Modular microrna expression from self-replicating RNA (replicons)

Engineered self-replicating RNAs express hybrid pre-miRNAs with user-defined targeting sequences, addressing the limitations of existing microRNA therapies by achieving stable and targeted downregulation of pathological RNAs and proteins.

WO2025155837A1PCT designated stage expired Publication Date: 2025-07-24MASSACHUSETTS INST OF TECH
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/012055
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-01-19
Filing Date
2025-01-17
Publication Date
2025-07-24

AI Technical Summary

Technical Problem

Existing therapeutic approaches for microRNA expression, such as lipid- or polymer-based vectors and viral vectors, face challenges like low organ specificity, high clearance, and lack of fine-tuned regulation, making them ineffective for targeted downregulation of disease-associated mRNA and proteins.

Method used

Engineered self-replicating RNAs (replicons) are developed to express hybrid pre-miRNAs with user-defined targeting sequences, reducing immunogenicity and clearance, and inducing less innate antiviral activity, allowing for selective targeting and degradation of target RNAs.

Benefits of technology

The engineered replicons provide stable and targeted microRNA expression, effectively downregulating pathological RNAs and proteins, while maintaining genomic integrity and reducing host cell toxicity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025012055_24072025_PF_FP_ABST
    Figure US2025012055_24072025_PF_FP_ABST
Patent Text Reader

Abstract

Described herein are hybrid pre-miRNAs comprising user-defined targeting sequences. In some embodiments, these hybrid pre-miRNAs have greater stability when encoded by engineered self-replicating ribonucleic acids (RNAs) ("replicons") compared to non-hybrid pre-miRNAs. Also provided herein are engineered replicons comprising hybrid pre-miRNAs and, optionally, encoding additional payloads.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] MODULAR MICRORNA EXPRESSION FROM SELF-REPLICATING RNA (REPLICONS)

[0002] RELATED APPLICATIONS

[0003] This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 63 / 623,196, filed January 19, 2024, and entitled “MODULAR MICRORNA EXPRESSION FROM SELF -REPLICATING RNA (REPLICONS),” the content of which is hereby incorporated by reference herein in its entirety for all purposes.

[0004] FEDERALLY SPONSORED RESEARCH

[0005] This invention was made with government support under CA265706 awarded by the National Institutes of Health, and MCB2116037 awarded by the National Science Foundation. The government has certain rights in the invention.

[0006] REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0007] The contents of the electronic sequence listing (M065670548WO00-SEQ-JRV.xml; Size: 80,781 bytes; and Date of Creation: January 16, 2025) is herein incorporated by reference in its entirety.

[0008] BACKGROUND

[0009] MicroRNAs are small non-coding RNAs involved in downregulation or degradation of target mRNAs in many biological processes. Altered microRNA expression is associated with many diseases, such as multiple types of cancer and cardiovascular diseases. Therapeutic approaches targeting dysregulated microRNA profiles include mature, pre- microRNA, chemically modified microRNA or antisense oligonucleotides delivered by lipid- or polymer-based vectors, and plasmid-expressed microRNAs delivered by viral vectors. However, these approaches have some disadvantages, such as low organ specificity, high clearance, and lack of fine-tuned regulation.

[0010] SUMMARY

[0011] Described herein, in some aspects, are self-replicating ribonucleic acids (RNAs) (replicons) engineered to provide microRNA (miRNA) (e.g., hybrid pre-miRNA). Typically, miRNA biogenesis from deoxyribonucleic acids (DNA) (e.g., genomic DNA, plasmids) involves transcription of pre-miRNA and then cleavage and processing (e.g., via DICER, Ago2) into mature miRNA. Mature miRNA comprise targeting sequences which specifically bind to target sites on target mRNA, allowing for its subsequent degradation and / or downregulation of proteins encoded by the target mRNA. Due to cleavage of RNAs, miRNA expression has not seemed feasible from RNA-based delivery systems; however, certain selfreplicating RNA viruses have been shown to express miRNAs without reduction in genomic integrity or replication. The inventors have appreciated that self-replicating RNAs (replicons) can be used to express miRNA in cells with reduced immunogenicity, reduced clearance by host cells, reduced induction of toxicity in host cells, and reduced induction of innate antiviral activity in host cells.

[0012] The inventors have also appreciated that certain viral miRNA scaffolds can be used to create modular, hybrid pre-miRNA that contain user-defined targeting sequences and that are deliverable by RNA-based delivery systems, such as engineered replicons described herein. Such hybrid pre-miRNA may be useful for, inter alia, selective targeting and degradation of target RNAs for therapeutic purposes (e.g., downregulation of disease-associated mRNA and / or encoded proteins) and / or RNA-based gene network regulatory purposes.

[0013] Described herein, in some aspects, is a hybrid pre-micro ribonucleic acid (pre- miRNA), comprising a scaffold and user-defined targeting sequence (UTS), wherein the scaffold comprises a guide strand stem domain, a passenger strand stem domain, and a terminal loop, wherein the guide strand stem domain comprises a pre-miR-BART2 guide strand stem domain or a pre-miR-BART17 guide strand stem domain, and wherein the passenger strand stem domain comprises a pre-miR-BART2 passenger strand stem domain; and wherein the UTS is not a pre-miR-BART2 targeting sequence.

[0014] In some embodiments, the guide strand stem domain comprises a pre-miR-BART2 guide strand stem domain. In some embodiments, the pre-miR-BART2 guide strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 79. In some embodiments, the pre-miR-BART2 guide strand stem domain consists of the sequence set forth in SEQ ID NO: 79.

[0015] In some embodiments, the guide strand stem domain comprises a pre-miR-BART17 guide strand stem domain. In some embodiments, the pre-miR-BART17 guide strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 82. In some embodiments, the pre-miR-BART17 guide strand stem domain consists of the sequence set forth in SEQ ID NO: 82. In some embodiments, the terminal loop comprises a pre-miR-BART2 terminal loop. In some embodiments, the pre-miR-BART2 terminal loop comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 81. In some embodiments, the pre-miR-BART2 terminal loop consists of the sequence set forth in SEQ ID NO: 81.

[0016] In some embodiments, the guide strand stem domain comprises a pre-miR-BART2 guide strand stem domain, the passenger strand stem domain comprises a pre-miR-BART2 passenger strand stem domain, and the terminal loop comprises a pre-miR-BART2 terminal loop. In some embodiments, the guide strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 79, the passenger strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 80, and the terminal loop comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 81.

[0017] In some embodiments, the guide strand stem domain comprises a pre-miR-BART17 guide strand stem domain and the passenger strand stem domain comprises a pre-miR- BART2 passenger strand stem domain. In some embodiments, the guide strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 82, and the passenger strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 80.

[0018] In some embodiments, the UTS comprises an miRNA targeting sequence cognate to an miRNA target site in a therapeutic target. In some embodiments, therapeutic target is a target RNA encoding a pathological protein. In some embodiments, the UTS comprises an miRNA targeting sequence selected from Table 2. In some embodiments, the hybrid pre- miRNA comprises a sequence selected from Table 3.

[0019] Described herein, in some aspects, is an RNA polynucleotide comprising the hybrid pre-miRNA described herein in some aspects, is an engineered replicon comprising the hybrid pre-miRNA described herein in some aspects, is an engineered replicon comprising a hybrid pre-micro ribonucleic acid (pre-miRNA), the hybrid pre-miRNA comprising a scaffold and user-defined targeting sequence (UTS), wherein the scaffold comprises a guide strand stem domain, a passenger strand stem domain, and a terminal loop, wherein the guide strand stem domain comprises a pre-miR-BART2 guide strand stem domain or a pre-miR-BART17 guide strand stem domain, and wherein the passenger strand stem domain comprises a pre- miR-BART2 passenger strand stem domain; and wherein the UTS is not a pre-miR-BART2 targeting sequence. In some embodiments, the guide strand stem domain comprises a pre-miR-BART2 guide strand stem domain. In some embodiments, the pre-miR-BART2 guide strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 79. In some embodiments, the pre-miR-BART2 guide strand stem domain consists of the sequence set forth in SEQ ID NO: 79.

[0020] In some embodiments, the guide strand stem domain comprises a pre-miR-BART17 guide strand stem domain. In some embodiments, pre-miR-BART17 guide strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 82. In some embodiments, the pre-miR-BART17 guide strand stem domain consists of the sequence set forth in SEQ ID NO: 82.

[0021] In some embodiments, the terminal loop comprises a pre-miR-BART2 terminal loop. In some embodiments, the pre-miR-BART2 terminal loop comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 81. In some embodiments, the pre-miR-BART2 terminal loop consists of the sequence set forth in SEQ ID NO: 81.

[0022] In some embodiments, the guide strand stem domain comprises a pre-miR-BART2 guide strand stem domain, the passenger strand stem domain comprises a pre-miR-BART2 passenger strand stem domain, and the terminal loop comprises a pre-miR-BART2 terminal loop. In some embodiments, the guide strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 79, the passenger strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 80, and the terminal loop comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 81.

[0023] In some embodiments, the guide strand stem domain comprises a pre-miR-BART17 guide strand stem domain and the passenger strand stem domain comprises a pre-miR- BART2 passenger strand stem domain. In some embodiments, the guide strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 82, and the passenger strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 80.

[0024] In some embodiments, the UTS comprises an miRNA targeting sequence cognate to an miRNA target site in a therapeutic target. In some embodiments, the therapeutic target is a target RNA encoding a pathological protein.

[0025] In some embodiments, the UTS comprises an miRNA targeting sequence selected from Table 2. In some embodiments, the engineered replicon comprises a sequence selected from Table 3. In some embodiments, the engineered replicon further comprises a 3’ UTR. In some embodiments, the 3’ UTR comprises the hybrid pre-miRNA.

[0026] In some embodiments, the engineered replicon comprises a nucleic acid encoding non- structural proteins 1-4 (nsPl-4) of an alphavirus. In some embodiments, the alphavirus is a Venezuelan equine encephalitis virus (VEEV).

[0027] In some embodiments, the engineered replicon further comprises a subgenomic promoter (SGP). In some embodiments, the SGP is an alphavirus SGP In some embodiments, the SGP comprises the sequence set forth in any one of SEQ ID NOs: 74-76. In some embodiments, the SGP is operably linked to the hybrid pre-miRNA. In some embodiments, the engineered replicon further comprises two or more SGPs.

[0028] In some embodiments, the engineered replicon comprises two or more hybrid pre- miRNAs. In some embodiments, the two or more hybrid pre-miRNAs comprise a first hybrid pre-miRNA and a second hybrid pre-miRNA. In some embodiments, the first hybrid pre- miRNA is operably linked to a first SGP and the second hybrid pre-miRNA is operably linked to a second SGP. The engineered replicon of embodiment 50, wherein the first SGP and the second SGP are different.

[0029] In some embodiments, the engineered replicon further comprises a nucleic acid sequence encoding a payload. In some embodiments, the payload is a therapeutic payload. In some embodiments, the payload is a protein. In some embodiments, the payload is a functional nucleic acid.

[0030] In some embodiments, the engineered replicon further comprises a polyadenylation tail (pA).

[0031] In some embodiments, the engineered replicon further comprises a 5’ 7- m ethylguanosine (m7G) cap.

[0032] In some embodiments, the engineered replicon further comprises a miRNA target site. In some embodiments, the miRNA target site is cognate to the UTS. In some embodiments, the engineered replicon further comprises a plurality of miRNA target sites.

[0033] Described herein, in some aspects, is a method of expressing a hybrid pre-miRNA in a cell, the method comprising contacting a cell with the hybrid pre-miRNA described herein, the RNA polynucleotide described herein, or the engineered replicon described herein the cell is a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is in a subject.

[0034] Described herein, in some aspects, is a cell comprising the hybrid pre-miRNA described herein, the RNA polynucleotide described herein, or the engineered replicon described herein in some aspects, is a composition comprising the hybrid pre-miRNA described herein, the RNA polynucleotide described herein, the engineered replicon described herein or the cell described herein.

[0035] Described herein, in some aspects, is a pharmaceutical composition comprising the hybrid pre-miRNA described herein, the RNA polynucleotide described herein, the engineered replicon described herein, or the cell described herein, and a pharmaceutically acceptable carrier.

[0036] Described herein, in some aspects, is a method of expressing a micro ribonucleic acid (miRNA) in a cell, the method comprising contacting the cell with an engineered replicon comprising a hybrid pre-miRNA, wherein the hybrid pre-miRNA comprises a scaffold and user-defined targeting sequence (UTS); wherein the scaffold comprises a guide strand stem domain, a passenger strand stem domain, and a terminal loop, wherein the guide strand stem domain comprises a pre-miR-BART2 guide strand stem domain or a pre-miR-BART17 guide strand stem domain, and wherein the passenger strand stem domain comprises a pre-miR- BART2 passenger strand stem domain; and wherein the UTS is not a pre-miR-BART2 targeting sequence. In some embodiments, the hybrid pre-miRNA comprises a UTS targeting a therapeutic target. In some embodiments, the cell is a diseased cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the cell is in a subject. In some embodiments, the cell is in a human subject. In some embodiments, expression of the hybrid pre-miRNA in the cell restores function of an endogenous miRNA that is reduced in the cell as compared to a control cell. In some embodiments, the control cell is a wild-type cell. In some embodiments, the cell is a diseased cell, and the control cell is a non-diseased cell.

[0037] Described herein, in some aspects, is a method of downregulating expression of a target ribonucleic acid (RNA) in a cell, the method comprising contacting the cell with an engineered replicon comprising a hybrid pre-microRNA (pre-miRNA), wherein the hybrid pre-miRNA comprises a scaffold and user-defined targeting sequence (UTS); wherein the scaffold comprises a guide strand stem domain, a passenger strand stem domain, and a terminal loop, wherein the guide strand stem domain comprises a pre-miR-BART2 guide strand stem domain or a pre-miR-BART17 guide strand stem domain, and wherein the passenger strand stem domain comprises a pre-miR-BART2 passenger strand stem domain; wherein the target RNA comprises an miRNA target site; and wherein the UTS comprises a targeting sequence cognate to the miRNA target site of the target RNA. In some embodiments, the target RNA is a pathological RNA. In some embodiments, the cell is a mammalian cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the cell is in a subject. In some embodiments, the cell is in a human subject. In some embodiments, the cell exhibits a reduced expression level of the target RNA relative to an expression level of the target RNA in the cell prior to the contacting.

[0038] Described herein, in some aspects, is a method of downregulating expression of a protein in a cell, the method comprising contacting the cell with an engineered replicon comprising a hybrid pre-microRNA (pre-miRNA), wherein the hybrid pre-miRNA comprises a scaffold and user-defined targeting sequence (UTS); wherein the scaffold comprises a guide strand stem domain, a passenger strand stem domain, and a terminal loop, wherein the guide strand stem domain comprises a pre-miR-BART2 guide strand stem domain or a pre-miR- B ART 17 guide strand stem domain, and wherein the passenger strand stem domain comprises a pre-miR-BART2 passenger strand stem domain; wherein the protein is encoded by a target RNA comprising an miRNA target site; and wherein the UTS comprises a targeting sequence cognate to the miRNA target site of the target RNA. In some embodiments, the protein is a pathological protein. In some embodiments, the cell is a mammalian cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the cell is in a subject. In some embodiments, the cell is in a human subject. In some embodiments, the cell exhibits a reduced expression level of the protein relative to an expression level of the protein in the cell prior to the contacting.

[0039] Described herein, in some aspects, is a method for treating a subject having a disease characterized by overexpression of a pathological ribonucleic acid (RNA) or a pathological protein encoded by an RNA, the method comprising contacting the cell with an engineered replicon comprising a hybrid pre-microRNA (pre-miRNA), wherein the hybrid pre-miRNA comprises a scaffold and user-defined targeting sequence (UTS); wherein the scaffold comprises a guide strand stem domain, a passenger strand stem domain, and a terminal loop, wherein the guide strand stem domain comprises a pre-miR-BART2 guide strand stem domain or a pre-miR-BART17 guide strand stem domain, and wherein the passenger strand stem domain comprises a pre-miR-BART2 passenger strand stem domain; wherein the pathological RNA comprises an miRNA target site or wherein the pathological protein is encoded by a target RNA comprising an miRNA target site; and wherein the UTS comprises a targeting sequence cognate to the miRNA target site of the pathological RNA or the target RNA.

[0040] Described herein, in some aspects, is a method of regulating expression of mRNA in a cell, the method comprising contacting the cell with a hybrid pre-miRNA comprising a pre- miR-BART2 with a user-defined targeting sequence (UTS). In some embodiments, contacting the cell with a hybrid pre-miRNA comprises contacting the cell with an RNA polynucleotide comprising the hybrid pre-miRNA. In some embodiments, contacting the cell with a hybrid pre-miRNA comprises contacting the cell with an engineered replicon comprising the hybrid pre-miRNA.

[0041] In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is comprised in a subject. In some embodiments, the subject is a mammalian subject. In some embodiments, the subject is a human subject. In some embodiments, contacting the cell with a hybrid pre-miRNA comprises administering a composition comprising the hybrid pre-miRNA to the subject. In some embodiments, the composition is a pharmaceutical composition.

[0042] Described herein, in some aspects, is a method of reducing immunogenicity of a miRNA, the miRNA comprising a targeting sequence, the method comprising inserting the targeting sequence into a pre-miR-BART2 scaffold to produce a hybrid pre-miRNA having reduced immunogenicity when expressed in a host cell relative to the immunogenicity of the miRNA.

[0043] Described herein, in some aspects, is a method of reducing clearance of an miRNA by a host cell, the miRNA comprising a targeting sequence, the method comprising inserting the targeting sequence into a pre-miR-BART2 scaffold to produce a hybrid pre-miRNA having reduced clearance when expressed by the host cell, relative to the clearance of the miRNA by the host cell.

[0044] Described herein, in some aspects, is a method of reducing induction of toxicity in a host cell by an miRNA, the miRNA comprising a targeting sequence, the method comprising inserting the targeting sequence into a pre-miR-BART2 scaffold to produce a hybrid pre- miRNA having reduced toxicity when expressed in the host cell relative to the toxicity induced by the miRNA.

[0045] Described herein, in some aspects, is a method of reducing induction of innate antiviral activity in a host cell by an miRNA, the miRNA comprising a targeting sequence, the method comprising inserting the targeting sequence into a pre-miR-BART2 scaffold to produce a hybrid pre-miRNA inducing less innate antiviral activity when expressed by the host cell relative to the innate antiviral activity induced by the miRNA.

[0046] The subject matter of this application may involve, in some cases, interrelated products, alternative solutions to a particular problem, and / or a plurality of different uses of a single system or article. These and other aspects of this disclosure, as well as various embodiments thereof, will become more apparent in reference to the drawings and detailed description. Additionally, the subject matter disclosed herein is not limited in its application to the details of construction and the arrangement of components set forth in the following description or illustrated in the drawings. It is capable of other embodiments and of being practiced or of being carried out in various ways. Also, the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting. The use of “including,” “comprising,” or “having,” “containing,” “involving,” and variations thereof herein, is meant to encompass the items listed thereafter and equivalents thereof as well as additional items.

[0047] BRIEF DESCRIPTION OF DRAWINGS

[0048] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. The figures are illustrative only and are not required for enablement of the invention disclosed herein.

[0049] FIG. 1 shows a schematic drawing of an engineered replicon, as described herein, for expression of miRNAs, and the uses thereof in therapeutic applications and in control of replicon degradation. nsPl-4'. replicon non- structural proteins; SGP'. subgenomic promoter; Actuator ', expressed protein of interest; Dicer, Ago2: Proteins associated with miRNA biogenesis.

[0050] FIGs. 2A-2C show proof-of concept experiment design and results of engineered replicons described herein.

[0051] FIG. 2A shows a schematic drawing of exemplary engineered replicons used in proof-of-concept experiments described herein. Top panel- an engineered replicon containing, from 5’ to 3’ : a 7-m ethylguanosine (m7G) cap; a nucleic acid encoding alphaviral non- structural proteins 1-4 (“nsPl-4”); one alphaviral subgenomic promoter (“SGP”); a payload-encoding nucleic acid encoding mKate (“mKate”) and operably linked to the SGP; a pre-miRNA operably linked to the same SGP; a 3’ untranslated region (“3’ UTR”); and a poly-adenylation (“pA”) tail. Bottom panel- an engineered replicon containing, from 5’ to 3’: a m7G cap; a nucleic acid encoding alphaviral nsPl-4; a first alphaviral SGP; a first payloadencoding nucleic acid encoding EBFP2 (“EBFP2”) and operably linked to the first SGP; a first 3’ UTR; a second alphaviral SGP; a second payload-encoding nucleic acid encoding mVenus-PEST (“mVenus-PEST”); 4 identical repeats of a miRNA target sequence (“4x miRNA target”); a second 3’ UTR; and a pAtail. The 4x miRNA target sequences are congruent to the pre-miRNA contained in the engineered replicon depicted in the top panel.

[0052] FIG. 2B shows two possible effects on payload expression of the engineered replicons in FIG. 2A.

[0053] FIG. 2C shows the expression of mKate, EBFP2, and mVenus PEST in cells transfected with one of the following engineered replicon pairs: an engineered replicon encoding mKate (“Rep mKate”), and an engineered replicon encoding EBFP2 operably linked to a first SGP, and mVenusPEST and 4x svRNA-5 target sequences operably linked to a second SGP (“Rep EBFP2 + mVenusPEST-svRNA-5 4xtargef ’); an engineered replicon encoding mKate and svRNA-5, operably linked to the same SGP (“Rep mKate-svRNA-5”), and Rep EBFP2 + mVenusPEST-svRNA-5 4xtarget; Rep mKate, and an engineered replicon encoding: EBFP2 operably linked to a first SGP, and mVenusPEST and 4x-miRBART2 target sequences operably linked to a second SGP (“Rep EBFP2+mVenusPEST-mir BART2 4xtargef ’); or an engineered replicon encoding mKate and pre-miRNA corresponding to miR- BART2 operably linked to the same SGP (Rep mKate-miR-BART2); and Rep EBFP2+mVenusPEST-mir BART2 4xtarget. Expression is shown as log fluorescence intensity (A.U.).

[0054] FIG. 3 shows the effects of changing the position of a pre-miRNA sequence within an engineered replicon (here, corresponding to miR-BART2), such that the pre-miRNA is operably linked to a first subgenomic promoter (“SGP”) or a second SGP as shown in FIG. 2A (bottom panel). Expression is shown as log fluorescence intensity, as in FIG. 2C.

[0055] FIG. 4 shows the effects of low and medium strength subgenomic promoters (“SGP”) on miR-BART2 expression as assessed by fluorescence intensity, as shown in FIG. 2C and FIG. 3. Medium-. SGP30 (SEQ ID NO: 76); Low. SGP5 (SEQ ID NO: 74).

[0056] FIG. 5 shows hybrid pre-miR designs and the effects of hybrid pre-miR-BART2 in an engineered replicon, as shown in FIG. 2C, FIG. 3, and FIG. 4.

[0057] FIG. 6 shows schematic drawings of non-limiting, exemplary designs (D1-D5) of engineered replicons for expressing miRNA (e.g., hybrid pre-miRNA). DI is an engineered replicon design containing, from 5’ to 3’ : a 7-methylguanosine (m7G) cap, a nucleic acid encoding alphaviral non- structural proteins 1-4 (“nsPl-4”), an alphaviral subgenomic promoter (“SGP”), a payload-encoding nucleic acid (“payload”), a miRNA-encoding sequence (“miR”), a nucleic acid encoding a truncated El protein (“El(trunc)”), a 3’ untranslated region (3’ UTR), and a poly adenylation tail (pA). D2 is an engineered replicon design containing, from 5’ to 3’: a m7G cap, a nucleic acid encoding alphaviral nsPl-4, a first alphaviral SGP, a first payload-encoding nucleic acid (“payload”), a pre-miRNA sequence (“miR”), a first 3’ UTR, a second alphaviral SGP, a second payload-encoding nucleic acid (“payload”), a nucleic acid encoding El(trunc), a second 3’ UTR, and a p A tail. D3 is an engineered replicon design containing, from 5’ to 3’ : a m7G cap, a nucleic acid encoding nsPl-4, a first alphaviral SGP, a first payload-encoding nucleic acid, a first 3’ UTR, a second alphaviral SGP, a second payload-encoding nucleic acid, a miR, a nucleic acid encoding El(trunc), a second 3’ UTR, and pA. D4 is an engineered replicon design containing, from 5’ to 3’ : a m7G cap, a nucleic acid encoding nsPl-4, a first SGP, a first payload-encoding nucleic acid, a first miR, a first 3’ UTR, a second SGP, a second payload-encoding nucleic acid, a second miR, a nucleic acid encoding El(trunc), a second 3’ UTR, and pA. D5 is an engineered replicon design containing, from 5’ to 3’ : a m7G nucleoside, a nucleic acid encoding nsPl-4, an SGP, a miR, a nucleic acid encoding El(trunc), a 3’ UTR, and pA.

[0058] FIGs. 7A-7C shows that engineered replicons can effectively express miRNA in various configurations.

[0059] FIG. 7A shows engineered replicon-based expression of miR-BART2 under three different subgenomic promoters of different strengths: SGP15 (SEQ ID NO: 75), SGP30 (SEQ ID NO: 76), SGP5 (SEQ ID NO: 74).

[0060] FIG. 7B shows engineered replicon-based expression of miR-BART2 at different tandem site positions, wherein “1stposition” indicates miR-BART2 is expressed under control of the 5’-most SGP and wherein “second position” indicates miR-BART2 is expressed under control of a different SGP downstream of the 5 ’-most SGP.

[0061] FIG. 7C shows an engineered replicon-based expression of miR-BART2 miRNA or a scramble sequence under control of SGP 15 (SEQ ID NO: 75) without an upstream ORF or payload-encoding sequence (e.g., as shown in D5 of FIG. 6).

[0062] FIG. 8 shows effects of hybrid pre-miRNA, miRNA, or scramble sequences on target expression in cells containing engineered replicons or plasmids encoding the hybrid pre- miRNA, miRNA, or scramble sequences. Hybrid pre-miRNAs are labelled according to the following nomenclature: [pre-miR-scaffold] / [mature miR targeting sequence]; for example, “miR-BART2 / mir-LET-7b”, corresponding to SEQ ID NO: 27, refers to a hybrid pre-miRNA having a pre-miR-BART2 scaffold and a mature targeting sequence of mir-LET-7b (SEQ ID NO: 64).

[0063] FIGs. 9A-9D shows various engineered replicons can self-repress expression of a payload and / or a miRNA. Expression data for FIGs. 9A-9D is shown as fluorescence [log] (A U ). FIG. 9A shows an exemplary engineered replicon for repressed expression of a miRNA (here, miR-BART2) and a payload encoded by the same open reading frame (ORF), utilizing miRNA target sites cognate to the expressed miRNA.

[0064] FIG. 9B shows an exemplary engineered replicon for tandem expression of a first payload encoded by a first ORF, and repressed expression of a second payload encoded by a second ORF. In this example, the miRNA is encoded by the second ORF and miRNA target sites are contained within the second ORF, allowing for repression of the second payload, without affecting expression of the first payload.

[0065] FIG. 9C shows an exemplary engineered replicon for tandem repressed expression of a first payload encoded by a first ORF, and expression of a second payload encoded by a second ORF. In this example, the miRNA is encoded by the first ORF and miRNA target sites are contained within the first ORF, allowing for repression of the first payload, without affecting expression of the second payload.

[0066] FIG. 9D shows an exemplary engineered replicon for tandem expression of a first payload encoded by a first ORF, and repressed expression of a second payload encoded by a second ORF. In this example, the miRNA is encoded by the first ORF and miRNA target sites are contained within the second ORF, allowing for repression of the second payload, without affecting expression of the first payload.

[0067] FIGs. 10A-D shows that endogenous miRNA expression can downregulate miRNA expression from replicons via target site degradation while heterologous miRNAs downregulate target plasmid reporters.

[0068] FIG. 10A shows a schematic of endogenous miRNA-mediated downregulation (here, mediated by miR-21) of an engineered replicon, and engineered replicon-mediated downregulation (here, mediated by miR-BART2) of a plasmid target (here, NeonGreenPEST). BHK-21 and HeLa cells were transfected with a plasmid encoding two transcription units: a first encoding EBFP2, serving as a “transfection” reporter, and a second encoding NeonGreenPEST (serving as miRNA repression activity reporter) plus 4x miR- BART2 target sites, and with an engineered replicon encoding mK02PEST, serving as a reporter of endogenous miR expression (here, miR-21), 4x miR-21 target sites, and a miRNA sequence (here, miR-BART2) or a scramble sequence control.

[0069] FIG. 10B shows levels of endogenous miR-21 repression activity as measured by a ratio of geometric mean values of miRNA repression activity Transfection reporter (“Normalized Reporter Signal,” CopGFP:EBFP2) (CopGFP not depicted in FIG. 10A). Lower normalized reporter expression indicates higher endogenous miR-21 expression. In this figure, higher endogenous miR-21 expression in HeLa cells represses CopGFP expression to a greater extent.

[0070] FIG. IOC shows percentage of cells expressing the replicon-encoded reporter mK02PEST (as shown in FIG. 10A). In this figure, HeLa cells are shown to have lower levels of expression of mK02PEST, indicating that high miR-21 expression in HeLa cells results in degradation and repression of engineered replicon-encoded mK02PEST.

[0071] FIG. 10D shows plasmid reporter de-repression in BHK-21 and HeLa cells contacted with the engineered replicon of FIG. 10A (BHK-21 : 51% repression; HeLa: 36% repression). When endogenous miR-21 level is low (e.g., in BHK-21 cells, as seen in FIG. 10B), engineered replicon-mediated expression of mK02PEST (as seen in FIG. IOC) and miR- BART2 is higher, resulting in increased repression of plasmid reporters compared to scramble sequence controls. When endogenous miR-21 level is high (e.g., in HeLa cells, as seen in FIG. 10B), engineered replicon-mediated expression of mK02PEST (as seen in FIG. IOC) and miR-BART2 is lower, resulting in decreased repression of plasmid reporters compared to scramble sequence controls.

[0072] The exemplary engineered replicons depicted in FIGs. 1-10D can be understood to comprise a conserved sequence element (not shown) cognate to the nsPl-4 depicted therein, unless otherwise specified.

[0073] DETAILED DESCRIPTION

[0074] Replicons are positive-stranded RNA alphaviruses used, for example, as antigen expression vectors in RNA-based vaccines. It was hypothesized that microRNA expression from replicons should be feasible due to extensive evidence of wild-type RNA viruses expressing native microRNAs without compromising their replication and genomic integrity from cleavage and processing by host’s microRNA biogenesis pathway.

[0075] Programmable microRNA expression from replicons provides novel functionality in designing genetic circuits and synthetic networks in RNA-based therapeutics. In addition, microRNA expression from replicons could potentially target any disease caused by altered microRNA profile, upregulated gene expression (e.g., oncogenes) or viruses. User-defined miRNAs were expressed within the miR-BART2 precursor (pre-miR-BART2) such that secondary structure was retained, but new target specificity was gained as a result of the user- defined miRNA sequence. Engineered Replicons

[0076] In some aspects, this disclosure describes engineered self-replicating ribonucleic acids, also referred to herein as “engineered replicons,” comprising pre-miRNA (e.g., hybrid pre-miRNA).

[0077] The term “engineered,” as used herein in reference to a polynucleotide (e.g., “engineered replicons”), refers to a polynucleotide which is artificial (i.e., not naturally occurring). In some embodiments, an engineered polynucleotide comprises one or more synthetic nucleic acids (e.g., a synthetic nucleic acid, a hybrid pre-miRNA). In some embodiments, an engineered polynucleotide comprises naturally occurring elements, wherein the naturally occurring elements are present in a combination or configuration which itself does not naturally occur. In some embodiments, an engineered polynucleotide comprises a modified nucleic acid. A “modified nucleic acid” is a nucleic acid (e.g., miRNA) derived from a naturally occurring nucleic acid and substantially modified, so as to alter function or expression relative to the naturally occurring nucleic acid. In some embodiments, an engineered polynucleotide comprises a combination of synthetic nucleic acids, naturally occurring nucleic acids, and / or modified nucleic acids.

[0078] The terms “replicon” and “self-replicating RNA” are used synonymously herein and refer to self-replicating genetic elements comprised of RNA that replicate from one origin of replication. In some embodiments, an engineered replicon is derived from (e.g., substantially modified from) a genome of an RNA virus.

[0079] In some embodiments, an engineered replicon is derived from an alphavirus genome. Alphaviruses are part of the Togaviridae family of viruses, possess a positive sense, singlestranded RNA genome, and are characterized by an icosahedral nucleocapsid. Alphaviruses have a broad host range and are transmitted by mosquitos and hematophagous arthropods. Non-limiting examples of alphaviruses include Venezuelan equine encephalitis virus (VEEV), Eastern Equine Encephalitis virus (EEEV), Western equine encephalitis virus (WEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Pixuna virus (PIXV), Semliki Forest virus (SFV), Middelburg virus (MIDV), Chikungunya virus (CHIKV), O’Nyong- Nyong virus (ONNV), Ross River virus (RRV), Barmah Forest virus (BFV), Getah virus (GETV), Sagiyama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), Una virus (UNAV), Sindbis virus (SINV), Aura virus (AURAV), Babanki virus (BABV), Highlands J virus (HJV), and Fort Morgan virus (FMV). Alphaviral Proteins

[0080] The alphavirus genome typically includes four non- structural proteins (nsPs): nsPl, nsP2, nsP3, and nsP4; and several structural proteins: El, E2, E3, 6K / TF, and C. The term “structural protein,” as used in the context of viruses herein, refers to proteins that constitute the structural components of mature assembled virus particles or virions. Non-limiting examples of such structural proteins include nucleocapsid core proteins (e.g., gag proteins), enzymes packaged within the virus particle (e.g., pol proteins), and membrane components (e.g., env proteins). In contrast, the term “non-structural protein,” as used in the context of viruses herein, refer to proteins that are expressed within the host cell but do not constitute structural components of the virus particle or virion. Some of the roles of non-structural proteins include, but are not limited to, replicon formation, immunomodulation, and transactivation of structural protein genes.

[0081] In some embodiments, an engineered replicon comprises nucleic acids encoding nsPl-4. When expressed by a host cell, alphaviral nsPl-4 form the replicase complex “Rep”. Rep is an RNA-dependent RNA polymerase capable of transcribing template RNAs to produce mirrored copies of the template RNA (i.e., to “replicate” the template RNA”), which can be translated (e.g., by a host cell). A “template RNA,” as used herein, refers to an RNA comprising a conserved sequence element (CSE) which is cognate to a reference replicase. In some embodiments, an engineered replicon is self-replicating, such that the replicon comprises a CSE and serves as the template RNA for its encoded replicase. A replicase is considered cognate to a CSE if the replicase is capable of binding the CSE such that the template RNA comprising the CSE can be replicated by the replicase. In some embodiments, an engineered replicon is capable of replicating a template RNA which is not comprised in the replicon.

[0082] In some embodiments, an engineered replicon encodes nsPl-4 from an RNA virus. In some embodiments, an engineered replicon encodes nsPl-4 from an alphavirus. In some embodiments, an engineered replicon encodes nsPl-4 from VEEV, EEEV, WEEV, EVEV, MUCV, PIXV, SFV, MIDV, CHIKV, ONNV, RRV, BFV, GETV, SAGV, BEBV, MAYV, UNAV, SINV, AURAV, BAB V, HJV, or FMV. In some embodiments, an engineered replicon encodes nsPl-4 of an alphavirus and does not encode alphaviral structural proteins. In some embodiments, an engineered replicon encodes nsPl-4 of an alphavirus and encodes an El protein, or fragment thereof, of the alphavirus. In some embodiments, an engineered replicon encodes nsPl-4 of an alphavirus and encodes a truncated El protein (El(trunc)) of the alphavirus. In some embodiments, an engineered replicon encodes nsPl-4 from VEEV. In some embodiments, an engineered replicon encodes VEEV nsPl-4 and does not encode VEEV structural proteins. In some embodiments, an engineered replicon encodes VEEV nsPl-4 and VEEV El protein, or fragment thereof. In some embodiments, an engineered replicon encodes nsPl-4 of an alphavirus and encodes VEEV El(trunc).

[0083] Untranslated Regions (UTRs)

[0084] In some embodiments, an engineered replicon comprises one or more untranslated regions (UTRs). UTRs are typically found upstream and / or downstream of an open reading frame (ORF). AUTR located upstream of a start codon (e.g., upstream of an ORF) and operably linked to a gene is referred to herein as a 5’ UTR. AUTR located downstream of a stop codon (e.g., downstream of an ORF) is referred to herein as a 3’ UTR. 5’ UTRs and / or 3’ UTRs may comprise structural elements which regulate expression, modulate transcriptional control, or alter stability of a polynucleotide (e.g., of an engineered replicon). In some embodiments, a 5’ UTR comprises a 5’ cap. In some embodiments, a 5’ UTR comprises a 7-methylguanosine (m7G) cap (5’ m7G). In some embodiments, a 3’ UTR comprises a polyadenylation (pA) tail. In some embodiments, a UTR (e.g., a 5’ UTR and / or a 3’ UTR) is synthetic. In some embodiments, a UTR (e.g., a 5’ UTR and / or a 3’ UTR) is naturally occurring. In some embodiments, a UTR (e.g., a 5’ UTR and / or a 3’ UTR) is an alphavirus UTR (e.g., a VEEV 5’ UTR, a VEEV 3’ UTR). In some embodiments, a UTR (e.g., a 5’ UTR and / or a 3’ UTR) is derived from a naturally occurring UTR. In some embodiments, a UTR (e.g., a 5’ UTR and / or a 3’ UTR) is derived from an alphavirus UTR. A variety of 5’ UTRs and 3’ UTRs (e.g., synthetic, naturally occurring, modified) are known in the art.

[0085] Sub-genomic Promoters (SGP)

[0086] In some embodiments, an engineered replicon comprises a subgenomic promoter (SGP). As used herein, the term “subgenomic” refers to a smaller section of a whole genome e.g., an alphaviral genome). A “subgenomic promoter” (SGP) refers to a promoter the drives the transcription of subgenomic mRNAs. Typically, an mRNA is transcribed from genomic DNAs and episomal DNAs e.g., plasmids). Certain self-replicating RNA viruses are capable of initiating transcription of certain viral genes e.g., genes encoding structural genes) operably linked to SGPs, which are usually located upstream of viral genes. When comprised in engineered polynucleotides e.g., engineered replicons), SGPs e.g., alphaviral SGPs) may thus be useful for initiating transcription of portions nucleic acids to which they are operably linked. As used herein, the term “cargo sequence” refers to a functional nucleic acid (e.g., a pre-miRNA, a hybrid pre-miRNA) or a nucleic acid encoding a payload. An SGP and cargo sequence are “operably linked” when the SGP is capable of initiating, promoting, or otherwise modulating expression of the cargo sequence. In some embodiments, an engineered replicon comprises an SGP operably linked to a cargo sequence. In some embodiments, an engineered replicon comprises an SGP operably linked to a single cargo sequence. In some embodiments, an engineered replicon comprises an SGP operably linked to two or more cargo sequences (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more cargo sequences).

[0087] In some embodiments, an SGP is an alphaviral SGP. In some embodiments, an SGP is derived from an alphaviral SGP. Alphaviral SGPs vary in length and can range from about 20 nucleotides to over 100 nucleotides; SGP and are usually found upstream of the transcription start. In some embodiments, the subgenomic viral promoter is 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48,

[0088] 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73,

[0089] 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98,

[0090] 99, 100 nucleotides long, or longer. Viral subgenomic promoters have been described in the art, e.g., in PCT Application Publication No. WO 2016 / 040359, and Wagner et al., Nature Chemical Biology, DIO: 10.1038 / s41589-018-0146-9 (2018), incorporated herein by reference for the disclosure therein of subgenomic promoters. Non-limiting, exemplary SGPs are also provided herein.

[0091] In some embodiments, an SGP is SGP5. In some embodiments, SGP5 is a “low strength” promoter, such that it promotes low levels of expression of a cargo sequence (e.g., relative to expression of the cargo sequence when operably linked to a different promoter, such as SGP15 or SGP30). In some embodiments, SGP5 comprises the sequence set forth in SEQ ID NO: 74:

[0092] ACTTCCATCATAGTTATGGCCATGACTACTCTAGCTAGCAGTGTTAAATCATTCAGC TACCTGAGAGGGGCCCCTATAACTCTCTACGGCTAACCTGAATGGA (SEQ ID NO: 74).

[0093] In some embodiments, a SGP is SGP15. In some embodiments, SGP 15 is a “high strength” or “strong” promoter, such that it promotes elevated levels of expression of a cargo sequence (e.g., relative to expression of the cargo sequence when operably linked to a different promoter, such as SGP5 or SGP30). In some embodiments, SGP15 comprises the sequence set forth in SEQ ID NO: 75.

[0094] ACTTCCATCATAGTTATGGCCATGACTACTCTAGCTAGCAGTGTTAAATCATTCAGC TACCTGAGAGGGGCCCCTATAACTCTCTACGGCTAACCTGAATGGACTACGACATA (SEQ ID NO: 75) In some embodiments, a SGP is SGP30. In some embodiments, SGP30 is a “medium strength” promoter, such that it promotes medium levels of expression of a cargo sequence (e.g., relative to expression of the cargo sequence when operably linked to a different promoter, such as SGP5 or SGP15). In some embodiments, SGP30 comprises the sequence set forth in SEQ ID NO: 76.

[0095] ACTTCCATCATAGTTATGGCCATGACTACTCTAGCTAGCAGTGTTAAATCATTCAGC TACCTGAGAGGGGCCCCTATAACTCTCTACGGCTAACCTGAATGGACTACGACATAG TCTAGTCCGCCAAG (SEQ ID NO: 76).

[0096] In some embodiments, an engineered replicon comprises two or more SGPs, each operably linked to a different cargo sequence. In some embodiments, the two SGPs are the same. In some embodiments, the two SGPs are different. In some embodiments, the two SGPs are independently selected from SGP5, SGP15, and SGP30.

[0097] In some embodiments, an engineered replicon comprises a first SGP operably linked to a first cargo sequence, and a second SGP operably linked to a second cargo sequence, wherein expression of the first cargo sequence and expression of the second cargo sequence are independent of each other. In some embodiments, an engineered replicon comprises a first SGP operably linked to a first cargo sequence, a second SGP operably linked to a second cargo sequence and a third cargo sequence, wherein expression of the first cargo sequence is independent of expression of the second and third cargo sequences. In some embodiments, the first SGP and the second SGP are the same. In some embodiments, the first SGP and the second SGP are different. In some embodiments, the first SGP and the second SGP are independently selected from SGP5, SGP15, or SGP30.

[0098] In some embodiments, an engineered replicon comprises a first SGP operably linked to a first cargo sequence, a second SGP operably linked to a second cargo sequence, and a third SGP operably linked to a third cargo sequence, wherein expression of the first cargo sequence, expression of the second cargo sequence, and expression of the third cargo sequence are independent of each other. In some embodiments, the first SGP, the second SGP, and the third SGP are the same. In some embodiments, the first SGP, the second SGP, and the third SGP are different. In some embodiments, the first SGP, the second SGP, and the third SGP are independently selected from SGP5, SGP15, and SGP30.

[0099] Payloads

[0100] In some embodiments, an engineered replicon encodes a payload. As used herein, a “payload” refers to a gene product (e.g., polypeptide payload, nucleic acid payload) that can be expressed by a cell (e.g., a host cell, a cell in a subject). In some embodiments, a payload is a polypeptide. In some embodiments, a payload is a functional nucleic acid. An engineered replicon encoding a payload can be understood to comprise a payload-encoding sequence. In some embodiments, a cargo sequence is a payload-encoding sequence.

[0101] In some embodiments, a payload is a selectable marker. As used herein, a “selectable marker” is a molecule that alters (e.g., transforms) a cell such that it can be screened by artificial selection. In some embodiments, a selectable marker increases or decreases either resistance or sensitivity to antibiotics (e.g., puromycin) or other compounds. In some embodiments, a selectable marker is an enzyme, the activity of which is detectable by standard assays known in the art (e.g., P-galactosidase, luciferase, or alkaline phosphatase).

[0102] In some embodiments, a payload is a reporter. A “reporter,” as used herein, is a detectable molecule. In some embodiments, the detectable molecule is a nucleic acid or a polypeptide. In some embodiments, the reporter is a fluorophore (e.g., a fluorescent molecule capable of re-emitting photons of a first specific wavelength upon excitation with photons of a second specific wavelength). Non-limiting examples of fluorophores include green fluorescent protein (e.g., EGFP, NeonGreen, NeonGreenPEST, CopGFP, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen, T-Sapphire, etc.), blue fluorescent protein, (e.g., EBFP, EBFP2, Azurite, mTagBFP, etc.), cyan fluorescent protein (e.g., ECFP, mECFP, Cerulean, mTurquoise, CyPet, AmCyanl, Midori-Ishi Cyan, TagCFP, mTFPl (Teal), etc.), yellow fluorescent protein (e.g., EYFP, mVenus, mVenus- PEST, Topaz, Venus, mCitrine, YPet, TagYFP, PhiYFP, ZsYellowl, mBanana, etc.), orange fluorescent protein (e.g., mK02, mK02PEST, Kusabira Orange, Kusabira Orange2, mOrange, m0range2, dTomato, dTomato-Tandem, TagRFP, TagRFP-T, DsRed, DsRed2, DsRed-Express (T 1 ), DsRed-Monomer, mTangerine, etc.), or red fluorescent protein (e.g., mKate, iRFP, mRuby, mApple, mStrawberry, AsRed2, mRFPl, JRed, mCherry, HcRedl, mRaspberry, dKeima-Tandem, HcRed-Tandem, mPlum, AQ143, etc.).

[0103] In some embodiments, a payload is a therapeutic protein. As used herein, a “therapeutic protein” refers to a polypeptide useful for treating or preventing a disease or disorder. In some embodiments, a therapeutic protein replaces a deficient or absent endogenous protein (e.g., protein endogenous to a non-diseased cell). In some embodiments, a therapeutic protein interferes with activity of a deficient or pathological protein (e.g., a mutant protein with a gain-of-function mutation). In some embodiments, a therapeutic protein interferes with the activity of a pathogen (e.g., interferes with viral or bacterial replication). In some embodiments, a therapeutic protein augments activity of existing metabolic or synthetic pathways (e.g., acts as a catalyst for existing metabolic or synthetic pathways). In some embodiments, a therapeutic protein reduces toxicity of a toxic molecule (e.g., sequesters the toxic molecule). In some embodiments, a therapeutic protein is an antigen (e.g., viral antigen, bacterial antigen, tumor antigen). In some embodiments, a therapeutic protein provides a novel function or activity. Non-limiting examples of therapeutic proteins include antigens, secreted proteins (e.g., hormones), signalling proteins (e.g., peptide neurotransmitters), cytokines, membrane proteins, membrane-associated proteins, intracellular proteins, immunomodulatory proteins, and antibodies (e.g., engineered antibodies such as single domain antibodies and scFv) or antigen-binding fragments thereof (e.g., Fab, Fv).

[0104] In some embodiments, a payload is a functional nucleic acid. Afunctional nucleic acid is a non-coding nucleic acid (e.g., translation of the nucleic acid does not produce a functional polypeptide) capable of exerting one or more functions. In some embodiments, a functional nucleic acid modulates gene expression. In some embodiments, a functional nucleic acid interferes with (e.g., knocks down or inhibits) gene expression. In some embodiments, a functional nucleic acid induces (e.g., knocks in) gene expression. In some embodiments, a functional nucleic acid increases (e.g., promotes) gene expression. In some embodiments, a functional nucleic acid provides one or more therapeutic effects (e.g., is a therapeutic functional nucleic acid). Non-limiting examples of functional nucleic acids include, for example: microRNA (miRNA; e.g., a therapeutic miRNA, a hybrid miRNA described herein, an artificial miRNA), short terminal loop RNA (shRNA), small interfering RNA (siRNA), circular RNA (circRNA), and aptamers. In some embodiments, an engineered replicon comprises an SGP operably linked to a payload-encoding sequence. In some embodiments, an engineered replicon comprises an SGP operably linked to a single payloadencoding sequence. In some embodiments, an engineered replicon comprises an SGP operably linked to two or more payload-encoding sequences (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more cargo sequences).

[0105] In some embodiments, an engineered replicon comprises two or more SGPs, each operably linked to a different payload sequence. In some embodiments, the two SGPs are the same. In some embodiments, the two SGPs are different. In some embodiments, the two SGPs are independently selected from SGP5, SGP15, and SGP30.

[0106] In some embodiments, an engineered replicon comprises a first SGP operably linked to a first payload sequence, and a second SGP operably linked to a second payload sequence, wherein expression of the first payload sequence and expression of the second payload sequence are independent of each other. In some embodiments, an engineered replicon comprises a first SGP operably linked to a first payload sequence, a second SGP operably linked to a second payload sequence and a third payload sequence, wherein expression of the first payload sequence is independent of expression of the second and third payload sequences. In some embodiments, the first SGP and the second SGP are the same. In some embodiments, the first SGP and the second SGP are different. In some embodiments, the first SGP and the second SGP are independently selected from SGP5, SGP15, or SGP30.

[0107] In some embodiments, an engineered replicon comprises a first SGP operably linked to a first payload sequence, a second SGP operably linked to a second payload sequence, and a third SGP operably linked to a third payload sequence, wherein expression of the first payload sequence, expression of the second payload sequence, and expression of the third payload sequence are independent of each other. In some embodiments, the first SGP, the second SGP, and the third SGP are the same. In some embodiments, the first SGP, the second SGP, and the third SGP are different. In some embodiments, the first SGP, the second SGP, and the third SGP are independently selected from SGP5, SGP15, and SGP30. miRNA

[0108] Provided herein, in some aspects, are engineered replicons useful for, inter alia, providing miRNA (e.g., comprising pre-miRNA). In some embodiments,

[0109] As used herein, the terms “microRNA,” “miRNA,” and “miR,” used synonymously herein, refer to an RNA polynucleotide comprising a guide strand comprising a targeting sequence and having a length of between 18 to 25 nt. The “targeting sequence,” also known as a “seed region,” refers to a sequence of the miRNA, typically within positions 2-8 of the guide strand, which has high complementarity (e.g., at least 90% complementarity) to a cognate miRNA target site in a target RNA. A miRNA “target site” is to a sequence of ribonucleotides within an RNA that can be recognized by a cognate miRNA. In some embodiments, a miRNA target site comprises at least 6 nucleotides (e.g., 6-8 nucleotides) that are complementary to an miRNA targeting sequence. As used herein, the term “cognate” refers to molecules which are compatible (e.g., capable of interacting). For example, an miRNA is cognate to a target sequence if the targeting sequence of the miRNA and the target site comprise sufficient complementary to hybridize (e.g., by traditional Watson-Crick hybridization rules or by any stable association of the miRNA with the target RNA at or adjacent to the miRNA target site). In some embodiments, an engineered replicon configured to provide an miRNA comprises a pre-miRNA. As used herein, “pre-miRNA” refers to a single-stranded RNA comprising a guide strand, a passenger strand, and a terminal loop, which under physiological conditions, have a secondary structure comprising a stem loop. A “stem loop,” as used herein, refers to a single-stranded RNA duplex comprising two stem domains having sufficient complementarity to hybridize with one another and joined by a terminal loop. The guide strand of a pre-miRNA can be understood to comprise a guide strand stem domain and a targeting sequence. Similarly, the passenger strand of a pre-miRNA can be understood to comprise a passenger strand stem domain and a sequence having complementarity to the targeting sequence. In some embodiments, a guide strand and a passenger strand further comprise flanking sequences (z.e., a guide strand flanking sequence and a passenger strand flanking sequence, respectively), which do not hybridize with one another. The non-targeting sequence elements of a pre-miRNA (e.g., the guide strand stem domain, terminal loop, and passenger strand stem domain) are referred to herein as a “pre-miRNA scaffold”.

[0110] Typically, miRNA capable of recognizing (e.g., binding to) a target RNA polynucleotide are mature miRNA (e.g., a targeting sequence complexed with RISC). However, exogenous miRNA capable of binding to a target RNA are typically provided to cells (e.g, cells in subjects) in precursor form (e.g, as a pre-miRNA). Once in a cell (e.g., expressed by the cell), pre-miRNAs are cleaved (e.g., processed) by additional enzymes (e.g., Dicer, Ago2) to produce an intermediate miRNA duplex. miRNA duplexes are two-stranded RNA duplexes comprising a guide strand and a passenger strand, wherein the guide strand and passenger strand are not connected by a terminal loop. miRNA duplexes can be incorporated into RNA-induced silencing complex (RISC). Once incorporated into RISC, the passenger strand of the miRNA duplex is ejected resulting in a mature miRNA (e.g., RISC comprising the targeting sequence). When the mature miRNA hybridizes with the cognate target site in the target RNA, the target RNA is degraded by the cell (e.g., by deadenylation complexes, decapping factors, degradation factors, translational inhibition, dissociation of initiation factors, etc.). While not capable of binding directly to a miRNA target site, cognate target sites for pre-miRNA can be determined using methods known to those of ordinary skill in the art, e.g., by identifying the targeting sequence of the corresponding mature miRNA.

[0111] Non-limiting examples of pre-miRNA sequences are provided in Table 1 below, with targeting sequences bolded. Table 1. Non-limiting, Exemplary Pre-miRNA Sequences

[0112] Hybrid pre-miRNA

[0113] Described herein, in some aspects, are hybrid pre-miRNA, as well as engineered replicons comprising hybrid pre-miRNA. As used herein, the term “hybrid pre-miRNA” refers to a pre-miRNA comprising a scaffold of an miRNA (e.g., a scaffold present in the pre- miRNA corresponding to the first miRNA) and a user-defined targeting sequence (UTS). As used herein, the term “user-defined targeting sequence” (UTS) refers to a miRNA targeting sequence (e.g., a mature miRNA targeting sequence) which is different from the native targeting sequence of the miRNA from which the scaffold is derived. Accordingly, the ordinarily skilled artisan will understand that the hybrid pre-miRNAs described herein are synthetic, and thus distinct from naturally occurring miRNA. A UTS may comprise any known miRNA targeting sequence (e.g., targeting sequences of naturally occurring miRNA and synthetic targeting sequences, such as those of synthetic miRNA or artificial targeting sites predicted to bind to a known target site in a desired target RNA).

[0114] In some embodiments, a UTS is cognate to a miRNA target site in a target RNA. In some embodiments, a UTS is cognate to a miRNA target site comprised in a target RNA encoded by a eukaryote genome. In some embodiments, a UTS is cognate to a miRNA target site comprised in a target RNA encoded by a vertebrate animal genome. In some embodiments, a UTS is cognate to an miRNA target site comprised in a target RNA encoded by a mammalian genome. In some embodiments, a UTS is cognate to an miRNA target site comprised in a target RNA encoded by a human genome. In some embodiments, the target RNA is a protein coding RNA (e.g., an mRNA). In some embodiments, the target RNA is a therapeutic target. miRNA targeting sequences and their corresponding target sites are known in the art, for example, as found on the world wide web at mirbase.org. Additional miRNA target sites are known in the art, e.g., as described in Yang, Tzu-Hsien, et al., Journal of Chemical Information and Modeling. 2024 64.7 (413): 2445-2453 and Huang HY, Nucleic Acids Res. 2022 Jan 7;50(Dl):D222-D230. Accordingly, the ordinarily skilled artisan can readily identify desired miRNA targeting sequences for preparation of hybrid pre-miRNAfor any desired purpose.

[0115] Certain miRNA targeting sequences, corresponding to the exemplary miRNA in Table 1, are provided in Table 2 below, for illustrative purposes only.

[0116] Table 2. Non-limiting, Exemplary miRNA Targeting Sequences

[0117] In some embodiments, a hybrid pre-miRNA comprises a UTS comprising a targeting sequence selected from Table 2. In some embodiments, a hybrid pre-miRNA comprises a UTS consisting of a targeting sequence selected from Table 2. As illustrated in the section entitled “Examples” herein, certain pre-miRNA scaffolds have been found to be useful for preparing hybrid miRNA comprising UTS and which are energetically stable. In some embodiments, a hybrid pre-miRNA comprises one or more scaffold elements (e.g., guide strand stem domain, passenger strand stem domain, and terminal loop) derived from pre-miR-BART2 and / or from pre-miR-BART17. As illustrated in the section entitled “Examples” herein, hybrid pre-miRNA comprising pre-miR-BART2 and pre-miR-BART17 scaffolding elements and a UTS retain their secondary structure and, when expressed, specifically and potently target and degrade RNA polynucleotides comprising target sites cognate to the corresponding UTS. Notably, when comprised in engineered replicons (e.g., engineered replicons described herein), these hybrid miRNAs preserve the genomic integrity of the engineered replicon, preserving its ability to selfreplicate while preventing its degradation by host cell factors. Accordingly, such hybrid pre- miRNA may be useful for, inter alia, facilitating targeting and degradation of any target RNA molecule within a cell (c.g, mRNA, viral RNA) and / or replenishment of downregulated host miRNA expression (e.g., as a result of pathology). Additional, non-limiting examples of methods for uses thereof are provided herein in the section entitled “Methods of Use.”

[0118] In some embodiments, the scaffold of a hybrid pre-miRNA comprises a guide strand comprising a pre-miR-BART2 guide strand stem domain. In some embodiments, a pre-miR- BART2 guide strand stem domain comprises the sequence set forth in SEQ ID NO: 79:

[0119] ATGCCACCTCCCTGCCTGGTGGACTTCCAG (SEQ ID NO: 79).

[0120] In some embodiments, the scaffold of a hybrid pre-miRNA comprises a guide strand stem domain comprising the sequence set forth in SEQ ID NO: 79. In some embodiments, the scaffold of a hybrid pre-miRNA comprises a guide strand stem domain comprising a sequence having at least 90% (c.g, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 79.

[0121] In some embodiments, the scaffold of a hybrid pre-miRNA has a guide strand stem domain comprising a pre-miR-BART17 guide strand stem domain. In some embodiments, a pre-miR-BART17 guide strand stem domain comprises the sequence set forth in SEQ ID NO: 82:

[0122] TTGATAAACCTCCGCATGTCCAACCACCACAC (SEQ ID NO: 82).

[0123] In some embodiments, the scaffold of a hybrid pre-miRNA comprises a guide strand stem domain comprising the sequence set forth in SEQ ID NO: 82. In some embodiments, the scaffold of a hybrid pre-miRNA comprises a guide strand stem domain comprising a sequence having at least 90% (c.g, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 82.

[0124] In some embodiments, the scaffold of a hybrid pre-miRNA has a passenger strand stem domain comprising a pre-miR-BART2 passenger strand stem domain. In some embodiments, a pre-miR-BART2 passenger strand stem domain comprises the sequence set forth in SEQ ID NO: 80:

[0125] CTGTGAGTTTCACAGATCCACGGGCCACG (SEQ ID NO: 80). In some embodiments, the scaffold of a hybrid pre-miRNA comprises a passenger strand stem domain comprising the sequence set forth in SEQ ID NO: 80. In some embodiments, the scaffold of a hybrid pre-miRNA comprises a passenger strand stem domain comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 80.

[0126] In some embodiments, the scaffold of a hybrid pre-miRNA has a terminal loop comprising a pre-miR-BART2 terminal loop. In some embodiments, a pre-miR-BART2 terminal loop comprises the sequence set forth in SEQ ID NO: 81 :

[0127] GTGTCCATTGT (SEQ ID NO: 81).

[0128] In some embodiments, the scaffold of a hybrid pre-miRNA comprises a terminal loop comprising the sequence set forth in SEQ ID NO: 81. In some embodiments, the scaffold of a hybrid pre-miRNA comprises a guide strand stem domain comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 81.

[0129] In some embodiments, a hybrid-pre-miRNA is a pre-miR-BART2 flank hybrid pre- miRNA. In some embodiments, the scaffold of a pre-miR-BART2 flank hybrid pre-miRNA comprises a guide strand stem domain comprising a pre-miR-BART2 guide strand stem domain, a passenger strand stem domain comprising a pre-miR-BART2 passenger strand stem domain, a terminal loop (e.g., a terminal loop corresponding to the native miRNA scaffold from which the UTS is derived), and a UTS. In some embodiments, the scaffold of a pre-miR-BART2 flank hybrid pre-miRNA comprises a guide strand stem domain comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 79, a passenger strand stem domain comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 80, a terminal loop, and a UTS. In some embodiments, the scaffold of a pre-miR-BART2 flank hybrid pre-miRNA comprises a guide strand stem domain comprising the sequence set forth in SEQ ID NO: 79, a passenger strand stem domain comprising the sequence set forth in SEQ ID NO: 80, a terminal loop, and a UTS. In some embodiments, the UTS comprises a targeting sequence selected from Table 2. In some embodiments, the UTS consists of a targeting sequence selected from Table 2.

[0130] In some embodiments, a hybrid-pre-miRNA is a pre-miR-BART2 hybrid pre-miRNA. In some embodiments, the scaffold of a pre-miR-BART2 hybrid pre-miRNA comprises a guide strand stem domain comprising a pre-miR-BART2 guide strand stem domain, a passenger strand stem domain comprising a pre-miR-BART2 passenger strand stem domain, a terminal loop comprising a pre-miR-BART2 terminal loop, and a UTS. In some embodiments, the scaffold of a pre-miR-BART2 hybrid pre-miRNA comprises a guide strand stem domain comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 79, a passenger strand stem domain comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 80, a terminal loop comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 81, and a UTS. In some embodiments, the scaffold of a pre-miR-BART2 hybrid pre-miRNA comprises a guide strand stem domain comprising the sequence set forth in SEQ ID NO: 79, a passenger strand stem domain comprising the sequence set forth in SEQ ID NO: 80, a terminal loop comprising sequence set forth in SEQ ID NO: 81, and a UTS. In some embodiments, the UTS comprises a targeting sequence selected from Table 2. In some embodiments, the UTS consists of a targeting sequence selected from Table 2.

[0131] In some embodiments, a hybrid-pre-miRNA is a pre-miR-BART2_pre-miR-BART17 hybrid pre-miRNA. In some embodiments, the scaffold of a pre-miR-BART2_pre-miR- BART17 hybrid pre-miRNA comprises a guide strand stem domain comprising a pre-miR- BART17 guide strand stem domain, a passenger strand stem domain comprising a pre-miR- BART2 passenger strand stem domain, a terminal loop comprising a pre-miR-BART2 terminal loop, and a UTS. In some embodiments, the scaffold of a pre-miR-BART2_pre- miR-BART17 hybrid pre-miRNA comprises a guide strand stem domain comprising a sequence having at least 90% e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 82, a passenger strand stem domain comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 80, a terminal loop comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 81, and a UTS. In some embodiments, the scaffold of a pre-miR-BART2_pre-miR-BART17 hybrid pre-miRNA comprises a guide strand stem domain comprising the sequence set forth in SEQ ID NO: 82, a passenger strand stem domain comprising the sequence set forth in SEQ ID NO: 80, a terminal loop comprising sequence set forth in SEQ ID NO: 81, and a UTS. In some embodiments, the UTS comprises a targeting sequence selected from Table 2. In some embodiments, the UTS consists of a targeting sequence selected from Table 2. The ordinarily skilled artisan will appreciate that, in addition to the pre-miR-BART2 and / or pre-miR-BART17 scaffolding prescribed herein, hybrid pre-miRNAs comprise sequences having sufficient complementarity to hybridize such that a functional miRNA can be formed (e.g., having preserved secondary structure, such that a mature miRNA can be formed after further processing). Accordingly, pre-miRNAs within the scope of the hybrid pre-miRNAs disclosed herein may comprise common additional elements and / or minor variations in sequence (e.g., variations or additions of 2-6 nucleotides) outside of the prescribed sequence elements. Certain hybrid-pre-miRNAs, comprising the exemplary targeting sequences provided in Table 2 (bolded), pre-miR-BART2 and / or pre-miR-BART17 guide strand stem domain and passenger strand stem domain sequences (underlined), and pre- miR-BART2 terminal loops (italicized and underlined) are provided below in Table 3 for illustrative purposes only.

[0132] Table 3. Non-limiting, Exemplary Hybrid Pre-miRNAs

[0133] In some embodiments, a hybrid pre-miRNA comprises a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with a sequence selected from Table 3. In some embodiments, a hybrid pre-miRNA comprises a sequence selected from Table 3. Exemplary Engineered Replicons Comprising Hybrid pre-miRNAs

[0134] Provided herein, in some aspects, is an engineered replicon comprising a hybrid pre- miRNA described herein.

[0135] In some embodiments, an engineered replicon comprises a hybrid pre-miRNA comprising a UTS and a scaffold comprising a guide strand stem domain comprising a pre- miR-BART2 guide strand stem domain, a passenger strand stem domain comprising a pre- miR-BART2 passenger strand stem domain, and a terminal loop (e.g., a terminal loop corresponding to the native miRNA scaffold from which the UTS is derived). In some embodiments, an engineered replicon comprises a hybrid pre-miRNA comprising a UTS and a scaffold comprising a guide strand stem domain comprising a pre-miR-BART2 guide strand stem domain, a passenger strand stem domain comprising a pre-miR-BART2 passenger strand stem domain, and a pre-miR-BART2 terminal loop. In some embodiments, an engineered replicon comprises a hybrid pre-miRNA comprising a UTS and a scaffold comprising a guide strand stem domain comprising a pre-miR-BART17 guide strand stem domain, a passenger strand stem domain comprising a pre-miR-BART2 passenger strand stem domain, and a pre-miR-BART2 terminal loop.

[0136] In some embodiments, an engineered replicon comprises a hybrid pre-miRNA comprising a UTS and a scaffold comprising a guide strand stem domain comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 79. In some embodiments, an engineered replicon comprises a hybrid pre-miRNA comprising a UTS and a scaffold comprising a guide strand stem domain comprising the sequence set forth in SEQ ID NO: 79. In some embodiments, an engineered replicon comprises a hybrid pre-miRNA comprising a UTS and a scaffold comprising a guide strand stem domain comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 82. In some embodiments, an engineered replicon comprises a hybrid pre-miRNA comprising a UTS and a scaffold comprising a guide strand stem domain comprising the sequence set forth in SEQ ID NO: 82.

[0137] In some embodiments, an engineered replicon comprises a hybrid pre-miRNA comprising a UTS and a scaffold comprising a passenger strand stem domain comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 80. In some embodiments, an engineered replicon comprises a hybrid pre-miRNA comprising a UTS and a scaffold comprising a passenger strand stem domain comprising the sequence set forth in SEQ ID NO:

[0138] 80.

[0139] In some embodiments, an engineered replicon comprises a hybrid pre-miRNA comprising a UTS and a scaffold comprising a terminal loop strand comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 81. In some embodiments, an engineered replicon comprises a hybrid pre-miRNA comprising a UTS and a scaffold comprising a terminal loop strand comprising the sequence set forth in SEQ ID NO: 81.

[0140] In some embodiments, an engineered replicon comprises a hybrid pre-miRNA comprising a UTS and a scaffold comprising a guide strand stem domain comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 79 and a passenger strand stem domain comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 80. In some embodiments, an engineered replicon comprises a hybrid pre-miRNA comprising a UTS and a scaffold comprising a guide strand stem domain comprising the sequence set forth in SEQ ID NO: 79 and a passenger strand stem domain comprising the sequence set forth in SEQ ID NO: 80.

[0141] In some embodiments, an engineered replicon comprises a hybrid pre-miRNA comprising a UTS and a scaffold comprising a guide strand stem domain comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 79; a passenger strand stem domain comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 80; and a terminal loop strand comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO:

[0142] 81. In some embodiments, an engineered replicon comprises a hybrid pre-miRNA comprising a UTS and a scaffold comprising a guide strand stem domain comprising the sequence set forth in SEQ ID NO: 79; a passenger strand stem domain comprising the sequence set forth in SEQ ID NO: 80; and a terminal loop strand comprising the sequence set forth in SEQ ID NO: 81.

[0143] In some embodiments, an engineered replicon comprises a hybrid pre-miRNA comprising a UTS and a scaffold comprising a guide strand stem domain comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 82 and a passenger strand stem domain comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 80. In some embodiments, an engineered replicon comprises a hybrid pre-miRNA comprising a UTS and a scaffold comprising a guide strand stem domain comprising the sequence set forth in SEQ ID NO: 82 and a passenger strand stem domain comprising the sequence set forth in SEQ ID NO: 80.

[0144] In some embodiments, an engineered replicon comprises a hybrid pre-miRNA comprising a UTS and a scaffold comprising a guide strand stem domain comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 82; a passenger strand stem domain comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 80; and a terminal loop strand comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 81. In some embodiments, an engineered replicon comprises a hybrid pre-miRNA comprising a UTS and a scaffold comprising the sequence set forth in SEQ ID NO: 82; a passenger strand stem domain comprising the sequence set forth in SEQ ID NO: 80; and a terminal loop strand comprising the sequence set forth in SEQ ID NO: 81.

[0145] In some embodiments, an engineered replicon comprises a hybrid pre-miRNA selected from Table 3.

[0146] In some embodiments, an engineered replicon comprises a 3’ UTR and a hybrid pre- miRNA. In some embodiments, an engineered replicon comprises a 3’ UTR comprising a hybrid pre-miRNA. In some embodiments, the 3’ UTR comprises a hybrid pre-miRNA flanked by spacer sequences (e.g., a spacer sequence lObp or greater in length).

[0147] In some embodiments, an engineered replicon comprises an miRNA target site. In some embodiments, an engineered replicon comprises at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more) identical miRNA target sites. In some embodiments, an engineered replicon comprises at least 4 identical miRNA target sites. In some embodiments, an engineered replicon comprises two or more sets of miRNA target sites, wherein each set comprises identical miRNA target sites, and wherein the two or more sets are different (e.g., comprise miRNA target sites for different miRNA). In some embodiments, the two or more sets of miRNA target sites each comprise at least 4 identical miRNA target sites. In some embodiments, an engineered replicon comprises an SGP, and a hybrid pre- miRNA operably linked to the SGP. In some embodiments, an engineered replicon comprises a plurality of SGPs (e.g., different SGPs, identical SGPs) and a plurality of hybrid pre- miRNAs (e.g., different hybrid pre-miRNAs, identical hybrid pre-miRNAs) operably linked to the SGPs. In some embodiments, an engineered replicon comprises two or more SGPs and an equivalent number of hybrid pre-miRNAs, wherein each hybrid pre-miRNAis independently operably linked to a different SGP. In some embodiments, an engineered replicon comprises one or more SGPs and a greater number of hybrid pre-miRNAs, such that more than one hybrid pre-miRNA is operably linked to at least one of the SGPs. In some embodiments, each hybrid pre-miRNA of the plurality of hybrid pre-miRNAs is different. In some embodiments, each hybrid pre-miRNA of the plurality of hybrid pre-miRNAs is identical.

[0148] In some embodiments, an engineered replicon comprises an SGP, a payload-encoding sequence, and a hybrid pre-miRNA operably linked to the SGP. In some embodiments, an engineered replicon comprises a plurality of SGPs (e.g., different SGPs, identical SGPs), a plurality of payload-encoding sequences (e.g., different hybrid payload-encoding sequences, identical payload-encoding sequences), and a plurality of hybrid pre-miRNAs (e.g., different hybrid pre-miRNAs, identical hybrid pre-miRNAs) operably linked to the SGPs. In some embodiments, an engineered replicon comprises two or more SGPs, an equivalent number of payload-encoding sequences, and an equivalent number of hybrid pre-miRNAs, wherein each payload and / or each hybrid pre-miRNA is independently operably linked to a different SGP. In some embodiments, an engineered replicon comprises one or more SGPs, an equivalent number or a greater number of payload-encoding sequences, and an equivalent number or a greater number of hybrid pre-miRNAs, such that more than one or more than one payload and / or each hybrid pre-miRNA is operably linked to at least one of the SGPs.

[0149] In some embodiments, an engineered replicon comprises an SGP, a payload-encoding sequence, and an miRNA target site (e.g., a set of miRNA target sites). In some embodiments, an engineered replicon comprises an SGP and a set of miRNA target sites. In some embodiments, an engineered replicon comprises a plurality of SGPs (e.g., different SGPs, identical SGPs), a plurality of payload-encoding sequences (e.g., different hybrid payload-encoding sequences, identical payload-encoding sequences), and a plurality of miRNA target sites (e.g., different miRNA target sites, identical miRNA target sites).

[0150] In some embodiments, an engineered replicon comprises two or more SGPs, an equivalent number of payload-encoding sequences, and an equivalent number of miRNA target sites or sets thereof, wherein each payload is independently operably linked to a different SGP and each miRNA target site or set thereof is positioned such that activity of a cognate miRNA can independently suppress expression of each payload.

[0151] In some embodiments, an engineered replicon comprises an SGP, a payload-encoding sequence, a 3’ UTR, and a hybrid pre-miRNA. In some embodiments, an engineered replicon comprises an SGP, a payload-encoding sequence, a 3’ UTR, an miRNA target site (e.g., a set of miRNA target sites), and a hybrid pre-miRNA comprising a UTS cognate to the miRNA target site. In some embodiments, an engineered replicon comprises an SGP, a payloadencoding sequence, a 3’ UTR, an miRNA target site (e.g., a set of miRNA target sites), and a hybrid pre-miRNA comprising a UTS which is not cognate to the miRNA target site. In some embodiments, the payload-encoding sequence is operably linked to the SGP.

[0152] In some embodiments, an engineered replicon comprises an SGP operably linked to a payload-encoding sequence, and a hybrid pre-miRNA. In some embodiments, an engineered replicon comprises an SGP operably linked to a single payload-encoding sequence, and a hybrid pre-miRNA. In some embodiments, an engineered replicon comprises an SGP operably linked to two or more payload-encoding sequences (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more cargo sequences), and two or more hybrid pre-miRNA.

[0153] In some embodiments, an engineered replicon comprises two or more SGPs, each operably linked to a different payload sequence, and a hybrid pre-miRNA. In some embodiments, the two SGPs are the same. In some embodiments, the two SGPs are different. In some embodiments, the two SGPs are independently selected from SGP5, SGP15, and SGP30.

[0154] In some embodiments, an engineered replicon comprises a first SGP operably linked to a first payload sequence and a first hybrid pre-miRNA; and a second SGP operably linked to a second payload sequence and a second hybrid pre-miRNA, wherein expression of the first payload sequence and the first hybrid pre-miRNA and expression of the second payload sequence and the second hybrid pre-miRNA are independent of each other. In some embodiments, an engineered replicon comprises a first SGP operably linked to a first payload sequence and a first hybrid pre-miRNA; a second SGP operably linked to a second payload sequence and a second hybrid pre-miRNA; and a third payload sequence and a third hybrid pre-miRNA; wherein expression of the first payload sequence and first hybrid pre-miRNA is independent of expression of the second and third payload sequences and second and third hybrid pre-miRNAs. In some embodiments, the first SGP and the second SGP are the same. In some embodiments, the first SGP and the second SGP are different. In some embodiments, the first SGP and the second SGP are independently selected from SGP5, SGP15, or SGP30.

[0155] In some embodiments, an engineered replicon comprises a first SGP operably linked to a first payload sequence and a first hybrid pre-miRNA; a second SGP operably linked to a second payload sequence and a second hybrid pre-miRNA; and a third SGP operably linked to a third payload sequence and a third hybrid pre-miRNA; wherein expression of the first payload sequence and first hybrid pre-miRNA, expression of the second payload sequence and second hybrid pre-miRNA, and expression of the third payload sequence and third hybrid pre-miRNA are independent of each other. In some embodiments, the first SGP, the second SGP, and the third SGP are the same. In some embodiments, the first SGP, the second SGP, and the third SGP are different. In some embodiments, the first SGP, the second SGP, and the third SGP are independently selected from SGP5, SGP15, and SGP30.

[0156] Further exemplary configurations of engineered replicons are further contemplated herein, for example, as shown in FIG. 6.

[0157] Vectors

[0158] Provided herein, in some aspects are vectors comprising polynucleotides encoding or comprising an engineered replicon and / or hybrid miRNA described herein.

[0159] As used herein, a “vector” is a vehicle for the transfer of one or more nucleic acids between different genetic environments (e.g., for expression in a host cell). In some embodiments, a vector is composed of DNA or RNA. Suitable vectors include plasmids, fosmids, phagemids, viral genomes, and artificial chromosomes. In some embodiments, a vector is an expression vector. An “expression vector” is a vector into which a desired nucleotide sequence may be inserted by restriction and ligation such that the desired sequence is operably joined to regulatory sequences and may be expressed as an RNA transcript. Vectors may further contain one or more payload-encoding sequences (e.g., selectable markers) suitable for use in the identification of cells which have or have not been transformed or transfected with the vector. The choice and design of an appropriate vector is within the ability and discretion of one of ordinary skill in the art. Expression vectors containing all the necessary elements for expression are commercially available and known to those skilled in the art. See, e.g., Green et al., Molecular Cloning: A Laboratory Manual, Fourth Edition, Cold Spring Harbor Laboratory Press, 2014.

[0160] In some embodiments, a vector is a viral vector. In some embodiments, a vector is an adenoviral vector, adeno-associated virus (AAV) vector, alphaviral vector, vaccinia virus (VACV) vector, herpes simplex virus (HSV) vector, simian virus 40 (SV40) vector, retroviral vector (e.g., lentiviral vector), or baculovirus vector.

[0161] Host Cells

[0162] Provided herein, in some aspects, are host cells comprising an engineered replicon and / or hybrid pre-miRNA described herein. As used herein, a “host” cell refers to any cell capable of expressing (e.g., transcribing, translating, and / or processing) an engineered replicon and / or hybrid pre-miRNA described herein. In some embodiments, a host cell is an isolated cell (e.g., not comprised in a subject). In some embodiments, the host cell is a eukaryotic cell. In some embodiments, the host cell is a mammalian cell (e.g., a cell from a mouse, hamster, pig, cow, sheep, goat, horse, and / or primate). In some embodiments, a mammalian cell is a non-human primate cell. In some embodiments, a mammalian cell is a human cell. In some embodiments, a mammalian cell is a reproductive cell (e.g., sperm, ova and embryonic cells), an immune cell (e.g., antigen-presenting cell, dendritic cell, monocyte, macrophage, NKT cell, NK cell, basophil, eosinophil, or neutrophil, B cell, T cell), a kidney cell, lung cell, spleen cell, lymphoid cell, cardiac cell, gastric cell, intestinal cell, pancreatic cell, muscle cell, bone cell, neural cell, brain cell, or epithelial cell of a mammal (e.g., of a human). In some embodiments, a host cell is a stem cell. In some embodiments, a host cell is a cell from an established cell line generally known in the art, (e.g., BHK-21, HeLa, A549, Cl 27, CHO, HEK, HT-1080, Huh7, Jurkat, NSO, PER.C6, Sp2 / 0, Vero, and derivatives thereof).

[0163] In some embodiments, a host cell is in a subject. In some embodiments, the subject is a mammalian subject, such as a mouse, a hamster, a pig, a cow, a sheep, a goat, a horse, or a primate (e.g., humans, non-human primates). In some embodiments, a subject is human.

[0164] In some embodiments, a host cell is a diseased cell. A “diseased cell,” as used herein, refers to a cell having abnormal biological functions compared to a non-diseased (normal) control cell. In some embodiments, a diseased cell is characterized by overexpression of a gene (e.g., a pathological gene). In some embodiments, a diseased cell is characterized by expression of a pathological gene (e.g., a gene associated with a disease state). In some embodiments, a pathological gene is a gene having one or more mutations relative to a wildtype or non-pathological gene (e.g., a pathological variant of a gene). In some embodiments, a diseased cell is characterized by reduced or absent expression of an endogenous miRNA (e.g., relative to a non-diseased cell). In some embodiments, a host cell is a mutant cell (e.g., comprises one or more mutations in one or more genes) and the control cell is a wild-type cell.

[0165] Compositions

[0166] Provided herein, in some aspects, are compositions comprising an engineered replicon described herein, a hybrid miRNA described herein, a vector encoding an engineered replicon and / or hybrid miRNA described herein, and / or a cell comprising an engineered replicon and / or hybrid miRNA described herein.

[0167] In some embodiments, the composition further comprises additional agents (e.g. for specific delivery, or other therapeutic agents). In some embodiments, a composition is a pharmaceutical composition. A “pharmaceutical composition,” as used herein, refers to a composition comprising an engineered replicon described herein, a hybrid miRNA described herein, a vector encoding an engineered replicon and / or hybrid miRNA described herein, and / or a cell comprising an engineered replicon and / or hybrid miRNA described herein; and a pharmaceutically acceptable carrier.

[0168] The term “pharmaceutically acceptable” refers to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. A “pharmaceutically acceptable carrier” is a material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the subject agents from one organ, or portion of the body, to another organ, or portion of the body, which is compatible with the other ingredients of the pharmaceutical composition (e.g., nucleic acids, cells), and which is suitable for administration to a subject. In some embodiments, a pharmaceutically acceptable carrier is a lipidoid, liposome, lipid nanoparticle, polymer nanoparticle, or lipoplex. In some embodiments, a pharmaceutically acceptable carrier is a solvent, dispersion media, coating, surfactant, antioxidant, preservative (e.g., antibacterial agents, antifungal agents), isotonic agent, absorption delaying agent, salt, preservative, drug, drug stabilizer (e.g., antioxidants), gel, binder, excipient, disintegration agent, lubricant, sweetening agent, flavoring agent, dye, such like materials, and combinations thereof, as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences (1990), incorporated herein by reference). Some examples of materials which can serve as pharmaceutically-acceptable carriers include, without limitation: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as com starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, methylcellulose, ethyl cellulose, microcrystalline cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol (PEG); (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and / or polyanhydrides; (22) bulking agents, such as peptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; (24) C2-C12 alcohols, such as ethanol; and (25) other non-toxic compatible substances employed in pharmaceutical formulations. Wetting agents, coloring agents, release agents, coating agents, sweetening agents, flavoring agents, perfuming agents, preservative and antioxidants can also be present in the formulation. The terms such as “excipient,” “carrier,” “pharmaceutically acceptable carrier” or the like are used interchangeably herein.

[0169] In some embodiments, a pharmaceutical composition described herein comprises lipid nanoparticles or liposomes. Lipid nanoparticles can be prepared by methods known in the art, such as described in Epstein, et al., Proc. Natl. Acad. Sci. USA 82:3688 (1985); Hwang, et al., Proc. Natl. Acad. Sci. USA 77:4030 (1980); and U.S. Pat. Nos. 4,485,045 and 4,544,545. Liposomes with enhanced circulation time are disclosed in U.S. Pat. No. 5,013,556. Particularly useful liposomes can be generated by the reverse phase evaporation method with a lipid composition comprising phosphatidylcholine, cholesterol and PEG- derivatized phosphatidylethanolamine (PEG-PE). Liposomes are extruded through filters of defined pore size to yield liposomes with the desired diameter.

[0170] In some embodiments, a pharmaceutical composition described herein is or is comprised in a vaccine (e.g., an RNA vaccine).

[0171] In some embodiments, a composition (e.g., a pharmaceutical composition) comprises an effective amount of an engineered replicon described herein, a hybrid miRNA described herein, a vector encoding an engineered replicon and / or hybrid miRNA described herein, and / or a cell comprising an engineered replicon and / or hybrid miRNA described herein. The term “effective amount,” as used herein, refers to the amount of the composition required to transform a cell or subject (e.g., to confer a therapeutic effect), alone or in combination with other agents (e.g., therapeutic agents). Effective amounts vary, as recognized by those skilled in the art, depending on the particular condition being treated, the severity of the condition, the individual subject parameters including age, physical condition, size, gender and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. It is generally preferred that a maximum dose of the individual components or combinations thereof be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art, however, that a subject may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons or for virtually any other reasons.

[0172] Methods of Use

[0173] Provided herein, in some aspects, are methods of creating hybrid pre-miRNAs, the method comprising inserting a UTS into a pre-miRNA scaffold as described herein.

[0174] In some embodiments, the method comprises inserting a UTS into a pre-miRNA scaffold comprising a guide strand stem domain comprising a pre-miR-BART2 guide strand stem domain, a passenger strand stem domain comprising a pre-miR-BART2 passenger strand stem domain, and a terminal loop (e.g., a terminal loop corresponding to the native miRNA scaffold from which the UTS is derived). In some embodiments, the pre-miR- BART2 guide strand stem domain comprises a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 79. In some embodiments, the pre-miR-BART2 passenger strand stem domain comprises a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 80. In some embodiments, the pre-miR-BART2 guide strand stem domain comprises the sequence set forth in SEQ ID NO: 79 and the pre-miR-BART2 passenger strand stem domain comprises the sequence set forth in SEQ ID NO: 80. In some embodiments, the UTS comprises a targeting sequence selected from Table 2. In some embodiments, the UTS consists of a targeting sequence selected from Table 2.

[0175] In some embodiments, the method comprises inserting a UTS into a pre-miRNA scaffold comprising a guide strand stem domain comprising a pre-miR-BART2 guide strand stem domain, a passenger strand stem domain comprising a pre-miR-BART2 passenger strand stem domain, and a terminal loop comprising a pre-miR-BART2 terminal loop. In some embodiments, the pre-miR-BART2 guide strand stem domain comprises a sequence having at least 90% (e.g, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 79. In some embodiments, the pre-miR- BART2 passenger strand stem domain comprises a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 80. In some embodiments, the terminal loop comprises a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 81. In some embodiments, the pre-miR- BART2 guide strand stem domain comprises the sequence set forth in SEQ ID NO: 79, the pre-miR-BART2 passenger strand stem domain comprises the sequence set forth in SEQ ID NO: 80, and the terminal loop comprises the sequence set forth in SEQ ID NO: 81. In some embodiments, the UTS comprises a targeting sequence selected from Table 2. In some embodiments, the UTS consists of a targeting sequence selected from Table 2.

[0176] In some embodiments, the method comprises inserting a UTS into a pre-miRNA scaffold comprising a guide strand stem domain comprising a pre-miR-BART17 guide strand stem domain, a passenger strand stem domain comprising a pre-miR-BART2 passenger strand stem domain, and a terminal loop comprising a pre-miR-BART2 terminal loop. In some embodiments, the pre-miR-BART17 guide strand stem domain comprises a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 82. In some embodiments, the pre-miR- BART2 passenger strand stem domain comprises a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 80. In some embodiments, the terminal loop comprises a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity with the sequence set forth in SEQ ID NO: 81. In some embodiments, the pre-miR- BART17 guide strand stem domain comprises the sequence set forth in SEQ ID NO: 82, the pre-miR-BART2 passenger strand stem domain comprises the sequence set forth in SEQ ID NO: 80, and the terminal loop comprises the sequence set forth in SEQ ID NO: 81. In some embodiments, the UTS comprises a targeting sequence selected from Table 2. In some embodiments, the UTS consists of a targeting sequence selected from Table 2.

[0177] Provided herein, in some aspects, is a method of expressing a hybrid pre-miRNA and / or engineered replicon (e.g., in a cell, in a subject). The ordinarily skilled artisan will appreciate that expression of a hybrid pre-miRNA and / or engineered replicon in a subject may have numerous uses, including, for example, downregulating expression of a target RNA in a cell, downregulating expression of a protein in a cell, treating a subject having a disease characterized by overexpression of a pathological RNA or protein, or regulating expression of mRNA in a cell or subject.

[0178] In some embodiments, a method provided herein comprises contacting a cell with an hybrid pre-miRNA and / or engineered replicon. In some embodiments, expressing a hybrid pre-miRNA described herein in a cell (e.g., a host cell) comprises contacting the cell with an engineered replicon comprising the hybrid pre-miRNA. In some embodiments, a cell that has been contacted with a hybrid pre-miRNA and / or engineered replicon expresses the hybrid pre-miRNA and / or engineered replicon transiently or stably. In some embodiments, contacting the cell with a hybrid pre-miRNA and / or engineered replicon modulates one or more properties of the cell. In some embodiments, contacting the cell with a hybrid pre- miRNA and / or engineered replicon imparts new properties onto the cell. In some embodiments, the cell is a host cell. In some embodiments, the cell is in a subject.

[0179] In some embodiments, the contacting comprises transfecting the cell with the hybrid pre-miRNA and / or engineered replicon. As used herein, the term “transfection” refers to the artificial delivery and introduction of polynucleotides (e.g., engineered replicons), into a cell (e.g., a host cell). Methods of transfection are well established in the art and range from chemical, to biological, and to physical methods. Chemical methods include, but are not limited to, calcium phosphate transfection, cationic polymer transfection, lipofection, FUGENE®, and DEAE-Dextran-mediated transfection. Other methods of transfection include, but are not limited to, electroporation (e.g., by using a Neon® transfection system), sonoporation, cell squeezing, impalefection, optical transfection, protoplast fusion, magnetofection™, and particle bombardment.

[0180] In some embodiments contacting a cell with an engineered replicon and / or hybrid miRNA described herein comprises contacting the cell with a vector described herein. In some embodiments, the contacting comprises transduction of the cell with the vector.

[0181] In some embodiments, the contacting comprises administering a hybrid pre-miRNA and / or engineered replicon to a subject. In some embodiments, administering a hybrid pre- miRNA to a subject comprises administering an engineered replicon comprising the hybrid pre-miRNA to the subject. In some embodiments, administering the hybrid pre-miRNA and / or engineered replicon to a subject comprises administering a composition (e.g., a pharmaceutical composition, a vaccine) to the subject. In some embodiments, administering the hybrid pre-miRNA and / or engineered replicon to a subject comprises administering a cell comprising the hybrid pre-miRNA and / or engineered replicon to the subject. In some embodiments, administering the hybrid pre-miRNA and / or engineered replicon to a subject comprises administering a vector (e.g., a viral vector) comprising polynucleotides encoding or comprising the hybrid pre-miRNA and / or engineered replicon to the subject. Administering a hybrid pre-miRNA, engineered replicon, composition, pharmaceutical composition, or cell described herein to a subject may be performed using any method known to those of ordinary skill in the art, such as injection (e.g., intravenous, intraocular, intravitreal, intramuscular, intradermal, intracardiac, intraperitoneal, and subcutaneous).

[0182] Provided herein, in some aspects, is a method for downregulating expression of a target RNA in a cell. In some embodiments, the method comprises contacting the cell with the hybrid pre-miRNA and / or engineered replicon. In some embodiments, the contacting comprises contacting the cell with an engineered replicon described herein, a hybrid miRNA described herein, a vector encoding an engineered replicon and / or hybrid miRNA described herein, or a composition (e.g., a pharmaceutical composition) described herein. In some embodiments, the target RNA is a pathological RNA (e.g., an mRNA) comprising miRNA target sites cognate to the hybrid pre-miRNA (e.g., a hybrid pre-miRNA encoded by an engineered replicon). In some embodiments, the cell endogenously expresses the target RNA. In some embodiments, the cell has been transformed (e.g., by transduction with a vector) to express the target RNA. In some embodiments, the cell exhibits a reduced expression level of the target RNA after the contacting, relative to an expression level of the target RNA in the cell prior to the contacting. In some embodiments, the expression level of the target RNA is reduced by at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or by 100% relative to the expression level of the target RNA prior to the contacting.

[0183] Provided herein, in some aspects, is a method for downregulating expression of a protein in a cell. In some embodiments, the method comprises contacting the cell with the hybrid pre-miRNA and / or engineered replicon. In some embodiments, the contacting comprises contacting the cell with an engineered replicon described herein, a hybrid miRNA described herein, a vector encoding an engineered replicon and / or hybrid miRNA described herein, or a composition (e.g., a pharmaceutical composition) described herein. In some embodiments, the protein is a pathological protein encoded by a target RNA (e.g., an mRNA) comprising miRNA target sites cognate to the hybrid pre-miRNA (e.g., a hybrid pre-miRNA encoded by an engineered replicon). In some embodiments, the cell endogenously expresses the protein. In some embodiments, the cell has been transformed (e.g., by transduction with a vector) to express the protein. In some embodiments, the cell exhibits a reduced expression level of the protein after the contacting, relative to an expression level of the protein in the cell prior to the contacting. In some embodiments, the expression level of the protein is reduced by at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or by 100% relative to the expression level of the protein prior to the contacting.

[0184] Provided herein, in some aspects, is a method for treating a subject having a disease characterized by overexpression of a pathological RNA. In some embodiments, the method comprises administering an engineered replicon described herein, a hybrid miRNA described herein, a vector encoding an engineered replicon and / or hybrid miRNA described herein, a cell comprising an engineered replicon and / or hybrid miRNA described herein, a composition (e.g., a pharmaceutical composition) described herein to the subject. In some embodiments, the pathological RNA is an mRNA comprising miRNA target sites cognate to the hybrid pre- miRNA (e.g., a hybrid pre-miRNA encoded by an engineered replicon). In some embodiments, cells of the subject exhibit a reduced expression level of the pathological RNA after the contacting, relative to an expression level of the pathological RNA expressed in cells of the subject prior to the contacting. In some embodiments, the expression level of the pathological RNA is reduced by at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or by 100% relative to the expression level of the pathological RNA prior to the contacting. In some embodiments, the subject experiences a therapeutic effect as a result of the administration (e.g., experiences a reduction in the frequency and / or severity of one or more symptoms).

[0185] Provided herein, in some aspects, is a method for treating a subject having a disease characterized by overexpression of a pathological protein. In some embodiments, the method comprises administering an engineered replicon described herein, a hybrid miRNA described herein, a vector encoding an engineered replicon and / or hybrid miRNA described herein, a cell comprising an engineered replicon and / or hybrid miRNA described herein, a composition (e.g., a pharmaceutical composition) described herein to the subject. In some embodiments, the protein is encoded by a target RNA (e.g., an mRNA) comprising miRNA target sites cognate to the hybrid pre-miRNA (e.g., a hybrid pre-miRNA encoded by an engineered replicon). In some embodiments, cells of the subject exhibit a reduced expression level of the pathological protein after the contacting, relative to an expression level of the pathological protein expressed in cells of the subject prior to the contacting. In some embodiments, the expression level of the pathological protein is reduced by at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or by 100% relative to the expression level of the pathological protein prior to the contacting. In some embodiments, the subject experiences a therapeutic effect as a result of the administration (e.g., experiences a reduction in the frequency and / or severity of one or more symptoms).

[0186] Provided herein, in some aspects, is a method of expressing engineered replicons in a cell-free system. In some embodiments, the method comprises in vitro transcription (IVT) of the engineered replicon from a linearized viral vector by a polymerase. Transcription is known in the art, and is the first step of gene expression, wherein a segment of deoxyribonucleic acid (DNA) is copied into RNA by an RNA polymerase. In some embodiments, the polymerase is a T7 RNA polymerase, which catalyzes the formation of RNA from DNA in the 5’ to 3’ direction.

[0187] Further non-limiting examples of the features and benefits of the disclosed engineered replicons with hybrid pre-miRNA include: 1) sequence-specific RNA degradation; 2) higher and prolonged degradation capacity compared to siRNA due to self-replication of the replicon; 3) therapeutic replenishment of downregulated host miRNA; and 4) cross-regulation of co-delivered replicons. In addition, the disclosed replicons with hybrid pre-miRNA with user-defined targeting sequences: 1) avoiding plasmid (DNA)-based delivery of miRNA, which has risk of unwanted genomic integrations, while RNA-based delivery does not; 2) provides fine-tuned regulation of the replicon delivery system (e.g., small molecule-based induction or repression) which is not possible with siRNA; and 3) can alleviate targeted of replicons by innate antiviral immunity by a replicon-integrated non-protein based downregulation of such immunity.

[0188] ADDITIONAL EMBODIMENTS

[0189] All of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.

[0190] From the above description, one skilled in the art can easily ascertain the essential characteristics of the present invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Thus, other embodiments are also set forth as follows:

[0191] Embodiment 1. A hybrid pre-micro ribonucleic acid (pre-miRNA), comprising a scaffold and user-defined targeting sequence (UTS), wherein the scaffold comprises a guide strand stem domain, a passenger strand stem domain, and a terminal loop, wherein the guide strand stem domain comprises a pre-miR- BART2 guide strand stem domain or a pre-miR-BART17 guide strand stem domain, and wherein the passenger strand stem domain comprises a pre-miR-BART2 passenger strand stem domain; and wherein the UTS is not a pre-miR-BART2 targeting sequence.

[0192] Embodiment 2. The hybrid pre-miRNA of embodiment 1, wherein the guide strand stem domain comprises a pre-miR-BART2 guide strand stem domain.

[0193] Embodiment 3. The hybrid pre-miRNA of embodiment 1 or 2, wherein the pre-miR-BART2 guide strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 79.

[0194] Embodiment 4. The hybrid pre-miRNA of any one of embodiments 1-3, wherein the pre- miR-BART2 guide strand stem domain consists of the sequence set forth in SEQ ID NO: 79.

[0195] Embodiment 5. The hybrid pre-miRNA of embodiment 1, wherein the guide strand stem domain comprises a pre-miR-BART17 guide strand stem domain.

[0196] Embodiment 6. The hybrid pre-miRNA of embodiment 1 or 5, wherein the pre-miR- BART17 guide strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 82. Embodiment 7. The hybrid pre-miRNA of any one of embodiments 1, 5, or 6, wherein the pre-miR-BART17 guide strand stem domain consists of the sequence set forth in SEQ ID NO: 82.

[0197] Embodiment 8. The hybrid pre-miRNA of any one of embodiments 1-7, wherein the terminal loop comprises a pre-miR-BART2 terminal loop.

[0198] Embodiment 9. The hybrid pre-miRNA of embodiment 8, wherein the pre-miR-BART2 terminal loop comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 81.

[0199] Embodiment 10. The hybrid pre-miRNA of embodiment 9, wherein the pre-miR-BART2 terminal loop consists of the sequence set forth in SEQ ID NO: 81.

[0200] Embodiment 11. The hybrid pre-miRNA of embodiment 1, wherein the guide strand stem domain comprises a pre-miR-BART2 guide strand stem domain, the passenger strand stem domain comprises a pre-miR-BART2 passenger strand stem domain, and the terminal loop comprises a pre-miR-BART2 terminal loop.

[0201] Embodiment 12. The hybrid pre-miRNA of embodiment 11, wherein the guide strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 79, the passenger strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 80, and the terminal loop comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 81.

[0202] Embodiment 13. The hybrid pre-miRNA of embodiment 1, wherein the guide strand stem domain comprises a pre-miR-BART17 guide strand stem domain and the passenger strand stem domain comprises a pre-miR-BART2 passenger strand stem domain.

[0203] Embodiment 14. The hybrid pre-miRNA of embodiment 13, wherein the guide strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 82, and the passenger strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 80. Embodiment 15. The hybrid pre-miRNA of any one of embodiments 1-14 wherein the UTS comprises an miRNA targeting sequence cognate to an miRNA target site in a therapeutic target.

[0204] Embodiment 16. The hybrid pre-miRNA of any one of embodiments 1-15, wherein the therapeutic target is a target RNA encoding a pathological protein.

[0205] Embodiment 17. The hybrid pre-miRNA of any one of embodiments 1-16, wherein the UTS comprises an miRNA targeting sequence selected from Table 2.

[0206] Embodiment 18. The hybrid pre-miRNA of any one of embodiments 1-17, comprising a sequence selected from Table 3.

[0207] Embodiment 19. An RNA polynucleotide comprising the hybrid pre-miRNA of any one of embodiments 1-18.

[0208] Embodiment 20. An engineered replicon comprising the hybrid pre-miRNA of any one of embodiments 1-18.

[0209] Embodiment 21. An engineered replicon comprising a hybrid pre-micro ribonucleic acid (pre-miRNA), the hybrid pre-miRNA comprising a scaffold and user-defined targeting sequence (UTS), wherein the scaffold comprises a guide strand stem domain, a passenger strand stem domain, and a terminal loop, wherein the guide strand stem domain comprises a pre-miR- BART2 guide strand stem domain or a pre-miR-BART17 guide strand stem domain, and wherein the passenger strand stem domain comprises a pre-miR-BART2 passenger strand stem domain; and wherein the UTS is not a pre-miR-BART2 targeting sequence.

[0210] Embodiment 22. The engineered replicon of embodiment 21, wherein the guide strand stem domain comprises a pre-miR-BART2 guide strand stem domain. Embodiment 23. The engineered replicon of embodiment 21 or 22, wherein the pre-miR- BART2 guide strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 79.

[0211] Embodiment 24. The engineered replicon of any one of embodiments 21-23, wherein the pre-miR-BART2 guide strand stem domain consists of the sequence set forth in SEQ ID NO: 79.

[0212] Embodiment 25. The engineered replicon of embodiment 21, wherein the guide strand stem domain comprises a pre-miR-BART17 guide strand stem domain.

[0213] Embodiment 26. The engineered replicon of embodiment 21 or 25, wherein the pre-miR- BART17 guide strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 82.

[0214] Embodiment 27. The engineered replicon of any one of embodiments 21, 25, or 26, wherein the pre-miR-BART17 guide strand stem domain consists of the sequence set forth in SEQ ID NO: 82.

[0215] Embodiment 28. The engineered replicon of any one of embodiments 21-27, wherein the terminal loop comprises a pre-miR-BART2 terminal loop.

[0216] Embodiment 29. The engineered replicon of embodiment 28, wherein the pre-miR-BART2 terminal loop comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 81.

[0217] Embodiment 30. The engineered replicon of embodiment 29, wherein the pre-miR-BART2 terminal loop consists of the sequence set forth in SEQ ID NO: 81.

[0218] Embodiment 31. The engineered replicon of embodiment 21, wherein the guide strand stem domain comprises a pre-miR-BART2 guide strand stem domain, the passenger strand stem domain comprises a pre-miR-BART2 passenger strand stem domain, and the terminal loop comprises a pre-miR-BART2 terminal loop. Embodiment 32. The engineered replicon of embodiment 31, wherein the guide strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 79, the passenger strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 80, and the terminal loop comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 81.

[0219] Embodiment 33. The engineered replicon of embodiment 21, wherein the guide strand stem domain comprises a pre-miR-BART17 guide strand stem domain and the passenger strand stem domain comprises a pre-miR-BART2 passenger strand stem domain.

[0220] Embodiment 34. The engineered replicon of embodiment 33, wherein the guide strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 82, and the passenger strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 80.

[0221] Embodiment 35. The engineered replicon of any one of embodiments 21-34 wherein the UTS comprises an miRNA targeting sequence cognate to an miRNA target site in a therapeutic target.

[0222] Embodiment 36. The engineered replicon of any one of embodiments 21-35, wherein the therapeutic target is a target RNA encoding a pathological protein.

[0223] Embodiment 37. The engineered replicon of any one of embodiments 21-36, wherein the UTS comprises an miRNA targeting sequence selected from Table 2.

[0224] Embodiment 38. The engineered replicon of any one of embodiments 21-37, comprising a sequence selected from Table 3.

[0225] Embodiment 39. The engineered replicon of any one of embodiments 21-28, further comprising a 3’ UTR.

[0226] Embodiment 40. The engineered replicon of embodiment 39, wherein the 3’ UTR comprises the hybrid pre-miRNA. Embodiment 41. The engineered replicon of any one of embodiments 21-40, comprising a nucleic acid encoding non-structural proteins 1-4 (nsPl-4) of an alphavirus.

[0227] Embodiment 42. The engineered replicon of embodiment 41, wherein the alphavirus is a Venezuelan equine encephalitis virus (VEEV).

[0228] Embodiment 43. The engineered replicon of any one of embodiments 21-42, further comprising a subgenomic promoter (SGP).

[0229] Embodiment 44. The engineered replicon of embodiment 43, wherein the SGP is an alphavirus SGP.

[0230] Embodiment 45. The engineered replicon of embodiment 43 or 44, wherein the SGP comprises the sequence set forth in any one of SEQ ID NOs: 74-76.

[0231] Embodiment 46. The engineered replicon of any one of embodiments 43-45, wherein the SGP is operably linked to the hybrid pre-miRNA.

[0232] Embodiment 47. The engineered replicon of any one of embodiments 21-42, further comprising two or more SGPs.

[0233] Embodiment 48. The engineered replicon of any one of embodiments 21-47, comprising two or more hybrid pre-miRNAs.

[0234] Embodiment 49. The engineered replicon of embodiment 48, wherein the two or more hybrid pre-miRNAs comprise a first hybrid pre-miRNA and a second hybrid pre-miRNA.

[0235] Embodiment 50. The engineered replicon of embodiment 49, wherein the first hybrid pre- miRNA is operably linked to a first SGP and the second hybrid pre-miRNA is operably linked to a second SGP.

[0236] Embodiment 51. The engineered replicon of embodiment 50, wherein the first SGP and the second SGP are different. Embodiment 52. The engineered replicon of any one of embodiments 21-51, further comprising a nucleic acid sequence encoding a payload.

[0237] Embodiment 53. The engineered replicon of embodiment 52, wherein the payload is a therapeutic payload.

[0238] Embodiment 54. The engineered replicon of embodiment 52 or 53, wherein the payload is a protein.

[0239] Embodiment 55. The engineered replicon of embodiment 52 or 53, wherein the payload is a functional nucleic acid.

[0240] Embodiment 56. The engineered replicon of any one of embodiments 21-55, further comprising a polyadenylation tail (pA).

[0241] Embodiment 57. The engineered replicon of any one of embodiments 21-56, further comprising a 5’ 7-m ethylguanosine (m7G) cap.

[0242] Embodiment 58. The engineered replicon of any one of embodiments 21-57, further comprising a miRNA target site.

[0243] Embodiment 59. The engineered replicon of embodiment 58, wherein the miRNA target site is cognate to the UTS.

[0244] Embodiment 60. The engineered replicon of any one of embodiments 21-57, further comprising a plurality of miRNA target sites.

[0245] Embodiment 61. A method of expressing a hybrid pre-miRNA in a cell, the method comprising contacting a cell with the hybrid pre-miRNA of any one of embodiments 1-18, the RNA polynucleotide of embodiment 19, or the engineered replicon of any one of embodiments 20-60.

[0246] Embodiment 62. The method of embodiment 61, wherein the cell is a mammalian cell. Embodiment 63. The method of embodiment 61 or 62, wherein the cell is a human cell.

[0247] Embodiment 64. The method of any one of embodiments 61-63, wherein the cell is in a subject.

[0248] Embodiment 65. A cell comprising the hybrid pre-miRNA of any one of embodiments 1-18, the RNA polynucleotide of embodiment 19, or the engineered replicon of any one of embodiments 20-60.

[0249] Embodiment 66. A composition comprising the hybrid pre-miRNA of any one of embodiments 1-18, the RNA polynucleotide of embodiment 19, the engineered replicon of any one of embodiments 20-60, or the cell of embodiment 65.

[0250] Embodiment 67. A pharmaceutical composition comprising the hybrid pre-miRNA of any one of embodiments 1-18, the RNA polynucleotide of embodiment 19, the engineered replicon of any one of embodiments 20-60, or the cell of embodiment 65, and a pharmaceutically acceptable carrier.

[0251] Embodiment 68. A method of expressing a micro ribonucleic acid (miRNA) in a cell, the method comprising contacting the cell with an engineered replicon comprising a hybrid pre- miRNA, wherein the hybrid pre-miRNA comprises a scaffold and user-defined targeting sequence (UTS); wherein the scaffold comprises a guide strand stem domain, a passenger strand stem domain, and a terminal loop, wherein the guide strand stem domain comprises a pre-miR- BART2 guide strand stem domain or a pre-miR-BART17 guide strand stem domain, and wherein the passenger strand stem domain comprises a pre-miR-BART2 passenger strand stem domain; and wherein the UTS is not a pre-miR-BART2 targeting sequence.

[0252] Embodiment 69. A method of downregulating expression of a target ribonucleic acid (RNA) in a cell, the method comprising contacting the cell with an engineered replicon comprising a hybrid pre-microRNA (pre-miRNA), wherein the hybrid pre-miRNA comprises a scaffold and user-defined targeting sequence (UTS); wherein the scaffold comprises a guide strand stem domain, a passenger strand stem domain, and a terminal loop, wherein the guide strand stem domain comprises a pre-miR- BART2 guide strand stem domain or a pre-miR-BART17 guide strand stem domain, and wherein the passenger strand stem domain comprises a pre-miR-BART2 passenger strand stem domain; wherein the target RNA comprises an miRNA target site; and wherein the UTS comprises a targeting sequence cognate to the miRNA target site of the target RNA.

[0253] Embodiment 70. A method of downregulating expression of a protein in a cell, the method comprising contacting the cell with an engineered replicon comprising a hybrid pre- microRNA (pre-miRNA), wherein the hybrid pre-miRNA comprises a scaffold and user-defined targeting sequence (UTS); wherein the scaffold comprises a guide strand stem domain, a passenger strand stem domain, and a terminal loop, wherein the guide strand stem domain comprises a pre-miR- BART2 guide strand stem domain or a pre-miR-BART17 guide strand stem domain, and wherein the passenger strand stem domain comprises a pre-miR-BART2 passenger strand stem domain; wherein the protein is encoded by a target RNA comprising an miRNA target site; and wherein the UTS comprises a targeting sequence cognate to the miRNA target site of the target RNA.

[0254] Embodiment 71. A method for treating a subject having a disease characterized by overexpression of a pathological ribonucleic acid (RNA) or a pathological protein encoded by an RNA, the method comprising contacting the cell with an engineered replicon comprising a hybrid pre-microRNA (pre-miRNA), wherein the hybrid pre-miRNA comprises a scaffold and user-defined targeting sequence (UTS); wherein the scaffold comprises a guide strand stem domain, a passenger strand stem domain, and a terminal loop, wherein the guide strand stem domain comprises a pre-miR- BART2 guide strand stem domain or a pre-miR-BART17 guide strand stem domain, and wherein the passenger strand stem domain comprises a pre-miR-BART2 passenger strand stem domain; wherein the pathological RNA comprises an miRNA target site or wherein the pathological protein is encoded by a target RNA comprising an miRNA target site; and wherein the UTS comprises a targeting sequence cognate to the miRNA target site of the pathological RNA or the target RNA.

[0255] EXAMPLES

[0256] The following examples are provided to illustrate specific instances of the practice of the present disclosure and are not intended to limit the scope of the invention. As will be apparent to one of ordinary skill in the art, the present invention will find application in a variety of compositions and methods.

[0257] Example 1: Expression of Viral miRNA in Replicon

[0258] Small viral RNA-5 (svRNA-5) were cloned from Dengue virus (SEQ ID NO: 1) and scaffolding of pre-miR-BART2 (SEQ ID NOs: 79-81) from Epstein-Barr virus (SEQ ID NO: 2) were inserted within the 3’UTR of an engineered replicon derived from Venezuelan equine encephalitis virus (VEEV). The Epstein-Barr virus (EBV) miR-BART2 sequence was obtained from genomic DNA of human herpesvirus. To create variants containing the miR- BART2 precursor stem-loop and flanking EBV sequence, DNA was amplified from EBV B95-8 genomic DNA using primers 5’-ATCGACCGGTATGCCACCTCCCTGCCTG-3’ (SEQ ID NO: 77) and 5’-CGATACCGGTGCGTGGCCCGTGGATCTG-3’ (SEQ ID NO: 78).

[0259] Viral microRNA transcription was driven by strong constitutive subgenomic promoter and transcription levels were correlated to mKate cloned upstream from 3’UTR. Viral microRNA targeting was quantified by downregulation of reporter mVenus-PEST with four tandem repeats of complementary microRNA target sites within 3’UTR on a different replicon. Engineered replicons containing pre-microRNA sequences and engineered replicons containing microRNA target-sites (as in FIG. 2A) were co-electroporated into BHK-21 cell line and fluorescence was analyzed using flow cytometry (schematically depicted in FIG. 2B). The results are shown in FIG. 2C.

[0260] Cells transfected with engineered replicons containing miR-svRNA-5 did not show significant mVenus-PEST reporter reduction compared to control replicons containing reporters without or with non-cognate target sites. However, replicons containing miR- BART2 significantly downregulated mVenus-PEST reporter below 10% of the control reporter intensities only when the cognate target site was present. miR-BART2 also showed similar reporter downregulation when expressed from weak and medium subgenomic promoters.

[0261] Example 2: miR-BART2 Expression from Different Relative Positions within Replicon

[0262] In this example, the position of the miR-BART2 was changed to observe the effects on expression. The electroporation and expression analysis were conducted as described in Example 1. The left two panels of FIG. 3 show the results from the replicon Rep mKate2- miR-BART2 + EBFP2, while the right two panels of FIG. 3 show the results from the replicon Rep EBFP2 + mKate2-miR-BART2 having the opposite order of elements.

[0263] In replicons with two tandem gene expression cassettes, miR-BART2 was effectively expressed in both first and second positions. Similarly, miR-BART2 could also specifically downregulate mVenus-PEST reporter placed in either tandem position, which showed versatility in microRNA expression and targeting within replicons.

[0264] Example 3: miR-BART2 Expression from Different Promoters

[0265] Low, medium, and high expression level subgenomic promoters (SGPs) were used to drive expression of miR-BART2. The electroporation and expression analysis were conducted as described in Example 1.

[0266] FIG. 4 shows the results of expression of miR-BART2 from low and medium strength SGPs on the expression of mKate and EBFP2.

[0267] Example 4: Other miRNAs and Design of Hybrid miR-BART2

[0268] The ability to incorporate user-defined microRNA sequences into pre-miR-BART2 sequence was evaluated. Hybrid pre-miR-BART2 were designed with preserved secondary structure and replaced mature miR-BART2 with microRNA sequences of interest (e.g., miR- 122 and FF4), as well as a sequence targeting IFNAR1 (interferon alpha and beta receptor subunit 1), which is associated with antiviral activity and replicon degradation. The electroporation and expression analysis were conducted as described in Example 1.

[0269] FIG. 5 shows designs for hybrid miR-BART2, showing folding parameters and secondary structures. Examples include: pre-miR-BART2 / miR-122, and pre-miR- BART2 / FF4. Pre-miR-BART2, pre-FF4, and pre-miR-122 are also shown. Also depicted are improved designs of IFNAR1 -targeting miRNAs, including pre-miR-BART2 / IFNARl(l) and pre-miR-BART2 / IFNARl(2). The effects of these various miRNAs on expression of mKate and EBFP2 are shown.

[0270] Hybrid pre-miR-BART2 activity is validated with complementary target site reporters on replicons, plasmids, and native mRNA target sequence with complete open reading frame.

[0271] Example 5: Replicon- vs Plasmid-mediated expression of miRNAs

[0272] Replicons were constructed using Golden Gate assembly hierarchical cloning to the final destination plasmid with nspl-4, subgenomic promoters, fluorescent protein payloads, pre-miRNA, miRNA target site, El(trunc) and 3’UTR. Plasmid-encoded replicon sequence was linearized using standard PCR, column purified, then in vitro transcribed, DNase treated, column purified, then capped using ScriptCap™ Cap 1 Capping System and finally column purified before electroporation into cells. Reporter plasmids were constructed using Golden Gate assembly hierarchical cloning.

[0273] Plasmids for assessing transfection and miRNA repression activity had two transcriptional units: 1) constitutive fluorescent reporter 1 expression (z.e., transfection marker), and 2) constitutive fluorescent reporter 2 expression with corresponding miRNA target sites within 3’UTR (miRNA repression activity marker). EBFP2 was used as a transfection reporter and NeonGreenPEST or CopGFP were used as miRNA repression activity reporters, as shown in FIG. 10A (CopGFP not shown). Fluorescent reporter 1 (z.e., transfection marker) expression was used to normalize change in fluorescent reporter 2 (i.e., miRNA repression activity marker) expression upon miRNA repression.

[0274] Plasmids expressing miRNA had two transcriptional units: 1) constitutive fluorescent reporter expression (miRNA-plasmid-positive marker), and 2) Pre-miRNA expression from U6 promoter.

[0275] Replicons were electroporated into BHK-21 cells. miRNA-expressing plasmids were transfected using Lipofectamine 3000. Electroporated replicons and transfected plasmids were incubated for 24 hours. After 24 hours, cells were detached and fluorescence was measured using flow cytometry. Flow data was analyzed using CytoFlow and reported as histograms, scatter plots or bar charts with normalized reporter signal. To determine normalized reporter signal, cell population was gated for miRNA-positive cells (upstream fluorescent marker-positive or miRNA-plasmid-positive marker) and reporter transfection marker-positive cells, then a ratio of fluorescence geometric mean value of reporter with corresponding miRNA target site and transfection marker were determined. As exemplified in FIGs. 7A-7C, engineered replicons can effectively express miRNA in various configurations. miRNA express well regardless of promoter strength (FIG. 7A), position in the replicon (FIG. 7B), and without upstream ORF and payload-encoding sequences (FIG. 7C). As shown in FIG. 8, hybrid pre-miRNA containing miR-BART2 scaffolding, but not scramble sequences or hybrid pre-miRNA containing miR-451 scaffolding, downregulate expression of reporters operably linked to cognate miRNA target sites. These findings confirm that replicons can be utilized to effectively deliver miRNA to cells. Furthermore, these findings indicate that hybrid pre-miRNA containing BART2 scaffolding are generally useful, inter alia, for delivering desired miRNA mature targeting sequences to cells. Sequences corresponding to the hybrid pre-miRNAs containing pre-miR-451 scaffolding are provided below in Table 4.

[0276] Table 4. Hybrid pre-miR-451

[0277] FIGs. 9A-9D demonstrate various engineered replicon designs for self-repression of engineered replicon-encoded payloads and miRNA (e.g., hybrid pre-miRNA), as desired by a user. Similarly, FIGs. 10A-10D demonstrate that endogenous miRNA expression can downregulate miRNA expression from engineered replicons via target site degradation while heterologous miRNAs downregulate target RNA or protein expression in a genomic site.

[0278] Overall, the engineered replicons and hybrid pre-miRNA designs described herein provide a robust toolbox for delivery of miRNA to cells and regulation of gene expression (e.g., RNA expression, protein translation) in the same.

Claims

CLAIMSWhat is claimed is:

1. A hybrid pre-micro ribonucleic acid (pre-miRNA), comprising a scaffold and user- defined targeting sequence (UTS), wherein the scaffold comprises a guide strand stem domain, a passenger strand stem domain, and a terminal loop; wherein the guide strand stem domain comprises a pre-miR-BART2 guide strand stem domain or a pre-miR-BART17 guide strand stem domain, and wherein the passenger strand stem domain comprises a pre-miR-BART2 passenger strand stem domain; and wherein the UTS is not a pre-miR-BART2 targeting sequence.

2. The hybrid pre-miRNA of claim 1, wherein the terminal loop comprises a pre-miR- BART2 terminal loop.

3. The hybrid pre-miRNA of claim 1, wherein the guide strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID: 79 or SEQ ID NO: 82.

4. The hybrid pre-miRNA of claim 1, wherein the passenger strand stem domain comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 80.

5. The hybrid pre-miRNA of claim 1, wherein the terminal loop comprises a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 81.

6. An RNA polynucleotide comprising the hybrid pre-miRNA of claim 1.

7. An engineered replicon comprising the hybrid pre-miRNA of claim 1.

8. An engineered replicon comprising a hybrid pre-micro ribonucleic acid (pre-miRNA), the hybrid pre-miRNA comprising a scaffold and user-defined targeting sequence (UTS), wherein the scaffold comprises a guide strand stem domain, a passenger strand stem domain, and a terminal loop;wherein the guide strand stem domain comprises a pre-miR-BART2 guide strand stem domain or a pre-miR-BART17 guide strand stem domain, and wherein the passenger strand stem domain comprises a pre-miR-BART2 passenger strand stem domain; and wherein the UTS is not a pre-miR-BART2 targeting sequence.

9. The engineered replicon of claim 8, further comprising a 3’ untranslated region (UTR).

10. The engineered replicon of claim 9, wherein the 3’ UTR comprises the hybrid pre- miRNA.

11. A cell comprising the hybrid pre-miRNA of claim 1 or the engineered replicon of claim 8.

12. A method of expressing a micro ribonucleic acid (miRNA) in a cell, the method comprising contacting the cell with an engineered replicon comprising a hybrid pre-miRNA, wherein the hybrid pre-miRNA comprises a scaffold and user-defined targeting sequence (UTS); wherein the scaffold comprises a guide strand stem domain, a passenger strand stem domain, and a terminal loop; wherein the guide strand stem domain comprises a pre-miR-BART2 guide strand stem domain or a pre-miR-BART17 guide strand stem domain, and wherein the passenger strand stem domain comprises a pre-miR-BART2 passenger strand stem domain; and wherein the UTS is not a pre-miR-BART2 targeting sequence.

13. A method of downregulating expression of a target ribonucleic acid (RNA) in a cell, the method comprising contacting the cell with an engineered replicon comprising a hybrid pre-microRNA (pre-miRNA), wherein the hybrid pre-miRNA comprises a scaffold and user-defined targeting sequence (UTS); wherein the scaffold comprises a guide strand stem domain, a passenger strand stem domain, and a terminal loop;wherein the guide strand stem domain comprises a pre-miR-BART2 guide strand stem domain or a pre-miR-BART17 guide strand stem domain, and wherein the passenger strand stem domain comprises a pre-miR-BART2 passenger strand stem domain; wherein the target RNA comprises an miRNA target site; and wherein the UTS comprises a targeting sequence cognate to the miRNA target site of the target RNA.

14. A method of downregulating expression of a protein in a cell, the method comprising contacting the cell with an engineered replicon comprising a hybrid pre-microRNA (pre- miRNA), wherein the hybrid pre-miRNA comprises a scaffold and user-defined targeting sequence (UTS); wherein the scaffold comprises a guide strand stem domain, a passenger strand stem domain, and a terminal loop; wherein the guide strand stem domain comprises a pre-miR-BART2 guide strand stem domain or a pre-miR-BART17 guide strand stem domain, and wherein the passenger strand stem domain comprises a pre-miR-BART2 passenger strand stem domain; wherein the protein is encoded by a target RNA comprising an miRNA target site; and wherein the UTS comprises a targeting sequence cognate to the miRNA target site of the target RNA.

15. A method for treating a subject having a disease characterized by overexpression of a pathological ribonucleic acid (RNA) or a pathological protein encoded by an RNA, the method comprising contacting the cell with an engineered replicon comprising a hybrid pre- microRNA (pre-miRNA), wherein the hybrid pre-miRNA comprises a scaffold and user-defined targeting sequence (UTS); wherein the scaffold comprises a guide strand stem domain, a passenger strand stem domain, and a terminal loop; wherein the guide strand stem domain comprises a pre-miR-BART2 guide strand stem domain or a pre-miR-BART17 guide strand stem domain, and wherein the passenger strand stem domain comprises a pre-miR-BART2 passenger strand stem domain; wherein the pathological RNA comprises an miRNA target site or wherein the pathological protein is encoded by a target RNA comprising an miRNA target site; andwherein the UTS comprises a targeting sequence cognate to the miRNA target site of the pathological RNA or the target RNA.

Citation Information

Patent Citations

  • Methods of analysis of alternative splicing in human

    US20050244851A1

  • Viral and viral associated MiRNAs and uses thereof

    US20070003575A1

  • HYBRID tRNA / pre-miRNA MOLECULES AND METHODS OF USE

    US20180237772A1

  • tRNA / pre-miRNA Compositions and Use in Treating Cancer

    US20210246446A1

  • Methods and compositions for modulating splicing and translation

    WO2020219934A1