Novel glutamine-hydrolyzing GMP synthase variant and method for producing 5'-guanosine monophosphate by using same

Abstract

The present application relates to a novel glutamine-hydrolyzing GMP synthase variant and a method for producing 5'-guanosine monophosphate by using same. A microorganism into which the glutamine-hydrolyzing GMP synthase variant of the present application is introduced is cultured to enable high-yield GMP production.

Description

Novel glutamine hydrolyzing GMP synthetase variant and method for producing 5'-guanine acid using the same

[0001] Cross-citation with related application(s)

[0002] This application claims the benefit of priority to Korean Patent Application No. 10-2024-0009487, filed January 22, 2024, the entire contents of which are incorporated herein by reference.

[0003] The present application relates to a novel glutamine hydrolyzing GMP synthase variant and a method for producing 5'-guanine acid using the same.

[0004] 5'-Guanosine monophosphate (GMP) is an intermediate in nucleic acid biosynthesis and plays a vital physiological role in both plants and animals. It is also widely used in food, pharmaceuticals, and various other medical applications. It is one of the nucleic acid-based seasonings that is gaining attention as a palatable seasoning, particularly due to its significant flavor enhancement effect when used with monosodium glutamate (MSG).

[0005] GMP manufacturing methods include (1) decomposing yeast RNA using microbial enzymes or chemically; (2) directly producing nucleotides through microorganisms in a medium containing sugars, nitrogen sources, and phosphate sources; and (3) chemically or enzymatically converting intermediates in nucleotide synthesis. Currently, a combined manufacturing method combining fermentation, chemical synthesis, and enzymatic conversion is widely used industrially.

[0006] This complex manufacturing method consists of a fermentation process using microorganisms to produce 5'-xanthosine monophosphate (XMP), an intermediate product of the purine nucleotide biosynthesis metabolic chain, and an enzymatic reaction process to convert the fermentation products into GMP. Microorganisms that produce XMP and microorganisms that can convert XMP into GMP are used. Therefore, in order to produce GMP efficiently, the microorganisms involved in GMP production must have GMP decomposition suppressed, and in particular, the microorganisms added during the enzymatic reaction process must have a high complex ability to convert XMP into GMP.

[0007] For these reasons, various studies are being conducted to develop high-efficiency production microorganisms and fermentation process technologies. For example, target-substance-specific approaches, such as increasing the expression of genes encoding enzymes involved in XMP or GMP biosynthesis or deleting genes unnecessary for biosynthesis, are primarily being utilized (US 2020-0347346 A1).

[0008] An example of the present application provides a polypeptide having glutamine-hydrolyzing GMP synthase activity.

[0009] The above polypeptide may include an amino acid sequence having 90% or more sequence identity with the amino acid sequence of SEQ ID NO: 1, in which i) the amino acid corresponding to the 123rd residue of the amino acid sequence of SEQ ID NO: 1 is replaced with a different amino acid, ii) the amino acid corresponding to the 441st residue of the amino acid sequence of SEQ ID NO: 1 is replaced with a different amino acid, or iii) a combination thereof.

[0010] Another example of the present application provides a polynucleotide encoding the polypeptide.

[0011] Another example of the present application provides a recombinant vector comprising the polynucleotide.

[0012] Another example of the present application provides a microorganism comprising at least one member selected from the group consisting of a polypeptide having the glutamine hydrolyzing GMP synthase activity, a polynucleotide encoding the polypeptide, and a vector comprising the polynucleotide.

[0013] Another example of the present application provides a GMP production method comprising the step of culturing the microorganism in a medium.

[0014] Another example of the present application provides a composition for producing 5'-guanine acid, comprising the microorganism.

[0015] Another example of the present application provides a use for the production of purine 5'-guanine by the microorganism.

[0016] Another example of the present application provides a use for the preparation of a composition for producing 5'-guanine acid by the microorganism.

[0017] In this application, we seek to provide a microorganism having excellent 5'-guanine acid (hereinafter, GMP) production ability (conversion ability) by searching for a mutant that enhances the activity of glutamine-hydrolyzing GMP synthase, and introducing the mutant into a microorganism or producing a microorganism including the mutant.

[0018] In this application, it was confirmed that when an amino acid substitution mutation was introduced at a specific position of the glutamine hydrolyzing GMP synthase, the 5'-guanine acid (GMP) production ability (conversion ability) increased.

[0019]

[0020] An example of the present application provides a polypeptide having glutamine hydrolyzing GMP synthase activity. The polypeptide may be a variant of a glutamine hydrolyzing GMP synthase derived from a microorganism of the genus Corynebacterium, and may be a variant that enhances the activity of the glutamine hydrolyzing GMP synthase.

[0021] In one specific example, the polypeptide may include an amino acid sequence having at least 90% sequence identity with the amino acid sequence of SEQ ID NO: 1, in which the amino acid corresponding to the 123rd residue of the amino acid sequence of SEQ ID NO: 1 from the N-terminus is replaced with another amino acid, the amino acid corresponding to the 441st residue is replaced with another amino acid, or a combination thereof.

[0022] In another specific embodiment, the polypeptide may comprise an amino acid sequence having at least 90% sequence identity with the amino acid sequence of SEQ ID NO: 96, wherein the amino acid corresponding to the 123rd residue of the amino acid sequence of SEQ ID NO: 96 from the N-terminus is replaced with another amino acid, the amino acid corresponding to the 441st residue is replaced with another amino acid, or a combination thereof.

[0023] In an amino acid sequence having 90% or more sequence identity with the amino acid sequence of SEQ ID NO: 1, the amino acid corresponding to the 123rd residue of the amino acid sequence of SEQ ID NO: 1 from the N-terminus may be an amino acid corresponding to the 123rd residue of the amino acid sequence of SEQ ID NO: 96 from the N-terminus in an amino acid sequence having 90% or more sequence identity with the amino acid sequence of SEQ ID NO: 96, and in an amino acid sequence having 90% or more sequence identity with the amino acid sequence of SEQ ID NO: 1, the amino acid corresponding to the 441st residue of the amino acid sequence of SEQ ID NO: 1 from the N-terminus may be an amino acid corresponding to the 441st residue of the amino acid sequence of SEQ ID NO: 96 from the N-terminus in an amino acid sequence having 90% or more sequence identity with the amino acid sequence of SEQ ID NO: 96.

[0024] As mentioned above, counting amino acids from the N-terminus in the amino acid sequence may mean counting with methionine (Met, M) translated from the start codon as the first amino acid.

[0025] Another example of the present application provides a polynucleotide encoding the polypeptide.

[0026] Another example of the present application provides a recombinant vector comprising the polynucleotide. The recombinant vector can be used as an expression vector for the polypeptide.

[0027] Another example of the present application provides a microorganism with enhanced activity of glutamine hydrolyzing GMP synthase. The microorganism may be a microorganism that produces GMP.

[0028] A microorganism having enhanced activity of the above glutamine hydrolyzing GMP synthase can have a higher GMP production capacity compared to a homologous microorganism having not enhanced glutamine hydrolyzing GMP synthase.

[0029] Another example of the present application provides a method for producing GMP, comprising the step of culturing a microorganism having enhanced activity of the glutamine hydrolyzing GMP synthase in a medium.

[0030] Another example of the present application provides a composition for producing GMP, comprising a microorganism having enhanced activity of the glutamine hydrolyzing GMP synthase.

[0031]

[0032] Below, it is explained in more detail.

[0033] The term “glutamine-hydrolyzing GMP synthase” as used herein refers to an enzyme involved in converting 5'-xanthosine monophosphate (XMP) into 5'-guanosine monophosphate (hereinafter referred to as GMP), and has an activity of catalyzing the chemical reaction of ATP + H2O + L-glutamine + XMP → AMP + diphosphate + GMP + 2H+ + L-glutamate. For the purpose of the present application, the enzyme is a protein involved in producing 5'-guanosine monophosphate (hereinafter referred to as GMP). Specifically, the glutamine hydrolyzing GMP synthase of the present application can be used interchangeably with “GMP synthase”, “GMP synthase”, “GMP synthetase”, “GMP synthetase”, “5'-guanine biosynthetase”, and “GuaA protein”. The sequence of the glutamine hydrolyzing GMP synthase in the present application can be obtained from the known database, NCBI’s GenBank (e.g., WP_194285183.1 or WP_025387107.1).

[0034] The protein to be subjected to mutation in the present application may be a wild-type protein having the activity of glutamine hydrolyzing GMP synthetase. Specifically, the glutamine hydrolyzing GMP synthetase to be subjected to mutation may have, include, consist of, or essentially consist of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96, but is not limited thereto. That is, it does not exclude meaningless sequence additions before or after the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96, mutations that may occur naturally, or silent mutations thereof, and if it has the same or corresponding activity as a protein including the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96, it may correspond to the protein to be subjected to mutation in the present application. For example, the protein that is the target of mutation introduction in the present application may be a protein composed of an amino acid sequence that has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.3%, 99.5%, 99.7%, or 99.9% or more, but less than 100% sequence homology or identity with the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96. In addition, if it is an amino acid sequence that has such homology or identity and exhibits an effect corresponding to the protein, a protein that has an amino acid sequence in which some sequences are deleted, modified, substituted, or added may also be included within the scope of the protein that is the target of mutation in the present application.

[0035] In the present application, the glutamine hydrolyzing GMP synthase may be derived from a microorganism of the genus Corynebacterium, specifically, but not limited to, Corynebacterium stationenis (Corynebacterium ammoniagenes) or Corynebacterium casei.

[0036]

[0037] An example of the present application provides a polypeptide having glutamine hydrolyzing GMP synthase activity, wherein the polypeptide comprises a mutation at a position corresponding to the 123rd position and / or the 441st position of the amino acid sequence of SEQ ID NO: 1 from the N-terminus in an amino acid sequence having at least 90% sequence identity with the amino acid sequence of SEQ ID NO: 1. The polypeptide may be a variant of the glutamine hydrolyzing GMP synthase. The variant of the glutamine hydrolyzing GMP synthase may increase the activity and / or GMP production ability (conversion ability) of the glutamine hydrolyzing GMP synthase. The variant of the above glutamine hydrolyzing GMP synthetase may mean an amino acid corresponding to the 123rd amino acid and / or the 441st amino acid of the amino acid sequence of SEQ ID NO: 1 from the N-terminus, in which the amino acid sequence of SEQ ID NO: 1 described above and / or the amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with the above SEQ ID NO: 1 is mutated.

[0038] For example, the polypeptide having the glutamine hydrolyzing GMP synthase activity may be composed of a polypeptide comprising an amino acid sequence having 90% or more sequence identity with the amino acid sequence of SEQ ID NO: 1, wherein i) the amino acid corresponding to the 123rd residue of the amino acid sequence of SEQ ID NO: 1 from the N-terminus is replaced with a different amino acid, ii) the amino acid corresponding to the 441st residue is replaced with a different amino acid, or iii) the amino acid corresponding to the 123rd residue is replaced with a different amino acid and the amino acid corresponding to the 441st residue is replaced with a different amino acid. The different amino acid may mean an amino acid other than the original amino acid.

[0039] Another example of the present application provides a polypeptide having glutamine hydrolyzing GMP synthase activity, wherein the polypeptide comprises a mutation at a position corresponding to the 123rd position and / or the 441st position of the amino acid sequence of SEQ ID NO: 96 from the N-terminus in an amino acid sequence having at least 90% sequence identity with the amino acid sequence of SEQ ID NO: 96. The polypeptide may be a variant of the glutamine hydrolyzing GMP synthase. The variant of the glutamine hydrolyzing GMP synthase may increase the activity and / or GMP production capacity (conversion capacity) of the glutamine hydrolyzing GMP synthase. The variant of the above glutamine hydrolyzing GMP synthetase may mean an amino acid corresponding to the 123rd amino acid and / or the 441st amino acid of the amino acid sequence of SEQ ID NO: 96 from the N-terminus, in which the amino acid sequence of SEQ ID NO: 96 described above and / or the amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with the above SEQ ID NO: 96 is mutated.

[0040] For example, the polypeptide having the glutamine hydrolyzing GMP synthase activity may be composed of a polypeptide comprising an amino acid sequence having 90% or more sequence identity with the amino acid sequence of SEQ ID NO: 96, wherein i) the amino acid corresponding to the 123rd residue of the amino acid sequence of SEQ ID NO: 96 from the N-terminus is replaced with a different amino acid, ii) the amino acid corresponding to the 441st residue is replaced with a different amino acid, or iii) the amino acid corresponding to the 123rd residue is replaced with a different amino acid and the amino acid corresponding to the 441st residue is replaced with a different amino acid. The different amino acid may mean an amino acid other than the original amino acid.

[0041] In one example, the polypeptide having the glutamine hydrolyzing GMP synthase activity may be one in which the amino acid corresponding to the 123rd residue (position) of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96 is replaced with another amino acid. The other amino acid may mean an amino acid different from the original amino acid aspartic acid, and specifically, may be any one amino acid selected from the group consisting of lysine, alanine, cysteine, glutamic acid, phenylalanine, glycine, histidine, isoleucine, leucine, methionine, asparagine, proline, glutamine, arginine, serine, threonine, valine, tryptophan, and tyrosine, and specifically, may be any one amino acid selected from the group consisting of lysine, glutamic acid, histidine, methionine, glutamine, arginine, serine, and tyrosine. In one specific example, a polypeptide in which an amino acid corresponding to the 123rd residue of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96 is substituted with another amino acid in an amino acid sequence having 90% or more sequence identity with the amino acid sequence of SEQ ID NO: 1, or an amino acid sequence having 90% or more sequence identity with the amino acid sequence of SEQ ID NO: 96 may comprise any one amino acid sequence selected from the group consisting of SEQ ID NO: 52 to SEQ ID NO: 59 and SEQ ID NO: 109, or may consist of the amino acid sequence.

[0042] In one example, the polypeptide having the glutamine hydrolyzing GMP synthase activity may be one in which the amino acid corresponding to the 441st residue (position) of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96 is substituted with another amino acid. The above other amino acids may refer to amino acids other than the original amino acid aspartic acid, and specifically, may be any one amino acid selected from the group consisting of valine, alanine, cysteine, glutamic acid, phenylalanine, glycine, histidine, isoleucine, lysine, leucine, methionine, asparagine, proline, glutamine, arginine, serine, threonine, tryptophan, and tyrosine, and specifically, may be any one amino acid selected from the group consisting of valine, alanine, cysteine, glutamic acid, phenylalanine, histidine, isoleucine, lysine, leucine, asparagine, glutamine, threonine, and tryptophan. In one specific example, a polypeptide in which the amino acid corresponding to residue 441 in the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96 is replaced with another amino acid may comprise or consist of any one amino acid sequence selected from the group consisting of SEQ ID NO: 60 to SEQ ID NO: 72 and SEQ ID NO: 110.

[0043] In one example, the polypeptide having the glutamine hydrolyzing GMP synthase activity may be one in which the amino acid corresponding to the 123rd residue of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96 is replaced with a different amino acid, and the amino acid corresponding to the 441st residue is replaced with a different amino acid. The different amino acid may refer to an amino acid different from the original amino acid, and specifically, the amino acid corresponding to the 123rd residue may be replaced with lysine, and the amino acid corresponding to the 441st residue may be replaced with valine. In one specific example, the polypeptide in which the amino acid corresponding to the 123rd residue of the amino acid sequence of SEQ ID NO: 1 is replaced with a different amino acid, and the amino acid corresponding to the 441st residue is replaced with a different amino acid may comprise the amino acid sequence of SEQ ID NO: 73, or may consist of the amino acid sequence.

[0044]

[0045] In addition, the polypeptide having the glutamine hydrolyzing GMP synthase activity of the present application may include a polypeptide having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with an amino acid sequence in which the 123rd amino acid from the N-terminus is substituted with a different amino acid and / or the 441st amino acid is substituted with a different amino acid in the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96. In addition, it is obvious that a polypeptide having an amino acid sequence in which a part of the sequence is deleted, modified, substituted, or added in addition to the amino acid sequence at the 123rd and / or 441st positions, as long as it has such homology or identity and exhibits an activity corresponding to the protein, is also included within the scope of the present application.

[0046] In one specific example, the polypeptide having the glutamine hydrolyzing GMP synthase activity has an amino acid sequence of any one of SEQ ID NOs selected from the group consisting of SEQ ID NOs: 52 to 73 that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 96.3%, at least 96.5%, at least 96.7%, at least 96.9%, at least 97%, at least 97.1%, at least 97.2%, at least 97.4%, at least 97.6%, at least 97.8%, at least 98%, at least 98.2%, at least 98.4%, at least 98.6%, at least 98.9%, at least 99%, at least 99.1%, at least 99.3%, at least 99.5%, at least 99.7% or It may comprise or consist of an amino acid sequence having 99.9% or more homology or identity.

[0047] In one specific example, the polypeptide having the glutamine hydrolyzing GMP synthase activity has an amino acid sequence of any one of SEQ ID NOs selected from the group consisting of SEQ ID NOs: 106 to 108 that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 96.3%, at least 96.5%, at least 96.7%, at least 96.9%, at least 97%, at least 97.1%, at least 97.2%, at least 97.4%, at least 97.6%, at least 97.8%, at least 98%, at least 98.2%, at least 98.4%, at least 98.6%, at least 98.9%, at least 99%, at least 99.1%, at least 99.3%, at least 99.5%, It may comprise or consist of an amino acid sequence having a homology or identity of 99.7% or 99.9% or more.

[0048] In addition, if a polypeptide has such homology or identity and exhibits an activity corresponding to a polypeptide having the glutamine hydrolyzing GMP synthase activity, it may be included in the variant of the present application even if it has an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted and / or added. For example, the variant of the glutamine hydrolyzing GMP synthase of the present application may have an addition or deletion of a sequence, a naturally occurring mutation, a silent mutation or a conservative substitution at the N-terminus, C-terminus and / or within the amino acid sequence that does not alter the activity of the variant.

[0049] The term "conservative substitution" refers to the replacement of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of a protein or polypeptide.

[0050] In one example, in an amino acid sequence having 90% or more sequence identity with the amino acid sequence of SEQ ID NO: 1, the amino acid corresponding to the 123rd residue of the amino acid sequence of SEQ ID NO: 1 and / or the amino acid corresponding to the 441st residue may be aspartic acid (Asp, D), but is not limited thereto.

[0051] In one example, in an amino acid sequence having 90% or more sequence identity with the amino acid sequence of SEQ ID NO: 96, the amino acid corresponding to the 123rd residue of the amino acid sequence of SEQ ID NO: 96 may be aspartic acid (Asp, D), and the amino acid corresponding to the 441st residue may be glutamic acid (Glu, E), but is not limited thereto.

[0052] The polypeptide having glutamine hydrolyzing GMP synthase activity of the present application (variant of glutamine hydrolyzing GMP synthase) may have a property that increases GMP production ability (conversion ability) compared to a wild-type polypeptide having glutamine hydrolyzing GMP synthase activity.

[0053]

[0054] In this application, the term "GMP (5'-guanosine monophosphate; hereinafter referred to as GMP)" refers to a type of nucleotide used as a unit in RNA, and an intermediate substance in the nucleic acid biosynthesis metabolic system. The "GMP" may be used interchangeably with "5'-guanosine acid", and may be synthesized by adding an ammonia molecule to XMP by a glutamine hydrolyzing GMP synthetase. The method for producing GMP from XMP and / or the means used in the method may be selected from known techniques.

[0055] In one example, the GMP may be manufactured by conversion from, but is not limited to, XMP.

[0056] As used herein, the term "variant" refers to a polypeptide in which one or more amino acids are conservatively substituted and / or modified, thereby differing from the amino acid sequence of the variant before the mutation, but retaining functions or properties. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the ability of the variant may be increased, unchanged, or decreased compared to the polypeptide before the mutation. Furthermore, some variants may include variants in which one or more portions, such as the N-terminal leader sequence or the transmembrane domain, are deleted. Other variants may include variants in which portions are deleted from the N- and / or C-terminus of the mature protein. The above term "variant" may be used interchangeably with terms such as variant, modification, variant polypeptide, mutated protein, mutation, and variant (in English, modification, modified polypeptide, modified protein, mutant, mutein, divergent, variant, etc.), and is not limited thereto as long as the term is used in a mutated sense. For the purpose of the present application, the variant may be a polypeptide having glutamine hydrolyzing GMP synthase activity, including an amino acid sequence having 90% or more sequence identity with SEQ ID NO: 1, or an amino acid sequence having 90% or more sequence identity with the amino acid sequence of SEQ ID NO: 96, in which the amino acid corresponding to the 123rd residue of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96 is substituted with a different amino acid, or the amino acid corresponding to the 441st residue is substituted with a different amino acid, or a combination thereof.

[0057] Additionally, variants may include deletions or additions of amino acids that have minimal impact on the properties and secondary structure of the polypeptide. For example, the N-terminus of the variant may be conjugated with a signal (or leader) sequence involved in co-translational or post-translational protein translocation. Furthermore, the variant may be conjugated to other sequences or linkers to facilitate identification, purification, or synthesis.

[0058] In one example, the variant may be encoded by a polynucleotide comprising / consisting of a nucleic acid sequence selected from any one of SEQ ID NOs: 74 to 95 and SEQ ID NOs: 109 to 111.

[0059]

[0060] Another example of the present application provides a polynucleotide encoding a polypeptide having the above glutamine hydrolyzing GMP synthase activity (e.g., a variant of the glutamine hydrolyzing GMP synthase).

[0061] In this application, the term "polynucleotide" means a DNA or RNA strand of a certain length or longer, which is a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain.

[0062] The polynucleotide encoding a polypeptide having glutamine hydrolyzing GMP synthase activity (e.g., a variant of glutamine hydrolyzing GMP synthase) of the present application may include, without limitation, any polynucleotide sequence encoding a polypeptide having glutamine hydrolyzing GMP synthase activity. In the present application, the gene encoding the amino acid sequence of glutamine hydrolyzing GMP synthase is the guaA gene, and may be derived from a microorganism of the genus Corynebacterium, specifically, may be derived from Corynebacterium stationensis or Corynebacterium casei, but is not limited thereto.

[0063] In one example, the polynucleotide may comprise a nucleic acid sequence (base sequence) set forth in any one of SEQ ID NOs: 74 to 95 and 109 to 111, or may consist of, or consist essentially of, a nucleic acid sequence of any one of SEQ ID NOs: 74 to 95 and 109 to 111.

[0064] A polynucleotide composed of or comprising a nucleic acid sequence selected from among SEQ ID NOs: 74 to 95 and SEQ ID NOs: 109 to 111 may encode an amino acid sequence described by any one of SEQ ID NOs: 52 to 73 and SEQ ID NOs: 106 to 108, respectively.

[0065] The polynucleotide of the present application may have various modifications made to the coding region within a range that does not change the amino acid sequence of the variant of the present application, taking into account the degeneracy of the codon or the codon preferred in the organism that is intended to express the variant of the present application. Specifically, the polynucleotide of the present application has or includes a base sequence having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, or 99.9% or more homology or identity with any one of the base sequences selected from SEQ ID NOs: 74 to 95 and SEQ ID NOs: 109 to 111, or has 70% or more, 75% or more, It may consist of, or consist essentially of, a base sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9%, but is not limited thereto.

[0066] The polynucleotide of the present application may include, without limitation, a probe that can be prepared from a known genetic sequence, for example, a sequence that can hybridize under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence of the present application. The term “stringent conditions” refers to conditions that enable specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, a condition in which polynucleotides having high homology or identity hybridize with each other, polynucleotides having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, or 99.9% or more homology or identity hybridize with each other, and polynucleotides having lower homology or identity do not hybridize with each other, or a washing condition of a typical southern hybridization, such as 60°C, 1×SSC, 0.1% SDS, specifically 60°C, 0.1×SSC, 0.1% SDS, more specifically Conditions for washing once, specifically two to three times, at a salt concentration and temperature equivalent to 68°C, 0.1×SSC, and 0.1% SDS can be listed.

[0067] Hybridization requires that two nucleotide sequences be complementary, but hybridized polynucleotides may contain some mismatches between bases, depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Accordingly, the polynucleotides of the present application may also include isolated nucleic acid fragments that are complementary in their entirety, as well as substantially similar nucleic acid sequences.

[0068] Specifically, a polynucleotide having homology or identity with the polynucleotide of the present application can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C, and can be appropriately adjusted by a person skilled in the art depending on the purpose.

[0069] The appropriate stringency for hybridizing the polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables which are well known in the art (e.g., J. Sambrook et al., supra).

[0070] In this specification, the phrase "a polynucleotide (which may be used interchangeably with a "gene") or a polypeptide (which may be used interchangeably with a "protein") "contains or consists of or is expressed by a specific nucleic acid sequence or amino acid sequence" may mean that the polynucleotide or polypeptide essentially includes the specific nucleic acid sequence or amino acid sequence, and may be interpreted as including (or not excluding) a "substantially equivalent sequence" in which a non-significant mutation (deletion, substitution, modification, and / or addition) is added to the specific nucleic acid sequence or amino acid sequence to the extent that the original function and / or the desired function of the polynucleotide or polypeptide is maintained.

[0071] As used herein, the terms "homology" or "identity" refer to the degree of similarity between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0072] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.

[0073] Whether any two polynucleotide or polypeptide sequences are homologous or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example, as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information database.

[0074] Homology or identity of polynucleotides or polypeptides can be determined by comparing sequence information using a GAP computer program, such as that disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482, or in, for example, Needleman et al. (1970), J Mol Biol. 48:443. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a comparison matrix as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0075] As used herein, the term "corresponding to" refers to an amino acid residue at a position listed in a polypeptide, or an amino acid residue that is similar, identical, or homologous to the residue listed in the polypeptide. Identifying an amino acid at a corresponding position may determine a specific amino acid in a sequence that references a particular sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related or reference protein.

[0076] For example, any amino acid sequence can be aligned with SEQ ID NO: 1, and based on this, each amino acid residue of the amino acid sequence can be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 1. For example, a sequence alignment algorithm such as that described in the present application can identify the position of an amino acid, or the position at which a modification such as a substitution, insertion, or deletion occurs, by comparing it to a query sequence (also referred to as a “reference sequence”).

[0077] For such alignment, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) can be used, but is not limited thereto, and any sequence alignment program known in the art, pairwise sequence comparison algorithm, etc. can be appropriately used.

[0078]

[0079] Another example of the present application provides a vector comprising a polynucleotide encoding a polypeptide having the glutamine hydrolyzing GMP synthase activity (e.g., a variant of the glutamine hydrolyzing GMP synthase). The vector may be an insertion vector or an expression vector.

[0080] As used herein, the term "vector" refers to a DNA construct for delivering a target polynucleotide into a suitable host or host cell. For example, it may include, but is not limited to, a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the target polypeptide in a suitable host cell. The control sequence may include a promoter capable of initiating transcription, an arbitrary operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and / or a sequence for regulating the termination of transcription and / or translation. After being transformed into a suitable host cell, the vector may be maintained independently of the genome (genome) of the host cell, or may be integrated into the genome of the host cell. For example, the target polynucleotide may be integrated into a chromosome via an insertion vector. Insertion of the above polynucleotide into a chromosome can be accomplished by any method known in the art, for example, but not limited to, homologous recombination.

[0081] The vector usable in this specification is not particularly limited as long as it is replicable in a host cell, and may be selected from all commonly used vectors. Examples of commonly used vectors include plasmids, cosmids, viruses, bacteriophages, etc. in a natural or recombinant state. For example, as the vector, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A, etc. can be used as a phage vector or a cosmid vector, and pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series, etc. can be used as a plasmid vector. Specifically, examples include, but are not limited to, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, and pDC24 vectors.

[0082] The above vector may further comprise a selection marker to determine whether the vector has been introduced into a transformed cell or has been integrated into the genome of the transformed cell. The selection marker is used to determine whether the vector-transformed cell or the polynucleotide has been integrated, and may be selected from genes that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or surface protein expression. In an environment treated with a selective agent, only cells expressing the selection marker will survive or exhibit other phenotypic characteristics, thereby enabling selection of transformed cells.

[0083] Expression of the above polypeptide (variant) in a microorganism can be performed by introducing a polynucleotide encoding the variant, or a vector containing the same, into a host cell and culturing a recombinant cell (e.g., a microorganism) containing the same.

[0084] The introduction of a polynucleotide encoding the polypeptide (variant) or a vector containing the same into a microorganism can be performed by a person skilled in the art by appropriately selecting a known transformation method. As used herein, the term "transformation" refers to changing the genetic characteristics of a host cell (microorganism) by introducing a target polynucleotide or a vector containing the same into the host cell (microorganism). The transformed polynucleotide may be inserted into and located within the chromosome of the host cell or may be located outside the chromosome. The polynucleotide may be introduced in an appropriate form depending on the purpose of introduction. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all elements necessary for autonomous expression. The expression cassette may typically include expression control elements such as a promoter, a transcription termination signal, a ribosome binding site, and / or a translation termination signal that are operably linked to the polynucleotide. The expression cassette may be in the form of an expression vector capable of autonomous replication. Additionally, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell. The term "operably linked" as used herein may mean that the polynucleotide is functionally linked to an expression control element (e.g., a promoter) so that transcriptional regulation (e.g., transcription initiation) of the polynucleotide can be performed. Operable linkage can be performed using genetic recombination techniques known in the art.

[0085] The method of transforming the above polynucleotide into a host cell can be performed by any method of introducing a nucleic acid into a cell (microorganism), and can be performed by appropriately selecting a transformation technique known in the art depending on the host cell. Examples of the known transformation methods include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) precipitation, DEAE-dextran, cationic liposome, lipofection, and lithium acetate-DMSO.

[0086]

[0087] Another example of the present application provides a microorganism having enhanced glutamine hydrolyzing GMP synthase activity.

[0088] The above microorganism may be a microorganism comprising at least one (e.g., at least one, at least two, or one, two, or three) selected from the group consisting of a polypeptide (variant) having the glutamine hydrolyzing GMP synthetase activity described above, a polynucleotide encoding (or encoding) the polypeptide, and a vector comprising the polynucleotide.

[0089] As used herein, the term “enhancement” of polypeptide activity (e.g., glutamine hydrolyzing GMP synthetase activity) means that the activity of the polypeptide within a host cell (microorganism) is increased compared to the intrinsic activity. The term “enhancement” may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may all include exhibiting an activity that was not originally present, or exhibiting an enhanced activity compared to the intrinsic activity or the activity before modification. The term “intrinsic activity” refers to the activity of a specific polypeptide that a parent strain or an unmodified microorganism originally possessed before the trait change, when the trait change is caused by genetic mutation due to natural or artificial factors. This may be used interchangeably with “activity before modification.” “Enhanced,” “upregulated,” “overexpressed,” or “increased” the activity of a polypeptide relative to its intrinsic activity means that the activity and / or concentration (expression amount) of the specific polypeptide is improved compared to the activity and / or concentration (expression amount) that the parent strain or unmodified microorganism originally had prior to the transformation.

[0090] The above enhancement can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and / or concentration (expression level) of an endogenous polypeptide. Whether the activity of the polypeptide is enhanced can be determined by an increase in the level of activity, expression level, or amount of product excreted from the polypeptide.

[0091] Enhancement of the activity of the above polypeptide can be achieved by applying various methods well known in the art, and is not limited as long as the activity of the target polypeptide can be enhanced compared to the microorganism before modification. Specifically, it may be achieved by using genetic engineering and / or protein engineering, which are routine methods of molecular biology and are well known to those skilled in the art, but are not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0092] Specifically, the enhancement of the polypeptide of the present application is

[0093] 1) Increase in the intracellular copy number of a polynucleotide encoding a polypeptide;

[0094] 2) Replacing the gene expression control region on the chromosome that codes for a polypeptide with a highly active sequence;

[0095] 3) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;

[0096] 4) Modification of the amino acid sequence of the polypeptide so as to enhance polypeptide activity;

[0097] 5) Modification of the polynucleotide sequence encoding the polypeptide so as to enhance the activity of the polypeptide (e.g., modification of the polynucleotide sequence of the polypeptide gene so as to encode a polypeptide modified so as to enhance the activity of the polypeptide);

[0098] 6) Introduction of a foreign polypeptide exhibiting the activity of the polypeptide or a foreign polynucleotide encoding the same;

[0099] 7) Codon optimization of polynucleotides encoding polypeptides;

[0100] 8) Analyzing the tertiary structure of the polypeptide and selecting the exposed portion to modify or chemically modify; or

[0101] 9) Control of cellular localization of proteins (polypeptides); or

[0102] 10) It may be a combination of two or more of the above 1) to 9), but is not particularly limited thereto.

[0103] More specifically,

[0104] The increase in the intracellular copy number of the polynucleotide encoding the polypeptide described above may be achieved by introducing into the host cell a vector capable of replicating and functioning independently of the host, to which the polynucleotide encoding the polypeptide is operably linked. Alternatively, the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into the chromosome of the host cell. The introduction into the chromosome may be performed by introducing into the host cell a vector capable of inserting the polynucleotide into the chromosome of the host cell, but is not limited thereto. The vector is as described above.

[0105] 2) Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence having strong activity may be, for example, a mutation in the sequence such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the expression control region, or replacement with a sequence having stronger activity. The expression control region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, it may be, but is not limited to, replacing the original promoter with a strong promoter.

[0106] Examples of known strong promoters include, but are not limited to, the CJ1 to CJ7 promoters (US Patent No. US 7662943 B2), the lac promoter, the trp promoter, the trc promoter, the tac promoter, the lambda phage PR promoter, the PL promoter, the tet promoter, the gapA promoter, the SPL7 promoter, the SPL13 (sm3) promoter (US Patent No. US 10584338 B2), the O2 promoter (US Patent No. US 10273491 B2), the tkt promoter, and the yccA promoter.

[0107] The above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a higher polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.

[0108] The modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity, or an amino acid sequence or polynucleotide sequence improved to have increased activity. The replacement may be specifically performed by inserting the polynucleotide into a chromosome by homologous recombination, but is not limited thereto. The vector used at this time may additionally include a selection marker to confirm whether or not the chromosome has been inserted. The selection marker is as described above.

[0109] The introduction of the foreign polynucleotide exhibiting the activity of the polypeptide as described above 6) may be the introduction into the host cell of a foreign polynucleotide encoding a polypeptide exhibiting the same / similar activity as the polypeptide. The foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same / similar activity as the polypeptide. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the polypeptide may be produced by expressing the introduced polynucleotide in the host cell, thereby increasing its activity.

[0110] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be codon optimization of an endogenous polynucleotide to increase transcription or translation within a host cell, or codon optimization of a foreign polynucleotide to achieve optimized transcription or translation within a host cell.

[0111] The above 8) analyzing the tertiary structure of a polypeptide and selecting an exposed portion to modify or chemically modify may be done by, for example, comparing the sequence information of the polypeptide to be analyzed with a database storing the sequence information of known proteins, determining a template protein candidate based on the degree of sequence similarity, confirming the structure based on this, and selecting an exposed portion to modify or chemically modify, and modifying or modifying it.

[0112] The above 9) regulation of the intracellular location of the polypeptide may target the polypeptide to a specific organelle or specific intracellular space within the cell. For example, targeting to the periplasm or cytoplasm may be achieved by adding or removing a leader sequence that functions in targeting the polypeptide, but is not limited thereto.

[0113] Such enhancement of polypeptide activity may be, but is not limited to, an increase in the activity or concentration or expression level of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microorganism, or an increase in the amount of a product produced from the polypeptide.

[0114]

[0115] In this application, the term "microorganism (or strain)" may include both wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification. The microorganism may be a microorganism whose specific mechanism has been strengthened or weakened, such as by the insertion of an external gene or the enhancement or weakening of the activity of an endogenous gene, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein, or product (e.g., GMP). In this application, the terms "microorganism," "strain," "host," and "host cell" may be used interchangeably.

[0116] The microorganism (or strain, recombinant cell) of the present application may be a microorganism having enhanced activity of glutamine hydrolyzing GMP synthetase, GMP converting ability, improved (or increased) GMP converting ability, GMP production ability (or production amount), or improved (or increased) GMP production ability.

[0117] In this application, “GMP production capacity” may be used interchangeably with “GMP conversion capacity.”

[0118] For example, the microorganism of the present application may be a microorganism that naturally does not have GMP production ability (conversion ability), or a microorganism that has GMP production ability but is provided with or has improved GMP production ability by introducing a polypeptide (variant) having glutamine hydrolyzing GMP synthase activity of the present application or a polynucleotide encoding the same, but is not limited thereto.

[0119] In this specification, the term “microorganism having enhanced glutamine hydrolyzing GMP synthase activity” may mean a microorganism that has been engineered (mutated) to express a polypeptide (variant) having the glutamine hydrolyzing GMP synthase activity described above, thereby causing a microorganism that had no GMP production ability to have GMP production ability or to have a GMP production ability higher than its original GMP production ability.

[0120] In the present application, the term "unmodified microorganism" does not exclude a strain that contains a mutation that may occur naturally in a microorganism, and may refer to a wild-type strain or a natural strain itself, or a strain before its characteristics are changed by genetic mutation caused by natural or artificial factors. For example, the unmodified microorganism may refer to a strain into which a polypeptide (variant) having glutamine hydrolyzing GMP synthase activity of the present application or a polynucleotide encoding the polypeptide (variant) having glutamine hydrolyzing GMP synthase activity is not introduced, or before it is introduced. The term "unmodified microorganism" may be used interchangeably with "pre-modified strain", "pre-modified microorganism", "unmodified strain", "unmodified microorganism", or "reference microorganism".

[0121] In the present application, the reference microorganism may be a wild type microorganism known to produce GMP, for example, Corynebacterium stationensis ATCC6872. Alternatively, the reference microorganism may be a microorganism known to produce GMP or convert XMP into GMP, for example, Corynebacterium stationensis KCCM13320P, but is not limited thereto. In addition, the reference microorganism may be a wild type Corynebacterium casei, and specifically, may be a Corynebacterium casei LMG S-19264 strain, but is not limited thereto.

[0122] The microorganism producing the GMP of the present application is not particularly limited as long as it can produce GMP, but may be a microorganism of the genus Corynebacterium. The above-mentioned Corynebacterium genus microorganisms are Corynebacterium stationis, Corynebacterium casei, Corynebacterium thermoaminogenes, Corynebacterium glutamicum, Brevibacterium flavum, Brevibacterium lactofermentum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, and Corynebacterium singulare. The microorganism may be at least one selected from the group consisting of, but is not limited to, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris, and Corynebacterium flavescens.

[0123]

[0124] Another example of the present application provides a method for producing GMP, comprising the step of culturing a microorganism having enhanced activity of glutamine hydrolyzing GMP synthase in a medium.

[0125] The microorganism and GMP with enhanced activity of the above glutamine hydrolyzing GMP synthase are as described above.

[0126] In the present application, "cultivation" means growing a microorganism, such as a Corynebacterium genus microorganism, into which a polypeptide having glutamine hydrolyzing GMP synthase activity of the present application or a gene encoding the same has been introduced or whose activity has been enhanced, under appropriately controlled environmental conditions. The culturing process of the present application can be performed according to appropriate media and culture conditions known in the art. Such a culturing process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culturing may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0127] In the present application, the term "medium" refers to a substance containing as its main component nutrients required for culturing a microorganism, such as a microorganism of the genus Corynebacterium, into which a polypeptide having glutamine hydrolyzing GMP synthase activity of the present application or a gene encoding the same has been introduced or into which the activity thereof has been enhanced, and which supplies water essential for survival and growth, as well as nutrients and growth factors. In addition, the medium may contain XMP for GMP synthesis. Specifically, any medium and other culture conditions used for culturing the microorganism of the present application may be used without particular limitation as long as it is a medium used for culturing general microorganisms, but the microorganism of the present application may be cultured under aerobic conditions while controlling temperature, pH, etc. in a general medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compound, amino acid, and / or vitamin, etc.

[0128] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses (e.g., blackstrap molasses), rice winter, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted into reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

[0129] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; amino acids such as glutamic acid, methionine, glutamine, etc.; organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

[0130] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.

[0131] In addition, during the cultivation of the microorganism of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during the cultivation, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. In addition, in order to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or in order to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection, but is not limited thereto.

[0132] In the culture of the present application, the culture temperature can be maintained at 20 to 45°C, or 25 to 37°C, specifically 25 to 37°C, and the culture can be performed for about 10 to 160 hours, or about 20 to 120 hours, but is not limited thereto.

[0133] GMP produced by the culture of the present application may be secreted into the medium or remain within the cells.

[0134] The GMP production method of the present application may include a step of adding an enzyme to a medium or a step of adding a microorganism expressing the enzyme. For example, the method may further include, after the step of culturing a microorganism producing XMP, a step of adding an enzyme that converts XMP to GMP or a microorganism expressing the enzyme and / or a step of culturing the microorganism.

[0135] In one example, the GMP production method of the present application may further include a step of culturing a microorganism producing 5'-xanthylic acid (XMP) prior to the step of culturing a microorganism having enhanced activity of glutamine hydrolyzing GMP synthase in a medium, or a step of adding XMP to the medium.

[0136] The GMP production method of the present application may further include a step of recovering GMP from the cultured microorganism (e.g., a microorganism of the genus Corynebacterium), the culture medium (the medium in which the culture was performed), or both. The recovering step may be additionally included after the culturing step.

[0137] The above recovery may be performed by collecting the desired purine nucleotide using a suitable method known in the art according to the culture method of the microorganism of the present application, such as a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallized protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and the desired GMP can be recovered from the medium or microorganism using a suitable method known in the art.

[0138] Additionally, the GMP production method of the present application may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, if the GMP production method of the present application includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, regardless of order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.

[0139]

[0140] Another example of the present application provides a composition for producing GMP comprising a microorganism having enhanced activity of glutamine hydrolyzing GMP synthase, a medium in which the microorganism is cultured, or a combination thereof.

[0141] The microorganism and GMP with enhanced activity of the above glutamine hydrolyzing GMP synthase are as described above.

[0142] Another example provides for the use of the above microorganisms in GMP production.

[0143] Another example provides a use for the preparation of a composition for GMP production of the above microorganism.

[0144] The composition of the present application may further comprise any suitable excipient commonly used in compositions for GMP production, and such excipients may be, for example, but are not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.

[0145]

[0146] The present application relates to a novel glutamine hydrolyzing GMP synthase variant and a method for producing 5'-guanine acid using the same, and high-yield GMP production is possible by culturing a microorganism into which the glutamine hydrolyzing GMP synthase variant of the present application has been introduced.

[0147]

[0148] The present application will be described in more detail below through examples. However, the following examples are merely preferred embodiments intended to illustrate the present application and are therefore not intended to limit the scope of the present application. Furthermore, technical details not described herein can be readily understood and implemented by those skilled in the technical field of the present application or similar fields.

[0149]

[0150] Example 1: Discovery of a mutant that enhances glutamine hydrolysis GMP synthase.

[0151] The following examples were conducted to discover protein mutations that enhance the activity of glutamine hydrolyzing GMP synthase (GuaA protein), which is encoded by the guaA gene (SEQ ID NO: 2), a protein endogenously present in microorganisms of the genus Corynebacterium, thereby increasing GMP conversion ability.

[0152]

[0153] Example 1-1: Construction of a vector containing guaA

[0154] To construct a guaA library to identify mutations that enhance the activity of GuaA, which is expected to be involved in GMP conversion, a pCES208-Pn vector containing the guaA promoter and 500 bp of nucleotides upstream of guaA (SEQ ID NO: 51) was first constructed.

[0155] Specifically, the chromosomal gene of the wild-type Corynebacterium stationensis ATCC6872 strain was isolated using the G-spin Total DNA extraction mini kit (Cat. No. 17045) from Intron according to the protocol provided in the kit, and the guaA gene fragment was obtained by performing polymerase chain reaction using the primer pair of SEQ ID NO: 3 and SEQ ID NO: 4. The PCR amplification conditions were as follows: denaturation at 95°C for 5 minutes, followed by 25 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 40 seconds, followed by polymerization at 72°C for 5 minutes.

[0156] The gene fragment obtained above was mixed with the pCES208 vector prepared by cutting it with XbaI and BamHI restriction enzymes, and cloned using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain a recombinant plasmid, which was named pCES208-Pn.

[0157] Meanwhile, a vector to be used as a control group for guaA random mutation evaluation was created using the following method.

[0158] Specifically, a gene fragment of SEQ ID NO: 1 was obtained for constructing a vector through PCR using the chromosomal DNA of Corynebacterium stationensis ATCC6872 strain as a template. PCR products were obtained using primers of SEQ ID NO: 5 and SEQ ID NO: 6, and SolgTM Pfu-X DNA polymerase was used as the polymerase. PCR amplification conditions were as follows: denaturation at 95°C for 5 minutes, followed by 25 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, followed by polymerization at 72°C for 5 minutes, to obtain a PCR product. The amplified product was mixed with the pCES208-Pn vector prepared by cutting it with XbaI and BamHI restriction enzymes in advance, and cloned using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain a recombinant plasmid, which was named pCES208-Pn-guaA(wt).

[0159] The sequences of the primers used in Example 1-1 are shown in Table 1 below.

[0160] Name Sequence (5'->3') Sequence number pCES208-Pn-FGGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGTGGCAGTAGCTGAAATCATTSequence number 3 pCES208-Pn-RGGCGAATTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTTGGATCCCACAGGTAGTTTAACACACCCsequence number 4 pCES208-Pn-guaA(wt)-FGTTTACCGCCGTAGGCCGCGGGTGtGTTAAACTACCTGTATGACTCAACCTGCAACAACTsequence number 5 pCES208-Pn-guaA(wt)-RCTATAGGGCGAATTGGAGCTCCACCGCGGTGGCGGCCGCTTTACTCCCACTCGATGGTTCsequence number 6

[0161] Example 1-2: Construction of a guaA mutant library

[0162] Based on the vector produced in Example 1-1 above, a guaA mutant library vector was produced using the following method. The gene fragment for producing the random library vector was obtained through PCR using the chromosomal DNA of the Corynebacterium stationaryus ATCC6872 strain as a template.

[0163] Specifically, a vector was constructed in which a polynucleotide encoding guaA with a mutation introduced into the endogenous guaA gene locus of Corynebacterium stationensis can be substituted, and the library was prepared using an error-prone PCR kit (clontech Diversify® PCR Random Mutagenesis Kit), and random mutations were induced according to the manufacturer's manual using primers of SEQ ID NO: 5 and SEQ ID NO: 6 to obtain guaA mutant PCR products with different sequences. The amplified product was mixed with the pCES208-Pn vector prepared in advance by digesting it with XbaI and BamHI restriction enzymes, and cloned using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain a recombinant plasmid, which was named pCES208-Pn-guaA random library.

[0164]

[0165] Example 1-3: Evaluation of the constructed guaA random library and selection of strains.

[0166] The pCES208-Pn-guaA random library constructed in the above Example 1-2 was transformed into the GMP conversion strain KCCM13320P (KR 10-2024-0133212 A) or Corynebacterium stationensis ATCC6872 strain by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and then spread on a seed medium containing 25 mg / L of kanamycin and 2% agar to obtain 10,000 colonies of strains with inserted mutant genes, and each colony was named pCES208-Pn-guaA(mt)_1 to pCES208-Pn-guaA(mt)_10000.

[0167] The 10,000 colonies secured above were inoculated into a 96-Deep Well Plate containing 350 ㎕ of seed medium containing kanamycin (25 mg / L) corresponding to a 17% filling rate per well using a Qpix420 Colony Picker facility from Molecular Devices. Corynebacterium stationensis ATCC6872 strain containing pCES208-Pn-guaA(wt), a vector encoding wild-type guaA, was inoculated into 4 wells per plate to serve as a control for GMP high-conversion mutant screening. The 96-Deep Well Plates inoculated with the control strain and mutants were sealed using Azenta's Gas permeable seal mark2 and cultured in a Multitron facility from Infors-HT at 30℃ and 1,000 rpm for 48 hours. After adding 1% xylene to the cultured strains and mutants and further culturing for 1 hour, 150 ㎕ of the titer evaluation solution containing XMP was added and further cultured for 12 hours at 30℃, 1,000 rpm in a Multitron shaking incubator from Infors-HT. The 96 Deep Well Plate cultured for 12 hours was centrifuged for 20 minutes at 15℃, 4,000 rpm in a Centrifuge 5810R from Eppendorf. Then, 100 ㎕ of the culture supernatant from which the cells were separated was transferred to a 96 Well Black Polystyrene Microplate from Corning using a Biomek i5 liquid handler from Beckman Coulter for NIR Spectrometry analysis. Afterwards, individual analysis spectra of each well were obtained by applying NIR Spectrometry, and the coefficient of determination for the GMP 0 to 20 g / L concentration range was established based on culture samples whose GMP concentrations were quantified through pre-HPLC analysis.By applying the regression analysis prediction model of 96 and applying the selection logic of 15% or more improvement in GMP concentration compared to the control group, 6 strains out of 10,000 mutants were initially selected. Cultivation was performed in the same manner as above for the 6 selected strains, and 2 strains with high GMP concentrations were finally selected.

[0168]

[0169] The composition of the seed medium and titer evaluation solution used in the above examples 1-3 is as follows:

[0170] <Jongbaeji>

[0171] Glucose 30 g / L, peptone 15 g / L, yeast extract 15 g / L, sodium chloride 2.5 g / L, urea 3 g / L, adenine 150 mg / L, guanine 150 mg / L, agar 20 g / L, pH 7.0 (based on 1 liter of distilled water)

[0172] <Valuation amount>

[0173] Trizma-base 24.20 g / L, ATP 3 0 g / L, XMPㆍ2Naㆍ7H2O 30 g / L, magnesium sulfate 15 g / L, ammonium sulfate 20 g / L

[0174]

[0175] Example 1-4: Identification of guaA mutations through gene sequencing

[0176] In order to confirm the guaA gene mutation sequence of the two mutant strains selected in the above Examples 1-3, PCR and base sequence analysis were performed on the pCES208-Pn-guaA(mt)_2338 and pCES208-Pn-guaA(mt)_3450 strains using the primer pairs of SEQ ID NO: 7 and SEQ ID NO: 8, and the results were compared with the guaA gene sequence of the wild-type Corynebacterium stationenis ATCC6872 strain.

[0177] As a result of comparison with the guaA gene sequence of the wild type strain, it was confirmed that the pCES208-Pn-guaA(mt)_2338 strain contained a mutation in which the 123rd amino acid of the amino acid sequence (amino acid sequence 1) encoded by the guaA gene was substituted from aspartic acid (D) to lysine (K), and the pCES208-Pn-guaA(mt)_3450 strain contained a mutation in which the 441st amino acid of the amino acid sequence encoded by the guaA gene was substituted from aspartic acid (D) to valine (V).

[0178] The sequences of the primers used in Examples 1-4 are shown in Table 2 below.

[0179] Name sequence (5'->3') Sequence number pCES208-Pn-guaA seq-FTTCGAGCTCGGTACCCGTCAGCAGTGGAACGAAGGCGAC Sequence number 7 pCES208-Pn-guaA seq-RCTCTAGAGGATccccAGATATCGGTCAGGTGGTCATCG Sequence number 8

[0180] In the following examples, it was attempted to determine whether the guaA mutation affects GMP conversion ability.

[0181]

[0182] Example 2: Production of strains introducing guaA mutants and evaluation of GMP production capacity (conversion capacity)

[0183] Example 2-1: Construction of a recombinant vector for introducing a guaA mutant.

[0184] In order to confirm the influence of the D123K mutation and D441V mutation discovered in the above Examples 1-4 on GMP production ability (conversion ability), a vector introducing the mutation into the endogenous guaA gene of the Corynebacterium stationaryus strain was constructed.

[0185] First, in order to confirm the effect of the mutant guaA (D123K) in which aspartic acid at position 123 of the GuaA protein amino acid sequence was substituted with lysine on the GMP conversion ability, a vector for producing an expression strain was produced as follows using plasmid pDC24 (SEQ ID NO: 112) for insertion and replacement of genes in the Corynebacterium chromosome.

[0186] PCR was performed using the pCES208-Pn-guaA(mt)_2338 vector as a template and the primer pair of SEQ ID NO: 9 and SEQ ID NO: 10. SolgTM Pfu-X DNA polymerase was used as the polymerase, and the PCR amplification conditions were as follows: denaturation at 95°C for 5 minutes, followed by 25 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, followed by polymerization at 72°C for 5 minutes to obtain the PCR product. The PCR product obtained above was mixed with the pDC24 vector prepared by cutting it with XbaI restriction enzyme in advance and cloned using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix), thereby obtaining a recombinant plasmid, which was named pDC24-guaA (D123K).

[0187] In the same way, to confirm the effect of the mutant guaA (D441V) in which aspartic acid at position 441 of the GuaA protein amino acid sequence was substituted with valine on the GMP conversion ability, a PCR product was obtained using the pCES208-Pn-guaA (mt) _3450 vector as a template and the primer pair of SEQ ID NO: 9 and SEQ ID NO: 10, and then cloned into the pDC24 vector digested with XbaI to construct a recombinant plasmid, which was named pDC24-guaA (D441V).

[0188] The sequences of the primers used in Example 2-1 are shown in Table 3 below.

[0189] Name sequence (5'->3') Sequence number pDC24-guaA(mt)-FacgacggccagtgaattcgagctcggtacccggggatcctTGGCAGTAGCTGAAATCATTSequence number 9 pDC24-guaA(mt)-RgaccatgattacgccaagcttgcatgcctgcaggtcgactTTACTCCCACTCGATGGTTCsequence number 10

[0190]

[0191] Example 2-2: Production of a strain expressing a guaA mutant

[0192] In order to confirm the influence of the D123K and D441V mutations of guaA discovered in the above examples 1-4 on GMP production ability (conversion ability), a strain was created in which mutations were introduced into the endogenous guaA gene of a Corynebacterium stationaryus strain.

[0193] The pDC24-guaA (D123K) and pDC24-guaA (D441V) vectors constructed in Example 2-1 were each transformed into the GMP-converted strain, Corynebacterium stationarynis KCCM13320P, by electroporation. Then, the strains in which the vectors were inserted into the chromosome by recombination of homologous sequences in a selection medium containing 25 mg / L of kanamycin were selected as the primary candidate. The selected primary strains were then subjected to a second crossover to select strains in which mutations in the target genes were introduced. The introduction of genetic mutations in the final transformed strains was confirmed by PCR using the primer pairs of SEQ ID NOs: 11 and 12, followed by base sequence analysis using SEQ ID NOs: 11 and 12. The obtained strains were named KCCM13320P::guaA(D123K) or ATCC6872::guaA(D123K), KCCM13320P::guaA(D441V) or ATCC6872::guaA(D441V), respectively.

[0194] The sequences of the primers used in Example 2-2 are shown in Table 4 below.

[0195] Name sequence (5'->3') Sequence number pDC24-guaA seq-FTGTGATTGCCGGTGCCAGCA Sequence number 11 pDC24-guaA seq-RCCTACTAAAGGCGAAGCCCC Sequence number 12

[0196] Example 2-3: Evaluation of GMP production capacity of guaA mutant expression strain

[0197] In order to confirm the GMP conversion ability of the two strains, KCCM13320P::guaA(D123K) and KCCM13320P::guaA(D441V) produced in Example 2-2 above, they were cultured using the following method.

[0198] Specifically, the parent strain Corynebacterium stationarynis KCCM13320P and the two mutant strains produced in Example 2-2 were each inoculated into a 250 ml corner-baffle flask containing 25 ml of the seed medium described in Example 1-3, and then cultured at 30°C for 20 hours with shaking at 200 rpm. 800 μl of the titer evaluation solution described in Example 1-3 was added to 200 μl of the culture solution, and the reaction was performed at 42°C for 30 minutes to convert XMP to GMP. After completion of the culture, the production amount of GMP was measured using liquid high-performance chromatography, and the GMP concentration in the culture solution for each strain tested is shown in Table 5 below.

[0199] Comparison of GMP conversion ability of Corynebacterium stationensis KCCM13320P, KCCM13320P::guaA(D123K), KCCM13320P::guaA(D441V) Strain number XMP concentration (g / l) GMP concentration (g / l) Increase / decrease in GMP production compared to parent strain (%) KCCM13320P (parent strain) 8.302.06 - KCCM13320P::guaA(D123K) 7.103.28159% KCCM13320P::guaA(D441V) 6.533.83186%

[0200] As a result, as shown in Table 5 above, the parent strain Corynebacterium stationenis (ammoniagenes) KCCM13320P produced (converted) GMP at a concentration of 2.06 g / l, but the mutant strains KCCM13320P::guaA(D123K) and KCCM13320P::guaA(D441V), in which mutations were introduced into the GuaA protein, were confirmed to convert GMP at concentrations of 3.28 g / l and 3.83 g / l, respectively.

[0201] Through the above results, it was confirmed that a strain into which a mutation was introduced in which the 123rd amino acid of the amino acid sequence encoded by the guaA gene was substituted with lysine or a mutation was introduced in which the 441st amino acid was substituted with valine increased GMP production compared to a strain into which the mutation was not introduced.

[0202]

[0203] Example 2-4: Evaluation of GDP production ability of guaA mutant expression strain

[0204] In order to confirm the effect of increasing GDP production, a factor in the GMP synthesis pathway, in addition to the GMP conversion ability of the two mutant strains KCCM13320P::guaA(D123K) and KCCM13320P::guaA(D441V) produced in Example 2-2, they were cultured in the same manner as Example 2-3, and 800 ㎕ of the titer evaluation solution described in Example 1-3 was added to 200 ㎕ of the culture solution, and the reaction was performed at 42℃ for 30 minutes to convert XMP to GMP. After completion of the culture, the production amounts of GMP and GDP were measured using liquid high-performance chromatography, and the concentrations are shown in Table 6 below.

[0205] Strain number XMP concentration (g / l) GMP concentration (g / l) GDP concentration (g / l) KCCM13320P (parent strain) 6.302.010.31 KCCM13320P::guaA (D123K) 5.103.140.48 KCCM13320P::guaA (D441V) 4.533.690.52

[0206] As a result, as shown in Table 6 above, the parent strain Corynebacterium stationaryus KCCM13320P produced GMP at a concentration of 2.01 g / l and GDP at a concentration of 0.31 g / l, and the mutant strains KCCM13320P::guaA(D123K) and KCCM13320P::guaA(D441V), in which mutations were introduced into the GuaA protein, converted GMP at concentrations of 3.14 g / l and 3.69 g / l, respectively, and produced GDP at concentrations of 0.48 g / l and 0.52 g / l, respectively.

[0207] Through the above results, it was confirmed that a strain into which a mutation was introduced in which the 123rd amino acid of the amino acid sequence encoded by the guaA gene was substituted with lysine or a mutation was introduced in which the 441st amino acid was substituted with valine had increased GMP production ability (conversion ability) and GDP production ability compared to a strain into which the mutation was not introduced.

[0208]

[0209] Example 3: Substitution of amino acids in the GuaA (D123K) mutation with other amino acids.

[0210] Example 3-1: Construction of a vector for inserting a GuaA (D123) mutant amino acid substitution.

[0211] Through the above Example 2, it was confirmed that GMP conversion ability can be improved by mutation of the GuaA (D123) position. Accordingly, in order to confirm the positional importance of GuaA (D123), a vector was created in which the 123rd amino acid was substituted with another amino acid, and whether it affected the GMP conversion ability was confirmed.

[0212] Site-directed mutagenesis was performed using the pDC24-guaA (D123K) vector produced in Example 2-1 as a template. Specifically, for the introduction of the GuaA (D123E) mutation, primer pairs of SEQ ID NO: 9 and SEQ ID NO: 13 and SEQ ID NO: 14 and SEQ ID NO: 10, for the introduction of the GuaA (D123H) mutation, primer pairs of SEQ ID NO: 9 and SEQ ID NO: 15 and SEQ ID NO: 16 and SEQ ID NO: 10, for the introduction of the GuaA (D123M) mutation, primer pairs of SEQ ID NO: 9 and SEQ ID NO: 17 and SEQ ID NO: 18 and SEQ ID NO: 10, for the introduction of the GuaA (D123Q) mutation, primer pairs of SEQ ID NO: 9 and SEQ ID NO: 19 and SEQ ID NO: 20 and SEQ ID NO: 10, for the introduction of the GuaA (D123R) mutation, primer pairs of SEQ ID NO: 9 and SEQ ID NO: 21 and SEQ ID NO: 22 and SEQ ID NO: 10, for the introduction of the GuaA (D123S) mutation, primer pairs of SEQ ID NO: 9 and SEQ ID NO: 23 and SEQ ID NO: 24 and SEQ ID NO: For the introduction of the GuaA (D123Y) mutation, site-directed PCR was performed using primer pairs of SEQ ID NO: 9 and SEQ ID NO: 25 and SEQ ID NO: 26 and SEQ ID NO: 10, respectively, using SolgTM Pfu-X DNA polymerase as the polymerase. The PCR amplification conditions were as follows: denaturation at 95°C for 5 minutes, followed by 25 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute and 30 seconds, and then polymerization at 72°C for 5 minutes to obtain each PCR product. Each of the above amplification products was treated with DpnI restriction enzyme to remove pDC24-guaA (D123K) used as a template, and then transformed into DH5a to obtain a plasmid in which the 123rd amino acid of GuaA was modified with the target amino acid.

[0213] The plasmid information obtained above is shown in Table 7 below:

[0214] List of vectors for inserting amino acid substitutions in GuaA (D123) Plasmid number 1pDC24-guaA (D123E) 2pDC24-guaA (D123H) 3pDC24-guaA (D123M) 4pDC24-guaA (D123Q) 5pDC24-guaA (D123R) 6pDC24-guaA (D123S) 7pDC24-guaA (D123Y)

[0215] Example 3-2: Production of a strain in which the 123rd amino acid mutant of GuaA was substituted with another amino acid and verification of GMP conversion ability.

[0216] Each of the seven vectors for introducing mutations constructed in Example 3-1 was transformed into the Corynebacterium stationarynis KCCM13320P strain by electroporation, and strains in which the vectors were inserted into the chromosome by recombination of homologous sequences were selected on a medium containing 25 mg / L kanamycin. The selected primary strains were then subjected to a second crossover, and strains in which mutations were introduced into the target gene were selected. The introduction of genetic mutations in the final transformed strains was confirmed through PCR and base sequence analysis using the primer pairs of SEQ ID NOs: 11 and 12, and the strain names according to the inserted mutations are shown in Table 8 below:

[0217] List of strains in which the 123rd amino acid variant of GuaA is substituted with another amino acid. Number of strains 1 KCCM13320P::guaA(D123E) 2 KCCM13320P::guaA(D123H) 3 KCCM13320P::guaA(D123M) 4 KCCM13320P::guaA(D123Q) 5 KCCM13320P::guaA(D123R) 6 KCCM13320P::guaA(D123S) 7 KCCM13320P::guaA(D123Y)

[0218] The 18 strains produced above and the KCCM13320P and KCCM13320P::guaA(D123K) strains were cultured in the same manner as in Example 2-3 to evaluate their GMP conversion ability. The evaluation results are shown in Table 9 below:

[0219] Results of GMP conversion ability evaluation of strains in which the mutation of the 123rd amino acid variant of GuaA was substituted with another amino acid Strain number XMP concentration (g / l) GMP concentration (g / l) Increase / decrease rate of GMP production compared to the parent strain (%) KCCM13320P (parent strain) 8.402.63-KCCM13320P::guaA(D123K) 7.033.98151% KCCM13320P::guaA(D123E) 8.232.72103% KCCM13320P::guaA(D123H) 8.082.67101% KCCM13320P::guaA(D123 M)7.962.65101%KCCM13320P::guaA(D123Q)8.152.77105%KCCM13320P::guaA(D123R)8.172 .79106%KCCM13320P::guaA(D123S)8.272.66101%KCCM13320P::guaA(D123Y)8.322.72103%

[0220] As a result, as shown in Table 9, it was confirmed that the strain containing the guaA mutant gene in which the 123rd amino acid of the amino acid sequence encoded by the guaA gene was substituted with another amino acid in the GMP producing strain increased GMP production compared to KCCM13320P (parent strain) which did not contain the mutation. That is, it was confirmed that the 123rd amino acid of the amino acid sequence encoded by the guaA gene is a major mutation position in GMP production (conversion). More specifically, it was confirmed that the GMP productivity (conversion ability) of a microorganism containing a mutation in which the 123rd amino acid of the amino acid sequence encoded by the guaA gene was substituted with lysine, glutamic acid, histidine, methionine, glutamine, arginine, serine, or tyrosine was significantly increased.

[0221]

[0222] Example 4: Substitution of amino acids in the GuaA (D441V) mutation with other amino acids.

[0223] Example 4-1: Construction of a vector for inserting a GuaA (D441) mutant amino acid substitution.

[0224] Through the above Example 2, it was confirmed that GMP conversion ability can be improved by mutation of the GuaA (D441) position. Accordingly, in order to confirm the positional importance of GuaA (D441), a vector was created in which the 441st amino acid was substituted with another amino acid, and whether it affected the GMP conversion ability was confirmed.

[0225] Site-directed mutagenesis was performed using the pDC24-guaA (D441V) vector produced in Example 2-1 as a template.Specifically, for the introduction of the GuaA (D441A) mutation, primer pairs of SEQ ID NO: 9 and SEQ ID NO: 27 and SEQ ID NO: 28 and SEQ ID NO: 10, for the introduction of the GuaA (D441C) mutation, primer pairs of SEQ ID NO: 9 and SEQ ID NO: 29 and SEQ ID NO: 30 and SEQ ID NO: 10, for the introduction of the GuaA (D441E) mutation, primer pairs of SEQ ID NO: 9 and SEQ ID NO: 31 and SEQ ID NO: 32 and SEQ ID NO: 10, for the introduction of the GuaA (D441F) mutation, primer pairs of SEQ ID NO: 9 and SEQ ID NO: 33 and SEQ ID NO: 34 and SEQ ID NO: 10, for the introduction of the GuaA (D441H) mutation, primer pairs of SEQ ID NO: 9 and SEQ ID NO: 35 and SEQ ID NO: 36 and SEQ ID NO: 10, for the introduction of the GuaA (D441I) mutation, primer pairs of SEQ ID NO: 9 and SEQ ID NO: 37 and SEQ ID NO: 38 and SEQ ID NO: 10 primer pairs, primer pairs of SEQ ID NO: 9 and SEQ ID NO: 39 and SEQ ID NO: 40 and SEQ ID NO: 10 for introducing the GuaA (D441K) mutation, primer pairs of SEQ ID NO: 9 and SEQ ID NO: 41 and SEQ ID NO: 42 and SEQ ID NO: 10 for introducing the GuaA (D441L) mutation, primer pairs of SEQ ID NO: 9 and SEQ ID NO: 43 and SEQ ID NO: 44 and SEQ ID NO: 10 for introducing the GuaA (D441N) mutation, primer pairs of SEQ ID NO: 9 and SEQ ID NO: 45 and SEQ ID NO: 46 and SEQ ID NO: 10 for introducing the GuaA (D441Q) mutation, primer pairs of SEQ ID NO: 9 and SEQ ID NO: 47 and SEQ ID NO: 48 and SEQ ID NO: 10 for introducing the GuaA (D441T) mutation, primer pairs of SEQ ID NO: 9 and SEQ ID NO: 49 and SEQ ID NO: 50 and SEQ ID NO: 51 for introducing the GuaA (D441W) mutation Site-directed PCR was performed using 10 primer pairs, and SolgTM Pfu-X DNA polymerase was used as the polymerase. The PCR amplification conditions were as follows: denaturation at 95°C for 5 minutes, followed by 25 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute and 30 seconds, and then polymerization was performed at 72°C for 5 minutes to obtain each PCR product.Each of the above amplification products was treated with DpnI restriction enzyme to remove pDC24-guaA (D123K) used as a template, and then transformed into DH5a to obtain a plasmid in which the 441st amino acid of GuaA was modified to the target amino acid.

[0226] The plasmid information obtained above is shown in Table 10 below:

[0227] List of vectors for inserting amino acid substitutions in GuaA (D441) Number Plasmid name 1 pDC24-guaA (D441A) 2 pDC24-guaA (D441C) 3 pDC24-guaA (D441E) 4 pDC24-guaA (D441F) 6 pDC24-guaA (D441H) 7 pDC24-guaA (D441I) 8 pDC24-guaA (D441K) 9 pDC24-guaA (D441L) 11 pDC24-guaA (D441N) 13 pDC24-guaA (D441Q) 16 pDC24-guaA (D441T) 17 pDC24-guaA (D441W)

[0228] Example 4-2: Production of a strain in which the 441st amino acid variant of GuaA was substituted with another amino acid and verification of GMP conversion ability.

[0229] Each of the 18 vectors for introducing mutations prepared in Example 4-1 was transformed into the Corynebacterium stationarynis KCCM13320P strain by electroporation, and strains in which the vectors were inserted into the chromosome by recombination of homologous sequences were selected on a medium containing 25 mg / L kanamycin. The selected primary strains were then subjected to a second crossover, and strains in which mutations were introduced into the target gene were selected. The introduction of genetic mutations into the finally transformed strains was confirmed through PCR and base sequence analysis using the primer pairs of SEQ ID NOs: 11 and 12, and the strain names according to the inserted mutations are shown in Table 11 below:

[0230] List of strains in which the 441st amino acid variant of GuaA is substituted with another amino acid. Number of strains 1 KCCM13320P::guaA(D441A) 2 KCCM13320P::guaA(D441C) 3 KCCM13320P::guaA(D441E) 4 KCCM13320P::guaA(D441F) 6 KCCM13320P::guaA(D441H) 7 KCCM13320P::guaA(D441 I)8KCCM13320P::guaA(D441K)9KCCM13320P::guaA(D441L)10KCCM13320P::guaA(D441N) 11KCCM13320P::guaA(D441Q)12KCCM13320P::guaA(D441T)13KCCM13320P::guaA(D441W)

[0231] The 18 strains produced above and the KCCM13320P and KCCM13320P::guaA(D441V) strains were cultured in the same manner as in Example 2-3 and the GMP conversion ability was analyzed, and the results of the analysis are shown in Table 12 below:

[0232] Results of GMP conversion ability evaluation of strains in which the mutation of the 441st amino acid variant of GuaA was replaced with another amino acid. Strain number XMP concentration (g / l) GMP concentration (g / l) Increase / decrease rate of GMP production compared to the parent strain (%)KCCM13320P (parent strain)8.292.88-KCCM13320P::guaA(D441V)4.927.05245%KCCM13320P::guaA(D441A)8.083.06106%KCCM13320P::guaA(D441C) 5.985.46190%KCCM13320P::guaA(D441E)6.614.96172%KCCM13320P::guaA(D441F)6.355.06176%KCCM13320P::guaA(D441H)7.814.01139%KCC M13320P::guaA(D441I)5.16.72234%KCCM13320P::guaA(D441K)7.444.5157%KCCM13320P::guaA(D441L)5.795.59194%KCCM13320P::guaA(D44 1N)5.586.07211%KCCM13320P::guaA(D441Q)5.995.31185%KCCM13320P::guaA(D441T)8.053.67127%KCCM13320P::guaA(D441W)8.173.26113%

[0233] As a result, as shown in Table 12, it was confirmed that the strain containing the guaA mutant gene in which the 441st amino acid of the amino acid sequence encoded by the guaA gene was substituted with another amino acid in the GMP producing strain increased GMP production compared to KCCM13320P (parent strain) which did not contain the mutation. In other words, it was confirmed that the 441st amino acid of the amino acid sequence encoded by the guaA gene was a major mutation position in GMP production (conversion). More specifically, it was confirmed that the GMP productivity (conversion ability) of a microorganism containing a mutation in which the 441st amino acid of the amino acid sequence encoded by the guaA gene was substituted with valine, alanine, cysteine, glutamic acid, phenylalanine, histidine, isoleucine, lysine, leucine, asparagine, glutamine, threonine, or tryptophan was significantly increased.

[0234]

[0235] Example 5: Confirmation of the effect of the D123K + D441V combination mutant of the GuaA protein.

[0236] Example 5-1: Production of a strain expressing the D123K + D441V combination mutant of the GuaA protein.

[0237] The KCCM13320P::guaA(D123K) strain produced in the above Example 2-2 was transformed with the pDC24-guaA(D441V) vector produced in the above Example 2-1 by electroporation, and the strain in which the vector was inserted into the chromosome by recombination of the homologous sequence was selected on a medium containing 25 mg / L of kanamycin. The selected primary strain was then subjected to a second crossover to select a strain in which a mutation in the target gene was introduced. The introduction of the genetic mutation in the final transformed strain was confirmed by PCR using the primer pair of SEQ ID NO: 11 and SEQ ID NO: 12, followed by base sequence analysis using SEQ ID NO: 11 and SEQ ID NO: 12, and the obtained strain was named KCCM13320P::guaA(D123K, D441V).

[0238]

[0239] Example 5-2: Evaluation of GMP production ability of strain expressing D123K + D441V combination mutant of GuaA protein

[0240] In order to confirm the GMP conversion ability of the two mutant strains KCCM13320P::guaA(D123K) and KCCM13320P::guaA(D441V) produced in the above Example 2-2 and the KCCM13320P::guaA(D123K, D441V) mutant strain produced in the above Example 5-1, each strain was cultured using the method of Example 2-3 and the GMP conversion ability was analyzed. The analysis results are shown in Table 13 below:

[0241] Results of GMP conversion ability evaluation of Corynebacterium stationensis KCCM13320P, KCCM13320P::guaA(D123K), KCCM13320P::guaA(D441V), KCCM13320P::guaA(D123K, D441V) Strain number X MP concentration (g / l) GMP concentration (g / l) Increase / decrease rate of GMP production compared to parent strain (%) KCCM13320P (parent strain) 7.94 2.16 100% KCCM13320P::guaA(D123K) 6.56 3.31 153% KCCM13320P::guaA(D441V) 5.77 3.89 180% KCCM13320P::guaA(D123K, D441V)5.014.72218%

[0242] As a result, as shown in Table 13 above, the parent strain Corynebacterium stationensis KCCM13320P produced (converted) GMP at a concentration of 2.16 g / l, but the mutant strains KCCM13320P::guaA(D123K) and KCCM13320P::guaA(D441V), in which mutations were introduced into the GuaA protein, converted GMP at concentrations of 3.31 g / l and 3.89 g / l, respectively, and it was confirmed that the KCCM13320P::guaA(D123K, D441V) strain, in which the D123K + D441V combination mutations of the GuaA protein were introduced, converted GMP at a concentration of 4.72 g / l.

[0243]

[0244] Example 6: Confirmation of the effect of mutants in guaA of other species of Corynebacterium genus.

[0245] In order to confirm whether the D123K mutation and D441V mutation discovered in the above Examples 1-4 are mutations that also improve GMP production ability (conversion ability) in other Corynebacterium microorganisms, the influence of the mutation on the GuaA protein (SEQ ID NO: 96) of Corynebacterium casei (C. ca), which has approximately 95% sequence identity with the GuaA protein of Corynebacterium stationi, was confirmed.

[0246]

[0247] Example 6-1: Construction of a vector for expression of guaA mutants

[0248] In order to confirm the effect of mutants guaA (D123K) and guaA (E441V), in which aspartic acid at position 123 of the amino acid sequence of the GuaA protein is substituted with lysine, on GMP conversion ability, a vector for constructing an expression strain was constructed as follows using plasmid pDC24 (SEQ ID NO: 112) for insertion and replacement of a gene (SEQ ID NO: 97) in the Corynebacterium chromosome.

[0249] The chromosomal genes of the wild-type Corynebacterium casei LMG S-19264 strain were isolated using the G-spin Total DNA extraction mini kit (Cat. No. 17045) from Intron according to the protocol provided in the kit. Site-directed mutagenesis was performed using the primer pairs of SEQ ID NO: 98 and SEQ ID NO: 100 and SEQ ID NO: 101 and SEQ ID NO: 99 to introduce the GuaA (D123K) mutation, and the primer pairs of SEQ ID NO: 98 and SEQ ID NO: 102 and SEQ ID NO: 103 and SEQ ID NO: 99 to introduce the GuaA (E441V) mutation. At this time, SolgTM Pfu-X DNA polymerase was used as the polymerase, and the PCR amplification conditions were as follows: denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, polymerization at 72°C for 1 minute 30 seconds, repeated 25 times, and then polymerization was performed at 72°C for 5 minutes to obtain each PCR product. The gene fragment obtained above was mixed with the pDC24 vector prepared by cutting it with XbaI, a restriction enzyme, and cloned using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain recombinant plasmids, which were named pDC24-guaA (C.ca, D123K) and pDC24-guaA (C.ca, E441V), respectively.

[0250] The plasmid information obtained above is shown in Table 14 below:

[0251] List of vectors for inserting amino acid substitutions in GuaA (D123) Plasmid number 1pDC24-guaA (C.ca, D123K) 2pDC24-guaA (C.ca, E441V)

[0252] The sequences of the primers used in Example 6-1 are shown in Table 15 below.

[0253] Name Sequence (5'->3') Sequence number pDC24-guaA(mt)-FacgacggccagtgaattcgagctcggtacccggggatcctGAAGAGATCAAAGAACGCGCSEQ ID NO: 98pDC24-guaA(mt)-RgaccatgattacgccaagcttgcatgcctgcaggtcgactCACCCAGAGGGTCTATAACCSEQ ID NO: 99pDC24-guaA(C.ca, D123K)CGTGCGACATCCACACCTTGTGGTTGGCCTCCAAGCCtTtGTGCAGCACGCCACCGGTGTSEQ ID NO: 100pDC24-guaA(C.ca, D123K)aAaGGCTTGGAGGCCAACCACAASEQ ID NO: 101pDC24-guaA(C.ca, E441V)CGGACATCGGCGAGAAGAACGACTGGGCACTGCCAGATcaCGTTATCCAGGCCGGCGTTGSEQ ID NO: 102pDC24-guaA(C.ca, E441V)tgATCTGGCAGTGCCCAGTCGTSeq ID NO: 103

[0254] Example 6-2: Production of a strain expressing a Corynebacterium casei guaA mutant

[0255] In order to confirm the influence of the lysine mutation at position 123 and the valine mutation at position 441 of the guaA amino acid discovered in the above Example 1-4 on GMP production ability (conversion ability), a strain was created in which a mutation was introduced into the endogenous guaA gene of a Corynebacterium casei strain.

[0256] The pDC24-guaA(C.ca, D123K) and pDC24-guaA(C.ca, E441V) vectors constructed in Example 6-1 were each transformed into Corynebacterium casei LMG S-19264 strain by electroporation, and then strains in which the vectors were inserted into the chromosome by recombination of homologous sequences in a selection medium containing 25 mg / L of kanamycin were selected as primary candidates. The selected primary strains were then subjected to a second crossover to select strains in which mutations in the target gene were introduced. The introduction of genetic mutations in the final transformed strains was confirmed by PCR using the primer pairs of SEQ ID NOs: 104 and 105, followed by base sequence analysis using SEQ ID NOs: 104 and 105. The obtained strains were named LMG S-19264::guaA(D123K) or LMG S-19264::guaA(E441V), respectively.

[0257] In addition, the LMG S-19264::guaA(D123K) strain was transformed with the pDC24-guaA(C.ca, E441V) vector constructed in Example 6-1 by electroporation, and the strain in which the vector was inserted into the chromosome by recombination of the homologous sequence was selected on a medium containing 25 mg / L kanamycin. The selected primary strain was then subjected to a second crossover to select a strain in which a mutation in the target gene was introduced. The introduction of the genetic mutation in the final transformed strain was confirmed by PCR using the primer pair of SEQ ID NO: 104 and SEQ ID NO: 105, followed by base sequence analysis using SEQ ID NO: 104 and SEQ ID NO: 105, and the obtained strain was named LMG S-19264::guaA(C.ca, D123K, E441V).

[0258]

[0259] The sequences of the primers used in Example 6-2 are shown in Table 16 below.

[0260] Name sequence (5'->3') Sequence number pDC24-guaA seq-FGTGACTCAACCTGCAACAAC Sequence number 104 pDC24-guaA seq-RTTACTCCCACTCGATGGTTC Sequence number 105

[0261] Example 6-3: Evaluation of GMP production capacity of a strain expressing a Corynebacterium casei guaA mutant

[0262] In order to confirm the GMP conversion ability of the three strains LMG S-19264::guaA(D123K), LMG S-19264::guaA(E441V), and LMG S-19264::guaA(C.ca, D123K, D441V) produced in Example 2-2 above, they were cultured using the following method.

[0263] Specifically, the parent strain Corynebacterium casei LMG S-19264 and the three mutant strains produced in Example 6-2 were each inoculated into a 250 ml corner-baffle flask containing 25 ml of the seed medium described in Example 1-3, and then cultured with shaking at 200 rpm at 30°C for 20 hours. 800 μl of the titer evaluation solution described in Example 1-3 was added to 200 μl of the culture solution, and the reaction was performed at 42°C for 30 minutes to convert XMP to GMP. After completion of the culture, the production amount of GMP was measured using liquid high-performance chromatography, and the GMP concentration in the culture solution for each strain tested is shown in Table 17 below.

[0264] Comparison of GMP conversion ability of Corynebacterium casei LMG S-19264, LMG S-19264::guaA(D123K), LMG S-19264::guaA(E441V), LMG S-19264::guaA(C.ca, D123K, E441V) Strain number XMP concentration (g / l) GMP concentration (g / l) Increase or decrease in GMP production compared to parent strain (%) LMG S-19264 (parent strain) 8.590.94 - LMG S-19264::guaA(D123K) 8.331.18126% LMG S-19264::guaA(E441V) 8.231.33141% LMG S-19264::guaA(D123K, E441V)8.011.59169%

[0265] As a result, as shown in Table 17 above, the parent strain Corynebacterium casei LMG S-19264 produced (converted) GMP at a concentration of 0.94 g / l, but the mutant strains LMG S-19264::guaA(D123K), LMG S-19264::guaA(E441V), and LMG S-19264::guaA(C.ca, D123K, E441V), in which mutations were introduced into the GuaA protein, were confirmed to convert GMP at concentrations of 1.18 g / l, 1.33 g / l, and 1.59 g / l, respectively.

[0266] Through the above results, it was confirmed that a strain into which a mutation was introduced in which the 123rd amino acid of the amino acid sequence encoded by the guaA gene was substituted with lysine or a mutation was introduced in which the 441st amino acid was substituted with valine increased GMP production compared to a strain into which the mutation was not introduced.

[0267]

[0268] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.

[0269]

[0270] [Accession number]

[0271] Name of depositor: Korea Center for Microbiological Conservation (KCCM)

[0272] Accession number: KCCM13320P

[0273] Date of acceptance: 20230110

[0274]

[0275]

Claims

1. A polypeptide having glutamine-hydrolyzing GMP synthase activity, comprising an amino acid sequence in which the amino acid corresponding to the 123rd residue of the amino acid sequence of SEQ ID NO: 1 is replaced with a different amino acid, or the amino acid corresponding to the 441st residue is replaced with a different amino acid, or a combination thereof, in an amino acid sequence having 90% or more sequence identity with the amino acid sequence of SEQ ID NO:

1.

2. A polypeptide in which the amino acid corresponding to the 123rd residue of the amino acid sequence of sequence number 1 in paragraph 1 is substituted with lysine, glutamic acid, histidine, methionine, glutamine, arginine, serine, or tyrosine.

3. A polypeptide in which the amino acid corresponding to the 441st residue of the amino acid sequence of sequence number 1 in paragraph 1 is substituted with valine, alanine, cysteine, glutamic acid, phenylalanine, histidine, isoleucine, lysine, leucine, asparagine, glutamine, threonine, or tryptophan.

4. A polypeptide in which the amino acid corresponding to the 123rd residue of the amino acid sequence of SEQ ID NO: 96 in the first paragraph is substituted with lysine, glutamic acid, histidine, methionine, glutamine, arginine, serine, or tyrosine.

5. A polypeptide in which the amino acid corresponding to the 441st residue of the amino acid sequence of SEQ ID NO: 96 in paragraph 1 is substituted with valine, alanine, cysteine, glutamic acid, phenylalanine, histidine, isoleucine, lysine, leucine, asparagine, glutamine, threonine, or tryptophan.

6. A polypeptide according to claim 1, wherein the polypeptide comprises an amino acid sequence of any one of SEQ ID NOs: 52 to 73 and SEQ ID NOs: 106 to 108.

7. A polynucleotide encoding a polypeptide of any one of claims 1 to 6.

8. In the 7th paragraph, the polynucleotide comprises a nucleic acid sequence of any one of the sequence numbers selected from among SEQ ID NOs: 74 to 95 and SEQ ID NOs: 109 to 111.

9. A recombinant vector comprising the polynucleotide of paragraph 7.

10. A microorganism comprising at least one member selected from the group consisting of a polypeptide according to any one of claims 1 to 6, a polynucleotide encoding the polypeptide, and a vector comprising the polynucleotide.

11. In the 10th paragraph, the microorganism is a microorganism having increased 5'-guanosine monophosphate (GMP) production ability.

12. In paragraph 10, the microorganism is a microorganism of the genus Corynebacterium.

13. In claim 12, the microorganism is Corynebacterium stationis or Corynebacterium casei.

14. A method for producing 5'-guanine acid, comprising the step of culturing a microorganism comprising at least one selected from the group consisting of a polypeptide according to any one of claims 1 to 6, a polynucleotide encoding the polypeptide, and a vector comprising the polynucleotide in a medium.

15. A method for producing 5'-guanine acid, further comprising a step of recovering 5'-guanine acid from the cultured microorganism, medium, or both of the above-described 14th paragraph.

16. A method for producing 5'-guanine acid in claim 14, wherein the method further comprises a step of culturing a microorganism producing 5'-xanthrylic acid or a step of adding XMP to the medium prior to the step of culturing the microorganism in the medium.

17. A composition for producing 5'-guanine acid, comprising a microorganism comprising at least one member selected from the group consisting of a polypeptide according to any one of claims 1 to 6, a polynucleotide encoding the polypeptide, and a vector comprising the polynucleotide.

Images