K437A mutation of the P protein and L1361C / L1558I mutation of the L protein).

[0168] The Sendai viral vector is, for example, an F gene-deficient (AF) Sendai viral vector having G69E, T116A, and A183S mutations in the M protein, A262T, G264R, and K461G mutations in the HN protein, L51 IF mutation in the P protein, and N1197S and K1795E mutations in the L protein, which is a Sendai viral vector into which the TS7, TS12, TS13, TS14, or TS15 mutation is introduced. However, the temperature-sensitive mutation of the Sendai viral vector is not limited thereto.

[0169] The Sendai viral vector is, for example, SeV(PM) / TSAF, SeV18+ / TSAF, or SeV(HNL) / TSAF, and is a Sendai viral vector into which the TS7, TS12, TS13, TS14, or TS15 mutation is introduced. However, the temperature-sensitive mutation of the Sendai viral vector is not limited thereto.

[0170] The Sendai viral vector introduced into cells may be a combination of a temperature-sensitive Sendai viral vector and a temperature-insensitive Sendai viral vector. Alternatively, the Sendai viral vector introduced into cells may be a temperature-sensitiveSendai viral vector only and may not include a temperature-insensitive Sendai viral vector. For example, the Sendai viral vector introduced into cells may be only a temperaturesensitive Sendai viral vector into which the TS7, TS12, TS13, TS14, or TS15 mutation is introduced and may not include a temperature-insensitive Sendai viral vector. For example, the Sendai viral vector introduced into cells may be only a Sendai viral vector having a temperature sensitivity equal to or higher than that of a temperature-sensitive Sendai viral vector into which the TS7, TS12, TS13, TS14, or TS15 mutation is introduced, and may not include a temperature-insensitive Sendai viral vector. For example, the Sendai viral vector introduced into cells may be only a Sendai viral vector having a temperature sensitivity equal to or higher than that of a temperature-sensitive Sendai viral vector into which the TS7, TS12, TS13, TS14, or TS15 mutation is introduced, and may not include a Sendai viral vector having a lower temperature sensitivity than a temperature-sensitive Sendai viral vector into which the TS7, TS12, TS13, TS14, or TS15 mutation is introduced.

[0171] The Sendai viral vector introduced into cells carries arbitrary reprogramming factors. The Sendai viral vector introduced into cells may be, for example, a combination of a temperature-sensitive Sendai viral vector comprising KLF, OCT, and SOX in that order and not including MYC, and a temperature-sensitive Sendai viral vector comprising MYC and not including KLF, OCT, and SOX. However, the number, combination, and order of reprogramming factors carried on the Sendai viral vector are arbitrary, and are not particularly limited.

[0172] The Sendai viral vector introduced into cells may include a Sendai viral vector comprising KLF and not including OCT and SOX. The Sendai viral vector comprising KLF and not including OCT and SOX may be a temperature-sensitive Sendai viral vector or a temperature-insensitive Sendai viral vector.

[0173] The temperature-sensitive Sendai viral vector comprising KLF, OCT, and SOX is, for example, an F gene-deficient Sendai viral vector. In certain embodiments, the temperature sensitive Sendai viral vector comprises G69E, T116A, and A183S mutations in the M protein, A262T, G264R, and K461G mutations in the HN protein, L51 IF mutation in the P protein, and N1197S and K1795E mutations in the L protein, which is a Sendai viral vector comprising the TS7, TS12, TS13, TS14, or TS15 mutation. The temperature-sensitive mutation is, for example, TS7 or TS12, or TS12. The temperature-sensitive Sendai viral vector comprising KLF, OCT, and SOX is, for example, SeV(PM)KOS / TS7AF or SeV(PM)KOS / TS12AF, or SeV(PM)KOS / TS12AF.

[0174] Table 1 depicts the locations of point mutations in each gene in the TS and TS12 backbone.Table 1

[0175] The temperature-sensitive Sendai viral vector comprising MYC is, for example, an F gene-deficient Sendai virus vector. In certain embodiments, the temperature sensitive Sendai viral vector comprises G69E, T116A, and A183S mutations in the M protein, A262T, G264R, and K461G mutations in the HN protein, L51 IF mutation in the P protein, and N1197S and K1795E mutations in the L protein, which is a Sendai viral vector including the TS7, TS12, TS13, TS14, or TS15 mutation. The temperature- sensitive mutation is, for example, TS15. The temperature-sensitive Sendai viral vector comprising MYC RNA is, for example, SeV(HNL)MYC / TS12AF, SeV(HNL)MYC / TS13AF, or SeV(HNL)MYC / TS15AF, or SeV(HNL)MYC / TS15AF.

[0176] The Sendai viral vector comprising KLF RNA and not including OCT and SOX is, for example, an F gene-deficient Sendai viral vector. In certain embodiments, the temperature sensitive Sendai viral vector comprises G69E, T116A, and A183S mutations in the M protein, A262T, G264R, and K461G mutations in the HN protein, L51 IF mutation inthe P protein, and N1197S and K1795E mutations in the L protein. The Sendai viral vector comprising KLF RNA and not including OCT RNA and SOX RNA is less temperaturesensitive than, for example, a Sendai viral vector into which the TS7, TS12, TS13, TS14, or TS15 mutation is introduced and can express the KLF gene at a predetermined temperature or higher. The Sendai viral vector comprising KLF RNA and not including OCT RNA and SOX RNA is, for example, SeV18+KLF4 / TSAF.

[0177] In certain embodiments, the vector comprises one or more microRNAs (miRs). The target sequence of the microRNA specific to the induced pluripotent stem cell is not particularly limited as long as it is a sequence to which the microRNA specific to the induced pluripotent stem cell binds as a target. Examples of microRNAs specific to induced pluripotent stem cells include miR-367, miR-302, miR-371, miR-372, miR-373, miR-512, miR-517, miR-518, miR-519, MiR-520, miR-525, miR-187, miR-299, miR-499, miR-628, and miR-888.

[0178] In certain embodiments, the miRNA is miR-367T2, comprising a nucleic acid sequence TCACCATTGCTAAAGTGCAATTcgatTCACCATTGCTAAAGTGCAATT (SEQ ID NO: 1). In certain embodiments, the miR-367T2 comprises one or more mutations. In certain embodiments, the the miR-367T2 comprises at least a 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, sequence identity to SEQ ID NO: 1. In certain embodiments, the the miR-367T2 comprises at least a 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, sequence identity to SEQ ID NO: 1. In certain embodiments, the the miR-367T2 comprises at least a 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, sequence identity to SEQ ID NO: 1. In certain embodiments, the the miR-367T2 comprises at least a 95%, 96%, 97%, 98%, or 99%, sequence identity to SEQ ID NO: 1.

[0179] The microRNA target sequence is a sequence to which microRNA binds as a target. In the present application, as the microRNA target sequence, a natural microRNA target sequence or a variant thereof can be used as long as the expression is suppressed by the binding of microRNA. The microRNA target sequence may or may not be a sequence that is completely complementary to the microRNA, for example, at least 10 bases, for example, 11 bases or more, 12 bases or more, 13 bases or more, 14 with respect to the microRNA. Containing complementary bases of bases or more, 15 bases or more, 16 bases or more, 17 bases or more, 18 bases or more, 19 bases or more, 20 bases or more, 21 bases or more, 22 bases or more continuously or discontinuously. There is no particular upper limit to thelength of the sequence of the microRNA target sequence, but it is, for example, about 30 bases. In certain embodiments, the complementary base may be contiguous or may have several, eg, 5 or less, 4 or less, 3 or less, 2 or less, or 1 unpaired base. Unpaired bases may be included on the microRNA target sequence side and / or on the microRNA side.

[0180] In certain embodiments, the microRNA target sequence is a sequence that hybridizes with microRNA under physiological conditions. Physiological conditions are, for example, 150 mM NaCl, 15 mM sodium citrate, pH 7.0, 37 ° C. In certain embodiments, the microRNA target sequence is a sequence that hybridizes to the microRNA under stringent conditions. The stringent conditions are, for example, 1 x SSC (1 x SSC is 150 mM NaCl, 15 mM sodium citrate, pH 7.0) or 0.5 x SSC, 42 ° C., and 1 x SSC or 0.5 x SSC, The condition is 45 ° C, 1xSSC or 0.5 x SSC, 50 ° C. In hybridization, for example, either RNA containing a microRNA sequence or RNA containing a microRNA target sequence is labeled, and if necessary, the other is fixed to a membrane or the like to hybridize the two. Hybridization conditions are, for example, 5xSSC, 7% (W / V) SDS, 100 pg / ml denatured salmon sperm DNA, 5x Denhardt solution (lx Denhardt solution is 0.2% polyvinylpyrrolidone, 0.2% bovine serum albumin, and 0.2% Ficoll. In a solution containing, for example 37 ° C, or 45 ° C, or 50 ° C. After incubating for a sufficient time (for example, 3, 4, 5 or 6 hours or more), washing is performed under the above conditions to detect whether the labeled nucleic acid is hybridized, whereby the nucleic acid hybridizes under the conditions. You can decide whether or not.

[0181] In certain embodiments, the microRNA target sequence exhibits high homology with the complementary sequence of the microRNA sequence. High homology is, for example, 70% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 93% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more identical.

[0182] In certain embodiments, the microRNA target sequence comprises a sequence in which one or several bases are inserted, substituted, and / or deleted from the complementary sequence of the microRNA sequence. In certain embodiments, the microRNA target sequence is within 8 bases, within 7 bases, within 6 bases, within 5 bases, within 4 bases, within 3 bases, within 2 bases, or within 1 base with respect to the complementary sequence of the microRNA sequence. Includes sequences with insertions, substitutions, and / or deletions.

[0183] In general, the more a mutation is introduced into a microRNA target sequence, the more the binding to the microRNA is suppressed, and the effect of suppressing the expression is reduced. It is possible to regulate the inhibitory effect by appropriately introducing mutations.

[0184] When a plurality of types of Sendai viral vectors are introduced into cells, for example, a plurality of types of Sendai viral vectors are introduced into cells at the same time. Alternatively, within 48 hours, within 36 hours, within 24 hours, within 18 hours, within 12 hours, within 10 hours, within 8 hours, within 6 hours, within 3 hours, within 2 hours, or within 1 hour after a certain type of Sendai viral vector is introduced into cells, it is preferable to introduce all types of Sendai viral vectors into cells.

[0185] The multiplicity of infection (MOI) of the Sendai viral vector when cells are infected is, for example, 0.1 or more, 0.3 or more, 0.5 or more, 1.0 or more, 2.0 or more, 3.0 or more, 4.0 or more, or 5.0 or more. In addition, the MOI is, for example, 100 or less, 90 or less, 80 or less, 70 or less, 60 or less, 50 or less, 40 or less, 30 or less, 20 or less, 10 or less, or 5 or less.

[0186] The temperature at which cells are infected with a Sendai viral vector may be lower than a predetermined temperature at which the stability of the viral nucleic acid of the temperature-sensitive Sendai viral vector decreases, that is, a temperature at which the viral nucleic acid of the temperature-sensitive Sendai viral vector is stable, or a predetermined temperature or higher. When the Sendai viral vector is only a temperature-sensitive Sendai viral vector and does not include a temperature-insensitive Sendai viral vector, the temperature at which cells are infected with a Sendai viral vector is preferably a temperature that is lower than a predetermined temperature at which the stability of the viral nucleic acid of the temperature-sensitive Sendai viral vector decreases, that is, that is, a temperature at which the viral nucleic acid of the temperature-sensitive Sendai viral vector is stable.

[0187] In certain embodiments, the reprogramming factor is introduced into cells, for example, by a lipofection method. The lipofection method is a method in which a complex of a nucleic acid, which is a negatively charged substance, and a positively charged lipid, is formed by an electrical interaction, and the complex is incorporated into cells by endocytosis or membrane fusion. The lipofection method has advantages such as less damage to cells, excellent introduction efficiency, ease of operation, and less time-consumption. For example, the reprogramming factor is introduced into cells cultured using an RNA transfection reagent.For example, when cells are mononuclear cells, immediately after mononuclear cells are isolated from blood, RNA may be introduced into the mononuclear cells.

[0188] Lipofectamine MessengerMAX (registered trademark, Thermo Fisher SCIENTIFIC) can be used as the RNA transfection reagent. Alternatively, regarding the RNA transfection reagent, for example, a lipofection reagent such as Lipofectamine (registered trademark) RNAiMAX (Thermo Fisher SCIENTIFIC), Lipofectamine StemTransfection Reagent (Thermo Fisher SCIENTIFIC), TransIT (Minis), mRNA-In (MTL GlobalStem), Stemfect RNA Transfection Kit (ReproCELL), Jet Messenger (Polyplus), Lipofectamin (registered trademark) 2000, Lipofectamin (registered trademark) 3000, NeonTransfection System (Thermo Fisher SCIENTIFIC), Stemfect RNA transfection reagent (Stemfect), NextFect (registered trademark) RNA Transfection Reagent (BiooSientific), Amaxa (registered product) Human T cell Nucleofector (registered product) kit (Lonza, VAPA-1002), Amaxa (registered product) Human CD34 cell Nucleofector (registered product) kit (Lonza, VAPA-1003), and ReproRNA (registered trademark) transfection reagent (STEMCELL Technologies) may be used.

[0189] Some art-recognized lipid-formulated delivery vehicles for nucleic acid therapeutics include, according to various embodiments, polymer based carriers, such as polyethyleneimine (PEI), lipid nanoparticles and liposomes, nanoliposomes, ceramide- containing nanoliposomes, multivesicular liposomes, proteoliposomes, both natural and synthetically-derived exosomes, natural, synthetic and semi-synthetic lamellar bodies, nanoparticulates, micelles, and emulsions. These lipid formulations can vary in their structure and composition, and as can be expected in a rapidly evolving field, several different terms have been used in the art to describe a single type of delivery vehicle. At the same time, the terms for lipid formulations have varied as to their intended meaning throughout the scientific literature, and this inconsistent use has caused confusion as to the exact meaning of several terms for lipid formulations.

[0190] METHODS OF TREATMENT

[0191] In certain embodiments, the disclosure relates to a method of treating a patient in need thereof with a population of rejuvenated cells as described herein.

[0192] In certain embodiments, the disclosure relates to a method of treating a patient in need thereof with a population of rejuvenated immune cell (e.g., a T cell) produced by the methods disclosed herein. Methods are provided for treating diseases or disorders, including cancer, infectious disease, or autoimmune disease. In various embodiments, the disclosurerelates to a method of treating a patient in need thereof with a population of immune cell (e.g., a T cell) produced by a method comprising (a) isolating a plurality of immune cells (e.g., T cells) from a source; (b) contacting the plurality of immune cells (e.g., T cells) with at least one reprogramming factor selected from the group consisting of KLF4, OCT3 / 4, SOX2 and C- MYC; and (c) contacting said immune cells (e.g., T cells) with a culture medium comprising IL-2, IL-7 and / or IL-15, wherein said immune cells (e.g., T cells) are contacted with at least one reprogramming factor for a period of at least about four days. In some embodiments, the plurality of immune cells (e.g., T cells) are engineered to express a cell surface receptor that recognizes a specific antigen on the surface of a target cell. In certain embodiments, the target cell is a cancer cell, a virally infected cell and the like.

[0193] In certain embodiments, a pharmaceutical composition comprises a plurality of rejuvenated T cells produced by the methods herein. In certain embodiments, the pharmaceutical composition comprises rejuvenated T cells produced by a method comprising (a) contacting a plurality of T cells with at least one reprogramming factor selected from the group consisting of KLF4, OCT3 / 4, SOX2 and C- MYC; for a period time sufficient for the partially reprogrammed cells to attach to the culture vessel surface; and (b) contacting attached reprogrammed T cells with a culture medium comprising a T cell activating agent. In some embodiments, the pharmaceutical composition further comprises an additional active agent. In certain embodiments, a CTL is activated at least one day prior to exposure to the reprogramming factors.

[0194] In certain embodiments, the rejuvenated T cells may be engineered with chimeric antigen receptors (CARs) or T cell receptors (TCRs) to specific tumor antigens. As used herein, a chimeric antigen receptor (or CAR) may refer to any engineered receptor specific for an antigen of interest that, when expressed in a T cell, confers the specificity of the CAR onto the T cell. Once created using standard molecular techniques, a T cell expressing a chimeric antigen receptor may be introduced into a patient, as with a technique such as adoptive cell transfer. In some aspects, the T cells are activated CD4 and / or CD8 T cells in the individual which are characterized by y-IFN- producing CD4 and / or CD8 T cells and / or enhanced cytolytic activity relative to prior to the administration of the combination. The CD4 and / or CD8 T cells may exhibit increased release of cytokines selected from the group consisting of IFN-y, TNF-a and interleukins. The CD4 and / or CD8 T cells can be effector memory T cells. In certain embodiments, the CD4 and / or CD8 effector memory T cells are characterized by having the expression of CD44hlghCD62Llow.

[0195] In certain embodiments, the disclosure comprises a pharmaceutical composition comprising at least one rejuvenated cell as described herein (e.g. immune cells, fibroblasts etc) and a pharmaceutically acceptable excipient. In some embodiments, the pharmaceutical composition further comprises an additional active agent.

[0196] In certain embodiments, the rejuvenated cell comprises tumor-infiltrating leukocytes, chimeric antigen receptor T-cells (CAR-T), NK-cells. In certain embodiments, the cells comprise autologous patient-derived cells. In certain embodiments, the cells comprise allogenic donor-derived cells. In certain embodiments, the cells comprise cells that are not patient specific and amenable to long-term storage. Such therapies are also referred to as ' off-the-shelf therapies.

[0197] It will be appreciated that target doses for rejuvenated T cells can range from about 1 x 106to about 2 x 1010cells / kg, preferably 2xl06cells / kg. It will be appreciated that doses above and below this range may be appropriate for certain subjects, and appropriate dose levels can be determined by the healthcare provider as needed. In certain embodiments the target dose is IxlO5. In certain embodiments the target dose is IxlO6. In certain embodiments the target dose is IxlO7. In certain embodiments the target dose is IxlO8. In certain embodiments the target dose is IxlO9. In certain embodiments the target dose is IxlO10. In certain embodiments the target dose is 2xlO10. Additionally, multiple doses of cells can be provided in accordance with the disclosure. In certain embodiments at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses of cells are administered to the patient in need thereof.

[0198] In certain embodiments, the rejuvenated cells are administered with one or more other therapeutics, as part of a combination therapy. The term “combination therapy”, as used herein, refers to those situations in which two or more different pharmaceutical agents are administered in overlapping regimens so that the subject is simultaneously exposed to both agents. When used in combination therapy, two or more different agents may be administered simultaneously or separately. This administration in combination can include simultaneous administration of the two or more agents in the same dosage form, simultaneous administration in separate dosage forms, and separate administration. That is, two or more agents can be formulated together in the same dosage form and administered simultaneously. Alternatively, two or more agents can be simultaneously administered, wherein the agents are present in separate formulations. In another alternative, a first agent can be administered just followed by one or more additional agents. In the separate administration protocol, two or more agents may be administered a few minutes apart, or a few hours apart, or a few daysapart. Treatment of a subject also includes a variety of combination therapies with both physical, e.g. surgery, and radiation based treatments.

[0199] In certain embodiments, the combination therapy may include immunotherapy may comprise suppression of T regulatory cells (Tregs), myeloid derived suppressor cells (MDSCs) and cancer associated fibroblasts (CAFs). In some embodiments, the immunotherapy is a tumor vaccine (e.g., whole tumor cell vaccines, peptides, and recombinant tumor associated antigen vaccines), or adoptive cellular therapies (ACT) (e.g., T cells, natural killer cells, TILs, and LAK cells).

[0200] KITS

[0201] Also included within the scope of the present disclosure are kits, e.g., pharmaceutical kits, comprising at least one reprogramming factor for contacting one or more cells in vitro. Kits typically include a label indicating the intended use of the contents of the kit and instructions for use. The term “label” includes any writing, or recorded material supplied on or with the kit, or which otherwise accompanies the kit.

[0202] In certain embodiments, the disclosure provides a kit for rejuvenating one or more cells for an adoptive cell therapy for a subject in need thereof, the kit comprising at least one reprogramming factor selected from the group consisting of KLF4, OCT3 / 4, SOX2 and C-MYC. In certain embodiments, the disclosure provides for a kit for preparing one or more T cells for a T cell therapy for a subject in need thereof, the kit comprising at least one expression vector capable of expression at least one reprogramming factor selected from the group consisting of KLF4, OCT3 / 4, SOX2 and C-MYC. In certain embodiments, the disclosure provides for a kit for preparing one or more T cells for a T cell therapy for a subject in need thereof, the kit comprising at least one Sendai virus vector capable of expression at least one reprogramming factor selected from the group consisting of KLF4, OCT3 / 4, SOX2 and C- MYC. In various embodiments, the kit further comprises a Sendai virus vector capable of expressing SV40.

[0203] In certain embodiments, the disclosure provides a kit for rejuvenating one or more cells, the kit comprising: an expression vector encoding KLF4, OCT3 / 4 and SOX2; an expression vector encoding KLF4; an expression vector encoding C-MYC. In certain embodiments the vector is a temperature sensitive Sendai virus vector embodied herein.EXAMPLES

[0204] EXAMPLE 1 : METHODS OF PRODUCING REJUVENATED HUMAN SOMATICCELLS

[0205] MATERIALS AND METHODS

[0206] Construction of Modified Sendai Virus Vector (SeV-KLF4 / TS12)*

[0207] The insert sequence containing the open reading frame of human KLF4 gene was constructed by PCR from cDNAs using Notl-tagged gene-specific forward and reverse primers including SeV-specific transcriptional regulatory signal sequences. The point mutations on the TS and TS12 backbones are reported elsewhere (Schlaeger, 2018). The sequence of miR367T2, which is inserted after the P gene is TCACCATTGCTAAAGTGCAATTcgatTCACCATTGCTAAAGTGCAATT (SEQ ID NO: 1).

[0208] The method for constructing the plasmids that contain the F gene deficient SeV vector backbone is described elsewhere (Inoue et al., 2003), and in principle the same method was used to construct plasmids pSeV18+KLF4 / TS12AF, which contain the additional mutations and insert as described above. The recovery and propagation of SeV-KLF4 vectors from the SeV-KLF4 vector plasmids were performed as previously described (Komuta et al., 2016).

[0209] Culturing Human CD8+Cytotoxic T Cells

[0210] Human peripheral blood mononuclear cells (PBMCs) were purchased from Cellular Technology Ltd (#CTL-UP1). Subsets of CD8+cytotoxic T cells (CTLs) were further separated using EasySep Human CD8+T Cell Isolation Kit (STEMCELL Technologies, #17953) from the PBMCs. The cells were maintained in X-VIVO 15 (Lonza, #04-418Q) containing 5% human serum (Sigma, H4522), 500mM NAC (Sigma, #A9165), lOOOx 2-Mercaptoethanol (Gibco, #21985-023), lOng / pl IL-7 (Peprotech, #200-07) and IL- 15 (Peprotech, #200-15).

[0211] CTL Rejuvenation Protocol

[0212] After isolating CTLs, CTLs were stimulated with Dynabeads Human T- Activator CD3 / CD28 (Gibco, #1113 ID) 3 days before SeV vector infection. On day 0, the cells were counted and infected with three SeV vectors: 1) polycistronic KLF4-OCT4-SOX2 at a multiplicity of infection (MOI) of 5, 2) CMYC at a MOI of 3, and 3) modified KLF4 at a MOI of 5, respectively. Just after adding SeV vector, cells were centrifuged 1200 xg for 2 hrsat room temperature (also called “spinoculation”), and then incubated at 35°C. On day 1, cells were seeded on iMatrix-511 silk (Amsbio, #AMS.892.021) coated plates and the medium was changed to NutriStem hPSC XF Culture Medium for Human iPS and ES Cells (Reprocell, #01-0005). Medium was replaced every other day. On day 7 or 9 or 11, the cells were detached from the plate using TrypLE Select Enzyme (Gibco, #12563011). Then cells were sorted by the cell sorter and returned to the T-cell culture environment as shown above. At the same time, the cell culture temperature was raised to 37°C.

[0213] Flow Cytometry

[0214] Cells were stained on ice for 15 min with fluorescent conjugated antibodies. Analyses were performed using Aurora (Cytek Biosciences) flow cytometer. Cell sorting was performed using FACSAria Fusion flow cytometer equipped with FACS Diva software (BD biosciences). The data were analyzed using FlowJo software (LLC). The conjugated antibodies used to detect the surface markers for T cell characterization were: Zombie Violet Fixable Viability Kit (BioLegend, #423113), Pacific Blue anti-human CD57 antibody (BioLegend, #359607), Brilliant Violet 510 anti-human CD28 antibody (BioLegend, #302935), Brilliant Violet 570 anti-human CD8a antibody (BioLegend, #301037), Brilliant Violet 605 anti-human CD3 antibody (BioLegend, #300459), Brilliant Violet 650 anti-human CD223 (LAG-3) antibody (BioLegend, #369315), Brilliant Violet 711 anti-human CD45RA antibody (BioLegend, #304137), Brilliant Violet 750 anti-human CD4 antibody (BioLegend, #344643), Brilliant Violet 785 anti-human CD279 (PD-1) antibody (BioLegend, #329929), Brilliant Violet 785 anti-human CD279 (PD-1) antibody (BioLegend, #329929), PE / Cyanine5 anti-human CD27 antibody (BioLegend, #302857), KLRG1 Monoclonal Antibody PE-Cyanine7 (eBioscience, #25-9488-42), PE / Fire 810 anti-human CD366 (Tim-3) antibody (BioLegend, #345059), Alexa Fluor700 anti-human CD25 Antibody (Biolegend, #302621), and APC / Cyanine7 anti-human CD197 (CCR7) Antibody (Biolegend, #353211). The conjugated antibodies used to detect the early markers indicating pluripotency were Alexa Fluor647 anti-human TRA-1-60-R Antibody (Biolegend, #330605), and PE / Dazzle 594 anti-human SSEA-4 antibody (BioLegend, #330415).

[0215] For HDF rejuvenation analysis, Brilliant Violet 785 or PE-Cy7 anti-human CD13 Antibody (Biolegend, #301725, and #3031712), and APC anti-human SSEA-5 Antibody (Biolegend, #355209) was used.

[0216] For HAEC rejuvenation analysis, APC-Cy7 anti-human CD31 Antibody (Biolegend, #303120), and APC anti-human SSEA4 antibody (Biolegend, #330418) was used.

[0217] Cytokine Secretion Analysis

[0218] The cell culture medium from CTLs was collected 4 days after CD3 / CD28 stimulation. Samples were processed using the LEGENDplex™ Human CD8 / NK Panel (Biolegend, #741186) according to the manufacturer's protocol, and data were acquired using an Attune Flow Cytometer (Thermo).

[0219] Cell Metabolism Analysis

[0220] Mitochondrial function of T cells including oxygen consumption rate (OCR) was measured using Seahorse XFe96 Flux Analyzer (Agilent) and Seahorse XF T Cell Metabolic Profiling Kit (Agilent, #103772-100) according to protocol provided by the manufacturer. The spare respiratory capacity was calculated as the difference between basal and FCCP-induced OCR (Nicholas et al., 2017).

[0221] Culturing Human Dermal Fibroblasts

[0222] Human dermal fibroblasts (HDFs) were obtained from Lonza (#CC-2511).HDFs were seeded on gelatin (STEMCELL Technologies, #07903) coated plate and maintained in Dulbecco’s modified Eagle medium containing GlutaMAX (Gibco #10566- 016) supplemented with 10% fetal bovine serum (Sigma, #F4135), lOOx NEAA (Gibco, #11140050) and lOOOx 2-Mercaptoethanol (Gibco, #21985-023).

[0223] HDF Rejuvenation Protocol

[0224] HDFs were seeded on the gelatin coated culture plates one day prior SeV vector infection. On day 0, the cells were counted and infected with three SeV vectors: 1) polycistronic KLF4-OCT4-SOX2 at a multiplicity of infection (MOI) of 5, 2) CMYC at a MOI of 3, and 3) modified KLF4 at a MOI of 5, respectively. After adding the vectors, cells were incubated at 35°C. On day 2, cells were dissociated using TrypLE Select Enzyme and the cells positive for GFP and OFP were sorted using FACSAria Fusion (BD). Sorted cells were seeded on iMatrix-511 silk (Amsbio, #AMS.892.021) coated plates. On day 7, the cells were sorted again by detecting SSEA5 or CD13 and reseeded on iMatrix-511 silk coated plates. The next day (day 8), the medium was changed to NutriStem hPSC XF Culture Medium for Human iPS and ES Cells (Reprocell, #01-0005) and replaced every other day. On day 11 or14, the cells were passaged onto gelatin coated plates and returned to the HDF culture environment as shown above. At the same time, the cell culture temperature was raised to 37°C.

[0225] Senescence-Associated Beta-Galactosidase (SA-|J-gal) Quantification

[0226] SA-P-gal was quantified using CellEvent Senescence Green Flow Cytometry Assay Kit (Invitrogen, #C 10840) according to manufacturer’s protocol. The intensity of SA- P-gal was calculated by dividing the Mean Fluorescence Intensity (MFI) of the CellEvent- stained sample by the unstained MFI of the same sample.

[0227] qPCR

[0228] RNA was extracted using AllPrep DNA / RNA Mini Kit (QIAGEN, #80204) and incubated with RNase-Free DNase Set (QIAGEN, #79254) to remove genomic DNA. For qPCR, the reverse transcription reaction was performed with 1 pg of DNase-treated RNA using PrimeScript RT Master Mix (Takara, #RR036B) containing oligo dT primer and random 6 mers. qPCR analysis was performed on StepOne Plus (Applied Biosystems) using TaqMan Fast Advanced Master Mix (Applied Biosystems) according to the manufacturer’s protocol.

[0229] Culturing Human Aortic Endothelial Cells

[0230] Human aortic endothelial cells (HAECs) were obtained from Lonza (#CC- 2535). HAECs were seeded on gelatin (STEMCELL Technologies, #07903) coated plate and maintained in EGM-2 Endothelial Cell Growth Medium-2 (Lonza #CC-3162).

[0231] HAEC Rejuvenation Protocol (see, FIGS. 48 and 49)

[0232] HAECs were seeded on the gelatin coated culture plates one day prior SeV vector infection. On day 0, the cells were counted and infected with three SeV vectors: 1) polycistronic KLF4-OCT4-SOX2 at a multiplicity of infection (MOI) of 5, 2) CMYC at a MOI of 3, and 3) modified KLF4 at a MOI of 5, respectively. After adding the vectors, cells were incubated at 35°C. From the following day, the HAEC medium was replaced every other day.

[0233] On day 7, cells were dissociated using Trypsin-EDTA (0.05%) (Thermo, #25300054) and GFP- and OFP-positive cells were sorted into three groups based on the expression of CD31 and SSEA4 using FACSAria Fusion (BD). Sorted cells were seeded on gelatin coated plates. From the same day, the incubator temperature was set to 38°C.

[0234] On day 14, the cells were passaged onto gelatin coated plates. Cells were passaged by re-seeding onto gelatin-coated plates every 7 days after sorting. The cells obtained during this process were used for flow cytometry and qPCR analyses.

[0235] Generation of HAEC Derived Human iPS cells (See, for example, FIG. 46)

[0236] HAECs were seeded on the gelatin coated culture plates one day prior SeV vector infection. On day 0, the cells were counted and infected with three SeV vectors: 1) polycistronic KLF4-OCT4-SOX2 at a multiplicity of infection (MOI) of 5, 2) CMYC at a MOI of 3, and 3) modified KLF4 at a MOI of 5, respectively. After adding the vectors, cells were incubated at 35°C. From the following day, the HAEC medium was replaced with StemFit Basic04 Complete Type (Amsbio, #50-204-1689), and medium changes were performed every other day until iPSC colonies appeared. After the appearance of iPSC colonies, the culture temperature was increased to 38°C, and well-maintained iPSC colonies were manually picked for cloning.

[0237] DNA Methylation Analysis for Estimating DNA Methylation Clock

[0238] CTLs with OSKM introduced were sorted on day 5, while HDFs and HAECs were sorted on day 7 using the cell sorter. Sampling for each cell group was conducted based on the expression of specific markers. DNA was extracted using AllPrep DNA / RNA Mini Kit (QIAGEN, #80204), and DNA methylation array chips were prepared using Infmium MethylationEPIC V2.0 Kit (Illumina, #20087708). Scanning of the chips was performed using iSCAN system (Illumina). The obtained data were analyzed using GenomeStudio (Illumina) and R (The R Foundation) software.

[0239] RESULTS

[0240] Sendai virus vectors with high gene transfer efficiency for transient reprogramming were used. Commercially available Sendai virus vectors such as CytoTune- iPS were considered inappropriate for transient reprogramming because it is difficult to control their expression once they infect cells. Therefore, an improved temperature-sensitive Sendai virus vector system was used to adjust the timing of reprogramming factor expression by increasing the culture temperature at specific timing. Furthermore, GFP was added to the SeV-KOS vector and the OFP gene to the SeV-CMYC vector in order to be able to track the cells that the Sendai virus vectors are infecting (FIG. 1).

[0241] Unstimulated cytotoxic T cells (CTLs) were infected with the SeV vectors, but the infection efficiency was extremely low (FIG. 2A). To overcome this problem, CTLs were stimulated with CD3 and CD28 three days before the SeV infection, using the spinoculation technique. Consequently, the infection efficiency improved to 30-50 % (FIGS. 2B, 3B). When the SeV-infected cells were cultured at 35°C, almost all cells were still SeV-positive after one week (FIG. 3C), but when the culture temperature was increased to 37°C, almost all SeV vectors disappeared (FIG. 3D). In addition, it was confirmed that iPS cells can be generated in both human dermal fibroblasts (HDFs) and CTLs when SeV-infected cells are continuously cultured at 35°C (FIGS. 4A and 4B). It was also confirmed that IL-7 and IL-15 significantly improved CTLs’ survival compared to IL-2 (FIGS. 5 A, 5B), so IL-7 and IL- 15 containing media instead of IL-2.

[0242] Based on these results, a CTL rejuvenation protocol was designed (FIG. 6). Three days before the SeV vectors infection, CTLs were stimulated with CD3 and CD28. On day 0, SeV vectors were infected with spinoculation and the temperature decreased to 35°C to avoid SeV vector inactivation. On day 1, the cells were washed and the medium was changed from T cell culture medium to iPSC medium, NutriStem. At the same time, the cells were plated on iMatrix-511 coated dish and adhesive culture was started to promote reprogramming.

[0243] After SeV vectors infection, OSKM introduced to CTLs changed their morphology with the day and gradually increased in cell size. On Day 11, there were some iPS cell-like morphological changes (FIG. 7).

[0244] Between day 7 and 11, the cells were dissociated and the SeV-infection efficiency was examined using flow cytometer to check GFP and OFP expression. None of the SeV-Mock infected cells showed GFP and OFP expression (FIG. 8A). On the contrary, almost all of the cells were both GFP and OFP positive in SeV-OSKM introduced CTLs (FIG. 8B). The percentage of the GFP+OFP+cells increased, and the GFP'OFP' cell population decreased as the duration of the reprogramming extended (FIGS. 8C and 8D).

[0245] Next, TRA-1-60 and SSEA4 expression of SeV-OSKM was determined in the GFP+OFP+cells. It was confirmed that SeV-Mock infected CTLs did not show TRA-1-60 or SSEA4 (FIG. 9A). Even on day 7, TRA-l-60+SSEA4+population was higher than that of TRA-1-60 SSEA4’ (FIG. 9B). The percentage of TRA-l-60+SSEA4+of the GFP+OFP+cellsincreased, and TRA-l-60'SSEA4‘ of the GFP+OFP+cells decreased as the duration of the reprogramming increased (FIGS. 9C, 9D).

[0246] CD4 and CD8a expression of SeV-infected CTLs was examined. Almost all of the SeV-Mock infected cells showed CD8a single positive that is same as before the SeV infection (FIG. 10A). However, OSKM-introduced GFP+OFP+cells did not express CD8a (FIGS. 10B, 10C, and 10D). It indicates that these cells were partially reprogrammed by OSKM and lost their CTL characteristics.

[0247] Next, SeV-infected CTLs were sorted on day 7, 9, and 11. First, a GFP+OFP+population was selected (FIG. 11 A), then the TRA-l-60+SSEA4+or TRA- 1-60'S SEA4' population was sorted (FIG. 1 IB). The GFP'OFP' population did not express TRA- 1-60 nor SSEA4 (FIG. 11C).

[0248] Reprogramming was stopped by incubating the cells at 37°C immediately after sorting, and cell morphology and GFP / OFP expression was checked one week later (FIG. 12). The TRA-l-60+SSEA4+or TRA- 1-60'S SEA4' groups were both reduced to about the same size as Mock, and GFP / OFP expression almost disappeared. At the same time, the expression of SSEA4, TRA-1-60, CD4, and CD8a was determined by flow cytometry. TRA- l-60'SSEA4‘ group showed the same results as Mock-infected control group, but some populations of TRA-l-60+SSEA4+group were still SSEA4 or TRA-1-60 positive and both CD4 and CD8a negative and had not regained their CTL characteristics after SeV disappearance (FIG. 13).

[0249] After terminating reprogramming, SeV vector-infected cells were stimulated almost every 2 weeks and cell proliferation was determined. OSKM+TRA-1-60'SSEA4‘ cells that were sorted on day 9 and stopped reprogramming proliferated the most compared to Mock-infected control (FIG. 14).

[0250] Next, on day 41 after the SeV infection, representative T cell marker expression of the cells that were sorted on day 9 were examined and reprogramming was stopped. Despite OSKM+TRA-1-60'SSEA4‘ cells being 10 times more proliferative than Mock-infected cells, the differentiation status was comparable, and the percentage of senescence marker-positive cells was lower (FIG. 15).

[0251] SeV vector-infected cells were then stimulated every week and cell proliferation was examined. OSKM+TRA-1-60'SSEA4‘ cells that were sorted on day 9 andstopped reprogramming proliferated more than 1000 times compared to Mock-infected control (FIG. 16).

[0252] On day 44 after the SeV infection, representative T cell marker expression of the cells that were sorted on day 9 were examined and reprogramming was terminated. Despite OSKM+TRA-1-60 SSEA4‘ cells being 1000 times more proliferative than Mock- infected cells, the differentiation status was comparable, and the percentage of senescence marker-positive cells was lower. The percentage of cells positive for the exhaustion marker was slightly higher in OSKM+TRA-1-60 SSEA4‘, possibly due to the effect of proliferation more than 1000-fold. (FIG. 17).

[0253] More proliferative and functional CTLs such as naive CTLs are known to have higher mitochondrial function. An extracellular flux analyzer (Agilent Seahorse) was used to examine mitochondrial function of CTLs after SeV infection. OSKM+TRA- 1-60'S SEA4' cells showed the highest OCR after FCCP administration at 40 min (FIG. 18A), and highest spare respiratory capacity among the comparison groups (FIG. 18B).

[0254] Modified SeV vectors were also used for HDF rejuvenation (FIG. 19). In HDF rejuvenation, after the SeV infection, SeV-infected HDFs were sorted on day 2 to select GFP+OFP+cells. Then the cells were seeded onto iMatrix-511 -coated cell culture dish, and the cells were again sorted on day 7 by detecting CD 13 and SSEA5. The next day, the medium was changed to Nutristem to accelerate reprogramming. Between day 11 and 14, the cells were dissociated and reseeded onto gelatin-coated cell culture dish. At the same time, the cell culture temperature was raised to 37°C to stop reprogramming.

[0255] On day 2, about half or more of the cells were GFP+OFP+(FIG. 20A). On day 7, OSKM introduced HDFs significantly changed their morphology (FIG. 20B) compared to the Mock-infected cells (FIG. 20C). About OSKM-introduced GFP+OFP+cells, approximately one-fourth of the cells were CD13+SSEA5‘ and half were CD13'SSEA5+(FIG. 20D).

[0256] The next day after the 2nd sorting (day 8 after the SeV-infection), DI 3' SSEA5+cells showed a circular cell morphology different from original HDF’s spindle shape. CD13+SSEA5‘ cells had mixed population of circular and spindle shape cells (FIG. 21).

[0257] To assess cellular senescence, the intensity of senescence associated P-gal (SA-P-gal) was quantified using CellEvent. SA-P-gal intensity was calculated as the ratio ofunstained to stained MFI for CellEvent. Comparing SA-P-gal before (FIG. 22A) and after 3 passages (FIG. 22B) of the same cell sample, the MFI ratio of SA-P-gal was clearly increased after 3 passages. This suggests that this experimental system is effective for the quantification of SA-P-gal.

[0258] On day 46 after the SeV infection, SA-P-gal intensity was compared among the three groups. The cell morphology was almost the same among them, but Mock-infected cells seemed to have slightly inflated in cell bodies. CD13+SSEA5‘ cells and CD13 SSEA5+cells showed significantly lower SA-P-gal intensity compared to the Mock-infected cells (FIG. 23).

[0259] IL-6 expression was compared as that is known as a senescence marker using qPCR. CD13'SSEA5+cells had the lowest expression of IL-6 among the three groups, and CD13+SSEA5‘ cells also had lower expression than the Mock-infected cells (FIG. 24).

[0260] To investigate whether the differentiation stages of OSKM-introduced CTLs change over time, the differentiation stages of CTLs were classified and analyzed based on CCR7 and CD45RA expression from day 2 to day 9 after SeV-OSKM infection (FIG. 25A). The results revealed an increasing proportion of Central Memory cells over time, suggesting that the differentiation stage of OSKM-introduced CTLs is shifting toward a more Naive-like state. Compared to Control CTLs with only GFP and OFP introduced, OSKM-introduced CTLs showed an increased proportion of Central Memory and Naive cells, while the proportions of Effector Memory and TEMRA cells decreased (FIG. 25B).

[0261] To analyze cells at each reprogramming stage in greater detail, reprogramming CTLs were divided into three groups based on CD8a and SSEA4 expression (FIG. 26). Group 1, characterized by CD8a-positive and SSEA4-negative cells, decreased in proportion over time after OSKM introduction. Group 2, characterized by CD8a-negative and SSEA4- negative cells, initially increased in proportion before decreasing, while Group 3, characterized by CD8a-negative and SSEA4-positive cells, steadily increased in proportion over time. These findings demonstrate that analyzing CD8a and SSEA4 expression is a useful approach for visualizing the reprogramming stages of CTLs.

[0262] Subsequent optimization revealed that sorting cells on day 5 and increasing the culture temperature to 38°C on the same day resulted in more active CTLs (FIG. 27). In this modified protocol, GFP- and OFP-positive cells were gated on day 5, followed by classification into three groups based on CD8a and SSEA4 expression within that cellpopulation (FIG. 28). In the Control group, where only GFP and OFP were introduced, only Group 1 cells were selected.

[0263] DNA from each cell group sorted on day 5 was extracted, and the DNA methylation clock was analyzed using a DNA methylation array (FIG. 29). All groups showed a significant decrease in DNA methylation age compared to the Control, indicating a rejuvenation of biological age.

[0264] To verify whether the removal of SeV facilitated by the increased temperature effectively halts reprogramming, cells sorted as Group 1 on day 5 were cultured at 38°C. The expression of CD8a and SSEA4 in these cells was monitored daily from day 6 to day 11 (FIG. 30). Throughout the observation period, the majority of cells remained in Group 1, indicating that SeV removal facilitated by the increased temperature effectively halts the reprogramming process.

[0265] Cells classified as Group 2 on day 5 showed up to 40% transitioning into Group 3 over the subsequent 2-3 days (FIG. 31). This suggests that once CTLs reach this state, halting reprogramming becomes challenging.

[0266] Cells classified as Group 3 on day 5 predominantly remained in Group 3 without transitioning (FIG. 32). This indicates that this state is irreversible in the context of reprogramming and unsuitable for partial reprogramming.

[0267] Seven days after cell sorting (12 days post-SeV infection), the expression of GFP / OFP and CD8a / SSEA4 was analyzed in Group 1, Group 2, and Control CTLs (FIG. 33). In Group 1, nearly all cells were GFP and OFP negative, expressed only CD8a, and exhibited characteristics consistent with original CTLs. In Group 2, more than half of the cells were GFP or OFP positive, and approximately half were CD8a negative. These findings suggest that even after raising the temperature to 38°C to remove SeV, about half of the cells in Group 2 failed to regain the characteristics of original CTLs, indicating that Group 2 is unsuitable for partial reprogramming.

[0268] On day 5, cell sorting and temperature elevation to 38°C were initiated, and CD3 / CD28 stimulation was applied weekly to track the proliferation of Group 1, Group 2, and Control CTLs until day 33 (FIG. 34). Group 1 exhibited significantly superior cell proliferation compared to the Control. In contrast, Group 2 showed early cessation of cell proliferation, suggesting that Group 2 cells failed to regain CTL characteristics and could not respond to CD3 / CD28 stimulation.

[0269] Focusing on the Group 1 cell population, we evaluated CTL activity beyond cell proliferation by comparing the secretion levels of fFNy and Perforin, cytokines specifically secreted by active CTLs, in the culture medium on day 25 (FIG. 35). Group 1 CTLs showed significantly higher secretion of fFNy and Perforin compared to the Control, indicating that Group 1 cells were more activated than the Control.

[0270] Mitochondrial function of Group 1 and Control CTLs was compared on day 25 using the Seahorse assay (FIG. 36). Group 1 CTLs exhibited higher OCR and spare respiratory capacity, indicating superior mitochondrial function.

[0271] To determine whether the reprogramming process of human dermal fibroblasts (HDFs) could be visualized based on the expression of representative markers, as with CTLs, the expression of CD 13 and SSEA5 was analyzed daily in OSKM-positive cells following the introduction of SeV-OSKM (FIG. 37). Over time, the proportion of CD 13 -positive, SSEA5- negative Group 1 cells decreased, while CD 13 -negative, SSEA5 -negative Group 2 cells initially increased before declining. In contrast, CD 13 -negative, SSEA5 -positive Group 3 cells showed an increasing proportion over time. These results demonstrate that using CD 13 and SSEA5 enables detailed classification and analysis of cells during the reprogramming process. Based on these results, we focused on day 7, the time point when Group 2 and Group 3 showed significant changes in their proportions.

[0272] In the modified protocol (FIG. 38), HDF sorting was performed only once on day 7 to minimize cell stress and loss due to sorting. Since partial iPSC formation was observed when using NutriStem, only HDF-specific medium was used throughout the experiment. After sorting, the culture temperature was increased to 38°C, and to further enhance cell survival, cells were cultured in a 2% O2 environment.

[0273] Similar to the sorting strategy for CTLs, on day 7, HDFs were detached from the culture dish, and GFP- and OFP-positive cells were first gated (FIG. 39). These cells were then classified into Group 1, Group 2, and Group 3 based on CD 13 and SSEA5 expression, sorted accordingly, and used for subsequent analyses.

[0274] On day 7, DNA was extracted from OSKM-positive HDFs sorted into Group 1, Group 2, and Group 3, and their DNA methylation age was calculated (FIG. 40). All three groups showed a significant decrease in DNA methylation age compared to the Control, indicating rejuvenation of biological age.

[0275] Observation of the cells on the day following cell sorting and temperature elevation to 38°C (day 8) revealed notable morphological changes, particularly in Group 2and Group 3, compared to the Control (FIG. 41). Even in Group 1, a certain proportion of cells displayed a clear transition from a spindle shape to a smaller, round shape.

[0276] Seven days after cell sorting (day 14 post-SeV infection), cell morphology and the expression of GFP, OFP, CD13, and SSEA5 were observed (FIG. 42). All groups contained a certain proportion of GFP- or OFP-positive cells, with the fewest in Group 1 and the most in Group 3. Additionally, Group 1 had the highest proportion of CD 13 -positive and SSEA5 -negative cells, whereas approximately half of the cells in Group 3 were CD 13- negative. These findings indicate that the recovery of CD 13 expression is slower as reprogramming progresses.

[0277] A similar observation was conducted seven days later (day 21) (FIG. 43). By this point, all groups had become GFP- and OFP-negative and exhibited CD13-positive and SSEA5 -negative characteristics. These results indicate that even Group 3 cells in HDFs can regain the traits of original dermal fibroblasts, demonstrating that partial reprogramming is reversible in this context.

[0278] SA-P gal activity on day 28 post-OSKM introduction was quantitatively assessed using CellEvent (FIG. 44). All groups showed a reduction in MFI ratio compared to the Control, with the most pronounced decrease observed in Group 1. This indicates that, similar to DNA methylation age, rejuvenation of HDFs occurs even in Group 1.

[0279] On day 25, the expression of IL-6, a representative senescence marker, was compared using qPCR (FIG. 45). All groups exhibited relatively lower IL-6 expression compared to the Control, with Groups 2 and 3 showing a significant reduction.

[0280] Following CTLs and HDFs, we investigated whether this method could also induce cellular rejuvenation in human aortic endothelial cells (HAECs). Since no reports were found on the direct establishment of iPS cells from HAECs, it was first tested whether iPS cells could be generated directly from HAECs using the vector employed in this method. As a result, iPS cells were successfully established from HAECs derived from all four donors (FIG. 46). However, the reprogramming efficiency was less than one-tenth that of HDFs, making iPS cell generation from HAECs significantly more challenging compared to CTLs and HDFs. These findings demonstrate that this method may also be effective for partial reprogramming and cellular rejuvenation in HAECs.

[0281] To investigate the reprogramming process in HAECs, the expression patterns of CD31, a representative endothelial marker, and SSEA4, an early reprogramming marker, were tracked daily up to day 12 after SeV-OSKM infection (FIG. 47). Reflecting the lowreprogramming efficiency, CD31 -negative, SSEA4-positive Group 3 cells rarely appeared by day 12. The proportion of Group 2 cells peaked around day 7, leading to the decision to perform cell sorting and increase the temperature on this day.

[0282] The protocol for cellular rejuvenation through partial reprogramming in HAECs was similar to that for HDFs, with HAEC-specific medium consistently used throughout (Fig.48). Cell sorting and temperature elevation were performed on day 7.

[0283] For cell sorting on day 7, GFP- and OFP-positive cells were first gated, and this population was further classified into Group 1, 2, and 3 based on CD31 and SSEA4 expression (FIG. 49). However, since very few Group 3 cells were obtained, subsequent analyses could not be performed for this group.

[0284] DNA was extracted from each cell group sorted on day 7, and DNA methylation arrays were performed to calculate the DNA methylation clock (FIG. 50). Both Group 1 and Group 2 exhibited a significant decrease in DNA methylation age, indicating that biological age rejuvenation also occurred in HAECs.

[0285] Observation of cell morphology on the day following sorting (day 8) revealed that both Group 1 and Group 2 had transitioned to a smaller cell morphology compared to the Control (FIG. 51). This indicates that reprogramming had progressed to some extent in all groups.

[0286] The expression of GFP, OFP, CD31, and SSEA4 was analyzed seven days after cell sorting (day 14) (FIG. 52). Both Group 1 and Group 2 contained a certain proportion of GFP- or OFP-positive cells, but the proportion was lower in Group 1. Additionally, nearly all cells in both groups expressed CD31.

[0287] The expression of GFP, OFP, CD31, and SSEA4 was observed seven days later (day 21) (FIG. 53). In all groups, GFP and OFP were negative, confirming complete removal of SeV.

[0288] Cell proliferation after sorting was compared (FIG. 54). In HAECs from three out of four donors, OSKM+HAECs, particularly those in Group 2, exhibited higher proliferative capacity. This indicates that OSKM introduction and partial reprogramming improved the cellular function of HAECs.

[0289] IL-6 expression on day 14 was compared using qPCR (FIG. 55). Both Group 1 and Group 2 showed significantly lower IL-6 expression compared to the Control. Together with the results of DNA methylation age and cell proliferation, this indicates that partial reprogramming contributed to the functional rejuvenation of HAECs.OTHER EMBODIMENTS

[0290] From the foregoing description, it will be apparent that variations and modifications may be made to the disclosure described herein to adopt it to various usages and conditions. Such embodiments are also within the scope of the following claims.

[0291] All citations to sequences, patents and publications in this specification are herein incorporated by reference to the same extent as if each independent patent and publication was specifically and individually indicated to be incorporated by reference. By their citation of various references in this document, Applicants do not admit any particular reference is “prior art” to their disclosure.

Claims

What is claimed:

1. A method of rejuvenating a cell comprising: reprogramming the cell by infecting the cell with one or more temperature sensitive vectors, wherein the one or more temperature sensitive vectors comprise at least one reprogramming factor comprising OCT4, SOX2, KLF4, CMYC or combinations thereof, incubating the infected cells at a permissive temperature for two or more days wherein the infected cells transiently express one or more reprogramming factors; terminating reprogramming of the cells prior to the step of forming induced pluripotent stem cells (iPS), thereby, rejuvenating the cell.

2. The method of claim 1, wherein the temperature sensitive vector is a virus vector.

3. The method of claim 2, wherein the virus vector is a Sendai virus vector.

4. The method of claim 3, wherein the Sendai virus vector is modified.

5. The method of claims 3 or 4, wherein the modified Sendai virus vector is lacking an F gene.

6. The method of claims 4 or 5, wherein the modified Sendai virus vector comprises one or more point mutations in the Sendai virus P gene.

7. The method of claim 5, wherein the modified Sendai virus vector further comprises a micro RNA (miRNA) sequence inserted after the Sendai virus vector P gene.

8. The method of claim 6, wherein the miRNA sequence comprises tcaccattgctaaagtgcaattcgattcaccattgctaaagtgcaatt (SEQ ID NO: 1).

9. The method of any one of claims 1-5, wherein the modified Sendai virus vector further comprises one or more selectable markers.

10. The method of claim 1, wherein the reprogramming is terminated by incubating the transfected cells at a non-permissive temperature following incubation at the permissive temperature.

11. The method of claim 10, wherein the rejuvenated cells express stem cell markers during reprogramming.

12. The method of claim 11, wherein the stem cell markers comprise: Oct4, Nanog, Tra- 1-60, SOX2, or SSEA4.

13. The method of claim 1, wherein the cell comprises: immune cells, fibroblasts, endothelial cells, epithelial cells, myocytes, neural cells, brain cells or combinations thereof.

14. The method of claim 13, wherein the cells are isolated from a subject.

15. The method of claim 13, wherein the cells are isolated from one or more sources comprising: autologous, allogeneic, haplotype matched, haplotype mismatched, haplo- identical, xenogeneic, cell lines or combinations thereof.

16. The method of claim 15, wherein immune cells comprise: T cells, CAR-T cells, CAR- NK cells, B cells, natural killer (NK) cells, or myeloid-derived cells.

17. A method of rejuvenating a cytotoxic T lymphocyte (CTL) comprising: stimulating isolated CTLs at least two days before reprogramming the CTLs, reprogramming the CTLs by transfecting the CTL with one or more temperature sensitive vectors, wherein the one or more temperature sensitive vectors comprise at least one reprogramming factor comprising OCT4, SOX2, KLF4, CMYC, or combinations thereof, incubating the transfected cells at a permissive temperature for two or more days wherein the infected cells transiently express one or more reprogramming factors; terminating reprogramming of the CTLs prior to the step of forming induced pluripotent stem cells (iPS), thereby, rejuvenating the CTL.

18. The method of claim 17, wherein the temperature sensitive vector is a virus vector.

19. The method of claim 18, wherein the virus vector is a Sendai virus vector.

20. The method of claim 19, wherein the Sendai virus vector is modified.

21. The method of claim 20, wherein the modified Sendai virus vector is lacking an F gene.

22. The method of claim 20, wherein the modified Sendai virus vector comprises one or more point mutations in the Sendai virus P gene.

23. The method of any one of claims 20-22, wherein the modified Sendai virus vector further comprises a micro RNA (miRNA) sequence inserted after the Sendai virus vector P gene.

24. The method of claim 23, wherein the miRNA sequence comprises tcaccattgctaaagtgcaattcgattcaccattgctaaagtgcaatt (SEQ ID NO: 1).

25. The method of any one of claims 20-23, wherein the modified Sendai virus vector further comprises one or more selectable markers.

26. The method of claim 17, wherein the reprogramming is terminated by incubating the transfected cells at a non-permissive temperature following incubation at the permissive temperature.

27. The method of claim 17, wherein the CTLs are cultured up to eleven days on a coated tissue culture dish.

28. The method of any one of claims 17-27, wherein the culture medium comprises IL-7 and IL-15.

29. The method of claim 17, wherein the rejuvenated CTLs express stem cell markers during reprogramming comprising: Oct4, Nanog, Tra-1-60, SOX2, or SSEA4.

30. The method of claim 17, wherein the rejuvenated CTLs do not express stem cell comprising: Oct4, Nanog, Tra-1-60, SOX2, or SSEA4.

31. The method of claim 17, wherein the CTLs transiently lose expression of CD8 during reprogramming.

32. The method of any one of claims 17-31, wherein the CTLs are infected using the method of spinoculation.

33. A method of rejuvenating a fibroblast comprising: reprogramming the fibroblast by transfecting the fibroblast with one or more temperature sensitive vectors, wherein the one or more temperature sensitive vectors comprise at least one reprogramming factor comprising OCT4, SOX2, KLF4, CMYC or combinations thereof, incubating the transfected fibroblasts at a permissive temperature for two or more days wherein the infected cells transiently express one or more reprogramming factors;terminating reprogramming of the cells prior to the step of forming induced pluripotent stem cells (iPS), thereby, rejuvenating the cell.

34. The method of claim 33, wherein the temperature sensitive vector is a virus vector.

35. The method of claim 34, wherein the virus vector is a Sendai virus vector.

36. The method of claim 35, wherein the Sendai virus vector is modified.

37. The method of claim 36, wherein the modified Sendai virus vector is lacking an F gene.

38. The method of claims 36 or 37, wherein the modified Sendai virus vector comprises one or more point mutations in the Sendai virus P gene.

39. The method of any one of claims 34-36, wherein the modified Sendai virus vector further comprises a micro RNA (miRNA) sequence inserted after the Sendai virus vector P gene.

40. The method of claim 40, wherein the miRNA sequence comprises tcaccattgctaaagtgcaattcgattcaccattgctaaagtgcaatt (SEQ ID NO: 1).

41. The method of any one of claims 33-40, wherein the modified Sendai virus vector further comprises one or more selectable markers.

42. The method of claim 33, wherein the reprogramming is terminated by incubating the transfected cells at a non-permissive temperature following incubation at the permissive temperature.

43. The method of claim 33, wherein the fibroblasts are cultured on a coated tissue culture dish.

44. The method of claim 31, wherein the rejuvenated fibroblasts do not express stem cell markers.

45. The method of claim 44, wherein the stem cell markers comprise: Oct4, Nanog, Tra- 1-60, SOX2, or SSEA5.

46. A modified Sendai virus vector wherein the Sendai virus vector is a temperature sensitive vector is a virus vector comprising nucleic acid sequences encoding OCT4, SOX2, KLF4, CMYC (OSKM) or combinations thereof.

47. The modified Sendai virus vector of claim 46, wherein the vector lacks an F gene.

48. The modified Sendai virus vector of claims 46 or 47, wherein the modified Sendai virus vector comprises one or more point mutations in the Sendai virus P gene.

49. The modified Sendai virus vector of any one of claims 46-48, wherein the modifiedSendai virus vector further comprises a micro RNA (miRNA) sequence inserted after the Sendai virus vector P gene.

50. The modified Sendai virus vector of claim 49, wherein the miRNA sequence comprises tcaccattgctaaagtgcaattcgattcaccattgctaaagtgcaatt (SEQ ID NO: 1).

51. A method of treating cancer, comprising: administering to the subject, a rejuvenated cytotoxic T lymphocyte (CTL) of claims 17-32, wherein the rejuvenated CTL specifically targets the subject’s cancer cells.

52. The method of claim 51, wherein the rejuvenated CTLs are autologous.

53. The method of claims 51 or 52, wherein the rejuvenated CTLs are cultured ex vivo with a sample of the subject’s cancer.

54. The method of claim 53, wherein the CTLs are reinfused into the subject.

55. A method of rejuvenating one or more desired cell types in a subject comprising: obtaining a biological sample from the subject, isolating the desired cell type from the biological sample, reprogramming the desired cell type by transforming the cell with one or more temperature sensitive vectors, wherein the one or more temperature sensitive vectors comprise at least one reprogramming factor comprising OCT4, SOX2, KLF4, CMYC or combinations thereof, incubating the transfected cells at a permissive temperature for two or more days wherein the infected cells transiently express one or more reprogramming factors; terminating reprogramming of the cells prior to the step of forming induced pluripotent stem cells (iPS), thereby, rejuvenating the cell.

56. The method of claim 55, wherein the temperature sensitive vector is a modified Sendai virus vector.

57. The method of claim 56, wherein the modified Sendai virus vector is lacking an F gene.

58. The method of claim 55 or 56, wherein the modified Sendai virus vector comprises one or more point mutations in the Sendai virus P gene.

59. The method of any one of claims 55-58, wherein the modified Sendai virus vector further comprises a micro RNA (miRNA) sequence inserted after the Sendai virus vector P gene.

60. The method of any one of claims 55- 57, wherein the miRNA sequence comprises tcaccattgctaaagtgcaattcgattcaccattgctaaagtgcaatt (SEQ ID NO: 1).

61. The method of any one of claims 55-58, wherein the modified Sendai virus vector further comprises one or more selectable markers.

62. The method of claim 55, wherein the reprogramming is terminated by incubating the transfected cells at a non-permissive temperature following incubation at the permissive temperature.

63. The method of claim 55, wherein the rejuvenated cells do not express stem cell markers comprising Oct4, Nanog, Tra-1-60, SOX2, or SSEA.

64. The method of claim 55, wherein the cell comprises: immune cells, fibroblasts, endothelial cells, epithelial cells, myocytes, neural cells, brain cells or combinations thereof.

65. The method of claim 64, wherein the cells are isolated from a subject.

66. The method of claim 64, wherein the cells are isolated from one or more sources comprising: autologous, allogeneic, haplotype matched, haplotype mismatched, haplo- identical, xenogeneic, cell lines or combinations thereof.

67. The method of claim 64 wherein immune cells comprise: T cells, CAR-T cells, B cells, natural killer (NK) cells, CAR-NK cells or myeloid-derived cells.

Citation Information

Patent Citations

  • Vectors for generating pluripotent stem cells and methods of producing pluripotent stem cells using the same

    US9365866B2

  • Method for producing naive human ips cells from somatic cells

    WO2022138964A1