Stable recombinant virus and methods of use thereof

Abstract

The present disclosure relates to a method of maintaining foreign gene expression cassette(s) stably integrated in the recombinant virus such that the recombinant virus can continuously express the foreign gene(s) at sufficient quantity even after multiple passages or amplifications.

Description

STABLE RECOMBINANT VIRUS AND METHODS OF USE THEREOFCROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 630364 filed January 29, 2024 and of U.S. Provisional Application No. 63 / 572852 filed April 1, 2024, the contents of both of which are hereby incorporated by reference in their entireties.FIELD

[0002] The present invention is in the fields of molecular biology, virology, and gene therapy. More particularly, the invention relates to a stable virus system for the synthesis of recombinant protein in insect or mammalian cells.BACKGROUND OF THE INVENTION

[0003] Gene therapy has been developed to treat a number of disorders such as cancer and genetic related diseases. Such treatment includes the use of recombinant proteins which have been produced in mammalian systems using viral vectors. There are several technologies in the field of recombinant protein and viral vector production which use different means of introducing foreign genes into the host cells, and there remains a challenge to viral vector production in these systems.SUMMARY

[0004] Traditional methods of introducing AAV genes can utilize transfection of mammalian cell lines such as HEK-293 or Hela cells with triple or dual plasmids (Xiao, Li et al. 1998, Grimm, Kay et al. 2003). Other technique can utilize Herpes simplex virus (HSV) to infect mammalian cells for AAV manufacturing (Zhang, De Alwis et al. 1999) or adenovirus harboring AAV rep and cap genes to infect mammalian cells for AAV manufacturing (Zhang, Wang et al. 2001, Su, Patricio et al. 2022). Despite advances in AAV vector production, there remain challenges which hinder commercial scale AAV manufacturing. For example, it has been reported that (i) there are difficulties in generating sufficient HSV seed stocks and (ii) rep gene can be lost after several passages of a recombinant adenovirus harboring AAV rep and cap genes (Zhang, Wang et al. 2001).

[0005] Other recombinant protein and viral production systems include use of baculovirus in insect cells (Chen 2008, Kotin 2011). The baculovirus expression vector (or bacmid) system (BEVS) has been recognized as a method for production of recombinant proteins to be used as vaccines, therapeutic molecules, or diagnostic reagents (van Oers, Pijlman et al. 2015). This system provides increased AAV production yields relative to other AAV production technologies (Galibert and Merten 2011). However, it is known that there are challenges with BEVS, as gradual deletion of heterologous genes from the rBV contributes to genetic instability of the recombinant baculovirus (rBV) (Kohlbrenner, Aslanidi et al. 2005). Inserting a baculovirus hr2 sequence into a rBV near the AAV rep-cap genes has also been reported to improve the stability of the rBV (see, e.g., US 20180371495). However, after a series of passages, heterologous DNA is gradually deleted from the recombinant baculoviruses, resulting in a loss of AAV production or protein expression.

[0006] Spontaneous excision of non- AAV heterologous genes from the rBV during passages has been reported (Pijlman, van Schijndel et al. 2003). Relocation of the Tn7 transposon to another location has been reported to improve the stability of the recombinant baculovirus harboring heterologous DNA (Pijlman, Grose et al. 2020).

[0007] US 6,428,960 Bl (‘“960”) described a selection method for producing recombinant baculovirus carrying a drug selection marker gene. The ‘960 patent described a gene of interest together with a puromycin gene cloned in a shuttle plasmid and used together with a baculovirus DNA to co-transfect Sf9 cells for recombinant baculovirus generation under puromycin selection. However, the ‘960 patent did not provide a method for maintaining the stability of rBV in multiple passages and / or amplifications in insect cells. Therefore, there remains a need to develop methods to achieve a low cost, large-scale recombinant virus production system with improved stability that produce useful amounts of recombinant viral vectors and proteins after a series of passages and / or amplifications.

[0008] The present disclosure provides solutions to prior unresolved technical problems. The present disclosure provides, in part, a rBV with genome including a selection marker gene expression cassette linked to one or more foreign gene expression cassettes enables itself to maintain the foreign gene expression cassettes stably after a series of passages in the presence of the selection drug. Therefore, the rBV including a selection marker gene expression cassette linked to the heterologous DNA sequence(s) can be amplified several times to obtain sufficient quantity of the virus without losing the foreign gene expression cassette for large scale production of viral vector or protein expression.

[0009] The present disclosure additionally provides an insight that methods described herein can be used to improve stability of production of recombinant adenovirus, herpes virus, vaccinia virus, or other virus commonly used in the protein expression or viral vector production. During the amplification or passaging of a recombinant virus, a selection drug is added to the cell culture to kill cells infected with a recombinant virus without the drug resistant gene. Thus, the recombinant virus carrying the drug resistant gene linked to the foreign gene expression cassette will be selectively amplified and maintained.

[0010] In one aspect, the disclosure provides an rBV including a foreign gene expression cassette linked to a selection marker gene expression cassette. In some embodiments, the foreign gene expression cassette is relatively stable after a series of passages / amplifications in insect cells as compared to an rBV without a foreign gene expression cassette linked to a selection marker gene expression cassette. For example, in some embodiments, an rBV includes a foreign gene expression cassette(s) linked to a selection marker gene expression cassette, and upon one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) passages / amplifications in insect cells, a higher percentage of rBV comprise the foreign gene expression cassette, relative to an rBV with a foreign gene expression cassette that is not linked to a selection marker gene expression cassette.

[0011] In another aspect, the disclosure provides a recombinant adenovirus including a foreign gene expression cassette linked to a selection marker gene expression cassette. In some embodiments, the foreign gene expression cassette is relatively stable after a series of passages / amplifications in mammalian cells as compared to a recombinant adenovirus without a foreign gene expression cassette linked to a selection marker gene expression cassette. For example, in some embodiments, a recombinant adenovirus includes a foreign gene expression cassette(s) linked to a selection marker gene expression cassette, and upon one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) passages / amplifications in mammalian cells, a higher percentage of recombinant adenovirus comprises the foreign gene expression cassette, relative to a recombinant adenovirus with a foreign gene expression cassette that is not linked to a selection marker gene expression cassette.

[0012] In some embodiments, the foreign gene expression cassette includes an artificial intron comprising the selection marker gene expression cassette without a polyadenylation signal such that the artificial intron can be spliced out during transcription to form an intact foreign gene transcript for protein expression. The selection marker gene located within the artificial intron can be transcribed by its own promoter in the expression cassette, terminatedby the same polyadenylation signal of the foreign gene expression cassette and the transcript can be translated to confer drug resistance.

[0013] In some embodiments, the rBV DNA backbone includes a DNA sequence homologous to two DNA fragments flanking the one or more foreign gene expression cassettes linked to an insect-cell-operable selection marker gene expression cassette in a donor or shuttle plasmid. In certain embodiments, the rBV DNA backbone is derived from bMON 14272 (Luckow, Lee et al. 1993). In some embodiments, the rBV DNA includes an origin of replication. In specific embodiments, the origin of replication is a mini-F-replicon, ColEl, oriC, OriV, OriT or OriS. In certain embodiments, the rBV DNA backbone further includes a reporter gene. In specific embodiments, the reporter gene is LacZa.

[0014] The present disclosure also provides a rBV genome, including at least one insect- cell-operable selection marker gene expression cassette and one or more foreign gene expression cassettes. The insect-cell-operable selection marker gene expression cassette can be located adjacent to the foreign gene expression cassettes (in any orientation) or between the foreign gene expression cassettes. In some embodiments, the one or more foreign gene expression cassettes are relatively stable as compared to a rBV genome without the selection marker gene expression cassette. In some embodiments, the foreign gene expression cassette includes: at least one foreign protein gene and an insect cell promoter operably linked to the at least one foreign gene.

[0015] In some embodiments, the at least one foreign protein gene in the foreign gene expression cassette includes at least one viral protein gene and / or at least one mammalian protein gene. In certain embodiments, the viral protein gene encodes an AAV protein, an adenoviral protein, a retroviral protein, an SV40 protein, or a Herpes simplex viral protein. In specific embodiments, the foreign gene expression cassette includes a sequence encoding at least one AAV capsid protein. In certain embodiments, the at least one AAV protein is VP1, VP2, VP3, and / or a Rep protein, and in particular embodiments, the at least one SV40 protein is VP1 major capsid protein.

[0016] In some embodiments, the foreign gene expression cassette includes an insect promoter, such as a polyhedron, plO, or p6.9 insect promoter, operably linked to the at least one foreign protein gene.

[0017] In some embodiments, the foreign gene expression cassette includes a mammalian promoter, such as a CMV, pGK, UbC, EFla, SV40, p5, p!9, and p40 promoter, operably linked to the at least one foreign protein gene.

[0018] In some embodiments, DNA sequences enable the foreign gene expression cassette and the insect-cell-operable selection marker gene expression cassette to integrate into the rBV DNA backbone. In some embodiments, DNA sequences that enable the foreign gene expression cassette and the insect-cell -operable selection marker gene expression cassette to integrate into the rBV DNA are homologous to DNA sequences in the rBV DNA genome. In particular embodiments, DNA sequences that enable the foreign gene expression cassette to integrate into the rBV DNA backbone are transposable elements. In certain embodiments, DNA sequences that enable the foreign gene expression cassette to integrate into the rBV DNA backbone are Tn7R and Tn7L.

[0019] In another aspect, the disclosure provides an rBV vector or particle including one or more foreign gene expression cassettes linked to an insect-cell-operable selection marker gene expression cassette. In some embodiments, the one or more foreign gene expression cassettes are relatively stable as compared to a rBV backbone without the insect-cell-operable selection marker gene expression cassette. The foreign protein gene cassette linked to the insect-cell- operable selection marker gene expression cassette includes: at least one foreign protein gene; an insect cell promoter operably linked to the at least one foreign gene; an insect-cell-operable selection marker gene expression cassette and two DNA sequences, enabling the foreign gene expression cassette together with the insect-cell-operable selection marker gene expression cassette to integrate into the rBV DNA backbone. In some embodiments, the rBV vector or particle includes a rBV backbone including a foreign gene expression cassette encoding at least one AAV capsid protein.

[0020] The disclosure also provides an insect cell including an rBV vector or particle including: an rBV genome; and at least one baculoviral capsid protein. In some embodiments, the rBV genome includes: an rBV DNA backbone; and a foreign gene expression cassette linked to an insect-cell-operable selection marker expression cassette, the rBV DNA backbone including: DNA sequences enabling integration of one or more foreign gene expression cassettes linked to the insect-cell-operable selection marker gene expression cassette into the backbone. In some embodiments, the one or more foreign gene expression cassettes are relatively stable as compared to an rBV backbone without the insect-cell-operable selection marker gene expression cassette. In some embodiments, the rBV genome includes a rBV backbone including a foreign gene expression cassette encoding at least one AAV capsid protein.

[0021] In some embodiments, the insect cell is an Sf9, Sf21, S2, Trichoplusia ni, E4a, or BTI-TN-5B1-4 cell. In particular embodiments, the insect cell further includes at least one foreign protein expressed from the foreign gene expression cassette in the rBV backbone of the rBV genome of the rBV vector or particle, and in certain embodiments, the at least one foreign protein is at least one AAV capsid protein.

[0022] In another aspect, the disclosure provides a heterologous expression system including: an rBV vector or particle; and an insect cell. In some embodiments, the rBV vector or particle includes: an rBV genome; and at least one baculoviral capsid protein. In some embodiments, the rBV genome includes: an rBV DNA backbone; and a foreign gene expression cassette linked to an insect-cell-operable selection marker gene expression cassette, the rBV DNA backbone including: a DNA fragment enabling integration of one or more foreign gene expression cassettes linked to the insect-cell-operable selection marker gene expression cassette into the backbone. In some embodiments, the one or more foreign gene expression cassettes are relatively stable as compared to an rBV backbone without the insect- cell-operable selection marker gene expression cassette. In some embodiments, the rBV genome includes a rBV backbone including a foreign gene expression cassette encoding at least one AAV capsid protein. The insect cell in the system is susceptible to infection, and capable of expressing the at least one foreign protein encoded, by the rBV backbone in the rBV vector or particle.

[0023] In some embodiments, rBV vector or particle includes an rBV backbone including a foreign gene expression cassette, the foreign gene expression cassette including a sequence encoding at least one AAV capsid protein. In some embodiments, the insect cell is an Sf9, Sf21, S2, Trichoplusia ni, E4a, or BTI-TN-5B1-4 cell.

[0024] In yet another aspect, the disclosure provides a heterologous expression system including: an rBV vector or particle; and an insect cell. In some embodiments, the rBV vector or particle includes: an rBV genome; and at least one baculoviral capsid protein. The rBV genome includes: an rBV DNA backbone; and a foreign gene expression cassette linked to an insect-cell-operable selection marker expression cassette, the rBV DNA backbone including: a DNA fragment enabling integration of one or more foreign gene expression cassettes linked to an insect-cell-operable selection marker gene expression cassette into the backbone. In some embodiments, the one or more foreign gene expression cassettes are relatively stable as compared to an rBV backbone without the insect-cell-operable selection marker gene expression cassette. In some embodiments, the rBV genome includes a rBV backboneincluding a foreign gene expression cassette encoding at least one AAV capsid protein. The insect cell of the system is susceptible to infection, and capable of expressing the at least one foreign protein encoded, by the rBV backbone in the rBV vector or particle.

[0025] In some embodiment, rBV vector or particle includes an rBV backbone including a foreign gene expression cassette linked to an insect-cell-operable selection marker expression cassette, the foreign gene expression cassette including a sequence encoding at least one AAV capsid protein. In some embodiments, the insect cell is an Sf9, Sf21, S2, Trichoplusia ni, E4a, or BTI-TN-5B1-4 cell.

[0026] In some embodiments, the at least one foreign protein encoded by the rBV genome is at least one AAV capsid protein. In some embodiment the insect cell lysate is derived from an Sf9, Sf21, S2, Trichoplusia ni, E4a, or BTI-TN-5B1-4 insect cell infected with the rBV genome.

[0027] In still another aspect, the present disclosure provides a method of producing a foreign protein in an insect cell, including: infecting the insect cell with a recombinant baculovirus (rBV) vector or particle described herein; culturing the infected cell under conditions conducive for the expression of the at least one foreign protein gene; and isolating the foreign protein.

[0028] In some embodiments, the insect cell is lysed to isolate the foreign protein. In certain embodiments, the foreign protein is at least one recombinant AAV capsid protein.BRIEF DESCRIPTION OF THE DRAWINGS

[0029] The foregoing and other objects of the present disclosure, the various features thereof, as well as the disclosure itself may be more fully understood from the following description, when read together with the accompanying drawings in which:

[0030] FIGs. 1 A-B depict exemplary recombinant baculovirus (rBV) DNA backbones or bacmids according to the disclosure. FIG. 1 depicts the locations of DNA sequences for homologous recombination (3,597 - 4,424 and 5, 170 - 6628 according to GenBank ID NC_001623). FIG. IB depicts the locations of the attTn7 sequence (11,321 - 11,410 according to bMON14271) for transposon-mediated integration of heterologous sequences into the rBV genome.

[0031] FIGs. 2A-D depict exemplary shuttle plasmids harboring one selection marker gene expression cassette linked to two foreign gene expression cassettes for generation of stable rBV. FIG. 2A depicts an exemplary selection marker gene expression cassette comprisingNeoR / KanR for generating stable rBV using the transposition method. The selection marker gene expression cassette CMV-NeoR / KanR-SV40 poly A is flanked by two foreign gene expression cassettes, polh promoter-AAV5 cap-SV40 poly A and plO promoter-Rep-HSV tk poly A (V598). FIG. 2B depicts an exemplary selection marker gene expression cassette comprising Zeocin for generating stable rBV using the transposition method. The selection marker gene expression cassette CMV-Amp-promoter-Zeocin-SV40 poly A is flanked by two foreign gene expression cassettes, polh promoter- AAV5 cap-SV40 poly A and plO promoter- Rep-HSV tk poly A expression cassettes (V648). FIG. 2C depicts an exemplary selection marker gene expression cassette comprising puromycin for generating stable rBV using the transposition method. The selection marker gene expression cassette p6.9 promoter-PuroR- SV40 poly A is flanked by two foreign gene expression cassettes, polh promoter- AAV9 cap- SV40 poly A and plO promoter-Rep-HSV tk poly A (V649). FIG. 2D depicts an exemplary selection marker gene expression cassette comprising NeoR / KanR for generating stable rBV using the homologous recombination method. The selection marker gene expression cassette CMV-NeoR / KanR-SV40 poly A is flanked by two foreign gene expression cassettes, polh promoter-AAV5.2 cap-SV40 poly A and plO promoter-Rep-HSV tk poly A (V651).

[0032] FIGs. 3A-D depict exemplary shuttle plasmids harboring at least one selection marker gene expression cassette linked to at least one foreign gene expression cassette for generating stable rBV. FIG. 3A depicts an exemplary foreign gene expression cassette, CMV promoter-hGH intron-plO promoter-GFP-SV40 poly A linked to one selection marker gene expression cassette, p6.9 promoter-NeoR / KanR-SV40 poly A. This shuttle plasmid is used for stable rBV generation using the transposition method (V620). FIG. 3B depicts an exemplary foreign gene expression cassette, CMV promoter-hGH intron-plO promoter-GFP-SV40 poly A located between two selection marker gene expression cassettes, p6.9 promoter- NeoR / KanR-SV40 poly A and p6.9 promoter-Zeocin-bGH poly A. This shuttle plasmid is used for stable rBV generation using the transposition method (V650). FIG. 3C depicts three exemplary foreign gene expression cassettes, CMV promoter-hGH-intron-GFP-SV40pA, polh promoter-AAV5-cap-SV40pA, and plO promoter-inRep-HSV tk pA, intertwined with two selection marker gene expression cassettes, p6.9 promoter-NeoR / KanR-SV40pA and lElpromoter-Zeocin-hGHpA (V657). This shuttle plasmid is used for generation of stable rBV via transposition method. FIG. 3D depicts an exemplary foreign gene expression cassette, CMV promoter-hGH intron-plO promoter-GFP-SV40 poly A linked to one selectionmarker gene expression cassette, CMV-promoter-NeoR / KanR-SV40 poly A. This shuttle plasmid is used for stable rBV generation using the transposition method (V597).

[0033] FIGs. 4A-B depict diagrammatic representations of integrating expression cassettes into the baculovirus system. FIG. 4A depicts the integration of a foreign expression cassette (“a”) and a selection marker gene expression cassette (“b”) into the baculovirus genome by homologous recombination. FIG. 4B depicts the integration of a foreign expression cassette (“a”) and a selection marker gene expression cassette (“b”) into the baculovirus genome by transposition.

[0034] FIGs. 5A-B depict diagrammatic representations of integrating expression cassettes into the baculovirus genome. FIG. 5A depicts the integration of a foreign expression cassette (“b”) and two selection marker gene expression cassettes (“a” & “c”) into the baculovirus genome by homologous recombination. FIG. 5B depicts the integration of a foreign expression cassette (“b”) and two selection marker gene expression cassettes (“a” & “c”) into the baculovirus genome by transposition.

[0035] FIG. 6 depicts a flowchart representation of maintaining foreign gene expression cassette(s) stably in the rBV via a serial passage and using the rBV for large scale productions by infecting Sf9 cells in a bioreactor or other vessels suitable for the productions.

[0036] FIGs. 7A-D depict diagrammatic representations of AAV vector production using the stably maintained rBVs. Px indicates any passage of the rBV that can be used in the production. Dual infection of Sf9 cells with 2 stable rBVs can be used for small scale (FIG. 7A) or large scale (FIG. 7B) AAV productions. Single infection of Sf9 cells with one stable rBV can be used for small scale (FIG. 7C) or large scale (FIG. 7D) AAV productions.

[0037] FIGs. 8A-C depict exemplary plasmids used for adenovirus generation. FIG. 8A, 3 ’-adenovirus type 5 genome in an exemplary plasmid form (pAdEasy-1) according to GenBank no. AY370909. FIG. 8B depicts an exemplary shuttle plasmid containing the 5’- adenovirus type 5 genome comprising ITR-CMV-GFP-hGHpA-ITR-UbC-Zeocin-AAVpA (V659). FIG. 8C depicts an exemplary shuttle plasmid containing the 5’-adenovirus type 5 genome comprising p5-inRep-hpGK promoter-Zeocin-p40-Cap8-hGHpA (V717).

[0038] FIGs. 9A-B depict exemplary representations of the full adenovirus genomes in plasmid forms. FIG. 9A depicts a plasmid comprising the full adenovirus genome comprising p5-Rep-hpGK-Zeocin- p40-Cap8-hGHpA (V737). FIG. 9B depicts a plasmid comprising the full adenovirus genome comprising ITR-CMV-GFP-hGHpA-ITR-UbC-Zeocin-AAVpA(V738). The plasmids are digested with PacI to release the Ad-ITRs and transfected into HEK293 cells to generate stable recombinant adenoviruses.

[0039] FIG. 10 depicts an exemplary flowchart representation of maintaining foreign gene expression cassette(s) stably in the rAd via a serial passage and using the rAd for large scale productions by infecting 293 cells in a bioreactor or other vessels suitable for the productions.

[0040] FIGs. 11A-B depict exemplary diagrammatic representations of AAV vector production using the stably maintained rAds in small scale (FIG. 11A) and large scale (FIG. 11B) vessels with dual infection. Px indicates any passage of the rAd can be used in the production.

[0041] FIG. 12 depicts exemplary infectivity of AAV vectors produced by Pl rBVs (Lot# 24-013) and P10 rBVs (Lot# 24-014). The AAV vectors were used to transduce HEK293 cells at different titers / well for 3 days and the GFP expression cells are scored as relative fluorescent units. Very similar infectivity was observed between the Pl and P10 rBV produced AAV vectors.

[0042] FIG. 13 depicts exemplary capsid ratios between Pl and P10 rBV produced AAV vectors. M, protein ladders; Lane 1, AAV8 control; Lane 2, AAV5 produced by Pl rBVs (Lot# 24-013); Lane 3, AAV5 produced by P10 rBVs (Lot# 24-014). Near identical capsid ratio was observed between the Pl and P10 rBV produced AAV vectors.

[0043] FIG. 14 depicts exemplary AAV genomes between Pl and P10 rBV produced AAV vectors. M, DNA ladders; Lane 2, AAV5 vector produced by Pl rBVs (Lot# 24-013); Lane 3, AAV5 vector produced by P10 rBVs (Lot# 24-014). Identical AAV genome patterns were observed between the Pl and P10 rBV produced AAV vectors.

[0044] FIG. 15A-B depict exemplary DNA sequencing results and show no mutations of rBV-V598 (FIG. 15A) and rBV-V620 (FIG. 15B) after 10 passages. The rBV genomes were extracted from infected Sf9 cells using a miniprep method followed by PCR amplification of the target sequences. The PCR fragments were analyzed using Sanger Sequencing method and aligned with the DNA sequences on files.DEFINITIONS

[0045] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The initial definition provided for a group or term herein applies to thatgroup or term throughout the present specification individually or as part of another group, unless otherwise indicated.

[0046] The term “bacmid” refers to a shuttle vector that can be propagated in both E. coli and insect cells.

[0047] The term “recombinant baculovirus (rBV) DNA backbone” refers to a bacmid including a baculovirus genome as described by Luckow el al. (1993) that contains a bacterial origin of replication, an antibiotic resistant gene and the mini-att Tn7 site enabling the integration of an expression cassette into the backbone.

[0048] The term “recombinant baculovirus (rBV) genome” is used herein to mean a baculovirus DNA genome including at least one expression cassette encoding at least one foreign protein.

[0049] An rBV vector refers to a recombinant baculovirus carrying an rBV genome and encased within the baculovirus capsid and which is capable of infecting an insect cell.

[0050] A recombinant adenovirus refers to the virus carrying a virus genome and encased within the adenovirus capsid and which is capable of infecting a mammalian cell.

[0051] A “viral particle” refers to a biological entity including a shell formed by the expression and operative assembly within a cell, of capsid proteins, and genetic information in the form of RNA or DNA.

[0052] “Serial passage” refers to the process of growing baculovirus in iterations. For example, the baculovirus can be grown in a 6-well plate for several days, a portion of it can be harvested and stored at appropriate conditions and another portion of it can be used to infect the fresh insect cells in a new 6-well plate under appropriate conditions. These steps can be repeated multiple times in the serial passage. Larger vessels than 6-well plate can be used for serial passage to amplify more baculoviruses.

[0053] A “selection marker gene” encompasses those genes that encode a selection marker protein useful for selecting an insect cell that has been successfully transfected by the bacmid, or infected by the rBV harboring the selection marker gene expression cassette such as, but not limited to, an antibiotic-resistance protein.

[0054] A “selection marker gene expression cassette”, as used herein, is a DNA sequence that encodes a non-native selection marker gene. In some embodiments, a selection marker gene expression cassette includes a non-native selection marker gene operably linked to an insect promoter and / or a polyadenylation sequence, e.g., for insect cell expression. In some embodiments, a selection marker gene expression cassette includes a non-native selectionmarker gene operably linked to a mammalian promoter and / or a polyadenylation sequence, e.g., for mammalian cell expression.

[0055] As used herein, the term “foreign protein” refers to a protein not encoded by a wild type baculovirus genome. Such proteins include, but are not limited to, non-insect proteins such as viral proteins and mammalian proteins.

[0056] A “heterologous DNA” refers to DNA sequences that originate from a different species or source than the host organism in which they are introduced. The term "heterologous" emphasizes the genetic dissimilarity or origin of the inserted DNA compared to the host organism's own genetic material. Any non-baculoviral protein coding sequence or RNAi sequence is heterologous DNA sequence.

[0057] A “foreign gene expression cassette” is a heterologous DNA sequence encoding at least one protein that is foreign to the virus such as a viral and / or mammalian protein, operably linked to an insect or mammalian promoter enabling expression in an insect or mammalian cell. In some embodiments, a foreign gene expression cassette may further link to (i) a selection marker gene expression cassette and (ii) insertion sequences enabling integration of the foreign gene expression cassette into the recombinant virus DNA backbone.

[0058] A “donor or shuttle plasmid” is a DNA vector or plasmid that has at least one foreign gene expression cassette linked to at least one insect cell-operable selection marker gene expression cassette. Both of the cassettes are flanked by recombination elements such as homologous recombination sequence transposons which can be used to transfer the foreign gene expression cassette to the bacmid to generate the rBV genome.DETAILED DESCRIPTION

[0059] Insect cells infected by recombinant baculovirus (rBV) are commonly used for expression of recombinant proteins, e.g., AAV capsid proteins (Kaba, Salcedo et al. 2004, Galibert, Savy et al. 2018). However, the foreign gene expression cassette(s) are frequently deleted after several passages (Kohlbrenner, Aslanidi et al. 2005), rendering the rBV much less productive.

[0060] The present disclosure provides several advantages of a rBV including a selection marker gene and at least one heterologous DNA fragment. For example, such advantages include, but not limited to, less deletion of a foreign gene expression cassette(s) after multiple rounds of passaging and / or amplification of the rBV under the pressure of a selection drug, as compared to a rBV without (i) a selection marker gene or (ii) application of a selection drug.

[0061] In some embodiments, methods described herein relate to maintaining heterologous DNA sequence stably integrated in a recombinant virus, including a) generating a recombinant virus including at least one host-cell-operable selection marker gene expression cassette operatively linked to at least one heterologous DNA fragment in a host cell; and b) passaging the recombinant virus several times in the host cells under selection condition to eliminate the virus without the selection marker gene such that the recombinant virus including the heterologous DNA sequence is stably maintained.

[0062] The disclosures of patents, patent applications, and publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art as known to those skilled therein as of the date of the invention described and claimed herein. The instant disclosure will govern in the instance that there is any inconsistency between patents, patent applications, and publications and this disclosure.Expression Cassettes

[0063] Among other things, the provided disclosure provides expression cassettes (e.g., selection marker expression cassette, foreign protein expression cassette). In some embodiments, an expression cassette can be introduced into a plasmid (e.g., a plasmid depicted in FIG. 8A) for adenovirus or rAD generation. In some embodiments, an expression cassette includes a control element (e.g., promoters, enhancers, transcription terminators, etc.). In some embodiments, an expression cassette includes a promoter. In some embodiments, a promoter is an inducible promoter, a constitutive promoter, an insect promoter, a mammaliancell-operable promoter, a chimeric promoter, an engineered promoter, or any other type of promoter known in the art.

[0064] In some embodiments, an expression cassette includes an insect promoter. In some embodiments, an insect promoter includes a polyhedron (polh), p 10, OpIE2, hsp70, actin, Bombyx mori Actin A3, Bombyx mori cytoplasmic, Drosophila Metallothionein (MT), Bombyx mori A3F, or p6.9 promoter. In some embodiments, an expression cassette includes a mammalian-cell-operable promoter. In some embodiments, a mammalian-cell-operable promoter includes CMV, SV40, pGK, EFla, synapsin, chicken beta actin, Ubc, TRE, AFP, PSA, COX2, survivin, or CamKII promoter.

[0065] In some embodiments, an expression cassette includes a polyadenylation signal. In some embodiments, a polyadenylation signal is not limited to a particular length; in some embodiments, a polyadenylation signal is any length. In some embodiments, apolyadenylation signal includes a bovine growth hormone (bGH) polyA sequence, SV40 polyA sequence, AAV polyA sequence, or a HSV TK polyA sequence.Selection Marker Gene Expression Cassette

[0066] In accordance with various embodiments, the present disclosure provides selection marker gene expression cassettes. In some embodiments, a selection marker gene expression cassette includes a selection marker gene coding sequence. In some embodiments, a selection marker gene expression cassette includes one or more selection marker gene coding sequences.

[0067] In some embodiments, a selection marker gene coding sequence encodes a neomycin-kanamycin phosphotransferase type II, puromycin resistance protein, zeocin resistance protein, hygromycin phosphotransferase, phosphoinothricin acetyltransferase, glyphosate oxidoreductase, or Blasticidin S.

[0068] In some embodiments, a selection marker gene expression cassette includes a control element (e.g., promoter, enhancer, transcription terminator, etc.), a selection marker gene coding sequence, and a polyadenylation signal. In some embodiments, a selection marker gene expression cassette includes one or more control elements (e.g., promoters, enhancers, transcription terminators, etc.), one or more selection marker gene coding sequences, and a polyadenylation signal.

[0069] In some embodiments, an insect or mammalian-cell-operable promoter drives expression of a selection marker gene coding sequence. In some embodiments, an insect or mammalian-cell-operable promoter is operatively linked to a selection marker gene coding sequence.

[0070] In some embodiments, a selection marker gene expression cassette includes a CMV promoter operatively linked to a neomycin-kanamycin phosphotransferase type II (GenBank ID: BAM38519.1) gene and a SV40 polyadenylation signal (see, e.g., FIG. 2A & 2D). In some embodiments, a selection marker gene expression cassette includes a CMV promoter operatively linked to a zeocin resistance gene (GenBank ID: AOS59253. 1) and a SV40 polyadenylation signal (see, e.g., FIG. 2B). In some embodiments, a selection marker gene expression cassette includes a p6.9 promoter operatively linked to puromycin resistant gene (GenBank ID: BAM95187.1) and a SV40 polyadenylation signal (see, e.g., FIG. 2C). In some embodiments, a selection marker gene expression cassette includes a pGK promoter operatively linked to a zeocin resistance gene situated within an intron inserted in a codingsequence (see, e.g., FIG. 8C). In some embodiments, a selection marker gene expression cassette can be inserted into a shuttle plasmid depicted in FIG. 8B and used in methods of the disclosure.Foreign Gene Expression Cassette

[0071] In accordance with various embodiments, the present disclosure provides foreign gene expression cassettes. In some embodiments, a foreign gene expression cassette includes a foreign gene coding sequence. In some embodiments, a foreign gene expression cassette includes one or more foreign gene coding sequences.

[0072] In some embodiments, a foreign gene coding sequence includes at least one viral protein gene and / or at least one mammalian protein gene. In some embodiments, a viral protein gene encodes an AAV protein, an adenoviral protein, a retroviral protein, an SV40 protein, or a Herpes simplex viral protein.

[0073] In some embodiments, a foreign gene coding sequence includes a sequence encoding at least one AAV capsid protein. In some embodiments, the at least one AAV protein is VP1, VP2, VP3, and / or a Rep protein. In some embodiments, a SV40 protein is VP1 major capsid protein.

[0074] In some embodiments, a foreign gene coding sequence encodes viral proteins that forms a structural part or capsid of a vector carrying a mammalian gene of interest. For example, a foreign gene expression cassette can include genes encoding AAV viral proteins, e.g., Rep and Cap proteins (see, e.g., FIG. 2A - 2D). Proteins of other viruses useful in gene therapy methods include, but are not limited to, hexon, penton complex, fiber proteins from adenovirus, matrix, capsid, nucleocapsid proteins from retrovirus such as, but not limited to, lentivirus, VP5, VP23, VP19C, VP26, and capsid-vertex-specific component proteins from Herpes simplex virus (HSV), and the major VP1 protein from SV40.

[0075] In some embodiments, a foreign gene coding sequence encodes mammalian proteins. For example, mammalian proteins can include, but are not limited to, human immunoglobulins, human serum albumins, erythropoietin-alpha, and Factor VIII, etc.

[0076] In some embodiments, a foreign gene expression cassette includes a control element (e.g., promoters, enhancers, transcription terminators, etc), a foreign gene coding sequence, and a poly adenylation signal. In some embodiments, a foreign gene expression cassette includes one or more control elements (e.g., promoters, enhancers, transcription terminators, etc.), one or more foreign gene coding sequences, and a polyadenylation signal.

[0077] In some embodiments, an insect or mammalian-cell-operable promoter drives expression of a foreign gene coding sequence. In some embodiments, an insect or mammalian- cell-operable promoter is operatively linked to a foreign gene coding sequence.

[0078] In some embodiments, a foreign gene expression cassette can be operatively linked to a selection marker gene expression cassette. In some embodiments, a foreign gene expression cassette can be operatively linked to a selection marker gene expression cassette in any combination and integrated into a virus.

[0079] In some embodiments, foreign gene expression cassettes can be operatively linked to a selection marker gene expression cassette in any combination and integrated into a rBV. In some embodiments, a foreign gene expression cassette can be operatively linked to a selection marker gene expression cassette in any combination and integrated into a rBV for maintaining the stability of a foreign gene expression cassette under selection condition.

[0080] In some embodiments, one or more foreign gene expression cassettes can be operatively linked to a selection marker gene expression cassette. In some embodiments, a selection marker gene expression is situated between two foreign gene expression cassettes.

[0081] In some embodiments, a foreign gene expression cassette can be operatively linked to one or more selection marker gene expression cassettes. In some embodiments, one or more selection marker gene expression cassettes can be operatively linked to a foreign gene expression cassette. In some embodiments, a foreign gene expression cassette is situated between the two selection marker gene expression cassettes (see, e.g., FIG. 3B). When integrated into the virus and under selection conditions with two selection drugs, the foreign gene expression cassette can be maintained stably in the virus for multiple passages.

[0082] In some embodiments, a selection marker gene can be used in both the E. coli and the insect cells. When dual promoters and termination signals (bacteria and insect) are used, one selection marker gene expression cassette can be used for cloning, recombinant bacmid selection in E. coli and maintenance of a foreign gene expression cassette stability in insect cells. For example, the CMV promoter (mammalian or insect) and the AmpR promoter (bacteria) can be used to drive the expression of Zeocin both in insect and E. coli cells and the transcription can be terminated by SV40pA (insect) and downstream naturally occurring rho- independent terminator (bacteria) (see, e.g., FIG. 2B).

[0083] In some embodiments a foreign gene expression cassette linked to a selection marker gene expression cassette can be flanked by transposable DNA elements. In some embodiments, a transposable DNA element facilitates integration into a rBV DNA backboneat specific nucleic acid sites or locations. In some embodiments, a transposable DNA element include, but are not limited to, Tn7L and Tn7R (see, e.g., FIG. 4B and 5B). In some embodiments, such a rBV DNA backbone is described in FIG. IB. Alternatively, they can be flanked by sequences homologous to the baculovirus genome, for example the sequences between 2,845 and 4,202, and between 11,546 and 12,373 in the shuttle plasmid V651-pBP- inCap5.2-CMV-NeoR_KanR-SV40pA-inRep, which enable the flanked sequence to be integrated into the baculovirus genome via homologous recombination mechanism as shown in FIG. 4A and 5A. In some embodiments, such a baculovirus genome is described in FIG. 1A.

[0084] In some embodiments, a foreign gene expression cassette described herein includes an artificial intron comprising the selection marker gene expression cassette. The artificial intron can be spliced out during transcription to form an intact foreign gene transcript for protein expression. The selection marker gene located within the artificial intron can be transcribed by its own promoter in the expression cassette and the transcript can be expressed to confer drug resistance.Cell Culture

[0085] Cells that can be infected by a rBV vector, adenovirus vector or transformed by bacmid include insect cells, mammalian cells or prokaryotic cells such as E. coli. Useful E. coli cells include, but are not limited to, ToplO, DH5a, DH10B, TGI, BW23473, BW23474, MW003, Mwoo5, and BL21. Useful insect cells that can be infected by an rBV vector, as described herein, include, but are not limited to, Sf9, Sf21 , Express Sf+, and S2 cells from the Fall Army worm Spodoptera frugiperda), or BTI-TN-5B1-4 (High Five cells) from the cabbage looper Trichoplusia ni (Lepidopterd), D. melanogaster, and other cell lines. Mammalian cells that can be infected by recombinant adenovirus vector include HEK293, HEK293T cells, and PerC6 cells. These cells are commercially available from a number of sources (e.g., ThermoFisher Scientific, ATCC, and Expression Systems). Insect cells are cultured in a medium conducive for maintenance and growth, such as, but not limited to Gibco insect media: ExpiSf CD Medium, Sf-900 III SFM, Express Five SFM, or SF-900 II SEM (ThermoFisher Scientific), ESF921 and ESFAF (Expression Systems). Mammalian cells are cultured in a medium conducive for maintenance and growth, such as, but not limited to Dulbecco’s Modified Eagle Medium (DMEM), Minimal Essential Medium (MEM), Opti-MEM, FreeStyle 293 Expression Medium (serum-free), EX-CELL or CD 293 Medium (chemically defined).Virus Infection

[0086] rBV infects insect cells upon contact under conditions conducive for the virus to enter the cell, e.g., by culturing the contacted cells at about 25°C, about 26°C, about 27°C, about 28°C, about 29°C, about 30°C, about 31°C, about 32°C, or about 33°C (e.g., at about 28°C) for about 48 hours, about 50 hours, about 60 hours, about 70 hours, about 72 hours, about 75 hours, about 80 hours, about 85 hours, or about 90 hours (e.g., about three days) in a medium conducive for expression of the foreign proteins, e.g., in Gibco insect media (ExpiSf CD Medium, Sf-900 III SFM, Express Five SFM, or SF-900 II SEM (ThermoFisher Scientific), ESF921 or ESF AF media (Expression Systems). rAd infects mammalian cells upon contact under conditions conducive for the virus to enter the cell, e.g., by culturing the contacted cells at about 30°C, about 32°C, about 35°C, about 37°C, about 39°C, for about 24 hours, about 48 hours, about 60 hours, about 70 hours, about 72 hours, about 75 hours, about 80 hours, about 85 hours, or about 90 hours (e.g., about three days) in a medium conducive for expression of the foreign proteins, e.g., in DMEM, MEM, Opti-MEM, or CD 293 Medium. Successful infection can be monitored e.g., by expression of a visually detectable marker protein such as GFP, or the expression of the gene for which had been incorporated into the viral genome such as AAV capsid proteins VP1, VP2, and VP3.Maintenance of Heterologous DNA Sequence Stably in the recombinant virus

[0087] Among other things, the present disclosure provides methods to generate rBV and rAd. In some embodiments, a heterologous DNA sequence together with a selection marker gene DNA sequence can be integrated into the baculovirus genome via the transposon- or the homologous recombination-mediated mechanism described herein to generate rBV or the adenovirus genome via ligation method followed by Pad digestion and transfection into HEK293 cells to generate rAd (see, e.g, FIG. 9A - B). Then the rBV or rAd can be used to infect more insect or mammalian cells to amplify more rBVs or rAd under an appropriate selection condition.

[0088] In some embodiments, less than about 0.01, about 0.05, about 0.1, about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, or about 1.0 (e.g., about one) multiplicity of infection (moi) per cell of rBV or rAd can be used in the amplification. The selection drug(s) at predetermined suitable concentration will be added certain time afterviral infection so that the expression of selection marker gene protects the cells from the killing effect of selection drug. In some embodiments, selection drug can be added 6 hours, 12 hours, or 24 hours (one day) after viral infection. If the recombinant virus harboring the selection marker gene together with the heterologous DNA sequence infects the cells, those cells will be able to survive due to the expression of the selection marker gene. However, if the recombinant virus loses the selection marker gene, those virus infected cells will not survive in the presence of the selection drug(s) and will be eliminated. In some embodiments, additional selection marker genes surrounding or dispersed between the heterologous DNA sequences can be used to improve the stability of the virus. This stable virus harboring the heterologous DNA sequences can provide unlimited seed stock sources for many kinds of large-scale applications.

[0089] In some embodiments, a heterologous DNA sequence linked to the selection marker gene expression cassette(s) can be maintained stably for multiple rounds of passaging / amplification. In some embodiments, a heterologous DNA sequence linked to the selection marker gene expression cassette(s) can be maintained stably for about 2 rounds, about 3 rounds, about 4 rounds, about 5 rounds, about 6 rounds, about 7 rounds, about 8 rounds, about 9 rounds, about 10 rounds, about 11 rounds, about 12 rounds, about 13 rounds, about 14 rounds, about 15 rounds of passaging / amplification. In some embodiments, a heterologous DNA sequence linked to the selection marker gene expression cassette(s) can be maintained within the virus genome after one or more rounds of passaging / amplification at a level that is higher, relative to a corresponding level of a heterologous DNA sequence not linked to the selection marker gene expression cassette(s) (within the virus genome), by at least 30%, 50%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 400%, 500%, or more.Production of AAV Vectors with the Stably Maintained rBVs or rAds

[0090] Among other things, the present disclosure provides methods to produce AAV vectors with stably maintained rBVs or rAds.

[0091] In some embodiments, a stably maintained rBV comprising AAV rep and cap gene expression cassettes linked to a selection marker gene expression cassette, and a stably maintained rBV comprising an AAV ITR-flanked foreign gene expression cassette (e.g., CMV-GFP-SV40pA) linked to a selection marker gene expression cassette, can be used to infect insect cells (e.g., Sf9 cells) for AAV vector production.

[0092] In some embodiments, a stably maintained rAd comprising AAV rep and cap gene expression cassettes linked to a selection marker gene expression cassette, and a stably maintained rAd comprising an AAV ITR-flanked foreign gene expression cassette (e.g., CMV-GFP-SV40pA) linked to a selection marker gene expression cassette, can be used to infect mammalian cells (e.g., HEK293 cells) for AAV vector production.

[0093] In accordance with various embodiments, drug selection is not used during AAV production. If large volume of AAV manufacturing, such as 1 liter, 10 liters, 100 liters, 1,000 liters or even 10,000 liters is needed, both rBVs can be amplified under selection pressure to ensure the integrity of the rep and cap, and the therapeutic gene expression cassettes in multiple rounds of amplification to obtain sufficient quantities of rBVs. Quantities of the rBVs are used for co-infection of Sf9 cells under no selection pressure in a large vessel to produce the AAV vectors. Several days after the co-infection, the insect cells and the media can be harvested together or separately for AAV purification.

[0094] In some embodiments, AAV vectors are produced using exemplary methods depicted in Figure 6. For example, rBV can be serially passaged from Pl to P10 or more under drug selection conditions. In some embodiments, large scale production can be performed at P3 and afterwards of any passages once sufficient quantity of rBV is amplified. In some embodiments, instead of harvesting the supernatant containing the rBV, such passage scheme can be applied to baculovirus-infected insect cells (BIIC), in which insect cells with shorter infection time can be harvested and be used to infect the insect cells in the next passage, and subsequent passages.

[0095] In some embodiments, AAV vectors are produced using exemplary methods depicted in Figures 7A and 7B. For example, stably maintained rBV at any passage (e.g., Pl, P2, P3, P4, P5, P6, P7, P8, P9, P10, or more) can be used for AAV vector production. In some embodiments, dual infection of Sf9 cells with 2 stable rBVs at any passage (e.g., Pl, P2, P3, P4, P5, P6, P7, P8, P9, P10, or more) can be used for small scale or large scale production (see, e.g., FIG. 7A - B). In some embodiments single infection of Sf9 cells with one stable rBV at any passage (e.g., Pl, P2, P3, P4, P5, P6, P7, P8, P9, P10, or more) can be used for small scale or large scale production (see, e.g., FIG. 7A - D).

[0096] In some embodiments, AAV vectors are produced using exemplary methods depicted in Figure 10. For example, rAD can be serially passaged from Pl to P10 or more under drug selection conditions. In some embodiments, large scale production can be performed at P3 and afterwards of any passages (e.g., P4, P5, P6, P7, P8, P9, P10, or after),e.g., once sufficient quantity of rAD is amplified. In some embodiments, instead of harvesting and preparing the lysate containing the rAD, such passage scheme can be applied to adenovirus-infected mammalian cells (AIMC), in which mammalian cells with shorter infection time can be harvested and used to infect the mammalian cells in the next passage, and subsequent passages.

[0097] In some embodiments, AAV vectors are produced using exemplary methods depicted in Figure 11. For example, stably maintained rADs at any passage (e.g., Pl, P2, P3, P4, P5, P6, P7, P8, P9, PIO, or more) can be used for AAV vector production. In some embodiments, dual infection of 293 cells with 2 stable rADs at any passage e.g., Pl, P2, P3, P4, P5, P6, P7, P8, P9, PIO, or more) can be used for small scale or large scale production (see, e.g., FIG. 11A - B).

[0098] Reference will now be made to specific examples illustrating the disclosure. It is to be understood that the examples are provided to illustrate exemplary embodiments and that no limitation to the scope of the disclosure is intended thereby.EXAMPLES EXAMPLE 1 Insect and Mammalian Cell Culture

[0099] Sf9 cells (Expression Systems, Davis, CA) were cultured in Coming storage bottles at 28°C in ESF AF media (Expression Systems) supplemented with 100 units / mL penicillin and 100 pg / mL streptomycin (HyClone, Logan, ITT). The cells were split 1:4 once the cell density reaches about 8 x 106cells / mL for maintenance. HEK293T cells (ATCC, Manassas, VA) were cultured in T-75 flasks at 37°C in DMEM medium (ATCC) supplemented with 100 units / mL penicillin and 100 pg / mL streptomycin, and 10% FBS (ATCC) in a CO2 incubator with 5% CO2. Once the cells reach confluency, they were split 1:10 every twice a week for maintenance.EXAMPLE 2Cloning of CMV-NeoR / KanR-SV40pA Selection Marker Gene Expression Cassette Linking to a Foreign Gene Expression Cassette for Baculovirus System (V597)

[0100] Plasmid V445-pFB-CMV-GFP-SV40pA (“plasmid V445”) was digested with restriction enzyme SphI and SacII at 37°C for 1 hour and then 1 pL of calf intestine phosphatase (CIP) was added. After incubation at 37°C for 15 min, the 5737 bp backbone fragment was isolated. The insert CMV-NeoR / KanR-SV40pA fragment was synthesized denovo (Twist Bioscience, South San Francisco, CA). The backbone and the two insert fragments were assembled with NEBuilder HiFi DNA Assembly Kit (New England Biolabs, Ipswich, MA) according to the manufacturer’s protocol to create V597-pFB-CMV-GFP- SV40pA-CMV-NeoR / KanR-SV40pA (“plasmid V597”). Plasmid 597 was verified with restriction digestion and DNA sequence analysis.EXAMPLE 3Cloning of CMV-AmpR-NeoR / KanR-SV40pA Selection Marker Gene Expression Cassette between two Foreign Gene Expression Cassettes for Baculovirus System (V598)

[0101] Plasmid V295-pFB-inCap5-inRep-kozak-hr2 (“plasmid V295”) was digested with restriction enzyme BstBI at 65°C for 1 hour and then 1 u L of CIP was added. After incubation at 37°C for 15 min, the 8541 bp backbone fragment was isolated. The first insert CMV- NeoR / KanR-SV40pA fragment was PCR amplified with primers 9103 (5’-TCACTGCTTG AGCCTAGATTACTAGTTATTAATAGTAATC-3’) and 9104 (5’-AATTAAAGGTCCG TAGCTTTTGACAATTTACCGAACAACT-3’) and plasmid V597 as template. The second insert plO-partial Rep fragment was PCR amplified with primers 9105 (5’-AAAGCTACG GACCTTTAATT-3’) and 9106 (5’-CTTGCAACGGCTGCTGGTG TTCGAA-3’) and the plasmid V295 as template. The backbone and the two insert fragments were assembled with NEBuilder HiFi DNA Assembly Kit (New England Biolabs) according to the manufacturer’s protocol to create V598-pFB-inCap5-CMV-NeoR / KanR-SV40pA-inRep-kozak-hr2 (“plasmid V598”). Plasmid V598 was verified with restriction digestion and DNA sequence analysis.EXAMPLE 4Cloning of p6.9-NeoR / KanR-SV40pA Selection Marker Gene Expression Cassette Linking to a Foreign Gene Expression Cassette for Baculovirus System (V620)

[0102] Plasmid V597 was digested with restriction enzyme SphI for 1 hour at 37°C and then 1 pL of CIP was added. After incubation at 37°C for 15 min, the 6277 bp backbone fragment was isolated. The first insert p6.9 promoter fragment was PCR amplified with primers 9196 (5’-GAGCGCGCAGCTGCCTGCAGGCATGCCTCAGTCGGATGTA TTACAA-3’) and 9197 (5’-TGGTGGCGGATCCGTTTAAATTGTGTAATTTATGT-3’) and plasmid V422-pcDNA-p6.9-gp64-pIEl-NeoR / KanR as template. The second insert NeoR / KanR partial fragment was PCR amplified with primers 9198 (5’-ATTTAAACGG ATCCGCCACCATGATTGAACAAGATGGATTGCACG-3’) and 9199 (5’-GACGAGA TCCTCGCCGTCGGGCATG-3’) and the plasmid V422 as template. The backbone and twoinsert fragments were assembled with the NEBuilder HiFi DNA Assembly Kit (New England Biolabs) to create V620-pFB-CMV-GFP-p6.9-NeoR / KanR-SV40pA (“plasmid V620”). Plasmid V620 was verified with restriction digestion and DNA sequence analysis.EXAMPLE 5Cloning of p6.9-Zeocin-bGHpA Selection Marker Gene Expression Cassette between two Foreign Gene Expression Cassettes for Baculovirus System (V648)

[0103] The plasmid V621-pFB-inCap9-p6.9-Puro-SV40pA-inRep (“plasmid V621”) was digested with restriction enzymes Mfel and AflII for 1 hour at 37°C and then 1 pL of calf intestine phosphatase was added. After incubation at 37°C for 15 min the 8557 bp backbone fragment was isolated. The insert p6.9-Zeocin-bGHpA fragment was synthesized de novo (Twist Biosciences, South San Francisco, CA) and dissolved in TE buffer. The backbone and insert fragments were assembled with the NEBuilder HiFi DNA Assembly Kit to create V648- pFB-inCap9-p6.9-Zeocin-bGHpA-inRep (“plasmid V648”). Plasmid V648 was verified with restriction digestion and DNA sequence analysis.EXAMPLE 6Cloning of p6.9-Puro-SV40pA Selection Marker Gene Expression Cassette between two Foreign Gene Expression Cassettes for Baculovirus System (V649)

[0104] Plasmid V289-pFB-inCap9-inRep-kozak-hr2 (“plasmid V289”) was digested with restriction enzyme BstBI at 65°C for 1-hour followed by EcoRV at 37°C for another hour. Then 1 p L of CIP was added. After incubation at 37°C for 15 min, the 6106 bp backbone fragment was isolated. The first insert plO-inRep-HSVTKpA fragment was PCR amplified with primers 9105 (5’-AAAGCTACGGACCTTTAATT-3’) and 9201 (5’-TAGGTGGCGG TACTTGGGTCGATATCGGCTTGCCGCCCCGACGTTG-3’) and V289 as template. The second insert p6.9-Puro-SV40pA fragment was synthesized de novo (Twist Bioscience). The backbone and two insert fragments were assembled with the NEBuilder HiFi DNA Assembly Kit (New England Biolabs) to create V649-pFB-inCap9-p6.9-Puro-SV40pA-inRep (“plasmid V621”). Plasmid V649 was verified with restriction digestion and DNA sequence analysis.EXAMPLE 7Cloning of V650-pFB-inCap5-CMV-NeoR / KanR-SV40pA-inRep-p6.9-Zeocin-bGHpA with dual Selection Marker Gene Expression Cassettes for Baculovirus System (V650)

[0105] Plasmid V598 is digested with restriction enzymes BsrGI and Swal to isolate the 10,681-bp backbone fragment. The HSVtkpA-p6.9-Zeocin-bGHpA fragment is synthesized de novo and assembled into the BsrGI and Swal sites of V598 backbone fragment using the NEBuilder HiFi DNA Assembly Kit (New England Biolabs) to create V650-pFB-inCap5- CMV-NeoR / KanR-SV40pA-inRep-p6.9-Zeocin-bGHpA (“plasmid V650”). Plasmid V650 is verified with restriction digestion and DNA sequence analysis.EXAMPLE 8 Cloning of Selection Marker Gene Expression Cassette Linking to a Foreign Gene Expression Cassette for Baculovirus System (V651)

[0106] Plasmid V293, which is a shuttle plasmid for the homologous recombination baculovirus system, is digested with restriction enzymes Xbal and Nrul at 37°C for 1 hour and treated with CIP for 15 min to isolate the 10,133-bp backbone fragment. The backbone fragment is ligated to the XbaLNruI digested 2566-bp insert fragment from plasmid V598 to create plasmid V651-pBP-inCap5.2-CMV-NeoR_KanR-SV40pA-inRep (“plasmid V651”). The plasmid is verified with restriction digestion and DNA sequence analysis.EXAMPLE 9Cloning of Two Selection Marker Gene Expression Cassettes Linking to Multiple Foreign Gene Expression Cassettes for Baculovirus System (V657)

[0107] Plasmid V620 is cut with restriction enzyme Aflll at 37 °C for 1 hour and treated with CIP for 15 min. A linearized 7084 bp backbone fragment is isolated. The first insert inCap5-inRep is PCR amplified with primers 9343 (5’-GTCCAAACTCATCAATGT ATCTTACGGATCTCCTAGGTATACTCCGGAAT-3’) and 9344 (5’-TTGCCGCCCCG ACGTTGGCT-3’) and plasmid V295 as template. The second insert IE 1 -promo ter-Zeocin- hGHpA is synthesized de novo. These two inserts are assembled with the backbone fragment using the NEBuilder HiFi DNA Assembly Kit to create V657-pFB-CMV-GFP-p6.9- NeoR_KanR-inCap5-inRep-IEl-Zeocin (“plasmid V657”). The plasmid V657 is verified with restriction digestion and DNA sequence analysis. The verified plasmid V657 is used to create a single rBV including all necessary components for AAV production.EXAMPLE 10Cloning of a Selection Marker Gene Expression Cassette Linking to a Foreign Gene Expression Cassette for Adenovirus System (V659 & V717)

[0108] Plasmid V655-pAdONE-5L-CMV-GFP-hGHpA (“plasmid V655”) is cut with restriction enzymes EcoNI and BspHI at 37 °C for 1 hour and treated with CIP for 15 min to isolate the 4969 bp backbone fragment. The first insert UbC promoter-Zeocin-AAVpA is PCR amplified with primers 9349 (5’-CGAGGGGGGGCCCGGTACCCCTAGTGGCCTCCGCGC CGGGTTTTG-3’) and 9126 (5’-TATTCTTTCCCACCCTTAAGCTAGTTGTAGTTAATG ATTAACCCGCCAT -3’) and V656 as template. The second insert Ad-5’-arm with incorporated Swal site is PCR amplified with primers 9351 (5’-ACTAGCTTAAGGG TGGGAAAGAATA-3’) and 9352 (5’-TGCGGTATTTCACACCGCATATATTTAAA TCCGCTCGAGGACAGGCCTCT-3’) and V656 as template. The third insert Ori fragment is PCR amplified with primers 9353 (5’-ATGCGGTGTGAAATACCGCA-5’) and 9354 (5 ’ - GAAGATCCTTTTTGATAATC-3’) and plasmid V656 as template. These three inserts are assembled with the backbone fragment using the NEBuilder HiFi DNA Assembly Kit to create V659-pAdONE-5L-CMV-GFP-hGHpA-UbC-Zeocin-AAVpA (“plasmid V659”; FIG. 8B). The resulted plasmid is verified with restriction digestion and DNA sequence analysis. The first fragment 5’-Ad-ITR-t| / -AAV-ITR-CMV was PCR amplified with primers 9420 (5’- CTAGCTACGAATTCTTCGACCCATTCG CCATTCAGGATCG-3’) and 7685 (5’- GCTCCTCGCCCTTGCTCAC-3’) and plasmid V659 as template. The second fragment GFP- hGHpA-UBC-Zeocin-AAVpA was PCR amplified with primers 4316 (5’-GTGAGCAAG GGCGAGGAGC-3’) and 9126 (5’-TATTCTTTCCCACCCTTAAGCTAGTTGTAG TTAATGATTAACCCGCCAT-3’) and V659 as template. These 2 fragments were assembled into the BstBI digested pAdEasy-1 using the NEBuilder HiFi DNA Assembly Kit to create V738-pAdONE-AAV-CMV-GFP-UBC-Zeocin-full Ad-genome.

[0109] Plasmid V672 is cut with restriction enzymes Agel at 37°C for 1 hour and treated with CIP for 15 min to isolate the 9099 bp backbone fragment. A first DNA fragment containing partial hGH intron sequence is amplified with primers 9397 (5’-TGGCCGAG GAGCAGGACTGAACCGGTCCAATCTCAGAAAG-3’) and 4503 (5’-CTGGGGAG AAACCAGAGGGCA-3’) using V672 as template. A second DNA fragment containing partial rep sequence is amplified with primers 9588 (5’-GCCCTCTGGTTTCTCCCC AGGTTCGCGAAAAACTGATTCA-3’) and 8015 (5’-GAACGCTGGGGTGATGGC TCTACCG-3’) using V672 as template. Both PCR fragments are assembled with the backbone fragment using the NEBuilder HiFi DNA Assembly Kit to create V717-pAdONE- 5L-p5-inRep-pGK-Zeocin-p40-Cap8 (“plasmid V717”; FIG. 8C). The resulted plasmid is verified with restriction digestion and DNA sequence analysis. V717 is used as template toamplify the Ad5-ITR-\| / -p5-inRep-hpGK-Zeocin fragment with primers 9420 (5’- CTAGCTACGAATT CTTCGACCCATTCGCCA TTCAGGATCG-3’) and 5999 (5’- AGGTTGTCCTCGAG CCAATC-3’) and the p40-Cap8-hGHpA fragment using primers 5389 (5’-CAGATTGGC TCGAGGACAAC-3’) and 9422 (5’- TTTCCCACCCTTAAGCTAGTACTAGTGAATT CCGCAGGCC-3’). These two fragments are assembled into BstBI digested pAdEasy-1 using the NEBuilder HiFi DNA Assembly Kit to create V737-pAdONE-p5-inRep-hpGK-Zeocin-p40-Cap8-hGHpA-full Ad-genome.EXAMPLE 11 Recombinant Baculovirus Generation

[0110] Recombinant baculovirus is generated in two different ways. For homologous recombination-mediated method, 500 ng of shuttle plasmid containing the gene of interest (GOI) is mixed with 5 pL of Bsu36I-linearized baculovirus genome (Takara Bio USA, San Jose, CA) in final 95 pL ESF AF medium. Five microliters of GenJet reagent (SignaGene Labs, Rockville, MD) is diluted in 95 pL ESF AF medium and then mixed with the diluted DNA for 30 min. The GenJet-DNA mixture is diluted with 0.8 mL of fresh ESF AF medium and then added to le+6 Sf9 cells seeded in a 6-well plate. After incubation at 28°C overnight, 1 mL additional ESF AF medium is added to the cells. The cells are incubated for 7 to 10 days until recombinant baculovirus (rBV) is generated. The supernatant is harvested and titer of rBV determined. Then the rBV is used to infect Sf9 cells for multiple rounds of amplification / passaging using low moi under selection conditions to maintain the GOI stably in the rBV. To ensure drug resistance, the rBV infection is carried out for sufficient time for the resistant gene to express before selection drug being added. Each passage / amplification is carried out in the same manner to ensure that the insect cells infected with the rBV carrying the foreign gene expression cassette(s) together with the selection marker gene expression cassette(s) survive, whereas the insect cells infected with the rBV without the selection marker gene expression cassette(s) are killed and eliminated.

[0111] For transposon-mediated method, shuttle plasmids containing the GOIs were used to transform DHIOBac competent bacteria to select recombinant bacmids according to manufacturer’s protocol (Invitrogen, Carlsbad, CA). Briefly, the shuttle plasmids were diluted in sterile TE buffer (10 mM Tris-HCL, 1 mM EDTA, pH 8.0) to a concentration of 2 ng / pL, and 2 pL of the diluted plasmid DNA was used to transform 20 pL of DHIOBac competent cells. After 2 days of incubation on the LB-agar plates containing appropriate concentrationsof antibiotics, X-gal, and IPTG at 37°C, white colonies were picked and miniprep bacmid DNAs prepared according to manufacturer’s protocol (Invitrogen).

[0112] The miniprep bacmid DNAs were then used to transfect Sf9 cells to generate recombinant baculoviruses according to manufacturer’s protocol (Invitrogen) with modifications. Briefly, 5 pg miniprep bacmid DNA and 5 pL GenJet reagent (SignaGene Labs, Rockville, MD) were each diluted in 100 pL of ESF AF media (Expression Systems) in sterile 1.5 mL microfuge tubes. The diluted GenJet reagent was transferred to the diluted bacmid DNA tube and mix by gentle pipette up and down for 3 times. After incubation at room temperature for about 30 min, 0.8 mL ESF AF media was added to the GenJet-bacmid mixture and mixed by pipette up and down 3 times. Sf9 cells were plated on 6-well plate at density of 1.5 x 106cells / well in 2 mL ESF AF media and incubated at 28 °C in an incubator for about 30 min to attach. The media from each well was removed and the GenJet-bacmid mixture was then added. After incubation at 28°C in the incubator overnight, 1 mL of ESF AF media was added and the plate was incubated at 28°C for a total of 4 days for recombinant baculovirus to be generated. The recombinant baculoviruses in the media were collected and stored at 4°C under dark. For serial passaging, the rBV was used to infect fresh Sf9 cells in 6- well plates or larger vessels overnight and then selection drugs were added. The infection was carried out for a total of 3 to 5 days depending on the cytopathic effect (CPE). Then supernatants were harvested and rBV tittered. Next passage was performed in the same manner until passage 10 or more.EXAMPLE 12 Recombinant Adenovirus Generation

[0113] Recombinant adenovirus (rAd) is generated by transfecting the PacI digested plasmid DNA into the HEK293 cells. Briefly, pAdONE plasmids comprising the full adenovirus genome (FIG. 9A-B) were digested with the Pad enzyme to free both Ad-ITR ends. The digested DNA was extracted with phenol-chloroform-isoamyl and transfected into HEK293 cells to create recombinant adenovirus. The recombinant adenovirus is passaged under selection condition to maintain the heterologous DNA stably integrated in the adenovirus genome.EXAMPLE 13 Quantification of rBV

[0114] To determine the titers of recombinant baculoviruses, a specific QPCR method for rBV titration was employed. To determine the total quantity of rBV, QPCR primer set 3243 (5’-CCCTCTGTGTACTTGGCTCTAACG-3’) and 3244 (5’-CGGTGAAACGCAAA GTCGAGCACCG-3’) corresponding to baculovirus gp64 gene was used. To determine the quantity of specific rBV carrying GFP expression cassette, QPCR primer set 2095 (5’- TCGTGACCACCCTGACCTAC-3’) and 2096 (5’-AAGTCGTGCTGCTTCATGTG-3’) corresponding to the GFP coding sequence was used. To determine the quantity of rBV carrying AAV2 Rep coding sequences, QPCR primer set 3474 (5’-ATTCATGCTCC ACCTCAACC-3’) and 3475 (5’-GCCGTCTGGATCATGACTTT-3’) corresponding to the Rep coding sequence was used. Briefly, 50 pL rBV supernatant was mixed with 50 pL 0.2% SDS solution and heated at 95 °C for 30 min to release the rBV DNA. The rBV DNA was then diluted 1 :100 with QPCR dilution buffer (10 pg / mL yeast tRNA (Sigma Aldrich, Saint Louis, MO), 0.01% Tween 80, 10 mM Tris-HCl (pH 8.0), 1 mM EDTA). The copy numbers (quantity) of rBV were determined with QuantStudio 3 (Thermo Fisher Scientific, CA). One plaque forming unit (pfu) was empirically determined to contain average of 20 copies of rBV genomes.EXAMPLE 14 Quantification of r Ad

[0115] The total rAd titers were determined with QPCR method using primers 9355 (5’- GCGAAGGTGACATCGTTGAA-3’) and 9356 (5’-ACATCAACGGCTTTGACGAG-3’) which are located within the adenovirus DNA polymerase coding region. The specific titer of rAd carrying CMV-GFP was determined with primers 1878 (5’-TGACGTCAATGGG AGTTTGT-3’) and 1879 (5’-GGCGGAGTTGTTACGACATT-3’) corresponding to the CMV promoter. The specific titer of rAd carrying AAV2 Rep was determined with primers 3474 and 3475 corresponding to the Rep coding sequence as described above. Briefly, 50 pL rAd supernatant was mixed with 50 pL 0.2% SDS solution and heated at 95°C for 30 min to release the rAd DNA. The rAd DNA was then diluted 1:100 with QPCR dilution buffer (10 pg / mL yeast tRNA (Sigma Aldrich, Saint Louis, MO), 0.01% Tween 80, 10 mM Tris-HCl (pH 8.0), 1 mM EDTA). The copy numbers (quantity) of rAd were determined with QuantStudio 3 (Thermo Fisher Scientific, CA).EXAMPLE 15Comparison of rBV Stability with and without Drug Selection in Serial Passages in Insect cells under Different Multiplicity of Infection (moi)

[0116] The rBVs with drug selection marker gene expression cassettes were generated and used for passaging in Sf9 cells multiples times with or without selection drug G418 compare their stability of retaining the foreign gene expression cassettes. The rBVs listed in Table 1 were used and will be used in the comparison experiments.Table 1. List of shuttle plasmids used for generation of rBVs through the Bac-to-Bac system.Clone Plasmid name Heterologous Selection marker no. sequence geneV597 pFB-CMV-GFP-SV40pA-CMV-NeoR / KanR- CMV-GFP-SV40pA NeoR / KanRSV40pAV598 pFB-inCap5-CMV-NeoR / KanR-SV40pA-inRep- Cap5 and Rep2 NeoR / KanR hr2V620 pFB-CMV-GFP-SV40pA-p6.9-NeoR-SV40pA CMV-GFP-SV40pA NeoR / KanRV648 pFB-inCap5-CMV-Zeocin-SV40pA-inRep- Cap5 and Rep2 Zeocin kozak-hr2V649 pFB-inCap9-p6.9-Puro-SV40pA-inRep Cap9 and Rep2 PuroV676 pFB-inCap5-p6.9-KanR-SV40pA-inRep-kozak- Cap5 and Rep2 NeoR / KanR hr2

[0117] The first stability studies were performed with the first two rBVs (clone no. V597 and V598) in 6-well plates. After bacmid transfection into the Sf9 cells for 4 days, rBVs were harvested respectively by collecting the media and centrifugation briefly to remove cell debris. The supernatants (P0) were measured for their total and specific quantities of rBVs. The rBVs were used to infect Sf9 cells in 6-well plates at moi of 0.1, and 0.05 overnight based on total rBV titers in 1 mL / well. Then 1 mL of selection drug G418 at the concentration of 0.5 mg / mL was added to treat the cells at 28°C. One set of rBV infection at 0.1 moi without adding G418 was used as control. After infection for 3 to 4 days, the media were harvested without the cells and total rBV titers determined by quantitative PCR (QPCR) using primers 3243 and 3244 corresponding to the gp64 gene as described above and SYBR Green Master Mix (Thermo Fisher). The specific titers of rBV carrying the heterologous DNA sequence were also determined by QPCR method but with primers 2095 and 2096 corresponding to GFP coding sequence and primers 3474 and 3475 corresponding to the AAV2 Rep gene. The ratio of specific titer to total rBV titer was used as indication of rBV stability. If the ratio was 100%, it was considered to be no deletion of heterologous DNA sequence and an indication of perfect stability of the rBV. However, if the ratio was 0%, the heterologous DNA sequence was considered totally deleted. The results of the first studies are shown in Table 2 and 3. The ratio of specific to total rBV titer in rBV harvested right after bacmid transfection (P0) was set to100% assuming no deletion of the heterologous DNA sequence since the rBVs were newly generated from a homogenous single bacmid clone before passaging. The data in Table 2 indicate that without the selection drug G418, rBV-V597 lost the foreign gene expression cassette gradually. At P5, rBV-V597 passaged at moi of 0.1 retained only 53% of the GFP expression cassette. At P10, there were only 3% of rBV retaining the GFP expression cassette. In the presence of selection drug G418, at P5, rBV-V597 passaged at moi of 0.1 retained only 54% of the GFP expression cassette, similar to the control. At P10, rBV-V597 with drug selection at 0.1 moi retained 3% of the GFP expression cassette, the same as the control, indicating that drug selection did not improve the stability of the rBV under this condition. However, when the rBV-V597 was passaged at 0.05 moi, the ratio of retaining the GFP expression cassette increased slightly. At P5, it was 60% and at P10, it was 7%, slightly better than 3% at 0. 1 moi with or without drug selection.Table 2. Stability of rBV-V597 from passage PO to PIO under conditions without or with drug selection.Specific rBV / Total rBV ratioPassage no. 0.1 moi (-) G418 0.1 moi (+) G418 0.05 moi (+) G418P0 100% 100% 100%Pl 100% 102% 93%P2 106% 74% 109%P3 78% 61% 83%P4 61% 49% 62%P5 53% 54% 60%P6 24% 18% 27%P7 10% 15% 19%P8 10% 18% 22%P9 8% 9% 10%P10 3% 3% 7%

[0118] For rBV-V598 passaged at 0.1 moi without drug G418 selection, the ratio of specific rBV to total rBV at P5 was 65%. At PIO, it decreased to 2%, indicating that the AAV- Cap5-Rep2 gene expression cassettes were highly unstable. However, in the presence of drug selection, the rBV stability increased substantially. At P5, it retained 84%, and at PIO, it still retained 10% of rBV carrying the Cap5-Rep2 gene expression cassettes at 0.1 moi. Surprisingly, when rBV-V598 was passaged at 0.05 moi, the stability increased significantly. At P5, the ratio of specific rBV to total rBV was at 91% and at P10, there were still 43% of rBV carrying the Cap5-Rep2 gene expression cassettes.

[0119] When further analysis of the DNA sequences of both plasmids V597 and V598 was performed, a noticeable difference was revealed. V597 (FIG. 3D) contained not only two AAV ITR sequences flanking the GFP expression cassette, but also two identical CMV promoter sequences each having 570 bps in length. In addition, there were two SV40pA sequences each having 122 bps. These homologous sequences would cause homologous recombination during multiple passages which could lead to deletions of the GFP gene expression cassette. Even though there was a drug selection pressure, the GFP gene expression cassette was gradually lost possibly due to the large duplicates of CMV promoter sequences. In order to rule out this possibility, a new construct V620 was cloned in which the CMV promoter driving the expression of NeoR / KanR was replaced with the p6.9 promoter (FIG. 3A).Table 3. Stability of rBV-V598 from passage PO to PIO under conditions without or with drug selection.Specific rBV / Total rBV ratioPassage no. 0.1 moi (-) G418 0.1 moi (+) G418 0.05 moi (+) G418P0 100% 100% 100%Pl 109% 95% 91%P2 72% 90% 97%P3 77% 88% 74%P4 70% 79% 90%P5 65% 84% 91%P6 33% 60% 80%P7 15% 44% 72%P8 10% 34% 60%P9 5% 20% 53%P10 2% 10% 43%Table 4. Stability of rBV-V620 from passage P0 to P10 under conditions without or with drug selection.Specific rBV / Total rBV ratioPassage no. 0.1 moi (-) G418 0.1 moi (+) G418 0.05 moi (+) G418P0 100% 100% 100%Pl 73% 65% 71%P2 83% 120% 102%P3 63% 86% 105%P4 36% 108% 112%P5 19% 91% 90%P6 8% 65% 89%P7 5% 68% 97%P8 1% 34% 71%P9 3% 35% 85%PIO 1% 14% 80%

[0120] rBV-V620 was generated and rBV stability was investigated by passaging the rBV multiple times and measuring the ratio of specific rBV to total rBV. The results are shown in Table 4. In the same way the specific rBV to total rBV ratio at P0 was adjusted to 100%. The data from Table 4 indicate that after replacing the CMV promoter with the p6.9 promoter, the rBV carrying the GFP gene expression cassette was very stable. At P5, while the control (no drug selection) showed only 19% of rBV carrying the GFP gene expression cassette, there were very high percentages of rBV carrying the GFP gene expression cassette at both 0. 1 moi (91%) and 0.05 moi (90%) for infections under the drug selection conditions. At P10, nearly all GFP gene expression cassette was deleted from the rBV without drug selection. However, under drug selection at P10, there were 14% of the rBV retaining the GFP gene expression cassette at 0.1 moi and 80% rBV retaining the GFP gene expression cassette at 0.05 moi.

[0121] A different selection marker gene, puromycin resistant gene, was cloned into rBV- V649 (FIG. 2C) and it worked as well as the G418 resistant gene for stabilizing the rBV comprising foreign DNA sequences. rBV-V649 was passaged from Pl to P10 at 0.1 and 0.05 moi with or without drug selection pressure. The data in Table 5 indicate that puromycin resistant gene can prevent foreign gene expression cassette from deletion from the rBV. At P5 without puromycin selection, there were only 17% rBV retaining the rep sequence. However, under puromycin selection, the rBV retained 78% (passaged at 0. 1 moi) and 71% (passaged at 0.05 moi) of the rep sequence. At P9, the rBV lost all rep sequence without puromycin selection. However, under puromycin selection, 74% (passaged at 0.1 moi) and 26% (passaged at 0.05 moi) of the rBV retained the rep sequence. These results together with the results obtained with rBV-V598 and rBV-V620 demonstrate that drug selection during serial passaging can prevent rBV from deleting the foreign gene expression cassette independent of what types of promoters, drug resistant genes, polyadenylation signals, and foreign gene expression cassettes being used. These data further indicate that large repeat sequences (500 bp or more) will cause rearrangement / recombination and lead to deletion of the foreign gene expression cassette from the rBV even under drug selection pressure.

[0122] Using strong p6.9 promoter to replace the weak CMV promoter in the selection marker gene cassette improved the stability of rBV comprising the AAV genome (compare rBV-V597 in Table 2 with rBV-V620 in Table 4). The same stability improvement was alsoobserved in rBV comprising the AAV-rep and cap5 genes (compare rBV-V598 in Table 3 with rBV-V676 in Table 6).Table 5. Stability of rBV-V649 from passage PO to PIO under conditions without or with drug selection.Specific rBV / Total rBV ratioPassage no. 0.1 moi (-) Puromycin 0.1 moi (+) Puromycin 0.05 moi (+)PuromycinP0 100% 100% 100%Pl 79% 134% 203%P2 80% 119% 274%P3 68% 83% 75%P4 43% 97% 79%P5 17% 78% 71%P6 4% 104% 84%P7 3% 92% 59%P8 1% 82% 42%P9 0% 74% 26%P10 0% 52% 15%Table 6. Stability of rBV-V676 from passage PO to PIO under conditions without or with drug selection.Specific rBV / Total rBV ratioPassage no. 0.1 moi (-) G418 0.1 moi (+) G418 0.05 moi (+) G418P0 100% 100% 100%Pl 117% 117% 123%P2 106% 119% 143%P3 128% 129% 137%P4 70% 137% 119%P5 40% 134% 139%P6 13% 132% 145%P7 5% 113% 151%P8 2% 87% 135%P9 1% 46% 113%P10 2% 46% 98%EXAMPLE 16Timing of Adding Selection Drug to the Culture during rBV Infection

[0123] Protection of insect cells from killing effect of selection drug depends on the presence of sufficient quantity of anti-drug protein in the cells. The previous data indicate that when the drug was added one day after rBV infection, the insect cells were protected from the killing effect of the drug and produced high titers of rBV. If the selection drug were added at the same time when rBV infection were started, the insect cells might not survive the selectiondrugs killing effect due to the lack of drug-resistant enzyme. To test this possibility, further experiments were performed to determine when the selection drug can be added without compromise the rBV production. Briefly, Sf9 cells were seeded in 6-well plates, and rBV infection initiated. The selection drug G418 was added at 0, 1, 2, 4, 8, 16, and 24 hours after rBV infection and rBV titers determined. From these results it was determined that if the selection drug was added at the same time of rBV infection, most of the cells were killed and rBV titer was at the background level. However, when the drug was added 6 hours after rBV infection, the rBV titers were normal. These results indicate that selection drugs should be added several hours after rBV infection so that the drug resistant genes can be expressed to protect the cells from the killing effect of the selection drugs.EXAMPLE 17 AAV Vector Production and Purification

[0124] rBV is used to infect insect cells to produce AAV vectors. Briefly, 10 moi of rBV containing AAV Rep and Cap genes is co-infected with 5 moi of rBV containing the GFP marker gene flanked by AAV ITRs for 3 days at 28°C. Cell pellets are collected by centrifugation at 3000 rpm for 10 min. The cell pellets are lysed in SF9 lysis buffer (50 mM Tris-HCl, pH 7.8, 50 mM NaCl, 2 mM MgCl2, 1% Sarkosyl, 1% Triton X-100, and 140 units / mL Benzonase nuclease (Sigma Aldrich) by sonication. Cell debris is removed by centrifugation at 8,000 rpm for 20 min. The cleared lysates of about 23 mL each are transferred to ultraclear centrifuge tubes for SW28 rotor (Beckman Coulter, Brea, CA), followed by 10 mL of 1.32g / cc and 5 mL of 1.55 g / cc CsCl solutions and centrifuged at 28,000 rpm at 15°C for about 20 hours. The AAV vector band is visualized with a beam light shining underneath and collected with a syringe needle. The collected AAV vectors are transferred into another centrifuge tube for a 70.1 ti rotor (Beckman Coulter) which is then filled with 1 .38 g / cc CsCl solution and sealed. After centrifugation at 65,000 rpm for about 20 hours, the AAV vector band is visualized with a beam light shining underneath and collected with a syringe needle. The AAV vectors are buffer exchanged with PD-10 desalting columns (GE Healthcare Bio-Sciences, Pittsburgh, PA). After filter sterilization, the AAV vectors are used for further experiments.EXAMPLE 18 AAV Vector Quantification

[0125] AAV vectors in crude lysates or in purified form are quantified with QPCR according to protocol described by Aurnhammer et al. (Aurnhammer, Haase et al. 2012) with modifications. Briefly, AAV samples are first diluted 1: 100 with QPCR dilution buffer and contaminating DNA is removed by incubating 10 pl diluted AAV with 1 pl (2 units) DNasel enzyme (New England Biolabs) in 39 pl DNasel digestion buffer (10 mM Tris-HCl, pH 8.0, 2.5 mM MgCh, 0.5 mM CaCh) at 37°C for 1 hour. The DNase I enzyme is inactivated by mixing with 50 pl of 200 mM EDTA and heating at 95°C for 30 min. The treated AAV samples are further diluted 1:200, and 10 pl of each AAV sample is used in the Chromo4 QPCR machine (Bio-Rad, Hercules, CA) to determine the copy numbers of AAV vector genome.EXAMPLE 19 rBVs after 10 Passages under Drug Selection Produced High Yields of AAV Vectors

[0126] rBVs passaged to PIO with drug selection were used for AAV productions in a 200- mL culture volume and compared with Pl rBVs for AAV production yields. The results are shown in Table 7. The rBVs at P10 with drug selection can produce significant levels of AAV yields, although at slightly lower yields when compared to the Pl rBVs.Table 7. Comparison of AAV production yields between passage Pl to P10 rBVs. rBVs used for Lot AAV titers (vg / mL) Sample vol. (mL) Total vg production no. / SerotypeV598 (Pl) + V620 (Pl) 24-013 / AAV5 9.13E+13 2.0 1.84E+14V598 (P10) + V620 (P10) 24-014 / AAV5 1.72E+13 1.5 2.58E+13V649 (Pl) + V620 (Pl) 24-222 / AAV9 9.10E+13 0.5 4.55E+13V649 (P10) + V620 (P10) 24-223 / AAV9 1.24E+14 0.5 6.20E+13V676 (Pl) + V620 (Pl) 24-302 / AAV5 2.64E+14 0.5 1.32E+14V676 (P10) + V620 (P10) 24-303 / AAV5 1.11E+14 0.5 5.55E+13EXAMPLE 20 Infectivity of AAV Vectors

[0127] The infectivity of AAV vectors is tested using the in vitro AAV transduction assays.Briefly, AAV samples are serial diluted in DMEM medium containing 20 pg / mL etoposide (A.G. Scientific, San Diego, CA) and 0.5 mL of the diluted AAV samples is added to each well of a 24-well plate with HEK293T cells seeded at 3E+5 cells / well the previous day. After3 days of transduction, GFP expression is recorded with the infinite M200PRO plate reader (TECAN) and the intensity of the GFP expression is analyzed and compared. The results are shown in FIG. 12. AAV vectors (Lot# 24-014) produced with rBVs at passage 10 under drug selection show similar infectivity to the AAV vectors (Lot# 24-013) produced with rBVs at passage 1, indicating that the rBVs were very stable when passaged under drug selection pressure and that no detrimental effect on AAV infectivity was observed.EXAMPLE 21 Capsid Ratio of AAV Vectors Produced by rBVs under Selection Pressure

[0128] AAV vectors produced by rBVs after 10 passages under selection pressure were compared with AAV vectors produced with Pl rBVs for their capsid ratios. Briefly, purified AAV vectors were heated at 75°C for 10 min in the presence of SDS-loading dye and subjected to SDS-PAGE. The gel was stained and protein quantified with iBright Imager (Thermo Fisher Scientific, CA). The results shown in FIG. 13 and Table 8 demonstrate that the rBVs were very stable when passaged under drug selection pressure and that no change of AAV capsid ratio was observed.Table 8. Comparison of AAV capsid ratios between AAV vectors produced by Pl and PIO rBVs.Lane AAV sample VP content VP ratioVP1 VP2 VP3 VP total VP1 VP2 VP31 AAV8 control 1.491 1.289 8.732 11.512 13% 11% 76%2 AAV5 by Pl rBVs 1 0.982 6.058 8.04 12% 12% 75%3 AAV5 by P10 rBVs 1.036 0.959 6.038 8.033 13% 12% 75%EXAMPLE 22Genome Integrity of AAV Vectors Produced by rBVs under Selection Pressure

[0129] AAV vectors produced by rBVs after 10 passages under selection pressure were compared with AAV vectors produced with rBVs of passage 1. Briefly, AAV vectors are heated at 75 °C for 10 min in the presence of SDS to release the viral DNA molecules. The AAV DNA is mixed with loading dye and loaded on a 1% agarose gel and subjected to electrophoresis at 100 V for about 30 min or until the dye nearly reach the end of the agarose gel. The results shown in FIG. 14 indicate that the same AAV genome patterns are observed, indicating that repeated passaging the rBV under drug selection conditions did not impact the AAV genome integrity.EXAMPLE 23High-Fidelity of Heterologous DNA sequences maintained in rBV after multiple passages under Selection Pressure

[0130] The heterologous DNA sequences in the rBV were analyzed by Sanger DNA sequencing method. Briefly, Baculoviral DNA at PIO was extracted from infected Sf9 cells and the heterologous DNA sequences were PCR amplified and used for DNA sequencing analyses. The PIO heterologous DNA sequencing results are shown in FIG.15. The results indicate that there were no DNA mutations in the rBV sequences passaged 10 times in the insect cells, demonstrating the high-fidelity features of the stable rBVs.ReferencesAurnhammer, C., M. Haase, N. Muether, M. Hausl, C. Rauschhuber, I. Huber, H. Nitschko, U. Busch, A. Sing, A. Ehrhardt and A. Baiker (2012). "Universal real-time PCR for the detection and quantification of adeno-associated virus serotype 2-derived inverted terminal repeat sequences." Hum Gene Ther Methods 23(1): 18-28.Chen, H. (2008). "Intron splicing-mediated expression of AAV Rep and Cap genes and production of AAV vectors in insect cells." Mol Ther 16(5): 924-930.Galibert, L. and O. W. Merten (2011). "Latest developments in the large-scale production of adeno-associated virus vectors in insect cells toward the treatment of neuromuscular diseases." J Invertebr Pathol 107 Suppl: S80-93.Galibert, L., A. Savy, Y. Dickx, D. Bonnin, B. Bertin, I. Mushimiyimana, M. M. van Oers and O. W. Merten (2018). "Origins of truncated supplementary capsid proteins in rAAV8 vectors produced with the baculovirus system." PLoS One 13(11): e0207414.Grimm, D., M. A. Kay and J. A. Kleinschmidt (2003). "Helper virus-free, optically controllable, and two-plasmid-based production of adeno-associated virus vectors of serotypes 1 to 6." Mol Ther 7(6): 839-850.Kaba, S. A., A. M. Salcedo, P. O. Wafula, J. M. Vlak and M. M. van Oers (2004). "Development of a chitinase and v-cathepsin negative bacmid for improved integrity of secreted recombinant proteins." J Virol Methods 122(1): 113- 118.Kohlbrenner, E., G. Aslanidi, K. Nash, S. Shklyaev, M. Campbell-Thompson, B. J. Byrne, R. O. Snyder, N. Muzyczka, K. H. Warrington, Jr. and S. Zolotukhin (2005). "Successful production of pseudotyped rAAV vectors using a modified baculovirus expression system." Mol Ther 12(6): 1217-1225.Kotin, R. M. (2011). "Large-scale recombinant adeno-associated virus production." Hum Mol Genet 2O(R1): R2-6.Luckow, V. A., S. C. Lee, G. F. Barry and P. O. Olins (1993). "Efficient generation of infectious recombinant baculoviruses by site-specific transposon-mediated insertion of foreign genes into a baculovirus genome propagated in Escherichia coli." J Virol 67(8): 4566-4579.Pijlman, G. P., C. Grose, T. A. H. Hick, H. E. Breukink, R. van den Braak, S. R. Abbo, C. Geertsema, M. M. van Oers, D. E. Martens and D. Esposito (2020). "Relocation of the attTn7 Transgene Insertion Site in Bacmid DNA Enhances Baculovirus Genome Stability and Recombinant Protein Expression in Insect Cells." Viruses 12(12).Pijlman, G. P., J. E. van Schijndel and J. M. Vlak (2003). "Spontaneous excision of BAC vector sequences from bacmid-derived baculovirus expression vectors upon passage in insect cells." J Gen Virol 84(Pt 10): 2669-2678.Su, W., M. I. Patricio, M. R. Duffy, J. M. Krakowiak, L. W. Seymour and R. Cawood (2022). "Self-attenuating adenovirus enables production of recombinant adeno-associated virus for high manufacturing yield without contamination." Nat Commun 13(1): 1182.van Oers, M. M., G. P. Pijlman and J. M. Vlak (2015). "Thirty years of baculovirus-insect cell protein expression: from dark horse to mainstream technology." J Gen Virol 96(Pt 1): 6-23.Xiao, X., J. Li and R. J. Samulski (1998). "Production of high-titer recombinant adeno- associated virus vectors in the absence of helper adenovirus." J Virol 72(3): 2224-2232.Zhang, H. G., Y. M. Wang, J. F. Xie, X. Liang, H. C. Hsu, X. Zhang, J. Douglas, D. T. Curiel and J. D. Mountz (2001). "Recombinant adenovirus expressing adeno-associated virus cap and rep proteins supports production of high-titer recombinant adeno-associated virus." Gene Ther 8(9): 704-712.Zhang, X., M. De Alwis, S. L. Hart, F. W. Fitzke, S. C. Inglis, M. E. Boursnell, R. J.Levinsky, C. Kinnon, R. R. Ali and A. J. Thrasher (1999). "High-titer recombinant adeno- associated virus production from replicating amplicons and herpes vectors deleted for glycoprotein H." Hum Gene Ther 10(15): 2527-2537.EQUIVALENTS

[0131] Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific embodiments described specifically herein. Such equivalents are intended to be encompassed in the scope of the following claims.

Claims

CLAIMSWe claim:

1. A method of maintaining heterologous DNA sequence stably integrated in a recombinant virus, comprising: a) generating a recombinant virus comprising at least one host-cell-operable selection marker gene expression cassette linked to at least one heterologous DNA fragment in a host cell; b) passaging the recombinant virus multiple times in the host cells under selection condition to eliminate the virus without the selection marker gene such that the recombinant virus comprising the heterologous DNA sequence is stably maintained.

2. The method of claim 1, wherein said recombinant virus is a baculovirus.

3. The method of claim 1, wherein said recombinant virus is an adenovirus.

4. The method of claim 1, wherein said recombinant virus is a herpes simplex virus.

5. The method of claim 1, wherein said recombinant virus is a vaccinia virus.

6. The method of claim 1, wherein said recombinant virus is a Simian virus 40 (SV40)7. The method of claim 1, wherein said recombinant virus is an Epstein-Barr virus (EBV).

8. The method of claim 1 , wherein said heterologous DNA includes an AAV genome, AAV Rep and Cap genes, a protein coding sequence, and an RNA interference (RNAi) sequence.

9. The method of claim 1, wherein said selection marker gene includes neomycin- kanamycin phosphotransferase type II, hygromycin phosphotransferase, blasticidin S deaminase, puromycin-N-acetyltransferase, zeocin, Hypoxanthine-guanine phosphoribosyl transferase, and thymidine kinase.

10. The method of claim 1, wherein said host cell includes Sf9, Sf21, S2, Trichoplusia ni, E4a, BTI-TN-5B1-4, HEK293, A549, and Hela cell.

11. The method of claim 2, wherein said baculovirus includes Nucleopolyhedroviruses and Granuloviruses.

12. The method of claim 1, wherein said host-cell-operable expression cassette includes polyhedrin promoter, p6.9 promoter, plO promoter, CMV promoter, IE1 promoter, UbC promoter, EFla promoter, S V40 promoter, pGK promoter, RSV promoter, LTR promoter, CAG promoter, CBA promoter, SV40 poly A sequence, HSV tk poly A sequence, human grow hormone poly A sequence, and bovine growth hormone poly A sequence.

13. A method of producing foreign proteins using the recombinant virus from claim 1.

14. A method of producing AAV vectors using the recombinant virus from claim 1.

Images