Novel mutant glycosyltransferase polypeptide and method for producing steviol glycosides using same

A mutant UDP-glycosyltransferase polypeptide enhances the production of rebaudioside D and M by introducing specific amino acid substitutions, improving yield and efficiency in sweetener production.

WO2025159542A1PCT designated stage Publication Date: 2025-07-31CJ CHEILJEDANG CORP
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/001347
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-01-24
Filing Date
2025-01-23
Publication Date
2025-07-31

AI Technical Summary

Technical Problem

The extraction and purification of rebaudioside D and M from stevia leaves is costly due to their low abundance and unique taste and odor properties, limiting their use as alternative sweeteners, necessitating the development of efficient methods for mass production using novel enzymes.

Method used

A mutant polypeptide with glycosyltransferase activity, specifically a UDP-glycosyltransferase, is engineered to enhance the conversion of rebaudioside A into rebaudioside D and M by introducing specific amino acid substitutions at positions 92, 208, 380, and 381, and a method involving the use of a microorganism expressing this polypeptide to catalyze the reaction with glucose-linked nucleotide diphosphate.

Benefits of technology

The mutant polypeptide significantly increases the yield of rebaudioside D and M, offering a cost-effective and efficient alternative to natural sweeteners, addressing the limitations of existing methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025001347_31072025_PF_FP_ABST
    Figure KR2025001347_31072025_PF_FP_ABST
Patent Text Reader

Abstract

The present application relates to: a novel mutant polypeptide; a polynucleotide encoding the mutant polypeptide; a vector comprising the polynucleotide; a microorganism comprising at least one of the mutant polypeptide, the polynucleotide encoding the mutant polypeptide, or the vector comprising the polynucleotide; a method for producing steviol glycosides using the mutant polypeptide or the microorganism; a composition for producing at least one of rebaudioside D or rebaudioside M using same; and a use of the microorganism for producing at least one of rebaudioside D or rebaudioside M.
Need to check novelty before this filing date? Find Prior Art

Description

Novel mutant glycosyltransferase polypeptide and method for producing steviol glycosides using the same

[0001] The present application relates to a novel mutant polypeptide; a polynucleotide encoding the mutant polypeptide; a vector comprising the polynucleotide; a microorganism comprising at least one of the mutant polypeptide, the polynucleotide encoding the mutant polypeptide, and the vector comprising the polynucleotide; a method for producing steviol glycosides, the method comprising a step of reacting rebaudioside A with a nucleotide diphosphate having a glucose bond in the presence of the mutant polypeptide or the microorganism to transfer glucose to rebaudioside A; a composition for producing at least one of rebaudioside D and rebaudioside M using the same; and a use of the microorganism for producing at least one of rebaudioside D and rebaudioside M.

[0002]

[0003] Following the World Health Organization's (WHO) recommendation to reduce daily sugar intake due to concerns about the risk of obesity-related diseases, governments in developed countries are actively discussing policies to reduce sugar intake. Consequently, demand for various alternative sweeteners to replace sugar and high-fructose corn syrup is increasing, leading to the continuous development and commercialization of these alternative sweeteners.

[0004] From this perspective, customer demand for natural sweeteners continues to grow due to ongoing concerns about the safety of synthetic sweeteners. However, due to the limitations of the taste and odor properties unique to natural sweeteners, they are unable to fully replace existing low-calorie and zero-calorie products centered on synthetic sweeteners.

[0005] In this regard, a natural high-sweetness sweetener that has recently attracted considerable attention is stevia sweetener extracted from stevia leaves (U.S. Patent Application Publication No. 2023-0270146). Among the sweetening components of stevia or its extracts, rebaudioside D and M have low bitterness and excellent sweetness, making them valuable as alternative sweeteners. However, these components are present in extremely small amounts in stevia leaves, and the extraction and purification process for manufacturing them requires high costs.

[0006] Accordingly, there is a growing need for research on novel enzymes necessary for mass production of rebaudioside D and M and manufacturing methods using the same.

[0007]

[0008] The problem to be solved by the present application is to provide a mutant polypeptide having glycosyltransferase activity; a polynucleotide encoding the mutant polypeptide; a vector comprising the polynucleotide; a microorganism comprising at least one of the polypeptide, the polynucleotide, and the vector; a method for producing at least one of rebaudioside D and rebaudioside M, comprising a step of culturing the microorganism in a medium; a method for producing a steviol glycoside, comprising a step of reacting rebaudioside A with a nucleotide diphosphate linked to glucose in the presence of the mutant polypeptide and / or the microorganism to transfer glucose to rebaudioside A; a composition for producing at least one of rebaudioside D and rebaudioside M using the same; and a use of the microorganism for producing at least one of rebaudioside D and rebaudioside M.

[0009]

[0010] One object of the present application is to provide a mutant polypeptide having glycosyltransferase activity, which mutant polypeptide comprises at least one of: a substitution of the amino acid corresponding to position 92 of the amino acid sequence of SEQ ID NO: 1 with tryptophan; a substitution of the amino acid corresponding to position 208 with alanine or methionine; a substitution of the amino acid corresponding to position 380 with histidine, threonine, alanine, or glycine; and a substitution of the amino acid corresponding to position 381 with phenylalanine, serine, alanine, or asparagine.

[0011] Another object of the present application is to provide a polynucleotide encoding a variant polypeptide of the present application.

[0012] Another object of the present application is to provide a vector comprising the polynucleotide.

[0013] Another object of the present application is to provide a microorganism comprising at least one of a variant polypeptide of the present application, a polynucleotide encoding the variant polypeptide, and a vector comprising the polynucleotide.

[0014] Another object of the present application is to provide a method for producing a steviol glycoside, comprising the step of reacting rebaudioside A with a nucleotide diphosphate linked to glucose in the presence of the mutant polypeptide and / or the microorganism to transfer glucose to rebaudioside A, wherein the steviol glycoside is at least one of rebaudioside D and rebaudioside M.

[0015] Another object of the present application is to provide a composition for producing at least one of rebaudioside D and rebaudioside M, comprising a mutant polypeptide of the present application; a polynucleotide encoding the mutant polypeptide; a microorganism comprising at least one of the mutant polypeptide, the polynucleotide encoding the mutant polypeptide, and a vector comprising the polynucleotide; and a culture of the microorganism.

[0016] Another object of the present application is to provide a use of the above microorganism for producing rebaudioside D and rebaudioside M.

[0017] Another object of the present application is to provide a use of the composition for producing rebaudioside D and rebaudioside M.

[0018]

[0019] When using the mutant polypeptide of the present application or a microorganism comprising the same, production of rebaudioside D and / or M at a higher yield is possible compared to the unmodified polypeptide or microorganism.

[0020]

[0021] Figure 1 is a diagram showing the results of comparison of RebD synthesis ability using 10 types of improved enzyme single mutants of the present invention.

[0022] Figure 2 is a diagram showing the results of comparison of RebD synthesis ability using 16 types of improved enzyme double mutants of the present invention.

[0023] Figure 3 is a diagram showing the results of comparison of RebD synthesis ability using 10 types of improved enzyme complex mutants (double mutants or more) of the present invention.

[0024]

[0025] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below. Furthermore, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to more clearly explain the level of the technical field to which the present invention pertains and the contents of the present invention.

[0026]

[0027] One aspect of the present application provides a mutant polypeptide having glycosyltransferase activity, wherein at least one of the amino acids corresponding to positions 92, 208, 380, and 381 of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid.

[0028]

[0029] As an example of implementation, the amino acid sequence of SEQ ID NO: 1 and / or the variant polypeptide of the present application may be a glycosyltransferase, specifically a UDP-glycosyltransferase (UDP-glycosyltransferase; UGT), and more specifically, but not limited to, a UDP-glycosyltransferase B (UGT-B).

[0030] In this application, the term "glycosyltransferase" refers to an enzyme having the activity of transferring a monosaccharide moiety from a glycosyl donor to a glycosyl acceptor molecule, and the UDP-glycosyltransferase refers to an enzyme that uses a nucleotide diphosphate (e.g., UDP-sugar) linked to glucose as a glycosyl donor. In the following application, the term "glycosyltransferase" may be used interchangeably with "UDP-glycosyltransferase" and "UGT".

[0031] In the present application, "UDP-glycosyltransferase B" may be an enzyme capable of converting rebaudioside A (RebA) into rebaudioside D (RebD) using a glucose-linked nucleotide diphosphate as a glycosyl donor. In the present application below, UDP-glycosyltransferase B may be used interchangeably with glycosyltransferase B and UGT-B.

[0032] In the present application, “UDP-glycosyltransferase A” may be an enzyme capable of converting stevioside into rebaudioside A and / or rebaudioside D into rebaudioside M (RebM) using a glucose-linked nucleotide diphosphate as a glycosyl donor. In the present application below, UDP-glycosyltransferase A may be used interchangeably with glycosyltransferase A and UGT-A.

[0033]

[0034] The variant polypeptide of the present application may have the amino acid sequence of SEQ ID NO. 1 as the parent sequence, and at least one of the amino acids corresponding to the 92nd, 208th, 380th, and 381st positions of the amino acid sequence may be substituted with another amino acid.

[0035] In the present application, the parent sequence refers to a reference sequence into which modifications are introduced for producing a mutant polypeptide. In other words, the parent sequence may be a target for introducing substitution mutations of the present application. The parent sequence may be a naturally occurring or wild type, or a variant in which one or more substitutions, additions, or deletions have occurred in the natural or wild type sequence, or may be an artificially synthesized sequence.

[0036] A polypeptide comprising the parent sequence of the present application may comprise the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 70% or more homology or identity therewith. In addition, even if some sequences are deleted or substituted in the amino acid sequence of SEQ ID NO: 1 or another sequence is added to the amino acid sequence of SEQ ID NO: 1, as long as it is a protein exhibiting a function corresponding to the glycosyltransferase activity, it may be included in the polypeptide comprising the parent sequence. Specifically, the polypeptide comprising the parent sequence may have, comprise, consist of, or essentially consist of the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity therewith. For example, the parent sequence of the present application may be, but is not limited to, a polypeptide having, including, consisting of, or consisting essentially of the amino acid sequence of SEQ ID NO: 1.

[0037] For example, sequence number 1 of the present application may be sequence number 1 of U.S. Patent Publication No. 11,414,690, which is incorporated by reference herein.

[0038]

[0039] In addition, the sequence of a polynucleotide encoding a polypeptide comprising a parent sequence having an amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 70% or more homology or identity therewith can be obtained, for example, based on codon information known in the art. For example, the polypeptide comprising the parent sequence may be encoded by a polynucleotide having or including a base sequence having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity with the sequence of SEQ ID NO: 2 and / or SEQ ID NO: 127, or consisting of or consisting essentially of the base sequence, but is not limited thereto.

[0040] In the present application, the polynucleotide (or gene) comprising the base sequence of SEQ ID NO: 2 and / or SEQ ID NO: 127 may be used interchangeably with a polynucleotide (or gene) having or consisting of the base sequence of SEQ ID NO: 2 and / or SEQ ID NO: 127.

[0041]

[0042] Meanwhile, in the present application, the expression "an amino acid corresponding to a specific position in a specific amino acid sequence is replaced with another amino acid" can be interpreted to mean that the amino acid sequence is used as a reference sequence.

[0043] In the present application, the term "reference sequence" refers to a sequence that serves as a reference for specifying the Nth position in a specific amino acid sequence. For example, when a specific amino acid sequence and a reference sequence are aligned through a sequence alignment known in the art, and each amino acid residue of the specific amino acid sequence is numbered based on the alignment with reference to the amino acid residue position of the reference sequence, the position of the amino acid corresponding to the Nth position of the reference sequence within the specific amino acid sequence can be determined.

[0044] In the present application, the term "Nth position" in an amino acid sequence may include an amino acid position corresponding to the Nth position in addition to the Nth position. Specifically, it may include an amino acid position corresponding to any amino acid residue in a mature polypeptide disclosed in a particular amino acid sequence (e.g., a reference sequence).

[0045] As used herein, the term "corresponding to" refers to an amino acid residue at a position listed in a polypeptide, or an amino acid residue that is similar, identical, or homologous to the residue listed in the polypeptide. Identifying an amino acid at a corresponding position may be determining a specific amino acid in a sequence that references a specific sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in the amino acid sequence of a related protein or a reference sequence.

[0046] In the present application, the amino acid sequence of SEQ ID NO. 1 can be used as a reference sequence to determine the position of an amino acid in any amino acid sequence.

[0047] That is, the amino acid sequence of SEQ ID NO. 1 disclosed in the present application can be used to determine the corresponding amino acid residue in any polypeptide, and unless otherwise specified in the present application, residues of a particular amino acid sequence are numbered based on the amino acid sequence of SEQ ID NO. 1.

[0048] For example, any amino acid sequence can be aligned with the amino acid sequence of SEQ ID NO: 1, and based on this, each amino acid residue of the arbitrary amino acid sequence can be numbered with reference to the corresponding amino acid residue position of SEQ ID NO: 1. For example, a sequence alignment algorithm such as that described in the present application can identify the position of an amino acid, or the position at which a modification such as a substitution, addition, or deletion occurs, by comparing it with a query sequence (also referred to as a “reference sequence”).

[0049] For such alignment, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) can be used, but is not limited thereto, and any sequence alignment program or pairwise sequence comparison algorithm known in the art can be appropriately used.

[0050] Multiple sequence alignment can also be used to identify corresponding amino acid residues in other polypeptides. Examples of multiple sequence alignment programs known in the art include MUSCLE (multiple sequence comparison by log-expectation; version 3.5 or later; Edgar, 2004, Nucleic Acids Research 32: 1792-1797), MAFFT (version 6.857 or later; Katoh and Kuma, 2002, Nucleic Acids Research 30: 3059-3066; Katoh et al., 2005, Nucleic Acids Research 33: 511-518; Katoh and Toh, 2007, Bioinformatics 23: 372-374; Katoh et al., 2009, Methods in Molecular Biology 537: 39-64; Katoh and Toh, 2010, Bioinformatics 26: 1899-1900), and EMBOSS using ClustalW. EMMA (1.83 or higher; Thompson et al., 1994, Nucleic Acids Research 22: 4673-4680), etc., and the default parameters of each of the above programs can be used, but are not limited thereto.

[0051] Additionally, if polypeptides diverged from the mature polypeptide of SEQ ID NO: 1 and their relationships cannot be detected by conventional sequence-based comparison, other pairwise sequence comparison algorithms can be used (Lindahl and Elofsson, 2000, J. Mol. Biol. 295: 613-615). Higher sensitivity can be achieved in sequence-based searches by using search programs that utilize probabilistic representations of polypeptide families (profiles) to search databases. For example, the PSI-BLAST program generates profiles through an iterative database search process and can detect remote homologs (Atschulet et al., 1997, Nucleic Acids Res. 25: 3389-3402). Even greater sensitivity can be achieved if the family or superfamily for the polypeptide has more than one representation in a protein structure database. Programs such as GenTHREADER (Jones, 1999, J. Mol. Biol. 287: 797-815; McGuffin and Jones, 2003, Bioinformatics 19: 874-881) use information from a variety of sources, such as PSI-BLAST, secondary structure predictions, structural alignment profiles, and solvation potentials, as input to a neural network that predicts the structural folding of a query sequence. Similarly, the method of Gough et al., 2000, J. Mol. Biol. 313: 903-919, can be used to align an unknown sequence with superfamily models available in the SCOP database. These alignments can in turn be used to build homology models for the polypeptide, and these models can be evaluated for accuracy using a variety of tools developed for this purpose.

[0052] For proteins with known structures, several tools and resources are available for searching and generating structural alignments. For example, the SCOP superfamily of proteins is structurally aligned, and these alignments are accessible and downloadable. Two or more protein structures can be aligned using various algorithms, such as distance alignment matrix alignment (Holm and Sander, 1998, Proteins 33: 88-96) or combinatorial extension (CE) (Shindyalov and Bourne, 1998, Protein Engineering 11: 739-747). Implementations of these algorithms can additionally be used to query structural databases containing the target structure to discover possible structural homologues (Holm and Park, 2000, Bioinformatics 16: 566-567).

[0053] The above methods are examples and are not limiting.

[0054] For example, the amino acid corresponding to the 92nd position of the amino acid sequence of SEQ ID NO: 1 of the present application may be an amino acid at positions 90 to 100 in the amino acid sequence of the homologous enzyme of SEQ ID NO: 1. In this case, the mutant polypeptide in which the amino acid corresponding to the 92nd position of the amino acid sequence of SEQ ID NO: 1, tyrosine, is substituted with tryptophan may be a polypeptide in which the tyrosine corresponding to any one of positions 90 to 100 in the amino acid sequence of the homologous enzyme of SEQ ID NO: 1 is substituted with tryptophan. As another example, the amino acid corresponding to the 380th position of the amino acid sequence of SEQ ID NO: 1 of the present application may be an amino acid at positions 360 to 381 in the amino acid sequence of the homologous enzyme of SEQ ID NO: 1, and the amino acid corresponding to the 381st position of the amino acid sequence of SEQ ID NO: 1 of the present application may be an amino acid at positions 361 to 382 in the amino acid sequence of the homologous enzyme of SEQ ID NO: 1, but is not limited thereto.

[0055]

[0056] In the present application, with respect to an amino acid sequence, it is obvious that a polypeptide or protein “comprising,” “consisting of,” or “having” an amino acid sequence described in a specific sequence number may also include a polypeptide or protein in which some amino acid(s) are deleted, modified, substituted, or added, as long as it has the same or corresponding activity as the polypeptide or protein of the corresponding sequence number. For example, the polypeptide or protein may also include a polypeptide or protein having an amino acid(s) addition or deletion, a naturally occurring mutation, a silent mutation, or a conservative substitution within or at the N-terminus or C-terminus of the polypeptide or protein that does not alter the function of the protein, as long as it has the same or corresponding activity.

[0057] Also, for example, a polypeptide or protein conjugated with an N-terminal signal (or leader) sequence that is involved in translocation of a protein (polypeptide) co-translationally or post-translationally, or a polypeptide or protein conjugated with another sequence or linker so that the polypeptide or protein can be identified, purified, or synthesized, may also be included in the scope of the polypeptide or protein having the amino acid sequence set forth in the specific sequence number.

[0058] In this application, the term "conservative substitution" refers to the replacement of an amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions may have little effect on the activity of a polypeptide or protein.

[0059]

[0060] In the present application, the term "variant" or "variant polypeptide" refers to a polypeptide having a sequence different from the parent sequence due to conservative substitution and / or modification (such as substitution, addition, or deletion) of one or more amino acids in the parent sequence. The functions or properties of such variant polypeptides may be increased, unchanged, or decreased compared to the native polypeptide. For example, some variant polypeptides may include variant polypeptides in which any one or more of the amino acids corresponding to positions 92, 208, 380, and 381 of the amino acid sequence of SEQ ID NO: 1 are substituted with different amino acids, and additionally, one or more regions, such as the N-terminal leader sequence or the transmembrane domain, are deleted. In addition, as an example, another variant polypeptide may further include a variant in which a portion is removed from the N- and / or C-terminus of the mature protein. The term "variant polypeptide" may be used interchangeably with terms such as variant, modification, mutated protein, mutation, and variant (in English, modification, modified protein, mutant, mutein, divergent, variant, etc.), and is not limited thereto as long as the term is used in the meaning of variant.

[0061] Additionally, the variant polypeptide may contain deletions or additions of amino acids that have minimal impact on the properties and secondary structure of the polypeptide. For example, the polypeptide may be conjugated to a signal (or leader) sequence at the polypeptide N-terminus that is involved in protein translocation, either co-translationally or post-translationally. The polypeptide may also be conjugated to other sequences or linkers to facilitate identification, purification, or synthesis of the polypeptide.

[0062]

[0063] The variant polypeptide of the present application may be in an isolated form, but is not limited thereto.

[0064] As used herein, the term "isolated" refers to a substance that exists in an environment where it does not occur naturally, or in a form that does not occur naturally. This includes the substance (sequence or nucleic acid) being at least substantially free from at least one other component with which it is naturally associated and found in nature, such as a sequence or nucleic acid.

[0065] In the present application, a mutant polypeptide may be, but is not limited to, a non-naturally occurring polypeptide, i.e., a polypeptide that does not exist in nature itself.

[0066] The variant polypeptide of the present application may comprise biologically active fragments of the variant polypeptide.

[0067] In the present application, with respect to amino acid or base (nucleic acid) sequences, the term "biologically active fragments or fragments" may refer to "functional fragments." A "functional fragment," which may also be referred to as an active fragment, refers to a polypeptide that contains fewer amino acids than a full-length protein but possesses at least one biological activity of the corresponding full-length protein. For example, a functional fragment of an enzyme may include the catalytic site of the enzyme.

[0068]

[0069] In the present application, the term “other amino acid” is not limited to an amino acid other than the amino acid prior to substitution.

[0070] The mutant polypeptide of the present application may have at least one amino acid corresponding to positions 92, 208, 380, and 381 of the amino acid sequence of SEQ ID NO: 1 substituted with another amino acid.

[0071] The variant polypeptide of the present application may include an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% or 99.9% homology or identity with the amino acid sequence set forth in SEQ ID NO: 1, wherein at least one of the amino acids corresponding to positions 92nd, 208th, 380th and 381st from the N-terminus of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid. In addition, it is obvious that a variant having an amino acid sequence in which a part of the sequence is deleted, substituted, conservatively substituted or added is also included within the scope of the present application, as long as it includes the amino acid substitution and has the above-mentioned homology or identity and exhibits an effect corresponding to the variant of the present application.

[0072]

[0073] In the present application, when it is described that "the amino acid corresponding to the 92nd position of the amino acid sequence of SEQ ID NO: 1 was replaced with another amino acid" and / or "the amino acid corresponding to the 208th position of the amino acid sequence of SEQ ID NO: 1 was replaced with another amino acid", it may be a substitution with an amino acid other than tyrosine, when it is described that "the amino acid corresponding to the 380th position of the amino acid sequence of SEQ ID NO: 1 was replaced with another amino acid", it may be a substitution with an amino acid other than phenylalanine, and when it is described that "the amino acid corresponding to the 381st position of the amino acid sequence of SEQ ID NO: 1 was replaced with another amino acid", it may be a substitution with an amino acid other than glycine, and may be alanine, glutamic acid, phenylalanine, glycine, arginine, aspartate, cysteine, asparagine, glutamine, histidine, This may mean, but is not limited to, being substituted with any one of proline, serine, tyrosine, isoleucine, lysine, tryptophan, valine, methionine, threonine, or leucine.

[0074]

[0075] As an example of one embodiment, the variant polypeptide of the present application may include one or more of the following: a substitution of the amino acid corresponding to position 92 of the amino acid sequence of SEQ ID NO: 1 with tryptophan; a substitution of the amino acid corresponding to position 208 with alanine or methionine; a substitution of the amino acid corresponding to position 380 with histidine, threonine, alanine, or glycine; and a substitution of the amino acid corresponding to position 381 with phenylalanine, serine, alanine, or asparagine.

[0076] For example, a mutant polypeptide in which the amino acid corresponding to the 92nd position of the amino acid sequence of SEQ ID NO: 1 of the present application is substituted with tryptophan may include an amino acid sequence in which the amino acid corresponding to the 92nd position in the amino acid sequence described by SEQ ID NO: 1 is fixed as tryptophan, and has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%; and less than 100% homology or identity with SEQ ID NO: 1. In addition, it is obvious that a mutant polypeptide having an amino acid sequence in which a part of the sequence is deleted, modified, substituted, conservatively substituted, or added is also included within the scope of the present application, as long as it has such homology or identity and exhibits an effect corresponding to the mutant polypeptide of the present application.

[0077] The variant polypeptide of the present application may be one in which one to four amino acids, specifically one or more, two or more, three or more, or four amino acids corresponding to positions 92, 208, 380, and 381 of the amino acid sequence of SEQ ID NO: 1, are substituted with other amino acids.

[0078] The variant polypeptide of the present application may be included without limitation, as long as it includes a substitution of any one or more of the amino acids corresponding to positions 92, 208, 380, and 381 of the amino acid sequence of SEQ ID NO: 1 described above.

[0079] In one embodiment, the mutant polypeptide may further comprise a substitution of the amino acid corresponding to position 92 of the amino acid sequence of SEQ ID NO: 1 with tryptophan; a substitution of the amino acid corresponding to position 208 with alanine or methionine; and a substitution of the amino acid corresponding to position 381 with phenylalanine, serine, alanine, or asparagine, while further comprising a substitution of the amino acid corresponding to position 380 of the amino acid sequence of SEQ ID NO: 1 with glycine.

[0080] In one embodiment, the mutant polypeptide may be one in which the amino acid corresponding to position 92 of the amino acid sequence of SEQ ID NO: 1 is replaced with tryptophan; the amino acid corresponding to position 208 is replaced with alanine or methionine; the amino acid corresponding to position 380 is replaced with histidine, threonine, or alanine; the amino acid corresponding to position 381 is replaced with phenylalanine, serine, alanine, or asparagine; or the amino acid corresponding to position 380 is replaced with histidine, threonine, or glycine and the amino acid corresponding to position 381 is replaced with phenylalanine, serine, alanine, or asparagine.

[0081]

[0082] In one embodiment, the mutant polypeptide may further include a substitution of the amino acid corresponding to position 381 of the amino acid sequence of SEQ ID NO: 1 with phenylalanine, serine, alanine, or asparagine, and a substitution of the amino acid corresponding to position 380 of the amino acid sequence of SEQ ID NO: 1 with histidine, glycine, threonine, or alanine. In addition, the mutant polypeptide may further include a substitution of the amino acid corresponding to position 92 of the amino acid sequence of SEQ ID NO: 1 with tryptophan, a substitution of the amino acid corresponding to position 208 with alanine, or a combination thereof, but is not limited thereto. At this time, in one embodiment, the mutant polypeptide may further include a substitution of the amino acid corresponding to position 380 of the amino acid sequence of SEQ ID NO: 1 with alanine, and a substitution of the amino acid corresponding to position 381 with alanine; The amino acid corresponding to position 380 of the amino acid sequence of SEQ ID NO: 1 may be replaced with threonine, and the amino acid corresponding to position 381 may be replaced with phenylalanine; or the amino acid corresponding to position 380 of the amino acid sequence of SEQ ID NO: 1 may be replaced with threonine, and the amino acid corresponding to position 381 may be replaced with serine, but is not limited thereto.

[0083] In one embodiment, the mutant polypeptide may be one in which the amino acid corresponding to position 208 is replaced with alanine, the amino acid corresponding to position 380 is replaced with threonine or alanine, and the amino acid corresponding to position 381 is replaced with phenylalanine, serine, or alanine; the amino acid corresponding to position 92 is replaced with tryptophan, the amino acid corresponding to position 380 is replaced with threonine or alanine, and the amino acid corresponding to position 381 is replaced with phenylalanine, serine, or alanine; the amino acid corresponding to position 92 is replaced with tryptophan, and the amino acid corresponding to position 208 is replaced with alanine; or the amino acid corresponding to position 92 is replaced with tryptophan, the amino acid corresponding to position 208 is replaced with alanine, the amino acid corresponding to position 380 is replaced with threonine or alanine, and the amino acid corresponding to position 381 is replaced with phenylalanine, serine, or alanine.

[0084] In one embodiment of the above-described embodiment, the mutant polypeptide comprises: an amino acid corresponding to position 380 of the amino acid sequence of SEQ ID NO: 1 substituted with histidine and an amino acid corresponding to position 381 substituted with phenylalanine; an amino acid corresponding to position 380 of the amino acid sequence of SEQ ID NO: 1 substituted with histidine and an amino acid corresponding to position 381 substituted with asparagine; an amino acid corresponding to position 380 of the amino acid sequence of SEQ ID NO: 1 substituted with histidine and an amino acid corresponding to position 381 substituted with serine; an amino acid corresponding to position 380 of the amino acid sequence of SEQ ID NO: 1 substituted with histidine and an amino acid corresponding to position 381 substituted with alanine; an amino acid corresponding to position 380 of the amino acid sequence of SEQ ID NO: 1 substituted with glycine and an amino acid corresponding to position 381 substituted with phenylalanine; The amino acid corresponding to position 380 of the amino acid sequence of SEQ ID NO: 1 is replaced with glycine and the amino acid corresponding to position 381 is replaced with asparagine; The amino acid corresponding to position 380 of the amino acid sequence of SEQ ID NO: 1 is replaced with glycine and the amino acid corresponding to position 381 is replaced with serine; The amino acid corresponding to position 380 of the amino acid sequence of SEQ ID NO: 1 is replaced with glycine and the amino acid corresponding to position 381 is replaced with alanine; The amino acid corresponding to position 380 of the amino acid sequence of SEQ ID NO: 1 is replaced with threonine and the amino acid corresponding to position 381 is replaced with phenylalanine; The amino acid corresponding to position 380 of the amino acid sequence of SEQ ID NO: 1 is replaced with threonine and the amino acid corresponding to position 381 is replaced with asparagine; The amino acid corresponding to position 380 of the amino acid sequence of SEQ ID NO: 1 is replaced with threonine and the amino acid corresponding to position 381 is replaced with serine;The amino acid corresponding to position 380 of the amino acid sequence of SEQ ID NO: 1 is replaced with threonine and the amino acid corresponding to position 381 is replaced with alanine; the amino acid corresponding to position 380 of the amino acid sequence of SEQ ID NO: 1 is replaced with alanine and the amino acid corresponding to position 381 is replaced with phenylalanine; the amino acid corresponding to position 380 of the amino acid sequence of SEQ ID NO: 1 is replaced with alanine and the amino acid corresponding to position 381 is replaced with asparagine; the amino acid corresponding to position 380 of the amino acid sequence of SEQ ID NO: 1 is replaced with alanine and the amino acid corresponding to position 381 is replaced with serine; the amino acid corresponding to position 380 of the amino acid sequence of SEQ ID NO: 1 is replaced with alanine and the amino acid corresponding to position 381 is replaced with alanine; the amino acid corresponding to position 208 of the amino acid sequence of SEQ ID NO: 1 is replaced with alanine, the amino acid corresponding to position 380 is replaced with alanine, and the amino acid corresponding to position 381 is replaced with alanine; The amino acid corresponding to position 208 of the amino acid sequence of SEQ ID NO: 1 is replaced with alanine, the amino acid corresponding to position 380 is replaced with threonine, and the amino acid corresponding to position 381 is replaced with phenylalanine; the amino acid corresponding to position 208 of the amino acid sequence of SEQ ID NO: 1 is replaced with alanine, the amino acid corresponding to position 380 is replaced with threonine, and the amino acid corresponding to position 381 is replaced with serine; the amino acid corresponding to position 92 of the amino acid sequence of SEQ ID NO: 1 is replaced with tryptophan, the amino acid corresponding to position 380 is replaced with alanine, and the amino acid corresponding to position 381 is replaced with alanine; the amino acid corresponding to position 92 is replaced with tryptophan, the amino acid corresponding to position 380 is replaced with threonine, and the amino acid corresponding to position 381 is replaced with phenylalanine;The amino acid corresponding to position 92 is replaced with tryptophan, the amino acid corresponding to position 380 is replaced with threonine, and the amino acid corresponding to position 381 is replaced with serine; the amino acid corresponding to position 92 of the amino acid sequence of SEQ ID NO: 1 is replaced with tryptophan and the amino acid corresponding to position 208 is replaced with alanine; the amino acid corresponding to position 92 of the amino acid sequence of SEQ ID NO: 1 is replaced with tryptophan, the amino acid corresponding to position 208 is replaced with alanine, the amino acid corresponding to position 380 is replaced with alanine, and the amino acid corresponding to position 381 is replaced with alanine; the amino acid corresponding to position 92 is replaced with tryptophan, the amino acid corresponding to position 208 is replaced with alanine, the amino acid corresponding to position 380 is replaced with threonine, and the amino acid corresponding to position 381 is replaced with phenylalanine; Alternatively, the amino acid corresponding to position 92 may be substituted with tryptophan, the amino acid corresponding to position 208 may be substituted with alanine, the amino acid corresponding to position 380 may be substituted with threonine, and the amino acid corresponding to position 381 may be substituted with serine, but is not limited thereto.;

[0085]

[0086] In one embodiment of the above-described implementation example, the mutant polypeptide may be composed of an amino acid sequence of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, or SEQ ID NO: 73.

[0087] Specifically, the variant polypeptide of the present application may have, comprise, consist of, or consist essentially of an amino acid sequence having at least 70%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with the above sequence number.

[0088] As an example of an embodiment, among the mutant polypeptides of the present application, those in which the 92nd amino acid of the amino acid sequence of SEQ ID NO. 1 is single-substituted with tryptophan are SEQ ID NO. 3; those in which the 208th amino acid of the amino acid sequence of SEQ ID NO. 1 is single-substituted with alanine and methionine are SEQ ID NO. 5 and SEQ ID NO. 7, respectively; those in which the 380th amino acid of the amino acid sequence of SEQ ID NO. 1 is single-substituted with histidine, threonine, and alanine are SEQ ID NO. 9, SEQ ID NO. 11, and SEQ ID NO. 13, respectively; those in which the 381st amino acid of the amino acid sequence of SEQ ID NO. 1 is single-substituted with phenylalanine, serine, alanine, and asparagine are SEQ ID NO. 15, SEQ ID NO. 17, SEQ ID NO. 19, and SEQ ID NO. 21, respectively; The amino acid sequence of SEQ ID NO: 1, wherein the 380th amino acid is substituted with histidine and the corresponding amino acid at position 381 is double substituted with phenylalanine, asparagine, serine, and alanine, is SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, and SEQ ID NO: 29, respectively; The amino acid sequence of SEQ ID NO: 1, wherein the 380th amino acid is substituted with glycine and the corresponding amino acid at position 381 is double substituted with phenylalanine, asparagine, serine, and alanine, is SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, and SEQ ID NO: 37, respectively; The amino acid sequence of SEQ ID NO: 1, wherein the 380th amino acid is substituted with threonine and the corresponding amino acid at position 381 is double substituted with phenylalanine, asparagine, serine, and alanine, is SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, and SEQ ID NO: 45, respectively; The amino acid sequence of SEQ ID NO: 1, in which the 380th amino acid is substituted with alanine and the corresponding amino acid at the 381st position is double substituted with phenylalanine, asparagine, serine, and alanine, is SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, and SEQ ID NO: 53, respectively;A sequence in which the 208th amino acid of the amino acid sequence of SEQ ID NO: 1 is replaced with alanine, the 380th amino acid is replaced with alanine, and the 381st amino acid is replaced with alanine is SEQ ID NO: 55; A sequence in which the 208th amino acid of the amino acid sequence of SEQ ID NO: 1 is replaced with alanine, the 380th amino acid is replaced with threonine, and the 381st amino acid is replaced with phenylalanine is SEQ ID NO: 57; A sequence in which the 208th amino acid of the amino acid sequence of SEQ ID NO: 1 is replaced with alanine, the 380th amino acid is replaced with threonine, and the 381st amino acid is replaced with serine is SEQ ID NO: 59; A sequence in which the 92nd amino acid of the amino acid sequence of SEQ ID NO: 1 is replaced with tryptophan, the 380th amino acid is replaced with alanine, and the 381st amino acid is replaced with alanine is SEQ ID NO: 61; A sequence in which the 92nd amino acid of the amino acid sequence of SEQ ID NO: 1 is replaced with tryptophan, the 380th amino acid is replaced with threonine, and the 381st amino acid is replaced with phenylalanine is SEQ ID NO: 63; A sequence in which the 92nd amino acid of the amino acid sequence of SEQ ID NO: 1 is replaced with tryptophan, the 380th amino acid is replaced with threonine, and the 381st amino acid is replaced with serine is SEQ ID NO: 65; A sequence in which the 92nd amino acid of the amino acid sequence of SEQ ID NO: 1 is replaced with tryptophan and the 208th amino acid is replaced with alanine is SEQ ID NO: 67; A sequence in which the 92nd amino acid of the amino acid sequence of SEQ ID NO: 1 is replaced with tryptophan and the 208th, 380th, and 381st amino acids are replaced with alanine is SEQ ID NO: 69; The amino acid sequence of SEQ ID NO: 1 in which the 92nd amino acid is substituted with tryptophan, the 208th amino acid is substituted with alanine, the 380th amino acid is substituted with threonine, and the 381st amino acid is substituted with phenylalanine is SEQ ID NO: 71;And the amino acid sequence of SEQ ID NO: 1 in which the 92nd amino acid is substituted with tryptophan, the 208th amino acid is substituted with alanine, the 380th amino acid is substituted with threonine, and the 381st amino acid is substituted with serine may be SEQ ID NO: 73, but is not limited thereto.;

[0089]

[0090] As an example of one embodiment, the variant polypeptide of the present application may include one or more of the following: a substitution of tyrosine, an amino acid corresponding to position 92 of the amino acid sequence of SEQ ID NO: 1, with tryptophan; a substitution of tyrosine, an amino acid corresponding to position 208, with alanine or methionine; a substitution of phenylalanine, an amino acid corresponding to position 380, with histidine, threonine, or alanine; and a substitution of glycine, an amino acid corresponding to position 381, with phenylalanine, serine, alanine, or asparagine.

[0091] In one embodiment of the above-described embodiment, the mutant polypeptide may further include, but is not limited to, a substitution of tyrosine, an amino acid corresponding to position 92 of the amino acid sequence of SEQ ID NO: 1, with tryptophan; a substitution of tyrosine, an amino acid corresponding to position 208, with alanine or methionine; and a substitution of glycine, an amino acid corresponding to position 381, with phenylalanine, serine, alanine, or asparagine, while further including a substitution of phenylalanine, an amino acid corresponding to position 380 of the amino acid sequence of SEQ ID NO: 1, with glycine.

[0092]

[0093] Another aspect of the present application provides a polynucleotide encoding a variant polypeptide of the present application.

[0094] In this application, the term "polynucleotide" means a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain, a DNA or RNA strand of a certain length or longer, and more specifically, a polynucleotide fragment encoding the mutant polypeptide.

[0095] The polynucleotide of the present application may include, without limitation, a polynucleotide sequence encoding a variant polypeptide of the present application. The polynucleotide may be prepared based on codon information known in the art, but is not limited thereto. For example, it may include a base sequence encoding an amino acid sequence set forth in any one or more of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, and SEQ ID NO: 73. For example, the polynucleotide of the present application has or includes one or more sequences of SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44 or SEQ ID NO: 128, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, and SEQ ID NO: 74, It can be made up of, or essentially consisting of.

[0096] The polynucleotide of the present application may undergo various modifications in the coding region without altering the amino acid sequence of the variant polypeptide of the present application, due to codon degeneracy or in consideration of the codons preferred by the organism intended to express the variant polypeptide of the present application. Accordingly, it is self-evident that the polynucleotide of the present application may also include a polynucleotide that can be translated into a polypeptide comprising the amino acid sequence of the variant polypeptide of the present application or a polypeptide having homology or identity therewith due to codon degeneracy. For example, the polynucleotide of the present application may have a base sequence of SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44 or SEQ ID NO: 128, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, or SEQ ID NO: 74 or a degenerated sequence thereof. sequence). For example, SEQ ID NO: 2 and SEQ ID NO: 44 may be codon optimized for microorganisms of the genus Corynebacterium, and SEQ ID NO: 127 and SEQ ID NO: 128 may be codon optimized for microorganisms of the genus Escherichia (e.g., Escherichia coli).

[0097] As another example, the polynucleotide of the present application has homology or identity with any one or more of the sequences of SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44 or SEQ ID NO: 128, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, and SEQ ID NO: 74. It may have, comprise, consist essentially of, or consist of a base sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but is not limited thereto.

[0098] For example, the polynucleotide of the present application may include a base sequence in which at least one of the following is fixed: a codon encoding an amino acid corresponding to position 92 of SEQ ID NO: 1 is fixed to one of the codons encoding tryptophan; a codon encoding an amino acid corresponding to position 208 is fixed to one of the codons encoding alanine or methionine; a codon encoding an amino acid corresponding to position 380 is fixed to one of the codons encoding histidine, threonine, or alanine; and a codon encoding an amino acid corresponding to position 381 is fixed to one of the codons encoding phenylalanine, serine, alanine, or asparagine.

[0099] As an example of one implementation, the polynucleotide sequence encoding SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, and SEQ ID NO: 73 is SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8 ... 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44 or SEQ ID NO: 128 (both sequences can encode SEQ ID NO: 43), SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, and SEQ ID NO: 74, but are not limited thereto.

[0100]

[0101] Additionally, the polynucleotide of the present application can hybridize under stringent conditions with a probe that can be prepared from a known genetic sequence, for example, a complementary sequence to all or part of the polynucleotide sequence of the present application, and may include, without limitation, a sequence encoding a variant polypeptide of the present application. Stringent conditions are as described above.

[0102]

[0103] In this application, the terms "identity" or "homology" refer to the degree of similarity between two given amino acid or base sequences, which may be expressed as a percentage. In this application, "homology" and "identity" may often be used interchangeably.

[0104] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, which may be used in conjunction with default gap penalties established by the program being used.

[0105] Whether any two polynucleotide or polypeptide sequences are homologous, similar or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example, as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) or the GAP computer program such as the Smith-Waterman algorithm (Smith and Waterman, Adv. Appl. Math (1981) 2:482) can be determined by comparing the sequence information (GCG program package (Devereux, J.,et al., Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO et al.](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW from the National Center for Biotechnology Information database.

[0106]

[0107] Additionally, whether any two polynucleotide sequences have homology, similarity or identity can be determined by a Southern hybridization experiment under appropriate hybridization conditions, which can be determined by methods well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual; F. M. Ausubelet al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York), but are not limited thereto. For example, homologous or identical polynucleotide sequences can generally hybridize along the entire sequence or at least about 50%, 60%, 70%, 80% or 90% of the entire length under stringent conditions.

[0108] In this application, the term "stringent conditions" refers to conditions that allow specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8). For example, it may be a condition in which polynucleotides having high homology or identity hybridize with each other, polynucleotides having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity hybridize with each other, and polynucleotides having lower homology or identity do not hybridize with each other, or a condition in which washing is performed once, specifically twice or three times, at a salt concentration and temperature equivalent to 60°C, 1ХSSC, 0.1% SDS, specifically 60°C, 0.1ХSSC, 0.1% SDS, and more specifically 68°C, 0.1ХSSC, 0.1% SDS, which is a washing condition of a typical southern hybridization.

[0109] The above hybridization can occur between nucleotides having complementary base sequences; however, the hybridized polynucleotides may contain some mismatches between bases, depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Accordingly, the polynucleotides of the present application may include isolated nucleic acid fragments that are complementary in their entirety, as well as substantially similar base sequences.

[0110] For example, a polynucleotide having homology or identity with the polynucleotide of the present application can be hybridized and detected at a Tm value of 55°C. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C and can be appropriately adjusted by a person skilled in the art.

[0111] The appropriate stringency for hybridizing the polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables which are well known in the art (e.g., J. Sambrooket al., supra).

[0112]

[0113] Another aspect of the present application provides a vector comprising the polynucleotide of the present application. The vector may be, but is not limited to, an expression vector for expressing the polynucleotide in a microorganism.

[0114] The term "vector" as used in this application means a DNA preparation for delivering a desired polynucleotide into a suitable host or host cell.

[0115] For example, the vector may comprise a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (regulatory sequence) so as to enable expression of the target polypeptide in a suitable host. The expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. The vector may be transformed into a suitable host cell (microorganism) and replicate or function independently of the host genome, or may be integrated into the genome itself and replicate or function.

[0116] Additionally, as an example, the vector of the present application may include a sequence for inserting a target polynucleotide into a chromosome. Insertion of the polynucleotide into the chromosome using the vector may be accomplished by any method known in the art, such as, but not limited to, homologous recombination.

[0117] The vector used in the present application is not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ series, pDC series, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors. For example, pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pCES208, pET-28a vectors, etc. can be used.

[0118] The above vector may further include a selection marker to determine whether the vector is transformed into a host cell or further, whether the vector is integrated into a chromosome within the host cell. The selection marker is used to select cells transformed with the vector or to determine whether the target polynucleotide is integrated into the chromosome. Markers that confer selectable phenotypes such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of surface polypeptides may be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic characteristics, thereby enabling selection of transformed cells.

[0119] The term "transformation" in this application refers to changing the genetic characteristics of a host cell (including a microorganism) by introducing a target polynucleotide, or a vector containing the same, into the host cell. The transformed polynucleotide may be inserted into the chromosome of the host cell or located extrachromosomally. In addition, the polynucleotide may comprise DNA or RNA. The polynucleotide may be introduced in an appropriate form depending on the purpose of introduction. For example, a polynucleotide for expressing a target polypeptide may be introduced into a host cell (microorganism) in the form of an expression cassette, which is a genetic construct containing all elements necessary for autonomous expression. The expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, all of which are operably linked to the coding sequence of the target polypeptide. The expression cassette may be in the form of an expression vector capable of self-replication. Additionally, the polynucleotide may be introduced into a host cell (microorganism) in its own form and operably linked to a sequence required for expression in the host cell (microorganism), but is not limited thereto.

[0120] As used herein, the term "operably linked" refers to a configuration in which a regulatory sequence is positioned appropriately so that the regulatory sequence controls the expression of a coding sequence. Therefore, "operably linked" includes a regulatory region of a functional domain with a known or desired activity, such as a promoter, terminator, signal sequence, or enhancer region, attached or linked to a target (gene or polypeptide) so that the target's expression, secretion, or function can be controlled according to the known or desired activity. For example, it may mean that a promoter sequence that initiates and mediates the transcription of a polynucleotide encoding a polypeptide is functionally linked to the polynucleotide sequence.

[0121]

[0122] In this application, the term "genetic recombination" means a natural or artificial process in which elements that make up genes, such as DNA or RNA, are changed from their original sequence during the disassembly and reassembly process.

[0123] As used herein, the term "recombinant gene" refers to a gene with a novel genetic structure resulting from genetic recombination, such as chemical synthesis or genetic engineering techniques. The terms "recombinant gene," "recombinant DNA," and "recombinant polynucleotide" may be used interchangeably in this application. For example, the recombinant gene may include an artificial combination of nucleic acid fragments, such as regulatory sequences, that are not found together in nature.

[0124]

[0125] Another aspect of the present application provides a microorganism comprising at least one of a variant polypeptide of the present application, a polynucleotide encoding the variant polypeptide, and a vector comprising the polynucleotide.

[0126] The above mutant polypeptides, polynucleotides, and vectors are as described in other aspects.

[0127] In this application, the term "microorganism (or strain)" includes both wild-type microorganisms and prokaryotic or eukaryotic microorganisms that have undergone genetic modification, either naturally or artificially. It may be a microorganism that has a specific mechanism weakened or increased due to a cause such as the insertion of an external gene or the increased or inactivated activity of an endogenous gene, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein, or product. In this application, the terms "microorganism," "strain," "host," and "host cell" may be used interchangeably.

[0128] As used herein, the term "recombinant microorganism" refers to a microorganism that has been genetically modified to exhibit a different genotype and / or phenotype compared to a naturally occurring microorganism (e.g., when the genetic modification affects the coding base sequence of the microorganism), and may include all progeny or potential progeny of the microorganism. The terms "recombinant microorganism," "genetically modified microorganism," "recombinant host cell," "recombinant cell," and "recombinant strain" may be used interchangeably in this application.

[0129] For example, the microorganism of the present application may be, but is not limited to, a microorganism modified to express the variant polypeptide of the present application or a recombinant microorganism having the activity of the variant polypeptide of the present application.

[0130]

[0131] As an example of implementation, the microorganism of the present application may have the ability to produce at least one of rebaudioside D and rebaudioside M.

[0132] In the present application, the term "microorganism having the ability to produce at least one of rebaudioside D and rebaudioside M" refers to a prokaryotic or eukaryotic microorganism capable of producing rebaudioside D and / or M within the organism, and the microorganism may include not only a microorganism that inherently has the ability to produce rebaudioside D and / or M, but also a microorganism that does not inherently have the ability to produce it but is endowed with the ability. The ability to produce rebaudioside D and / or M may be endowed or enhanced by expression of the mutant polypeptide of the present application or by species improvement. The microorganism having the ability to produce at least one of rebaudioside D and rebaudioside M may be used interchangeably with "a microorganism having the ability to produce rebaudioside D" and "a microorganism having the ability to produce rebaudioside M", "a microorganism having the ability to produce rebaudioside D or M", and "a microorganism having the ability to produce rebaudioside D and M".

[0133] In this application, the term "unmodified microorganism" does not exclude microorganisms that contain mutations that can occur naturally, and may refer to wild-type microorganisms or natural microorganisms themselves, or microorganisms before their phenotypes are changed by genetic mutations caused by natural or artificial factors. In this application, the term "unmodified microorganism" may be used interchangeably with "pre-modified microorganism," "unmodified microorganism," "parent microorganism," "parent strain," "wild-type microorganism," "reference microorganism," or "reference microorganism." In this application, the unmodified microorganism may refer to a microorganism into which the mutant polypeptide of the present application is not introduced or before it is introduced; or a microorganism comprising a wild-type polypeptide, but is not limited thereto. In addition, the unmodified microorganism in this application may be a microorganism comprising a polypeptide consisting of SEQ ID NO: 1 or a polynucleotide encoding the same (for example, a polynucleotide consisting of SEQ ID NO: 2), but is not limited thereto.

[0134] For example, the microorganism of the present application includes, but is not limited to, a microorganism in which a gene on a chromosome encoding a polypeptide comprising the parent sequence of the present application is mutated to include a variant polypeptide sequence of the present application; and / or a microorganism in which a vector containing a polynucleotide encoding the variant polypeptide of the present application is introduced to include a variant polypeptide of the present application.

[0135] The microorganism of the present application may include any microorganism capable of producing at least one of rebaudioside D and rebaudioside M, including at least one of the variant polypeptide of the present application; a polynucleotide encoding the variant polypeptide; and a vector comprising the polynucleotide. For example, the microorganism of the present application may be a microorganism that has been transformed with a vector comprising a polynucleotide encoding the variant polypeptide of the present application, thereby expressing the variant polypeptide of the present application, thereby increasing the production ability of rebaudioside D and / or M, but is not limited thereto.

[0136] The microorganism having an increased ability to produce at least one of the above rebaudioside D and rebaudioside M may be a microorganism having an increased ability to produce rebaudioside D and / or M compared to a natural wild-type microorganism or an unmodified microorganism (e.g., a microorganism expressing a wild-type polypeptide or a polypeptide including a parent sequence; or a microorganism not expressing the modified polypeptide of the present application), but is not limited thereto.

[0137] For example, the microorganism having increased production ability of any one or more of rebaudioside D and rebaudioside M of the present application may be a microorganism having increased production ability of rebaudioside D and / or M compared to a parent microorganism (parent strain) before mutation or a non-modified microorganism (e.g., a wild-type polypeptide, a polypeptide including the parent sequence; or a microorganism expressing the polypeptide of SEQ ID NO: 1; or a microorganism that does not express the mutant polypeptide of the present application), but is not limited thereto. For example, the parent microorganism (parent strain) before mutation or the non-modified microorganism for which the increase in production ability is compared may be Corynebacterium ammoniagenes ATCC6872, but is not limited thereto.

[0138] For example, the microorganism with increased productivity may have an increase of about 1% or more, specifically about 5% or more, about 10% or more, about 20% or more, about 30% or more, about 50% or more, about 70% or more, about 90% or more, or about 100% or more (the upper limit is not particularly limited and may be, for example, about 500% or less) compared to the productivity of the parent microorganism (parent strain) or the non-transformed microorganism before mutation, but is not limited thereto as long as it has a positive increase compared to the productivity of the parent microorganism (parent strain) or the non-transformed microorganism before mutation. In another example, the recombinant microorganism with increased productivity may have an increased productivity of about 1.1 times or more, about 1.15 times or more, about 1.2 times or more, about 1.3 times or more, about 1.5 times or more, about 1.7 times or more, about 1.9 times or more, or about 2.0 times or more (the upper limit is not particularly limited and may be, for example, about 10 times or less) compared to the parent microorganism (parent strain) before mutation or the unmodified microorganism, but is not limited thereto.

[0139]

[0140] For example, the microorganism of the present application may be either a prokaryotic cell or a eukaryotic cell, but may specifically be a prokaryotic cell. The prokaryotic cell may include, but is not limited to, a microorganism belonging to the genus Escherichia sp., Erwinia sp., Serratia sp., Providencia sp., Corynebacterium sp., Pseudomonas sp., Leptospirasp., Salmonella sp., Brevibacteria sp., Hypomononas sp., Chromobacterium sp., and Norcardia sp., fungi, or yeast. Specifically, it may be a microorganism of the genus Escherichia, the genus Corynebacterium, the genus Leptospira, or a yeast. More specifically, it may be a microorganism of the genus Corynebacterium or the genus Escherichia.

[0141] As a microorganism according to any one of the preceding specific examples, the microorganism of the genus Corynebacterium of the present application is Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes ammoniagenes), Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris or Corynebacterium flavescens.

[0142] Specifically, the microorganism of the present application may be, but is not limited to, Corynebacterium ammoniagenes, Corynebacterium glutamicum or Escherichia coli.

[0143]

[0144] As an example of implementation, the microorganism having the ability to produce rebaudioside D and / or M of the present application may further comprise one or more of a UGT-A polypeptide, a polynucleotide encoding the same, and a vector comprising the same. The polypeptide and polynucleotide may be wild type or mutant, but as long as the polypeptide has UGT-A activity, it may be included without limitation in its type.

[0145] Specifically, the UGT-A of the present application may have, comprise, consist of, or consist essentially of the amino acid sequence of SEQ ID NO: 129; or an amino acid sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity thereto.

[0146] Specifically, the polynucleotide encoding UGT-A of the present application may have, comprise, consist of, or consist essentially of a polynucleotide sequence having SEQ ID NO: 130; or a polynucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity thereto.

[0147] As an example of implementation, the microorganism having the ability to produce rebaudioside D and / or M of the present application may further comprise one or more of a sucrose synthase, a polynucleotide encoding the same, and a vector including the same.

[0148] Specifically, the sucrose synthase of the present application may have, comprise, consist of, or consist essentially of the amino acid sequence of SEQ ID NO: 131; or an amino acid sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity thereto.

[0149] Specifically, the polynucleotide encoding the sucrose synthase of the present application may have, include, consist of, or consist essentially of the polynucleotide sequence of SEQ ID NO: 132; or a polynucleotide sequence having at least 70%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity thereto.

[0150]

[0151] Another aspect of the present application provides a method for producing a steviol glycoside, comprising the step of culturing a microorganism comprising at least one of a variant polypeptide of the present application, a polynucleotide encoding the variant polypeptide, and a vector comprising the polynucleotide in a medium.

[0152] Specifically, the steviol glycoside is at least one of rebaudioside D and rebaudioside M.

[0153] The above mutant polypeptides, polynucleotides, vectors, and microorganisms are as described in other aspects.

[0154] In this application, the term "cultivation" refers to the growth of microorganisms under appropriately controlled environmental conditions. The cultivation process can be conducted using appropriate media and culture conditions known in the art. This cultivation process can be easily adjusted and used by those skilled in the art depending on the selected microorganism. Specifically, the cultivation process may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0155] In this application, the term "medium" refers to a material containing nutrients necessary for culturing microorganisms as its main component, and supplies nutrients and growth factors, including water, which is essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganisms of this application may be any medium used for culturing conventional microorganisms without particular limitation. For example, the microorganisms of this application may be cultured under aerobic conditions by controlling temperature, pH, etc. in a conventional medium containing appropriate carbon sources, nitrogen sources, phosphorus sources, inorganic compounds, amino acids, and / or vitamins. For example, culture media for microorganisms of the genus Corynebacterium can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981)].

[0156] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted to reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

[0157] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc.; peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

[0158] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.

[0159] In addition, during the cultivation of the microorganism of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during the cultivation, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. In addition, to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection, but is not limited thereto.

[0160] In one implementation example, the microbial medium of the present application may include a substrate for the synthesis of rebaudioside D and / or rebaudioside M. The medium may include at least one of rebaudioside A, rebaudioside D, stevioside, a glucose-linked nucleotide diphosphate, sucrose, and a nucleotide diphosphate. Specifically, the medium for producing rebaudioside D may include rebaudioside A and a glucose-linked nucleotide diphosphate; rebaudioside A, sucrose, and a nucleotide diphosphate; or rebaudioside A, a glucose-linked nucleotide diphosphate, sucrose, and a nucleotide diphosphate. Stevioside and a glucose-linked nucleotide diphosphate may be included instead of or in addition to rebaudioside A, and sucrose and a nucleotide diphosphate may be included instead of or in addition to the glucose-linked nucleotide diphosphate. The above medium for producing rebaudioside M may include rebaudioside D and a nucleotide diphosphate combined with glucose; or rebaudioside D, sucrose, and a nucleotide diphosphate; and a medium for producing rebaudioside D may be included instead of the rebaudioside D. In one embodiment, the nucleotide diphosphate may be, but is not limited to, uridine diphosphate.

[0161]

[0162] In the culture of the present application, the culture temperature can be maintained at 20 to 45°C, specifically 25 to 40°C, and the culture can be performed for about 10 to 160 hours, but is not limited thereto.

[0163] In the present application, the term "culture" means a culture solution, concentrated culture solution, dried product of culture solution, culture filtrate, concentrated culture filtrate, or dried product of culture filtrate obtained by culturing a specific microorganism in a culture medium, wherein the culture solution means that it contains a specific microorganism, and the culture filtrate means that it does not substantially contain a specific microorganism (here, substantially means that a specific microorganism separated by filtration or the like is excluded, but does not mean that the filtrate is completely free of microorganisms). The culture is not limited in its formulation, and may be, for example, a liquid, an emulsion, or a solid.

[0164] In this application, the term "fermentation" refers to a process in which microorganisms use their enzymes to decompose organic matter, but not to a putrefaction reaction. While fermentation and putrefaction occur through similar processes, if the resulting decomposition produces useful substances, it is called fermentation. If the resulting decomposition produces foul-smelling or harmful substances, it is called putrefaction.

[0165] In the present application, the method for obtaining a fermented product from the microorganism is not particularly limited, and the product can be obtained according to a method commonly used in the relevant technical field or a similar field.

[0166] In the present application, the term "fermentation" includes all kinds of substances including a fermentation product produced from the microorganism, such as not only the fermented substance itself, but also a substance containing a fermented microorganism, a culture produced from the fermented microorganism, a fermentation product of the culture, a concentrated fermentation product, a dried product of the fermentation product, a filtrate of the fermentation product, a concentrated filtrate of the fermentation product, or a dried product of the fermentation product filtrate, an extract of the fermentation product, or a dilution of the fermentation product.

[0167] In the method of the present application, any culture conditions and methods known in the art can be used to cultivate microorganisms. Those skilled in the art can easily adjust and use these culture processes depending on the selected microorganism.

[0168] Rebaudioside D and / or M produced by the culture of the present application may be secreted into the medium or remain within the cells.

[0169]

[0170] Another aspect of the present application provides a method for producing a steviol glycoside comprising the step of reacting a nucleotide diphosphate having a glucose linkage with rebaudioside A in the presence of a variant polypeptide of the present application and / or a microorganism of the present application to transfer glucose to rebaudioside A.

[0171] The above steviol glycoside may be at least one of rebaudioside D and rebaudioside M.

[0172] The above mutant polypeptide may be contained in the microorganism of the present application or obtained (e.g., purified) therefrom; and the reaction step may include a step of culturing a microorganism comprising at least one of the mutant polypeptide, a polynucleotide encoding the mutant polypeptide, and a vector comprising the polynucleotide in a medium containing a glucose-linked nucleotide diphosphate and rebaudioside A.

[0173] The above mutant polypeptide, polynucleotide, vector, microorganism, culture, and medium are as described in other aspects.

[0174] As an example of implementation, the method for producing the steviol glycoside may further include, but is not limited to, a step of reacting sucrose and nucleotide diphosphate in the presence of sucrose synthase to produce a glucose-linked nucleotide diphosphate.

[0175] In the present application, the term "sucrose synthase" may be responsible for the role of producing sucrose by reversibly transferring glucose bound to nucleotide diphosphate to fructose in plant metabolism, and in the present application, may exhibit the activity of reacting sucrose and nucleotide diphosphate (for example, in a pH range of 5 to 10) to separate glucose bound to nucleotide diphosphate and fructose.

[0176] The above sucrose can be used without limitation as long as it can act as a substrate for sucrose synthase to provide glucose to nucleotide diphosphate, and for example, raw sugar or table sugar can be used, but is not limited thereto.

[0177] In the present application, the nucleotide diphosphate may be a purine nucleotide or a pyrimidine nucleotide, and specifically, uridine diphosphate (UDP) may be used, but is not limited thereto.

[0178]

[0179] As an example of an embodiment, the method for producing the steviol glycoside may further include a step of producing rebaudioside A by reacting a nucleotide diphosphate linked to glucose with stevioside in the presence of a microorganism comprising at least one of saccharin-containing glycosyltransferase A (UGT-A); and / or saccharin-containing glycosyltransferase A, a polynucleotide encoding the same, and a vector comprising the same.

[0180] As one embodiment of the above-described embodiment, the step of producing the rebaudioside A may be, but is not limited to, a step of culturing a microorganism including at least one of a glycosyltransferase A (UGT-A) polypeptide, a polynucleotide encoding the same, and a vector including the same.

[0181] In one embodiment of the above-described embodiment, the glycosyltransferase A (UGT-A) may be a glycosyltransferase derived from Oryza sativa, Stevia rebaudiana Bertoni, Bambusa oldhamii, Brachypodium distachyon, Hordeum vulgare, Sorghum bicolor, Zea mays, Arabidopsis thaliana, but is not limited thereto. The glycosyltransferase A (UGT-A) is not limited in source as long as it has the activity of glycosyltransferase A (UGT-A), such as one produced from a recombinant microorganism (e.g., Escherichia coli, Bacillus, yeast, Corynebacterium, or Agrobacterium) transformed with a polynucleotide containing a glycosyltransferase gene and / or a vector containing the same, one obtained (e.g., purified) after production from the microorganism, one known, one commercially available, etc.

[0182] As an example of an embodiment, the method for producing the steviol glycoside and / or the step of producing rebaudioside A (or the method for producing rebaudioside A) may further include, but is not limited to, a step of reacting sucrose and nucleotide diphosphate in the presence of sucrose synthase to produce a glucose-linked nucleotide diphosphate.

[0183] As an example of implementation, the production of rebaudioside A, D, and / or M may be performed continuously or discontinuously in the same reaction system, and may be performed in a one-pot manner, but is not limited thereto.

[0184] As an example of an embodiment, the method for producing the steviol glycoside may further include a step of producing rebaudioside M by reacting rebaudioside D with a nucleotide diphosphate linked to glucose in the presence of a microorganism comprising at least one of saccharin transferase A (UGT-A); and / or saccharin transferase A, a polynucleotide encoding the same, and a vector comprising the same.

[0185]

[0186] In one specific example, the method for producing a steviol glycoside of the present application may further comprise, for example, prior to the culturing step, a step of preparing a microorganism of the present application, a step of preparing a medium for culturing the microorganism, or a combination thereof (in any order).

[0187] The production method of the present application may further include a step of recovering one or more of rebaudioside D and rebaudioside M from the cultured microorganism, the culture of the microorganism, the fermented product of the microorganism, the culture medium, or the reaction solution in which the enzymatic reaction has occurred. The recovering step may be additionally included after the culturing step.

[0188] The above recovery may be performed by collecting at least one of the desired rebaudioside D and rebaudioside M using a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallizing protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and rebaudioside D and / or M may be recovered from a medium, microorganism, or reaction solution using a suitable method known in the art.

[0189] Additionally, the method for producing steviol glycosides of the present application may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, when the method for producing steviol glycosides of the present application includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, regardless of the order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.

[0190]

[0191] Another aspect of the present application provides a method for producing rebaudioside D, comprising the step of reacting a glucose-linked nucleotide diphosphate with rebaudioside A in the presence of a mutant polypeptide of the present application and / or a microorganism of the present application to produce rebaudioside D.

[0192] The method for producing the above rebaudioside D may include the method (step) for producing rebaudioside A provided in the above-described embodiment, and the above-described saccharoside A (UGT-A) is as described in the other embodiment.

[0193] As an example of implementation, the method for producing rebaudioside D may further include a step of recovering rebaudioside D.

[0194] As an example of implementation, the production of rebaudioside A and / or D may be performed continuously or discontinuously in the same reaction system, but is not limited thereto.

[0195]

[0196] Another aspect of the present application provides a method for producing rebaudioside M, comprising the step of producing rebaudioside M by reacting rebaudioside D with a nucleotide diphosphate linked to glucose in the presence of a microorganism comprising at least one of a glycosyltransferase A (UGT-A); and / or the glycosyltransferase A, a polynucleotide encoding the same, and a vector comprising the same.

[0197] The method for producing the above rebaudioside M may include a method (step) for producing rebaudioside A provided in the above-described aspect and / or a method for producing rebaudioside D (step for producing rebaudioside D).

[0198] The method for producing the above rebaudioside A, the method for producing the above rebaudioside D and the saccharotransferase A (UGT-A) are as described in other aspects.

[0199] As an example of implementation, the method for producing rebaudioside M may further include a step of recovering rebaudioside M.

[0200] As an example of implementation, the production of rebaudioside A, D, and / or M may be, but is not limited to, continuous or discontinuous in the same reaction system.

[0201]

[0202] Another aspect of the present application provides a microorganism comprising a variant polypeptide of the present application; a polynucleotide encoding the variant polypeptide; the variant polypeptide, the polynucleotide encoding the variant polypeptide, and a vector comprising the polynucleotide; a culture of the microorganism; or a composition for producing at least one of rebaudioside D and rebaudioside M comprising at least one of these.

[0203] The above mutant polypeptides, polynucleotides, vectors, microorganisms, and cultures are as described in other aspects.

[0204] The composition of the present application may further comprise any suitable excipient commonly used in compositions for producing rebaudioside D and / or M, such excipients may be, for example, but are not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.

[0205] As a specific example, each component present in the composition of the present application may be included in a microbiologically effective amount, or an amount that can be suitably present in the composition for production.

[0206]

[0207] Another aspect of the present application provides a use of the variant polypeptide of the present application or the microorganism of the present application for producing rebaudioside D and / or M. Specifically, the aspect provides a use of the variant polypeptide of the present application, a polynucleotide encoding the variant polypeptide, and a vector comprising the polynucleotide for producing any one or more of rebaudioside D and rebaudioside M by a microorganism.

[0208] The above mutant polypeptides and microorganisms, etc. are as described in other aspects.

[0209]

[0210] Another aspect of the present application provides a use for producing at least one of rebaudioside D and rebaudioside M, comprising a microorganism comprising at least one of the following: a variant polypeptide of the present application; a polynucleotide encoding the variant polypeptide; the variant polypeptide, the polynucleotide encoding the variant polypeptide, and a vector comprising the polynucleotide; a culture of the microorganism; or a composition comprising at least one of them.

[0211] The above mutant polypeptides, polynucleotides, microorganisms, and cultures are as described in other aspects.

[0212]

[0213] The present application will be described in more detail below through examples. However, the following examples are merely preferred embodiments intended to illustrate the present application and are therefore not intended to limit the scope of the present application. Furthermore, technical details not described herein can be readily understood and implemented by those skilled in the technical field of the present application or similar fields.

[0214]

[0215] Example 1. Design and production of improved UGT-B enzyme

[0216] 1-1. Design of an improved UGT-B enzyme

[0217] To increase the activity of the UGT-B enzyme, a total of 26 mutants were designed based on the amino acid sequence of sequence number 1, as shown in Table 1 below.

[0218]

[0219] Name substitutionM1Y92WM2Y208AM3Y208MM4F380HM5F380TM6F380AM7G381FM8G381SM9G381AM10G381N M11F380H-G381FM12F380H-G381NM13F380H-G381SM14F380H-G381AM15F380G-G381FM16F3 80G-G381NM17F380G-G381SM18F380G-G381AM19F380T-G381FM20F380T-G381NM21F380T- G381SM22F380T-G381AM23F380A-G381FM24F380A-G381NM25F380A-G381SM26F380A-G381A

[0220]

[0221] 1-2. Production of improved UGT-B enzyme

[0222] The improved enzymes designed in Example 1-1 were produced by the site-directed mutagenesis method. The site-directed mutagenesis PCR reaction used AccuPower® Pfu PCR premix (Bioneer), 10 ng of template plasmid (E. coli-Corynebacterium shuttle vector pCES208; or pET-28a vector for E. coli expression), and 0.5 μM each of forward and reverse primers (primers as shown in Table 2 below were used depending on the type of improved enzyme). In addition, the above-mentioned PCR was performed using a Mastercycler® X50s (Eppendorf) under the following conditions: pre-denaturation at 94°C for 3 minutes; 20 cycles of denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 1 minute / kb; and final extension at 72°C for 5 minutes.

[0223] Afterwards, the template plasmid was digested using 1 μl DpnI (NEB, R0176L), and 5 μl of the PCR reaction solution was injected into E. coli DH5α strain using the heat-shock method.

[0224] The transformed E. coli strain was cultured in LB medium containing 50 mg / L kanamycin. After colony selection, mutations were confirmed through plasmid DNA sequencing (Bioneer).

[0225] There are two types of plasmid vectors used to produce the improved enzyme. One is the E. coli-Corynebacterium shuttle vector (pCES208), which contains the codon-optimized UGT-B gene sequence (SEQ ID NO: 2) for expression in Corynebacterium strains and is referred to as pCES_UGT-B. The other vector is the pET-28a vector for E. coli expression, which contains the codon-optimized UGT-B gene sequence (SEQ ID NO: 127) for expression in E. coli strains and a 6x his tag for purification. Both vectors contain a kanamycin resistance gene.

[0226]

[0227] NameForward primer sequenceReverse primer sequence서열번호M1GATGTCCCATGGGATAAATTCGAGTTACGAATTTATCCCATGGGACATCGTTGGTTG75,76M2TAGCCGAACGCGCCTTCTTAACTTTAATGCAAGGCGCGTTCGGCTACCGTCATC77.78M3TAGCCGAACGCATGTTCTTAACTTTAATGCGAACATGCGTTCGGCTACCGTCATC79,80M4TATCCACGGTGATCAGGGCCCAAACTGATCACCGTGGATAGGGAGCATCAC81,82M5CTCCCTATCACCGGTGATCAGTCACCGGTGATAGGGAGCATC83,84M6ATGCTCCCTATCGCTGGTGATCAGACCAGCGATAGGGAGCATCACTAAG85,86M7ATCTTCTTTGATCAGGGCCCAAACGATCAAAGAAGATAGGGAGCATCAC87,88M8ATCTTCTCTGATCAGGGCCCAAACGATCAGAGAAGATAGGGAGCATCAC89,90M9TTCGCTGATCAGGGCCCAAACGATCAGCGAAGATAGGGAGCATC91,92M10ATCTTCAATGATCAGGGCCCAAACGATCATTGAAGATAGGGAGCATCAC93,94M11TATCCACTTTGATCAGGGCCCAAACTGATCAAAGTGGATAGGGAGCATCAC95,96M12TATCCACAATGATCAGGGCCCAAACTGATCATTGTGGATAGGGAGCATCAC97,98M13TATCCACTCTGATCAGGGCCCAAACTGATCAGAGTGGATAGGGAGCATCAC99,100M14TATCCACGCTGATCAGGGCCCAAACTGATCAGCGTGGATAGGGAGCATCAC101,102M15TATCGGCTTTGATCAGGGCCCAAACTGATCAAAGCCGATAGGGAGCATCAC103,104M16TATCGGTAATGATCAGGGCCCAAACTGATCATTACCGATAGGGAGCATCAC105,106M17TATCGGTTCTGATCAGGGCCCAAACTGATCAGAACCGATAGGGAGCATCAC107,108M18TATCGGTGCTGATCAGGGCCCAAACTGATCAGCACCGATAGGGAGCATCAC109,110M19TATCACCTTTGATCAGGGCCCCAAA CATCAAAGGTGATAGGGAGCATCAC111,112M20TATCACCAATGATCAGGGCCCAAACGATCATTGGTGATAGGGAGCATCAC113,114M21TATCACCTCTGATCAGGGCCCAAACTGATCAGAGTGATAGGGAGCATCAC115,11 6M22TATCACCGCTGATCAGGGCCCAAACTGATCAGGCGGTGATAGGGAGCATC117,118M23TATCGCTTTTGATCAGGGCCCAAACTGATCAAAAGCGATAGGGAGCATCAC119,120M24TATCGCTAATGATCAGGGCCCAAACTGA TCATTAGCGATAGGGAGCATCAC121,122M25TATCGCTTCTGATCAGGGCCCAAACTGATCAGGAAGCGATAGGGAGCATCAC123,124M26TATCGCTGCTGATCAGGGCCCAAACTGATCAGCAGCGATAGGGAGCATCAC125,126,

[0228]

[0229] Example 2. Production of microorganisms expressing improved enzymes and comparison of the RebD synthesis ability of 26 improved enzymes.

[0230] The 26 improved enzymes produced in Example 1 were expressed in Corynebacterium ammoniagenes (hereinafter, C.amm) and then subjected to a cell reaction to compare the conversion rate from rebaudioside A (hereinafter, RebA) to rebaudioside D (hereinafter, RebD).

[0231] To this end, first, the expression vector for microorganisms of the genus Corynebacterium, which is a plasmid vector produced in Example 1 of the improved enzyme, was inserted into the wild type C. amm strain ATCC6872 using electroporation.

[0232] The C. amm strain transformed with the plasmid vector was cultured on solid medium (80 g / L glucose, 20 g / L soytone, 10 g / L (NH4)2SO4, 1.2 g / L KH2PO4, 1.4 g / L MgSO4, 15 g / L agar) containing 50 μg / ml kanamycin. For expression of the improved enzyme, colonies grown on the solid medium were inoculated into 400 μl Corynebacterium sp. microbial medium (80 g / L glucose, 20 g / L soytone, 10 g / L (NH4)2SO4, 1.2 g / L KH2PO4, 1.4 g / L MgSO4) containing 50 μg / ml kanamycin and precultured in a 96-well plate. This pre-culture was performed for 24 h at 800 rpm at 30 °C using a shaking incubator (Infors HT Multitron Incubator Shaker), and then 10% (v / v) of the total volume of the pre-culture was inoculated into a new Corynebacterium spp. medium (containing 50 μg / ml kanamycin) (glucose 80 g / L, soytone 20 g / L, (NH4)2SO4 10 g / L, KH2PO4 1.2 g / L, MgSO4 1.4 g / L), and cultured under the same conditions for 24 h.

[0233] At this time, for the strain containing each improved enzyme, two colonies were cultured per improved enzyme to confirm reproducibility, and for the strain containing wild-type UGT-B for comparison, four colonies were cultured.

[0234]

[0235] For the enzyme activity test based on the RebD synthesis ability, 200 μl of each culture medium for the strain containing the improved enzyme or wild-type UGT-B was placed in a 96-well plate, centrifuged, and the supernatant was removed. A total of 400 μl of a reaction solution containing 10 mM UDPG (Uridine-5'-diphosphate-glucose; Carbosynth), 10% (w / v) RebA (Daepyung), 0.8% POESA (v / v), and 50 mM potassium phosphate (pH 7.0) was added to the remaining cells, and the reaction was performed at 40 °C for 24 h. The reaction solution was then diluted 1:10 in triple-distilled water, inactivated by enzyme inactivation at 100 °C for 5 min, and pretreated using a filter. The converted RebD was analyzed for the pretreated reaction solution using HPLC (Agilent). HPLC analysis conditions are as follows.

[0236]

[0237] - Detector wavelength: 210 nm

[0238] - Flow rate: 1 ml / min

[0239] - Sample injection volume: 10 ㎕

[0240] - Column: Capcell pak C18 MG II (Shiseido, 250 x 4.6 mm, particle size: 5μm)

[0241] - Solvent: Acetonitrile 30%

[0242]

[0243] The results of the analysis are shown in Figures 1 and 2.

[0244] As a result, as shown in Fig. 1, it was confirmed that all of the produced single mutants (M1, M2, M3, M4, M5, M6, M7, M8, M9, and M10) had superior RebD conversion activity compared to wild-type UGT-B.

[0245] In addition, as shown in Fig. 2, it was confirmed that all double mutants of F380X - G381X (M11 - M26) produced based on the results of single mutant activity had superior activity compared to wild-type UGT-B and each single mutant on which it is based.

[0246]

[0247] Example 3. Comparison of the activities of UGT-B (WT) and improved enzymes

[0248] 3-1. Evaluation of RebD Synthesis Activity of UGT-B Modified Enzyme

[0249] Based on the results of Example 2, 7 types (M1, M2, M14, M19, M20, M21, M26) of improved enzymes with superior activity compared to wild-type UGT-B were selected and their activity toward RebA was evaluated.

[0250] To this end, the recombinant Corynebacterium spp. microorganism produced in Example 2 was inoculated into a medium containing 50 μg / ml of kanamycin at an initial concentration of OD 600 = 0.1, and pre-cultured at 30°C for 24 hours. The resulting culture solution was inoculated with 5 ml of the pre-culture solution into 50 ml of a medium containing 50 μg / ml of kanamycin, and cultured at 30°C for 24 hours to induce enzyme expression. Thereafter, the cells were separated from the culture solution using centrifugation.

[0251] The enzymatic reaction was carried out at 30 °C for 16 hours by mixing 100 mg / ml of Corynebacterium spp. cells in a reaction solution containing 10 mM UDPG (Carbosynth), RebA (Daepyung), 0.8% POESA (v / v), and 50 mM potassium phosphate (pH 7.0). After completion of the enzymatic reaction, the HPLC analysis method was the same as in Example 2, and the conversion rate to RebD compared to wild-type UGT-B is shown in Table 3 below.

[0252]

[0253] Raw materialUGT-BM1M2M14M19M20M21M261 % (w / v) RebA1001501511702181952092103 % (w / v) RebA100187161178248203244244

[0254]

[0255] As shown in Table 3 above, all of the evaluated improved enzymes were confirmed to have a significantly superior conversion rate to RebD compared to wild-type UGT-B.

[0256]

[0257] 3-2. Evaluation of RebDM Synthetic Activity of UGT-B Modified Enzyme (1)

[0258] Using glycosyltransferase UGT-A, sucrose synthase (SS), and glycosyltransferase UGT-B, raw materials such as stevioside can be converted into RebD and rebaudioside M (hereinafter, RebM) using uridine-5'-diphosphate (UDP) and sucrose instead of uridine-5'-diphosphate-glucose (UDPG).

[0259] Accordingly, in this example, a reaction was evaluated to convert the raw material SG90 (Haigen), a mixture of stevioside and RebA, into RebD and RebM using a mixture of a recombinant Corynebacterium microorganism expressing UGT-A and SS and a recombinant Corynebacterium microorganism expressing a UGT-B improving enzyme. To this end, a gene (SEQ ID NO: 130) encoding UGT-A (SEQ ID NO: 129) and a gene (SEQ ID NO: 132) encoding SS (SEQ ID NO: 131) were cloned into an E. coli-Corynebacterium shuttle vector (pCES208). A strain that simultaneously expresses UGT-A and SS was constructed by transforming a Corynebacterium microorganism using the same method as in Example 2, and the vector constructed and used for transformation is referred to as pCES_SS_UGT-A. The method for culturing Corynebacterium microorganisms expressing UGT-B modified enzymes (representatively M20, M21, and M26) for enzyme expression was the same as in Example 3-1.

[0260] The enzymatic reaction was carried out at 30 °C for 24 hours by mixing 100 mg / ml each of UGT-A and SS expressing cells and UGT-B expressing cells in a reaction solution containing 10 mM UDP (Carbosynth), 1% (w / v) SG90 (Haigen), 10% (w / v) 0.8% POESA (v / v), and 50 mM potassium phosphate (pH 8.0). After completion of the enzymatic reaction, the HPLC analysis method was the same as in Example 2, and the conversion rate to a mixture of RebD and RebM (RebDM) compared to wild-type UGT-B is shown in Table 4 below.

[0261]

[0262] Raw material UGT-B (WT) M20 M21 M261% SG90100175192185

[0263]

[0264] As shown in Table 4 above, it was confirmed that the conversion rate of the improved enzyme into a mixture of RebD and RebM was significantly superior to that of the wild-type UGT-B.

[0265]

[0266] Example 4. Comparison of the activities of UGT-B (WT) and the improved complex enzyme.

[0267] Example 4-1. Production of improved UGT-B complex enzyme

[0268] In order to analyze the synergistic effect between mutations of the improved enzyme, which was confirmed to have increased activity compared to UGT-B, combinatorial mutants containing two or more mutations were designed as shown in Table 5 below.

[0269]

[0270] Name replacementMM1Y208A-F380A-G381AMM2Y208A-F380T-G381FMM3Y208A-F380T-G381SMM4Y92W-F380A-G381AMM5Y92W-F380T-G381FMM6 Y92W-F380T-G381SMM7Y92W-Y208AMM8Y92W-Y208A-F380A-G381AMM9Y92W-Y208A-F380T-G381FMM10Y92W-Y208A-F380T-G381S

[0271]

[0272] The designed composite improved enzymes were produced by the site-directed mutagenesis PCR method as in Example 1-2. Specifically, the plasmid containing the sequence of the improved enzyme mutant produced in Example 1-2 was used as a template, and one or two pairs of primers for the additional mutations were used to produce additional remaining mutations by the site-directed mutagenesis PCR method. For example, in the case of the MM1 mutant, the plasmid containing the polynucleotide sequence of the Y208A (M2) mutant was used as a template, and the primer for M26 was used to additionally produce F380A-G381A. As another example, in the case of the MM10 mutant, the plasmid containing the polynucleotide sequence of the Y92W (M1) mutant was used as a template, and the primer for M2 and the primer for M31 were used to produce the mutants to additionally include Y208A and F380T-G381S.

[0273]

[0274] 4-2. Evaluation of RebD Synthetic Activity of the Composite Improved Enzyme

[0275] A recombinant Corynebacterium strain expressing a composite improved enzyme produced as in Example 4-1 was produced by the same transformation method as in Example 2, and the activity evaluation using this was performed in the same manner as in Example 3-1, and the results are shown in Fig. 3.

[0276] As a result, as shown in Fig. 3, it was confirmed that all of the manufactured composite improved enzymes had significantly superior enzyme activity compared to wild-type UGT-B.

[0277]

[0278] Example 5. Evaluation of RebDM synthetic activity of improved enzyme (2)

[0279] Additionally, the RebDM synthetic activity of the improved enzymes was evaluated in a different manner. Four types of E. coli BL21(DE3) strains were constructed by introducing vectors in which the genes encoding the four enzymes (UGT-A, UGT-B_WT, UGT-B_M21, and RSS) (SEQ ID NOs: 130, 127, 128, and 132) were cloned into pET28-α, respectively, for expression. These strains were inoculated into 5 ml of LB medium and cultured at 37 °C and 200 rpm for 8 h, and then added to 2 L of LB medium for the main culture. After culturing at 37 °C and 200 rpm until the absorbance of the culture solution reached 0.4 at 600 mm, 1 mM IPTG (isopropyl ß-D-1-thiogalactothiopyranoside) was added to induce mass expression of the enzymes. After adding IPTG, the culture was incubated at 20 °C and 120 rpm for approximately 16 hours. The culture solution was centrifuged at 6000 xg at 4 °C for 20 minutes to obtain the cells, and the soluble proteins for the four enzymes described above were extracted through ultrasonication, and each enzyme was purified using Ni-NTA affinity chromatography.

[0280] Enzyme reactions under conditions 1 to 3 shown in Table 6 below were performed at 40°C and pH 8.0 to 9.0 using purified enzymes and raw materials (SG90, Haigen) containing stevioside and RebA as main components.

[0281]

[0282] Composition Condition 1 Condition 2 Condition 3SG90 Raw Material Concentration 3%5%10%UDP Concentration 10MmSucrose Concentration 30%Na2HPO4(pH8.0)100mMSS Concentration (mg / ml)0.20.30.4UGT-A Concentration (mg / ml)1.02.04.0UGT-B_WT or M21 Concentration (mg / ml)0.20.40.8

[0283]

[0284] Afterwards, after enzyme inactivation at 100 ℃ for 20 minutes, the amount of RebD, RebM, and RebDM (a mixture of RebD and RebM) produced was compared by analyzing via HPLC in the same manner as in Example 2 when UGT-B_WT and UGT-B_M21 were added. In the case of the reaction solution with UGT-B_M21 enzyme added under conditions 1 to 3, the RebDM contents were analyzed to be 100%, 100%, and 90.8%, respectively, and the RebM contents were analyzed to be 89.5%, 83.8%, and 52.1%, respectively, after 72 hours of reaction, and the results are shown in Table 7 below.

[0285]

[0286] Raw material % (w / v)UGT-B24 hour reaction48 hour reaction72 hour reactionRebDRebMRebDMRebDRebMRebDMRebDRebMRebDM3 %WT5.2%18.3%23.5%5.4%24.3%29.7%5.9%32.2%38.1%M2128.5%43.9%72.5%25.8%68.3%94.1%10.5%89.5%100.0%5 %WT6.6%19.3%25.9%8.4%22.8%31.3%8.4%36.9%45.3%M2136.7%43.0%79.7%32.5%64.4%96.9%16.2%83.8%100.0%10 %WT7.2%16.7%23.9%9.7%16.6%26.3%8.9%24.0%32.9%M2136.6%27.2%63.8%43.3%37.4%80.7%38.7%52.1%90.8%

[0287]

[0288] When the results of the reaction solution with the UGT-B_M21 enzyme added were compared with the results of the reaction solution with the UGT-B_WT enzyme added, both the RebDM content and the RebM content were approximately 2.2 to 2.8 times higher, thereby significantly improving the conversion ability of the enzyme from RebA to RebD and verifying that it is advantageous to use the improved enzyme of the present application for the conversion of RebM through a complex reaction.

[0289] From the above results, it was confirmed that RebDM production can be increased using the UGT-B single and complex mutant enzymes of the present invention.

[0290]

[0291] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.

Claims

1. A mutant polypeptide having glycosyltransferase activity, wherein the amino acid corresponding to position 92 of the amino acid sequence of SEQ ID NO: 1 is substituted with tryptophan; the amino acid corresponding to position 208 is substituted with alanine or methionine; the amino acid corresponding to position 380 is substituted with histidine, threonine, alanine, or glycine; and the amino acid corresponding to position 381 is substituted with phenylalanine, serine, alanine, or asparagine.

2. In the first paragraph, the mutant polypeptide The amino acid corresponding to position 92 of the amino acid sequence of sequence number 1 is replaced with tryptophan; The amino acid corresponding to position 208 is replaced with alanine or methionine; the amino acid corresponding to position 380 is replaced with histidine, threonine, or alanine; The amino acid corresponding to position 381 is replaced with phenylalanine, serine, alanine, or asparagine; or A mutant polypeptide wherein the amino acid corresponding to position 380 is substituted with histidine, threonine, or glycine, and the amino acid corresponding to position 381 is substituted with phenylalanine, serine, alanine, or asparagine.

3. In the first paragraph, the mutant polypeptide The amino acid corresponding to position 208 is replaced with alanine, the amino acid corresponding to position 380 is replaced with threonine or alanine, and the amino acid corresponding to position 381 is replaced with phenylalanine, serine, or alanine; The amino acid corresponding to position 92 is replaced with tryptophan, the amino acid corresponding to position 380 is replaced with threonine or alanine, and the amino acid corresponding to position 381 is replaced with phenylalanine, serine, or alanine; The amino acid corresponding to position 92 is replaced with tryptophan and the amino acid corresponding to position 208 is replaced with alanine; or A mutant polypeptide wherein the amino acid corresponding to position 92 is replaced with tryptophan, the amino acid corresponding to position 208 is replaced with alanine, the amino acid corresponding to position 380 is replaced with threonine or alanine, and the amino acid corresponding to position 381 is replaced with phenylalanine, serine, or alanine.

4. A mutant polypeptide according to claim 1, wherein the mutant polypeptide has at least 80% homology or identity with sequence number 1.

5. A polynucleotide encoding a mutant polypeptide of any one of claims 1 to 4.

6. A vector comprising the polynucleotide of paragraph 5.

7. A microorganism comprising at least one of a mutant polypeptide according to any one of claims 1 to 4, a polynucleotide encoding the mutant polypeptide, and a vector comprising the polynucleotide.

8. In the 7th paragraph, the microorganism has an increased production ability of at least one of rebaudioside D and rebaudioside M compared to a microorganism comprising a polypeptide having an amino acid sequence of sequence number 1 or a polynucleotide encoding the same.

9. In paragraph 7, the microorganism is a microorganism of the genus Corynebacterium or Escherichia.

10. In the 9th paragraph, the microorganism is Corynebacterium ammoniagenes, Corynebacterium glutamicum, or Escherichia coli.

11. A method for producing a steviol glycoside comprising a step of reacting rebaudioside A with a nucleotide diphosphate having a glucose bond in the presence of the mutant polypeptide of claim 1 or the microorganism of claim 7 to transfer glucose to rebaudioside A, wherein the steviol glycoside is at least one of rebaudioside D and rebaudioside M.

12. A production method according to claim 11, further comprising a step of recovering at least one of rebaudioside D and rebaudioside M.

13. In paragraph 11, A production method further comprising a step of producing rebaudioside M by reacting rebaudioside D with a nucleotide diphosphate linked to glucose in the presence of a microorganism comprising at least one of UGT-A (Glucose transferase A), a polynucleotide encoding the same, and a vector comprising the same.

14. A composition for producing at least one of rebaudioside D and rebaudioside M, comprising a mutant polypeptide according to any one of claims 1 to 4; a polynucleotide encoding the mutant polypeptide; a microorganism comprising at least one of the mutant polypeptide, the polynucleotide encoding the mutant polypeptide, and a vector comprising the polynucleotide; a culture of the microorganism; or at least one of these.

15. Use of a microorganism for producing at least one of rebaudioside D and rebaudioside M, the microorganism comprising at least one of the mutant polypeptide of any one of claims 1 to 4, a polynucleotide encoding the mutant polypeptide, and a vector comprising the polynucleotide.

16. Use of a mutant polypeptide according to any one of claims 1 to 4; a polynucleotide encoding the mutant polypeptide; a microorganism comprising at least one of the mutant polypeptide, the polynucleotide encoding the mutant polypeptide, and a vector comprising the polynucleotide; a culture of the microorganism; or a composition comprising at least one of these for producing at least one of rebaudioside D and rebaudioside M.

Citation Information

Patent Citations

  • Uridine diphosphate glycosyltransferase and use thereof

    US11414690B1

  • Glucosyl stevia composition

    US20230270146A1

  • Glycosyl transferase mutant and application thereof in catalytic synthesis of rebaudioside D

    CN116622662A

  • Non-oriented electrical steel sheet and manufacturing method of the same

    KR1020250017577A

  • UDP-dependent glycosyltransferase for high-efficiency production of rebaudioside

    KR102331018B1