Pharmaceutical composition for treating fibrosis

Abstract

The present disclosure includes a pharmaceutical composition or the like comprising a RIG-I ligand as an active ingredient for treating fibrosis.

Description

Pharmaceutical composition for treating fibrosis

[0001] This application claims priority to Japanese Patent Application No. 2024-022051, the entire contents of which are incorporated herein by reference. The present invention relates to a pharmaceutical composition for treating fibrosis.

[0002] Fibrosis, a condition caused by excessive accumulation of extracellular matrix such as collagen, leads to tissue dysfunction. Despite the large number of patients, there are few effective therapeutic drugs, and the development of innovative therapeutic drugs is therefore required. However, because various intracellular signals are involved in fibrosis, it is thought to be difficult to identify effective therapeutic targets.

[0003] RIG-I (Retinoic acid-inducible gene-I) is a pattern recognition receptor (PRR) involved in the innate immune system. It is present in the cytoplasm and recognizes viral RNA that has invaded cells, leading to the production of molecules with antiviral properties, such as type I interferon. Drug development targeting RIG-I is being conducted against cancer and infectious diseases. However, the relationship between RIG-I and fibrosis has not been known until now.

[0004] International Publication No. 2017 / 141942

[0005] The present disclosure aims to provide a therapeutic agent for tissue fibrosis.

[0006] In one aspect, the present disclosure provides a pharmaceutical composition comprising a RIG-I ligand as an active ingredient for treating fibrosis.

[0007] The present disclosure provides a new therapeutic agent for tissue fibrosis.

[0008] Figure 1 shows the suppression of fibrosis by RIG-I ligand (3p-hp-RNA) in human hepatic stellate cell line (LX-2 cells). Figure 2 shows the cell viability of LX-2 cells treated with 3p-hp-RNA. Figure 3 shows the protein expression of fibronectin and α-SMA in LX-2 cells treated with 3p-hp-RNA. Figure 4 shows the suppression of fibrosis by RIG-I ligand (3p-hp-RNA) in normal human lung fibroblasts (NHLF cells). Figure 5 shows the suppression of fibrosis by RIG-I ligand (3p-hp-RNA) in normal human lung fibroblasts (MRC-5 cells). Figure 6 shows the suppression of fibrosis by RIG-I ligand (3p-hp-RNA) in normal human dermal fibroblasts (NHDF cells). Figure 7 shows the results of investigating the involvement of RIG-I in the suppression of fibrosis by RIG-I ligand (3p-hp-RNA) in human hepatic stellate cell line (LX-2 cells). Figure 8 shows the results of investigating the involvement of RIG-I in the suppression of fibrosis by RIG-I ligand (3p-hp-RNA) in normal human dermal fibroblasts (NHDF cells). Figure 9 shows the suppression of fibrosis by RIG-I ligand (KIN1148) in human hepatic stellate cell line (LX-2 cells). Figure 10 shows the suppression of fibrosis by RIG-I ligand (3p-ds-RNA) in human hepatic stellate cell line (LX-2 cells). Figure 11 shows the recovery of lipid droplets by RIG-I ligand (3p-hp-RNA) in human hepatic stellate cell line (LX-2 cells). Figure 12 shows the effect of 5' triphosphate-depleted hairpin RNA on fibrosis suppression.

[0009] Unless otherwise specified, terms used herein have the meanings commonly understood by those skilled in the art of organic chemistry, medicine, pharmacology, molecular biology, microbiology, etc. Definitions of some terms used herein are provided below, but these definitions take precedence over common understandings in this specification.

[0010] RIG-I (Retinoic acid-inducible gene-I) is a pattern recognition receptor (PRR) involved in the innate immune system. RIG-I resides in the cytoplasm and recognizes viral RNA after it enters the cell, leading to the production of antiviral molecules such as type I interferon. RIG-I contains two caspase recruitment domains (CARDs) at its N-terminus, an RNA helicase domain in its mid-region, and a regulatory domain at its C-terminus, which recognizes viral RNA. Viral RNAs are distinguished from host RNAs by structural features such as the absence of a 5' cap structure and the presence of a 5' diphosphate or triphosphate, and are recognized by RIG-I. Recognition by RIG-I does not require the RNA to have a specific sequence. A representative amino acid sequence of human RIG-I is disclosed in NM_014314.

[0011] As used herein, the term "RIG-I ligand" refers to a substance that induces signal transduction from RIG-I. RIG-I ligands include substances that bind to the regulatory domain of RIG-I and substances that, when administered to a living body, result in a substance that binds to the regulatory domain of RIG-I in vivo. RIG-I ligands can be, for example, but are not limited to, nucleic acid molecules, small molecules, proteins, or peptides. In one embodiment, the RIG-I ligand does not induce type I interferon.

[0012] In certain embodiments, the RIG-I ligand is an RNA molecule. The RNA molecule may be a single-stranded RNA molecule or a double-stranded RNA molecule. As used herein, single-stranded RNA refers to a single RNA having one 5' end and one 3' end, and may be capable of forming one or more double-stranded portions (e.g., hairpin structures) through hydrogen bonds between complementary bases within the sequence. As used herein, double-stranded RNA refers to an RNA in which two RNA strands, each having one 5' end and one 3' end, form a duplex through hydrogen bonds between complementary bases. The double-stranded RNA may have blunt ends and / or overhanging ends. In certain embodiments, the double-stranded RNA has blunt ends and / or 5' overhanging ends. In certain embodiments, the double-stranded RNA has blunt ends.

[0013] In some embodiments, the RNA molecule does not have a 5' cap structure. In some embodiments, the RNA molecule has at least one phosphate group at the 5' end. In some embodiments, the RNA molecule has two or three phosphate groups at the 5' end. In some embodiments, the RNA molecule has three phosphate groups at the 5' end.

[0014] In certain embodiments, the RNA molecule is a single-stranded RNA molecule. The single-stranded RNA molecule can be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides in length or greater, or 1000, 900, 800, 700, 600, 500, 400, 300, 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, or 50 nucleotides in length, where the upper and lower limits can be independently selected. In certain embodiments, the single-stranded RNA molecule is 50-100 or 70-100 nucleotides in length.

[0015] In certain embodiments, the RNA molecule is a double-stranded RNA molecule. The double-stranded RNA molecule can be 5, 10, or 15 nucleotides or more in length, and 50, 45, 40, 35, 30, 25, or 20 nucleotides or less in length, where the upper and lower limits can be independently selected. In certain embodiments, the double-stranded RNA molecule is 10 to 40 nucleotides in length or 15 to 25 nucleotides in length, e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length.

[0016] In one embodiment, the RIG-I ligand is an RNA molecule derived from the genome of an RNA virus. RNA molecules derived from the genome of an RNA virus include RNA molecules that contain or consist of a portion of the genome sequence of an RNA virus, and RNA molecules that contain or consist of a sequence in which one or more bases have been modified in a portion of the genome sequence of an RNA virus. Examples of RNA viruses include influenza virus, hepatitis C virus, Sendai virus, measles virus, respiratory syncytial virus, vesicular stomatitis virus, and Japanese encephalitis virus. In one embodiment, the RIG-I ligand is not an RNA molecule derived from the genome of a reovirus.

[0017] In certain embodiments, the RIG-I ligand is a single-stranded RNA molecule comprising or consisting of the sequence of SEQ ID NO: 1, or a sequence in which 1 to 30, 1 to 20, 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 base has been modified in the sequence of SEQ ID NO: 1. In certain embodiments, the RIG-I ligand is a single-stranded RNA molecule comprising or consisting of the sequence of SEQ ID NO: 1. In certain embodiments, the RIG-I ligand is a single-stranded RNA molecule comprising or consisting of the sequence of SEQ ID NO: 1 and having three phosphate groups at the 5'-end.

[0018] In one embodiment, the RIG-I ligand is a double-stranded RNA molecule comprising or consisting of the sequence of SEQ ID NO: 2, or a sequence in which 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 base has been modified in the sequence of SEQ ID NO: 2. In one embodiment, the RIG-I ligand is a double-stranded RNA molecule comprising or consisting of the sequence of SEQ ID NO: 2. In one embodiment, the RIG-I ligand is a double-stranded RNA molecule comprising or consisting of the sequence of SEQ ID NO: 2 and having three phosphate groups at the 5' end. As used herein, when a double-stranded RNA molecule is said to comprise or consist of a given sequence, it means that one strand of the double-stranded RNA molecule comprises or consists of the given sequence.

[0019] As used herein, base modification includes base deletion, substitution, insertion, and addition. Modification may be any one of deletion, substitution, insertion, and addition, or a combination of two or more thereof. For example, in the modification of two or more bases, each modification is independently selected from deletion, substitution, insertion, and addition.

[0020] RNA molecules contain multiple nucleosides linked together by internucleoside linkages. A nucleoside is a compound containing a sugar moiety and a base moiety. RNA molecules may contain any nucleoside and internucleoside linkage known in the art and may be produced by known nucleic acid synthesis techniques.

[0021] In the RNA molecules of the present disclosure, nucleosides can be natural or unnatural nucleosides. Natural nucleosides refer to nucleosides containing natural sugar moieties and natural base moieties. Unnatural nucleosides refer to nucleosides containing unnatural sugar moieties and / or unnatural base moieties. Nucleosides include ribonucleosides and deoxyribonucleosides. RNA molecules of the present disclosure can contain ribonucleosides, but can also contain one or more nucleosides other than ribonucleosides. RNA molecules can contain two or more types of nucleosides and / or two or more types of internucleoside linkages. When an RNA molecule contains two or more types of nucleosides and / or two or more types of internucleoside linkages, the proportions and order of each nucleoside and internucleoside linkage are arbitrary.

[0022] A natural sugar moiety is a furanose-type ribose or 2'-deoxyribose. An unnatural sugar moiety can include modifications of one or more atoms of the ribofuranose ring (e.g., one or more positions selected from the 2', 4', and 5' positions), bridging two atoms of the ribofuranose ring (bicyclic sugars), replacing the oxygen atom (O) of the ribofuranose ring with another atom (e.g., S, N, or C), and replacing the ribofuranose ring with another structure, and any combination thereof. Modifications of the ribofuranose ring include halogen, amino, thio, alkyl, alkenyl, alkynyl, O-alkyl, O-alkenyl, O-alkynyl, S-alkyl, S-alkenyl, S-alkynyl, N-alkyl, N-alkenyl, N-alkynyl, allyl, O-allyl, S-allyl, N-allyl, O-alkyl-O-alkyl (wherein alkyl, alkenyl, alkynyl, and aryl can be substituted or unsubstituted alkyl, alkenyl, alkynyl, and aryl), etc. In certain embodiments, the modification of the ribofuranose ring is selected from 2'-F, 2'-OCH3 (2'-OMe), 2'-O-(CH2)2OCH3 (2'-MOE), 2'-OCH2CH2CH3, 4'-S, 5'-vinyl, and 5'-methyl. Nucleosides containing bicyclic sugars include those bridged at the 2' and 4' positions, such as LNA (Locked Nucleic Acid / 2'-O,4'-C-Methylene-bridged Nucleic Acid), AmNA (Amido-Bridged Nucleic Acid), and ENA (Ethylene-bridged Nucleic Acid). Substitution of the ribofuranose ring with other structures includes substitution with peptide nucleic acid or morpholino nucleic acid.

[0023] Natural bases are adenine (A), thymine (T), cytosine (C), guanine (G), and uracil (U). Unnatural bases include substitutes for natural bases, such as 5-methylcytosine, 5-hydroxymethylcytosine, 2-aminoadenine, 6-methyladenine, 6-methylguanine, 8-azaguanine, 7-deazaguanine, 2-thiouracil, 4-thiouracil, 5-bromouracil, 4-fluorouracil, and 5-hydroxymethyluracil.

[0024] In the RNA molecules of the present disclosure, the internucleoside linkage can be a natural internucleoside linkage or a non-natural internucleoside linkage. A natural internucleoside linkage is a phosphodiester linkage. Non-natural internucleoside linkages include phosphorothioates, phosphotriesters, methylphosphonates, and phosphoramidates.

[0025] The RNA molecule may be modified for the purpose of improving its disposition in vivo, etc. Modifications include cholesterol, phospholipids, fatty acids, cholic acid, polyamides, and polyethylene glycol.

[0026] RIG-I ligands also include ImOl100 (Rigontec) (also known as RGT100 or MK-4621), Inarigivir (F-star Therapeutics), KIN1148, KIN131A (Kineta), and TTX-RIGA (TransCode Therapeutics).

[0027] Fibrosis refers to a phenomenon in which fibroblasts in tissues are activated, resulting in the production of large amounts of extracellular matrix components such as type I collagen, leading to abnormal proliferation of connective tissue. As used herein, "treatment" of fibrosis includes reduction or removal of fibrotic tissue, inhibition of the progression of fibrosis, and maintenance of tissue with improved fibrosis.

[0028] RIG-I ligands are effective in treating fibrosis and diseases associated with tissue fibrosis. Tissue fibrosis has been reported to occur in various organs, including the liver, lungs, skin, heart, kidneys, bone marrow, and intestines, and RIG-I ligands can treat fibrosis in such organs. In one embodiment, an RIG-I ligand or a pharmaceutical composition containing the same is used to treat fibrosis in the liver, lungs, or skin. Diseases and conditions that can be treated with an RIG-I ligand or a pharmaceutical composition containing the same include liver fibrosis, cirrhosis, hepatitis B, hepatitis C, alcoholic hepatitis, nonalcoholic steatohepatitis, pulmonary fibrosis (e.g., idiopathic pulmonary fibrosis and pulmonary fibrosis associated with connective tissue diseases or sarcoidosis), skin fibrosis diseases such as scleroderma, cardiac fibrosis associated with myocardial infarction, renal fibrosis associated with chronic kidney disease, myelofibrosis (e.g., idiopathic myelofibrosis and myelofibrosis associated with connective tissue diseases or hematological tumors), and intestinal fibrosis associated with inflammatory bowel disease. In certain embodiments, the RIG-I ligand or a pharmaceutical composition comprising the same is used to treat liver fibrosis, cirrhosis, hepatitis B, hepatitis C, alcoholic hepatitis, or non-alcoholic steatohepatitis. In certain embodiments, the RIG-I ligand or a pharmaceutical composition comprising the same is used to treat pulmonary fibrosis. In certain embodiments, the RIG-I ligand or a pharmaceutical composition comprising the same is used to treat skin fibrosis diseases such as scleroderma. In certain embodiments, the RIG-I ligand or a pharmaceutical composition comprising the same is used to treat cardiac fibrosis associated with myocardial infarction. The RIG-I ligand or a pharmaceutical composition comprising the same may be used in combination with other therapeutic agents for fibrosis.

[0029] Pharmaceutical compositions may contain a pharmaceutically acceptable carrier in addition to the RIG-I ligand as an active ingredient. Pharmaceutically acceptable carriers include phosphate-buffered saline or other physiologically acceptable buffers, lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum arabic, calcium phosphate, alginate, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, sterile water, syrup, and methylcellulose. Pharmaceutical compositions may also contain additives such as lubricants (e.g., talc, magnesium stearate, and mineral oil), wetting agents, emulsifiers, suspending agents, preservatives (e.g., methyl benzoate and propylhexedrine benzoate), sweeteners, and flavoring agents. Pharmaceutical compositions can be formulated by conventional methods in the art. When the RIG-I ligand is a nucleic acid molecule such as an RNA molecule, it can be formulated using drug delivery systems such as nanoparticles, dendrimers, polymers, liposomes, or cationic delivery systems.

[0030] The pharmaceutical composition can be administered orally or parenterally (e.g., intravenously, intramuscularly, subcutaneously, transdermally, intranasally, or via the lungs). The pharmaceutical composition may also be administered systemically or locally. In some embodiments, the pharmaceutical composition is administered locally (e.g., locally to fibrotic tissue). In some embodiments, the pharmaceutical composition is administered intravenously. Intravenous administration may be via syringe or infusion.

[0031] Examples of dosage forms of the pharmaceutical composition include, but are not limited to, tablets, pills, capsules, granules, powders, oral liquids (e.g., elixirs, suspensions, and emulsions), syrups, inhalants, suppositories, injections, patches, etc. Examples of injections include liquid injections and solid injections (e.g., freeze-dried injections) that are dissolved before use.

[0032] The RIG-I ligand is administered to a subject in an amount that achieves the desired effect (referred to herein as an effective amount). The dosage may vary depending on the RIG-I ligand used, the age, sex, and weight of the subject, the severity of the disease, the dosage form, the route of administration, and the like. For example, when the RIG-I ligand is an RNA molecule, it may be administered to an adult human in a single dose of 0.1, 0.3, 1, 3, or 10 mg or more, or 1000, 300, 100, 30, 10, or 1 mg or less (the upper and lower limits are independently selected), e.g., 0.1 mg to 1000 mg, 0.1 mg to 100 mg, 0.1 mg to 10 mg, 0.1 mg to 1 mg, 1 mg to 300 mg, 1 mg to 100 mg, 1 mg to 30 mg, 1 mg to 10 mg, 10 mg to 100 mg, or 10 mg to 30 mg. The dose may be administered in a single dose or multiple doses (e.g., two, three, four, or more) and may be administered in a single composition or multiple compositions. Treatment with a RIG-I ligand may continue for days, weeks, months, or longer.

[0033] The subject can be a human or a non-human animal (e.g., mouse, rat, rabbit, dog, cat, horse, cow, monkey). In certain embodiments, the subject is a human.

[0034] In certain embodiments, the present disclosure relates to a method for treating fibrosis, comprising administering to a subject in need thereof an effective amount of a RIG-I ligand; a RIG-I ligand for use in treating fibrosis; and use of a RIG-I ligand for the manufacture of a medicament for treating fibrosis. These embodiments can be carried out as described above for pharmaceutical compositions.

[0035] Exemplary embodiments of the present disclosure are described below. 1. A pharmaceutical composition for treating fibrosis, comprising a RIG-I ligand as an active ingredient. 2. The pharmaceutical composition according to Item 1, wherein the RIG-I ligand is an RNA molecule. 3. The pharmaceutical composition according to Item 2, wherein the RNA molecule does not have a 5' cap structure. 4. The pharmaceutical composition according to Item 2 or 3, wherein the RNA molecule has two or three phosphate groups at the 5' end. 5. The pharmaceutical composition according to Item 4, wherein the RNA molecule has three phosphate groups at the 5' end. 6. The pharmaceutical composition according to any of Items 1 to 5, wherein the RNA molecule is a single-stranded RNA molecule 50 to 100 nucleotides in length. 7. The pharmaceutical composition according to any of Items 1 to 5, wherein the RNA molecule is a double-stranded RNA molecule 10 to 40 nucleotides in length. 8. 8. The pharmaceutical composition according to any one of Items 1 to 6, wherein the RNA molecule is a single-stranded RNA molecule comprising or consisting of the sequence of SEQ ID NO: 1, or a sequence in which 1 to 30, 1 to 20, 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 base has been modified in the sequence of SEQ ID NO: 1. 9. The pharmaceutical composition according to any one of Items 1 to 5 and 7, wherein the RNA molecule is a double-stranded RNA molecule comprising or consisting of the sequence of SEQ ID NO: 2, or a sequence in which 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 base has been modified in the sequence of SEQ ID NO: 2. 10. The pharmaceutical composition according to any one of Items 1 to 9, wherein the fibrosis is fibrosis in an organ selected from the liver, lung, skin, heart, kidney, bone marrow, or intestine. 11. The pharmaceutical composition according to Item 10, wherein the fibrosis is fibrosis in the liver, lung, or skin. 12. Item 12. The pharmaceutical composition according to any one of Items 1 to 11, for treating a disease or condition selected from hepatic fibrosis, liver cirrhosis, hepatitis B, hepatitis C, alcoholic hepatitis, non-alcoholic steatohepatitis, pulmonary fibrosis, skin fibrotic diseases, cardiac fibrosis associated with myocardial infarction, renal fibrosis associated with chronic kidney disease, myelofibrosis, and intestinal fibrosis associated with inflammatory bowel disease. 13. The pharmaceutical composition according to Item 12, for treating hepatic fibrosis, liver cirrhosis, hepatitis B, hepatitis C, alcoholic hepatitis, or non-alcoholic steatohepatitis. 14. The pharmaceutical composition according to Item 12, for treating pulmonary fibrosis. 15. The pharmaceutical composition according to any one of Items 12, for treating a skin fibrotic disease.16. The pharmaceutical composition according to item 15, wherein the skin fibrosis disease is scleroderma. 17. The pharmaceutical composition according to any one of items 1 to 16, which is administered intravenously. 16. The pharmaceutical composition according to any one of items 1 to 16, which is administered topically to fibrotic tissue.

[0036] 18. A method for treating fibrosis, comprising administering an RIG-I ligand to a subject in need thereof. 19. A RIG-I ligand for use in treating fibrosis. 20. Use of a RIG-I ligand for the manufacture of a medicament for treating fibrosis.

[0037] The present invention will be described below with reference to examples, but the present invention is not limited to these examples in any sense.

[0038] 1. Suppression of fibrosis by RIG-I ligand (3p-hp-RNA) in human hepatic stellate cell line (LX-2 cells) 1-1. Suppression of fibrosis by RIG-I ligand (3p-hp-RNA) (qRT-PCR) (Method) LX-2 cells were seeded in a 12-well plate at a density of 2.5 x 10^4 cells / well. After 12 hours of culture, TGF-β was added to the medium to a final concentration of 2 ng / mL, and the cells were cultured for an additional 12 hours. The RIG-I ligand, 3p-heapin-RNA (3p-hp-RNA) (5'-pppGGAGCAAAAGCAGGGUGACAAAGACAUAAUGGAUCCAAACACUGUGUCAAGCUUUCAGGUAGAUUGCUUUCUUUGGCAUGUCCGCAAAC-3') (SEQ ID NO: 1) (InvivoGen), was added to a final concentration of 0.5, 2.5, or 5.0 ng / mL using Lipofectamine. TM Transfection was performed using RNAiMAX (Thermo Fisher Scientific). After 6 hours of culture, the medium was replaced with fresh medium containing TGF-β (2 ng / mL) and cultured for 2 days. RNA was then extracted from the cells and gene expression levels were analyzed by quantitative RT-PCR.

[0039] (Results) Culturing in the presence of TGF-β increased the expression of fibrotic marker genes TGF-β, ACTA2, Col1A1, fibronectin, and FAP (fibroblast activation protein), indicating that hepatic stellate cells were activated and differentiated into myofibroblasts. In contrast, the expression of fibrotic marker genes was reduced in a concentration-dependent manner by the application of 3p-hp-RNA, a RIG-I ligand (Fig. 1).

[0040] 1-2. Cytotoxicity of RIG-I Ligand (3p-hp-RNA) (Method) LX-2 cells were seeded in a 96-well plate at a density of 1 x 10^4 cells / well. After 12 hours of culture, TGF-β was added to the medium to a final concentration of 2 ng / ml, and the cells were cultured for another 12 hours. 3p-hp-RNA (SEQ ID NO: 1) (InvivoGen) was added to a final concentration of 0.5, 2.5, or 5.0 ng / ml using Lipofectamine. TM Transfection was performed using RNAiMAX (Thermo Fisher Scientific). After 6 hours of culture, the medium was replaced with fresh medium containing TGF-β (2 ng / mL) and cultured for 2 days. Cell viability was then measured using the WST-8 assay.

[0041] (Results) 3p-hp-RNA did not show significant cytotoxicity to LX-2 cells (FIG. 2).

[0042] 1-3. Inhibition of fibrosis by RIG-I ligand (3p-hp-RNA) (Western blotting) (Method) LX-2 cells were seeded in a 12-well plate at a density of 2.5 x 10^4 cells / well. After 12 hours of culture, TGF-β was added to the medium to a final concentration of 2 ng / ml, and the cells were cultured for another 12 hours. 3p-hp-RNA (SEQ ID NO: 1) (InvivoGen) was added to a final concentration of 0.5 or 2.5 ng / ml using Lipofectamine. TMTransfection was performed using RNAiMAX (Thermo Fisher Scientific). After 6 hours of culture, the medium was replaced with fresh medium containing TGF-β (2 ng / mL) and cultured for 2 days. Cells were then harvested and subjected to Western blotting.

[0043] (Results) 3p-hp-RNA, a RIG-I ligand, significantly reduced the protein levels of fibronectin and α-SMA (α-smooth muscle actin), which are fibrosis markers, in activated human hepatic stellate cells (Figure 3).

[0044] 2. Inhibition of fibrosis by RIG-I ligand (3p-hp-RNA) in normal human lung fibroblasts (NHLF cells) (Method) NHLF cells were seeded at a density of 2.5 x 10^4 cells / well in a 12-well plate. After 12 hours of culture, TGF-β was added to the medium to a final concentration of 2 ng / ml, and the cells were cultured for another 12 hours. 3p-hp-RNA (SEQ ID NO: 1) (InvivoGen) was added to a final concentration of 0.5, 2.5, or 5.0 ng / ml using Lipofectamine. TM Transfection was performed using RNAiMAX (Thermo Fisher Scientific). After 6 hours of culture, the medium was replaced with fresh medium containing TGF-β (2 ng / mL) and cultured for 2 days. RNA was then extracted from the cells and gene expression levels were analyzed by quantitative RT-PCR.

[0045] (Results) 3p-hp-RNA also reduced the expression of fibrosis marker genes ACTA2, fibronectin, and FAP in a concentration-dependent manner in activated normal human lung fibroblasts (FIG. 4).

[0046] 3. Inhibition of fibrosis by RIG-I ligand (3p-hp-RNA) in normal human lung fibroblasts (MRC-5 cells) (Method) MRC-5 cells were seeded in a 12-well plate at a density of 2.5 x 10^4 cells / well. After 12 hours of culture, TGF-β was added to the medium to a final concentration of 2 ng / ml, and the cells were cultured for another 12 hours. 3p-hp-RNA (SEQ ID NO: 1) (InvivoGen) was added to a final concentration of 0.5, 2.5, or 5.0 ng / ml using Lipofectamine. TM Transfection was performed using RNAiMAX (Thermo Fisher Scientific). After 6 hours of culture, the medium was replaced with fresh medium containing TGF-β (2 ng / mL) and cultured for 2 days. RNA was then extracted from the cells and gene expression levels were analyzed by quantitative RT-PCR.

[0047] (Results) 3p-hp-RNA also reduced the expression of fibrosis marker genes ACTA2, Col1A1, fibronectin, and FAP in a concentration-dependent manner in activated MRC-5 cells (FIG. 5).

[0048] 4. Inhibition of fibrosis by RIG-I ligand (3p-hp-RNA) in normal human dermal fibroblasts (NHDF cells) (Method) NHDF cells were seeded in a 12-well plate at a density of 2.5 x 10^4 cells / well and cultured for 24 hours. TGF-β was added to a final concentration of 2 ng / ml, and the cells were cultured for another 24 hours. 3p-hp-RNA (SEQ ID NO: 1) (InvivoGen) was added to a final concentration of 0.5, 2.5, or 5.0 ng / ml using Lipofectamine. TM Transfection was performed using RNAiMAX (Thermo Fisher Scientific). After 6 hours of culture, the medium was replaced with fresh medium containing TGF-β (2 ng / mL) and cultured for 3 days. RNA was then collected from the cells and gene expression levels were analyzed by quantitative RT-PCR.

[0049] (Results) 3p-hp-RNA also reduced the expression of ACTA2, a fibrosis marker gene, in a concentration-dependent manner in activated NHDF cells (FIG. 6).

[0050] 5. Involvement of RIG-I in the suppression of fibrosis by RIG-I ligand (3p-hp-RNA) 5-1. Human hepatic stellate cell line (LX-2 cells) (Method) siRNA against RIG-I (On-TARGETplus siRNA, Dharmacon) and control siRNA (AllStars Negative Control siRNA, Qiagen) were transfected into suspension LX-2 cells using Lipofectamine. TM The cells were transfected using RNAiMAX (Thermo Fisher Scientific) at 30 nM and cultured for 12 hours. TGF-β was added to the medium at a final concentration of 2 ng / ml, and after 12 hours of culture, 3p-hp-RNA (SEQ ID NO: 1) (InvivoGen) was added to the medium at a final concentration of 2.5 ng / ml using Lipofectamine. TM Transfection was performed using RNAiMAX (Thermo Fisher Scientific). After 6 hours of culture, the medium was replaced with fresh medium containing TGF-β (2 ng / mL) and cultured for 2 days. RNA was then extracted from the cells and gene expression levels were analyzed by quantitative RT-PCR.

[0051] (Results) In the control siRNA pretreatment group, 3p-hp-RNA significantly reduced the expression of ACTA2 and Col1A1, whereas in RIG-I knockdown cells, the reduction in ACTA2 and Col1A1 expression was minimal even after 3p-hp-RNA treatment (Fig. 7). Therefore, 3p-hp-RNA was shown to reduce the expression of fibrosis marker genes in an RIG-I-dependent manner.

[0052] 5-2. Normal human dermal fibroblasts (NHDF cells) (Method) NHDF cells in suspension were transfected with siRNA against RIG-I (On-TARGETplus siRNA, Dharmacon) and control siRNA (AllStars Negative Control siRNA, Qiagen) using Lipofectamine. TMThe cells were transfected using RNAiMAX (Thermo Fisher Scientific) at 30 nM and cultured for 12 hours. TGF-β was added to the medium at a final concentration of 2 ng / ml, and after 12 hours of culture, 3p-hp-RNA (SEQ ID NO: 1) (InvivoGen) was added to the medium at a final concentration of 2.5 ng / ml using Lipofectamine. TM Transfection was performed using RNAiMAX (Thermo Fisher Scientific). After 6 hours of culture, the medium was replaced with fresh medium containing TGF-β (2 ng / mL) and cultured for 2 days. RNA was then extracted from the cells and gene expression levels were analyzed by quantitative RT-PCR.

[0053] (Results) In the control siRNA pretreatment group, ACTA2 expression was significantly reduced by 3p-hp-RNA, whereas in RIG-I knockdown cells, no reduction in fibrotic marker gene expression by 3p-hp-RNA was observed (Fig. 8). Therefore, it was demonstrated that the reduction in fibrotic marker gene expression by 3p-hp-RNA is RIG-I dependent.

[0054] 6. Inhibition of fibrosis by RIG-I ligands (small molecule compounds) in human hepatic stellate cell line (LX-2 cells) (Method) LX-2 cells were seeded at a density of 2.5 x 10^4 cells / well in a 48-well plate. After 12 hours of culture, TGF-β was added to the medium to a final concentration of 2 ng / ml and cultured for an additional 12 hours. KIN1148 (CAS Number: 1428729-56-9) (Selleck), known to function as a RIG-I agonist, was added to a final concentration of 10 μM or 50 μM and cultured for 12 hours. RNA was collected from the cells, and gene expression levels were analyzed by quantitative RT-PCR.

[0055] (Results) Culturing in the presence of TGF-β increased the expression of fibrotic marker genes ACTA2 and Col1A1, suggesting that hepatic stellate cells were activated and differentiated into myofibroblasts. In contrast, treatment with the RIG-I agonist KIN1148 reduced the expression of ACTA2 and Col1A1 in a dose-dependent manner (Fig. 9).

[0056] 7. Inhibition of fibrosis by RIG-I ligand (dsRNA) in human hepatic stellate cell line (LX-2 cells) (Method) LX-2 cells were seeded in 12-well plates at a density of 2.5 x 10^4 cells / well. After 12 hours of culture, TGF-β was added to the medium to a final concentration of 2 ng / mL, and the cells were cultured for another 12 hours. The RIG-I ligand 3p-hp-RNA (SEQ ID NO: 1) (InvivoGen) was added to a final concentration of 0.5 or 2.5 ng / mL, or 3p-double-stranded-RNA (3p-ds-RNA) (sense strand: 5'-pppGCAUGCGACCUCUGUUUGA -3') (SEQ ID NO: 2) (InvivoGen) was added to a final concentration of 300 or 1500 ng / mL using Lipofectamine. TM Transfection was performed using RNAiMAX (Thermo Fisher Scientific). After 6 hours of culture, the medium was replaced with fresh medium containing TGF-β (2 ng / mL) and cultured for 3 days. RNA was then collected from the cells and gene expression levels were analyzed by quantitative RT-PCR.

[0057] (Results) In activated human hepatic stellate cells, the expression of fibrosis marker genes ACTA2 and FAP was reduced by the action of 3p-ds-RNA, an RIG-I ligand (FIG. 10).

[0058] 8. Recovery of lipid droplets by RIG-I ligand (3p-hp-RNA) in human hepatic stellate cell line (LX-2 cells) (Method) LX-2 cells were seeded at a density of 2.5 x 10^4 cells / well in a 12-well plate. After 12 hours of culture, retinol (10 μM) and oleic acid (100 μM) were added to the medium and cultured for another 12 hours. The medium was replaced with one containing retinol (10 μM), oleic acid (100 μM), and TGF-β (2 ng / ml), and the cells were cultured for another 12 hours. After that, 3p-hp-RNA (SEQ ID NO: 1) (InvivoGen) was added to a final concentration of 5 ng / ml using Lipofectamine. TMTransfection was performed using RNAiMAX (Thermo Fisher Scientific). After 48 hours of culture, lipid droplets were stained with BODIPY. Nuclei were stained with DAPI.

[0059] (Results) Hepatic stellate cells are retinoid-storing cells, storing retinoids in their lipid droplets. It is known that when hepatic stellate cells are activated and extracellular matrix production increases, the number of intracellular lipid droplets decreases, resulting in a loss of retinoid storage capacity. Therefore, assessing lipid droplets allows us to assess whether hepatic stellate cells are differentiating into myofibroblasts, which contribute to fibrosis. 3p-hp-RNA restored lipid droplets in activated human hepatic stellate cell lines (Figure 11).

[0060] 9. Effect of 5'-triphosphate-depleted hairpin RNA on fibrosis inhibition (Method) To prepare hairpin RNA from 3p-hp-RNA with the three phosphate groups removed from the 5' end, 5 μL of 3p-hp-RNA (10 ng / μL) was added to 5 μL of 10x Alkaline Phosphatase Buffer (Takara), 2 μL of Alkaline Phosphatase (Calf intestine) (Takara), and 38 μL of MilliQ water to a total volume of 50 μL (final concentration: 1 ng / ml). The mixture was incubated at 37°C for 30 minutes. LX-2 cells were seeded in a 12-well plate at a density of 2.5 × 10^4 cells / well and cultured for 12 hours. After 12 hours of culture, the medium was replaced with that containing TGF-β (2 ng / ml). The medium was then cultured for another 12 hours. The hairpin RNA with the 5'-triphosphate-depleted hairpin RNA was added to a final concentration of 5 ng / ml with Lipofectamine. TM Transfection was performed using RNAiMAX (Thermo Fisher Scientific). After 48 hours of culture, RNA was collected from the cells and gene expression levels were analyzed by quantitative RT-PCR.

[0061] (Results) 3p-hp-RNA increased the expression of IFN-β, an indicator of RIG-I activation, and decreased the expression of fibrosis marker genes TGF-β, Col1A1, and fibronectin, whereas hairpin RNA with the 5' triphosphate removed did not show these effects (Fig. 12). This indicates that the structural features of the 5' end recognized by RIG-I are important for the suppression of fibrosis by RIG-I ligands, which are nucleic acid molecules such as hairpin RNA.

[0062] These results indicate that RIG-I ligands are effective in treating tissue fibrosis.

Claims

1. A pharmaceutical composition for treating fibrosis, comprising an RIG-I ligand as an active ingredient.

2. The pharmaceutical composition of claim 1, wherein the RIG-I ligand is an RNA molecule.

3. The pharmaceutical composition of claim 2, wherein the RNA molecule does not have a 5' cap structure.

4. The pharmaceutical composition of claim 2, wherein the RNA molecule has two or three phosphate groups at the 5' end.

5. The pharmaceutical composition of claim 2, wherein the RNA molecule is a single-stranded RNA molecule of 50 to 100 nucleotides in length.

6. The pharmaceutical composition of claim 2, wherein the RNA molecule is a double-stranded RNA molecule of 10 to 40 nucleotides in length.

7. The pharmaceutical composition according to any one of claims 1 to 6, wherein the fibrosis is in an organ selected from the liver, lung, skin, heart, kidney, bone marrow, and intestine.

8. The pharmaceutical composition according to claim 7, wherein the fibrosis is fibrosis in the liver, lungs, or skin.

9. The pharmaceutical composition according to any one of claims 1 to 6, for treating a disease or condition selected from hepatic fibrosis, liver cirrhosis, hepatitis B, hepatitis C, alcoholic hepatitis, non-alcoholic steatohepatitis, pulmonary fibrosis, cutaneous fibrotic diseases, cardiac fibrosis associated with myocardial infarction, renal fibrosis associated with chronic kidney disease, myelofibrosis, and intestinal fibrosis associated with inflammatory bowel disease.

10. The pharmaceutical composition according to claim 9, wherein the skin fibrosis disease is scleroderma.

Images