Aeroplysinin derivatives and uses thereof
Patent Information
- Application Number
- PCT/CA2025/050312
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-06
- Filing Date
- 2025-03-06
- Publication Date
- 2025-10-02
AI Technical Summary
Current treatments for acute respiratory distress syndrome (ARDS), such as those caused by SARS-CoV-2 and influenza infections, are inadequate, leading to high mortality rates and rapid pathogen resistance, and there is a need for alternative approaches that enhance lung vascular integrity without impairing viral clearance.
Development of Aeroplysinin derivatives, specifically compounds of Formula (I) and (III), which act as anti-inflammatory agents by modulating the host response to reduce excessive leukocyte recruitment and inflammation, thereby mitigating lung injury and improving vascular integrity.
The compounds effectively reduce lung injury and mortality from ARDS by attenuating endothelial and leukocyte activation, decreasing production of pro-inflammatory cytokines and reactive oxygen intermediates, and preventing alveolar-capillary leakage, as demonstrated in various animal models.
Smart Images

Figure CA2025050312_02102025_PF_FP_ABST
Abstract
Description
AEROPLYSININ DERIVATIVES AND USES THEREOFCROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of priority from United States Provisional Application No. 63 / 561 ,923, filed March 6, 2024, the entire contents of which is incorporated herein by reference in its entirety.FIELD
[0002] The present disclosure relates to compounds of Formula (I), and (III) and their uses as anti-inflammatory agents in the treatment and prevention of, for example, acute respiratory distress syndrome and / or ischemia-reperfusion injury.BACKGROUND
[0003] Acute respiratory distress syndrome (ARDS) is a potentially fatal complication of lung infections characterized by alveolar neutrophil recruitment and pulmonary edema. Alveolar flooding leads to arterial hypoxemia, diffuse alveolar damage and respiratory failure1-3. The mortality rate for ARDS caused by Sars- CoV-2 infection is approximately 40%4; similar rates have been reported for ARDS caused by other pathogens including bacterial pneumonia5and influenza A67. The high mortality rate, despite best medical and supportive care, highlights the fact that antiviral and antibacterial therapy is typically insufficient to prevent mortality once ARDS has developed.
[0004] In addition to issues of effectiveness, antimicrobial therapies are beset with the rapid development of pathogen resistance8-10. An alternative approach for ARDS would be to improve the host response; in principle, this should not induce microbial resistance and may be broadly applicable to different pathogens. For instance, successful treatment of influenza-induced ARDS using a compound that enhances lung vascular integrity without impairing or enhancing viral clearance has been previously reported11the treatment was effective against multiple strains of influenza.
[0005] The host response to lung infection would involve lung endothelial activation and consequent neutrophil and monocyte recruitment to clear the pathogen12'14. Infection by viral or bacterial pathogens, stimulation by pathogen- associated molecular patterns, or exposure to cytokines leads to activation of endothelial cells. This causes the upregulation of adhesion molecules for therecruitment of leukocytes to the site of infection. However, during infection by viruses such as influenza and SARS-CoV-2, excessive endothelial and innate immune cell activation can occur15 16. This culminates in excessive recruitment of leukocytes, overproduction of pro-inflammatory cytokines, and the development of alveolar-capillary leakage17. Production of reactive oxygen and nitrogen intermediates by activated leukocytes results in microbial killing but also tissue damage18 19.SUMMARY
[0006] The present disclosure relates to compounds of Formula (I), and (III) and their use as an anti-inflammatory agent. The compounds of Formula (I) and (III) may be used, among others, in the treatment and prevention of acute respiratory distress syndrome, as a result for example from an influenza and / or SARS-CoV-2 infection.
[0007] In one embodiment, the disclosure includes compounds of the formula (I)wherein:R’ is H, (Ci-Ce)-alkyl or (Ci-Ce)-acyl;R1is selected from H, halo, -CN, and (Ci-Ce)-alkyl;R2is selected from halo, -CN, (Ci-Ce)-alkyl and -O-(Ce-Cio) aryl, wherein the aryl is optionally substituted with one or more of halo, -CN, (Ci-C3)-alkyl or-(Co- C6)-alkylene-C(O)-N(R’)2 wherein each R’ is individually or simultaneously H or (Ci-C3)-alkyl;R3is selected from H, halo, and (Ci-Ce)-alkyl wherein the alkyl is optionally substituted with halo and nitrile;R4is selected from:- optionally substituted (C1-C1 o)-alkyl, wherein the optional substituents are halo, or CN;optionally substituted 5-10-membered heterocycle containing 1 -3 heteroatoms, wherein the optional substituents are halo, -CN, or (Ci-Ce)- alkyl; and, wherein X is (Co-Ce)-alkylene and Ring B is an optionally substituted, saturated or unsaturated heterocycle containing 1-3 heteroatoms, wherein the optional substituents are halo, -CN, or (Ci-Ce)- alkyl; wherein, the compound of Formula (I) is not
[0008] Other features and advantages of the present application will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples while indicating preferred embodiments of the application are given by way of illustration only, since various changes and modifications within the spirit and scope of the application will become apparent to those skilled in the art from this detailed description.BRIEF DESCRIPTION OF DRAWINGS
[0009] The disclosure is in the hereinafter provided paragraphs described, by way of example, in relation to the attached figures. The figures provided herein are provided for a better understanding of the example embodiments and to show more clearly how the various embodiments may be carried into effect. The figures are not intended to limit the present disclosure.
[0010] FIG. 1 is a chemical library screen that shows that Aeroplysinin-1 (Ap) protects larval zebrafish from human influenza A.
[0011] FIG. 2 shows that Aeroplysinin-1 (Ap) is beneficial in multiple murine models of lung injury.
[0012] FIG.3 shows thatAp decreases acute liver ischemia / reperfusion injury in a mouse model of systemic in vivo hemorrhagic shock / resuscitation (HSR).
[0013] FIG. 4 shows that Ap induces the Nrf2 oxidative stress response pathway and Nrf2 regulated genes in LPS treated macrophages.
[0014] FIG. 5 shows that Ap rapidly induces the Nrf2 pathway in endothelial cells and macrophages as early as 30 minutes post treatment.
[0015] FIG. 6 shows that Knockdown of Keapl or Nrf2 prevents induction of downstream Nrf2 genes.
[0016] FIG. 7 shows that Ap does not improve oxygen saturation or induce HO-1 in Nrf2 global knockout mice.
[0017] FIG. 8 shows that Ap9, a novel derivative of Ap, induces the Nrf2 pathway and is hepatoprotective in murine liver ischemia / reperfusion.
[0018] FIG. 9 shows that Aeroplysinin-1 (Ap) prevents the induction of ICAM- 1 expression.
[0019] FIG. 10 shows that Aeroplysinin-1 (Ap) reduces macrophage activation.
[0020] FIG. 11 shows that Ap induces the Nrf2 oxidative stress response pathway and Nrf2 regulated genes in Influenza infected endothelial cells.
[0021] FIG. 12 shows that Ap interferes with the interaction between Keapl and Nrf2.
[0022] FIG. 13 shows1H NMR spectrum (600 MHz, DMSO-cfe) of Ap25 TFA salt.
[0023] FIG. 14 shows13C NMR spectrum (150 MHz, DMSO-cfe) of Ap25 TFA salt.
[0024] FIG. 15 shows COSY spectrum (600 MHz, DMSO-cfe) of Ap25 TFA salt.
[0025] FIG. 16 shows HSQC spectrum (600 MHz, DMSO-cfe) of Ap25 TFA salt.
[0026] Fig. 17 shows HMBC spectrum (600 MHz, DMSO-cfe) of Ap25 TFA salt.
[0027] Fig. 18 shows cell survival after l / R (ischemia (hypoxia) followed by reperfusion) when treated with Ap25.
[0028] Fig. 19 shows HO-1 expression after treatment with Ap25 in the setting of Nrf2-depletion (the quantification of Figure 20).
[0029] Fig. 20 shows the effect of DMSO (solvent control), Ap23, Ap25, Ap28 on hemeoxygenase-1 (HO-1) protein levels in murine macrophages (bottom blot); beta-actin is the loading control (top blot). Cells were depleted beforehand of Nrf2 by siRNA (siNrf2) or treated with non-targeting control RNA (siNC).
[0030] Fig. 21 shows corresponding Nrf2 protein levels in cells from Figure20.
[0031] Fig. 22 shows reduction of leg edema after ischemia reperfusion following Ap25 administration.
[0032] Fig. 23 shows reduction of creatine kinase levels after leg ischemia reperfusion following Ap25 administration.
[0033] Fig. 24 shows induction of HO-1 by Ap25 in mice following Ap25 administration.DETAILED DESCRIPTIONI. Definitions
[0034] Unless otherwise indicated, the definitions and embodiments described in this and other sections are intended to be applicable to all embodiments and aspects of the present application herein described for which they are suitable as would be understood by a person skilled in the art.
[0035] As used in this application and claim(s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "include" and "includes") or "containing" (and any form of containing, such as "contain" and "contains"), are inclusive or open-ended and do not exclude additional, unrecited elements or process steps.
[0036] As used in the present application, the singular forms “a”, “an” and “the” include plural references unless the content clearly dictates otherwise. For example, an embodiment including “a compound” should be understood to present certain aspects with one compound, or two or more additional compounds.
[0037] The term “treating” or “treatment” as used herein and as is well understood in the art, means an approach for obtaining beneficial or desired results, including clinical results. Beneficial or desired clinical results can include, but are not limited to alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of disease, stabilized (i.e. not worsening) state of disease, preventing spread of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, diminishment of the reoccurrence of disease, and remission (whether partial or total), whether detectable or undetectable. Treatment methods comprise administering to a subject a therapeutically effective amount ofone or more of the compounds of the application and optionally consist of a single administration, or alternatively comprise a series of administrations.
[0038] The term “prevention” or “prophylaxis”, or synonym thereto, as used herein refers to a reduction in the risk or probability of a patient becoming afflicted with a disease, disorder or condition. For example, a subject may use drugs or other therapies to prevent the onset of a disease, disorder or condition.
[0039] The terms “hydroxy group”, and “hydroxy”, as used herein, refer to a molecule containing one atom of oxygen bonded to one atom of hydrogen, and having the formula -OH. A hydroxy through its oxygen atom may be chemically bonded to another entity.
[0040] The term “alkyl”, as used herein, refers to a straight and / or branched chain, saturated alkyl radical containing from one to “p” carbon atoms (“Ci-CP-alkyl”) and includes, depending on the identity of “p”, methyl, ethyl, propyl, isopropyl, n- butyl, s-butyl, isobutyl, t-butyl, 2,2-dimethylbutyl, n-pentyl, 2-methylpentyl, 3- methylpentyl, 4-methylpentyl, n- hexyl and the like, where the variable p is an integer representing the largest number of carbon atoms in the alkyl radical. Alkyl groups further include hydrocarbon groups arranged in a chain having the chemical formula -CnH2n+i, including, without limitation, methyl groups (-CH3), ethyl groups (- C2H5), propyl groups (-C3H7), and butyl groups (-C4H9).
[0041] The term “alkylene”, as used herein, refers to a divalent alkyl group.
[0042] The term “aryl”, as used herein, refers to a monocyclic, bicyclic, or tricyclic aromatic ring system containing, depending on the number of atoms in the rings, for example, from 6 to 14 carbon atoms (Ce-Cu-aryl) or from 6 to 10 carbons (Ce-Cw-aryl), and at least 1 aromatic ring and includes phenyl, naphthyl, anthracenyl, 1 ,2-dihydronaphthyl, 1 ,2,3,4-tetrahydronaphthyl, fluorenyl, phenanthrenyl, biphenylenyl, indanyl, indenyl and the like.
[0043] The terms “halogen”, “halogenated” and “halo-”, as used herein, refer to the class of chemical elements consisting of fluorine (F), chlorine (Cl), bromine (Br), and iodine (I). Accordingly, halogenated compounds can refer to “fluorinated”, “chlorinated”, “brominated”, or “iodinated” compounds.
[0044] The terms “cyano”, “-CN”, “nitrile group” and “nitrile”, as used herein, refer to a moiety containing one atom of carbon bonded to a nitrogen atom andhaving the formula — C=N it js to be understood that a nitrile group through its carbon atom may be chemically bonded to another entity.
[0045] The term "heterocycle," as used herein refers to single and multi- cyclic aromatic or non-aromatic ring systems in which at least one of the ring members is other than carbon, such as O, N orS. Heterocycles includes pyrimidine, furan, thiophene, pyrrole, isoxazole, isothiazole, pyrazole, oxazole, thiazole, imidazole, oxazole, including, 1 ,2,3-oxadiazole, 1 ,2,5-oxadiazole and 1 ,3,4- oxadiazole, thiadiazole, including, 1 ,2,3-thiadiazole, 1 ,2,5- thiadiazole, and 1 ,3,4- thiadiazole, triazole, including, 1 ,2,3-triazole, 1 ,3,4-triazole, tetrazole, including 1 ,2,3,4-tetrazole and 1 ,2,4,5-tetrazole, pyridine, pyridazine, pyrimidine, pyrazine, triazine, including 1 ,2,4-triazine and 1 ,3,5-triazine, tetrazine, including 1 , 2,4,5- tetrazine, pyrrolidine, piperidine, piperazine, morpholine, azetidine, tetrahydropyran, tetrahydrofuran, dioxane, and the like
[0046] The term “ICAM-1” as used herein refers to intercellular adhesion molecule-1 , an intercellular adhesion molecule present on the surface of leukocytes and endothelial cells and that increases during inflammation. Leukocyte emigration out of the circulation into the tissues requires ICAM-1 , which binds to LFA-1 (integrin), a receptor found on leukocytes.
[0047] The term “RNI” as used herein refers to reactive nitrogen intermediates. Reactive nitrogen intermediates (or reactive nitrogen species) are a family of antimicrobial 5 molecules derived from nitric oxide (»NO) and superoxide (O2-) produced via the enzymatic activity of inducible nitric oxide synthase (iNOS). They are produced by leukocytes.II. Compounds of the Application
[0048] The present disclosure is directed to a compound of Formula (I) which is useful as an anti-inflammatory agent.
[0049] In one embodiment, the disclosure includes compounds of the formula (I)wherein:R’ is H, (Ci-Ce)-alkyl or (Ci-Ce)-acyl;R1is selected from H, halo, -CN, and (Ci-Ce)-alkyl;R2is selected from halo, -CN, (Ci-Ce)-alkyl and -O-(Ce-Cio) aryl, wherein the aryl is optionally substituted with one or more of halo, -CN, (Ci-C3)-alkyl or-(Co- C6)-alkylene-C(O)-N(R’)2 wherein each R’ is individually or simultaneously H or (Ci-C3)-alkyl;R3is selected from H, halo, and (Ci-Ce)-alkyl wherein the alkyl is optionally substituted with halo and nitrile;R4is selected from:- optionally substituted (C1-C1 o)-alkyl, wherein the optional substituents are halo, or CN;y(Ci-Ce)-alkyl;, wherein X is (Ci-Ce)-alkylene and Ring A is an optionally substituted, saturated or unsaturated 5-10-membered heterocycle containing 1-3 heteroatoms, wherein the optional substituents are halo, -CN, (=0), or (Ci-Ce)-alkyl; and, wherein X is (Co-Ce)-alkylene and Ring B is an optionally substituted, saturated or unsaturated 5-10-membered heterocycle containing 1-3 heteroatoms, wherein the optional substituents are halo, -CN, (=0) or (Ci-Ce)-alkyl; wherein, the compound of Formula (I) is not
[0050] In one embodiment, R’ is H. In one embodiment, R’ is methyl. In one embodiment, R’ is -C(=O)-(Ci-C6)-alkyl, such as -C(=O)-(CH3).
[0051] In one embodiment, R1is Br or methyl.
[0052] In another embodiment, R2is Br, methyl or O-phenyl, wherein phenyl is optionally substituted with one or more Br, methyl or -CH2-C(O)-N(R’)2, wherein each R’ is individually or simultaneously H or methyl. In another embodiment, the phenyl is optionally substituted with one or more Br, and -(CH2)-C(O)-N(CH3)2 or - (CH2)-C(O)-NH(CH3).
[0053] In one embodiment, R3is H, Br or methyl. In one embodiment, R3is H. In another embodiment, R3is Br.
[0054] In one embodiment, R4is optionally substituted (Ci-Ce)-alkyl. In another embodiment, R4is -CH3, -CH2CH3 or -CH2CF3.
[0055] In another embodiment, whenC3)-alkylene and R’ is (Ci-C3)-alkyl. In another embodiment, R4is
[0056] In another embodiment, whenwhereinX is (Ci-C3)-alkylene and each R” is H or (Ci-C3)-alkyl. In another embodiment, R4is
[0057] In another embodiment, whenwhereinX is (Ci-C3)-alkylene and each R” is H or (Ci-C3)-alkyl. In another embodiment, R4
[0058] In another embodiment, whenwhereinX is (Ci-C3)-alkylene and each R” is H or (Ci-C3)-alkyl. In another embodiment, R4, wherein X is (C1-C3)- alkylene and Ring A is an optionally substituted 5-10-membered heterocycle containing 1-2. heteroatoms, wherein the optional substituents are halo, -CN, (=0), or (Ci-Ce)-alkyl.
[0061] In one embodiment, R4is, wherein X is (C0-C3)- alkylene and Ring B is an optionally substituted, saturated or unsaturated heterocycle containing 1-3 heteroatoms, wherein the optional substituents are halo, -CN, (=O) or (Ci-C6)-alkyl.(Ci-C6)-alkyl.
[0063] In one embodiment, the compound of Formula (I) isare independently H or (Ci-Ce)-alkyl.
[0064] In one embodiment of the disclosure, the compound of Formula (I) is selected from the group consisting of:
[0065] In another embodiment, the compounds of Formula (I) are useful as anti-inflammatory agents. In another embodiment, the compounds of Formula (I) are useful for the treatment of ischemia-reperfusion injury, for example, after cardiac arrest, cardiopulmonary bypass, transplant, stroke, limb ischemia, acute kidney injury, and / or shock such as hemorrhagic shock, septic shock or cardiogenic shock, or to reduce liver injury after ischemia reperfusion. In another embodiment, the compounds are also useful to decrease lung injury after infection, such as from a bacteria (E. coli) or a virus (such as COVID or influenza), or sepsis. In another embodiment, the compounds are useful for the treatment of autoimmune diseases such as multiple sclerosis, psoriasis, and transplant rejection. In another embodiment, the compound of formula (I) is useful for the treatment of atherosclerosis, asthma, rhinovirus infection, brain ischemia, diabetic nephropathy, acute respiratory distress syndrome (ARDS), cancer, osteoarthritis, sepsis-induced kidney injury or liver disease.III. Uses of the Compounds of the Formula (III)
[0066] In one aspect, the present disclosure relates to a use of a compound of Formula (III)wherein:R’ is H, (Ci-Ce)-alkyl or (Ci-Ce)-acyl;R1is selected from H, halo, -CN, and (Ci-Ce)-alkyl;R2is selected from halo, -CN, (Ci-Ce)-alkyl and -O-(Ce-Cio) aryl, wherein the aryl is optionally substituted with one or more of halo, -CN, (Ci-C3)-alkyl or-(Co- C6)-alkylene-C(O)-N(R’)2 wherein each R’ is individually or simultaneously H or (Ci-C3)-alkyl;R3is selected from H, halo, and (Ci-Ce)-alkyl wherein the alkyl is optionally substituted with halo and nitrile;R4is selected from:- optionally substituted (C1-C1 o)-alkyl, wherein the optional substituents are halo, or CN;y(Ci-Ce)-alkyl;wherein X is (Ci-Ce)-alkylene and each R” is H or, wherein X is (Ci-Ce)-alkylene and Ring A is an optionally substituted, saturated or unsaturated 5-10-membered heterocycle containing 1-3 heteroatoms, wherein the optional substituents are halo, -CN, (=0), or (Ci-Ce)-alkyl; and, wherein X is (Co-Ce)-alkylene and Ring B is an optionally substituted, saturated or unsaturated 5-10-membered heterocycle containing 1-3 heteroatoms, wherein the optional substituents are halo, -CN, (=0) or (Ci-Ce)-alkyl, as an anti-inflammatory agent.
[0067] In another embodiment, the compounds of Formula (III) are useful as anti-inflammatory agents. In another embodiment, the compounds of Formula (III) is useful for the treatment of ischemia-reperfusion injury, for example, after cardiac arrest, cardiopulmonary bypass, transplant, stroke, limb ischemia, acute kidney injury, and / or shock such as hemorrhagic shock, septic shock or cardiogenic shock, or to reduce liver injury after ischemia reperfusion. In another embodiment, the compounds are also useful to decrease lung injury after infection, such as from a bacteria (E. coli) or a virus (such as COVID or influenza), or sepsis. In another embodiment, the compounds are useful for the treatment of autoimmune diseases such as multiple sclerosis, psoriasis, and transplant rejection. In another embodiment, the compound of formula (III) is useful for the treatment of atherosclerosis, asthma, rhinovirus infection, brain ischemia, diabetic nephropathy, acute respiratory distress syndrome (ARDS), cancer, osteoarthritis, sepsis-induced kidney injury or liver disease.
[0068] In one embodiment, R’ is H. In one embodiment, R’ is methyl. In one embodiment, R’ is -C(=O)-(Ci-C6)-alkyl, such as -C(=O)-(CH3).
[0069] In one embodiment, R1is Br or methyl.
[0070] In another embodiment, R2is Br, methyl or O-phenyl, wherein phenyl is optionally substituted with one or more Br, methyl or -CH2-C(O)-N(R’)2, wherein each R’ is individually or simultaneously H or methyl. In another embodiment, the phenyl is optionally substituted with one or more Br, and -(CH2)-C(O)-N(CHs)2 or - (CH2)-C(O)-NH(CH3).
[0071] In one embodiment, R3is H, Br or methyl. In one embodiment, R3is H. In another embodiment, R3is Br.
[0072] In one embodiment, R4is optionally substituted (Ci-Ce)-alkyl. In another embodiment, R4is -CH3, -CH2CH3 or -CH2CF3.
[0073] In another embodiment, whenC3)-alkylene and R’ is (Ci-C3)-alkyl. In another embodiment, R4is
[0074] In another embodiment, whenwhereinX is (Ci-C3)-alkylene and each R” is H or (Ci-C3)-alkyl. In another embodiment, R4
[0075] In another embodiment, whenwhereinX is (Ci-C3)-alkylene and each R” is H or (Ci-C3)-alkyl. In another embodiment, R4
[0076] In another embodiment, whenwhereinX is (Ci-C3)-alkylene and each R” is H or (Ci-C3)-alkyl. In another embodiment, R4, wherein X is (C1-C3)- alkylene and Ring A is an optionally substituted 5-10-membered heterocycle containing 1-2. Heteroatoms, wherein the optional substituents are halo, -CN, (=0), or (Ci-Ce)-alkyl.
[0079] In one embodiment, R4is, wherein X is (C0-C3)- alkylene and Ring B is an optionally substituted, saturated or unsaturated 5-10- membered heterocycle containing 1-3 heteroatoms, wherein the optional substituents are halo, -CN, (=0) or (Ci-Ce)-alkyl.(Ci-C6)-alkyl.
[0081] In one embodiment, the compound of Formula (I) isare independently H or (Ci-Ce)-alkyl.
[0082] In one embodiment of the disclosure, the compound of Formula (III) is selected from the group consisting of:
[0083] In one embodiment, the compound of Formula (III) is
[0084] In another embodiment, the compounds of Formula (III) are useful as anti-inflammatory agents. In another embodiment, the compounds of Formula (III) are useful for the treatment of ischemia-reperfusion injury, for example, after cardiac arrest, cardiopulmonary bypass, transplant, stroke, limb ischemia, acute kidney injury, and / or shock such as hemorrhagic shock, septic shock or cardiogenic shock, or to reduce liver injury after ischemia reperfusion. In another embodiment, the compounds are also useful to decrease lung injury after infection, such as from a bacteria (E. coli) or a virus (such as COVID or influenza), or sepsis. In another embodiment, the compounds are useful for the treatment of autoimmune diseases such as multiple sclerosis, psoriasis, and transplant rejection. In one embodiment, the compounds of Formula (III) are useful as an anti-inflammatory agent for the treatment of, for example, acute respiratory distress syndrome (ARDS) as a result of a lung infection from a bacteria or virus, such as COVID, influenza or E. Coli. In another embodiment, the compounds of Formula (III) are useful as an antiinflammatory agent for the treatment of, for example, atherosclerosis, asthma, rhinovirus infection, brain ischemia, diabetic nephropathy, cancer, osteoarthritis, sepsis-induced kidney injury or liver disease.
[0085] In one embodiment, the compounds of Formula (I) and (III) are for the treatment or prevention of ARDS as a result of a COVID or influenza infection. In one embodiment, the compounds of Formula( I) and (III) are for the treatment or prevention of ARDS as a result of human influenza or SARS-CoV-2.
[0086] In another aspect, the present disclosure includes a method of treating or preventing ARDS as a result of a human influenza or SARS-CoV-2 infection comprising administering an effective amount of one or more compounds of the present disclosure to a subject in need thereof.
[0087] In some embodiments, the human influenza is human influenza A. in some embodiments, the human influenza A is selected from H1 N1 , H3N2, and H5N1.
[0088] In other embodiments, the compounds of Formula (III) are used for treating or preventing a disease, disorder or condition treatable by attenuating production of intercellular adhesion molecule-1 (ICAM-1 ) and / or reactive nitrogen intermediates (RNI):
[0089] In another aspects, the present disclosure includes a method of treating or preventing a disease, disorder or condition treatable by attenuating production of intercellular adhesion molecule-1 (ICAM-1 ) and / or reactive nitrogen intermediates (RNI) comprising administering an effective amount of one or more compounds of the Formula (II) and / or (III) to a subject in need thereof.
[0090] In an embodiment, the disease, disorder or condition treatable by attenuating production of ICAM-1 and / or RNI is selected from atherosclerosis, autoimmune diseases, psoriasis, multiple sclerosis, transplant rejection, asthma, bacterial infection, rhinovirus infection, brain ischemia, ischemia-reperfusion injury, diabetic nephropathy, sepsis, ARDS, cancer, osteoarthritis, sepsis-induced kidney injury, liver disease, and septic and cardiogenic shock.
[0091] In further embodiments, the compounds of Formula (I) and (III) are used for treating or preventing a disease, disorder or condition treatable by attenuating endothelial cell and / or leukocyte activation.
[0092] In another aspect, the present disclosure includes a method of treating or preventing a disease, disorder or condition treatable by attenuating endothelial cell and / or leukocyte activation comprising administering an effective amount of one or more compounds of Formula (III) to a subject in need thereof.
[0093] In an embodiment, the endothelial cell is dermal endothelial cell and / or lung endothelial cell.
[0094] In an embodiment, the disease, disorder or condition treatable by attenuating endothelial cell and / or leukocyte activation is selected from atherosclerosis, auto-immune diseases, psoriasis, multiple sclerosis, transplant rejection, asthma, bacterial infection, rhinovirus infection, brain ischemia, ischemiareperfusion injury, diabetic nephropathy, sepsis, ARDS, cancer, osteoarthritis, sepsis-induced kidney injury, liver disease, and septic and cardiogenic shock.IV. Examples
[0095] The following non-limiting examples are illustrative of the present application.
[0096] Example 1 - MethodsCell culture
[0097] Primary human pulmonary microvascular endothelial cells (HPMEC, PromoCell C-12281) and HMEC-1’s (ATCC CRL-3243) were cultured in EBM-2 media (EBM-2, CC-3156) supplemented with Lonza EGM-2MV (CC-4147), without gentamicin, and used from passage 4-8. RAW264.7 (ATCC TIB-71) and MDCK (ATCC NBL-2) cells were cultured in Dulbecco”s Modified Eagle Medium (DMEM) high glucose (Sigma-Aldrich, D5796), supplemented with 10% fetal bovine serum (FBS) (Sigma-Aldrich, F1051) and Penicillin / Streptomycin (pen / strep). All cell cultures were maintained in a humidified incubator, 5% CO2 at 37°C.Virus
[0098] Influenza A virus (IAV, X-31 , A / Aichi / 68, H3N2) was obtained from Charles River (now AVSBio, #10100375). Briefly, suppliers propagated the virus in specific pathogen free eggs in the allantoic cavity. The allantoic fluid was concentrated and resuspended in Hepes-Saline, layered on a sucrose gradient and interface band was pelleted then resuspended in Hepes-Saline for assessment of 50% egg infective dose (EID50)57. In our hands, virus was propagated according to published protocols5859. Briefly, MDCK cells were grown to confluence in a T75 flask. Viral stock was thawed in cool water and briefly maintained at 4°C while media was removed from the cells. Cells were washed twice with 10mL of room temperature phosphate buffered saline (PBS)+ (containing potassium). Cells were washed a final time with viral growth media (cDMEM with 7.5% bovine serum albumin (BSA), with pen / strep, L-glutamine, HEPES and TPCK trypsin). Viral stock was serially diluted in 1mL of virus growth media and added to cells. Cells and virus were incubated at 37°C for one hour, rocking every 15 minutes. After one hour, 20mL of growth medium was added to flasks, which were returned to the incubator and monitored daily for appearance of viral cytopathic effects (CPE). Once at least 75% of the monolayer exhibited CPE such as rounding and detaching, virus was harvested by collecting media, which was centrifuged at 4°C for 15 minutes to pelletdebris. Supernatant was then aliquoted in vials and stored in liquid nitrogen until use, reserving a small aliquot for determination of viral titer by plaque assay.In vitro influenza infections
[0099] For in vitro infection of MDCK cells, 1.15x105cells were plated per well of a 24 well plate. IAV was diluted in PBS+ accordingly, to obtain a multiplicity of infection (MOI) of 0.01 or 0.001 in 130pL for each well of a 24 well plate. Cells were washed twice with PBS+ and inoculum was added to cells. After one hour adsorption, with rocking every 15 minutes, inoculum was removed and 500pL cDMEM / 7.5% BSA, with or without Ap (1 pM) was added. For experiments aiming to determine viral titer, small aliquots of 30pL of media were removed and stored at -80°C, and used within a week. Recipe for cDMEM / 7.5% BSA is as follows: 500mL of DMEM, 5mL of pen / strep, 12.5mL of 7.5% BSA, 12.5mL of 1 M of HEPES pH 7.4, 500pL of TPCK trypsin (1 mg / mL) and 2.5mL of L-Glutamine (200 mM).
[0100] For in vitro infections of HPMECs, 1.5x105human primary microvascular endothelial cells were plated per well of a 12 well plate. The following day, cells were washed with twice PBS+ to remove any trace of FBS. Cells were infected with IAV X31 in 400uL of serum free media with an MOI of 1 and incubated with inoculum for one hour at 37°C. Plates were rocked every 15 minutes. After one hour, 1 mL of complete media containing Aeroplysinin-1 (Ap from abcam- ab142685, reconstituted in DMSO to a stock of 5.9mM, used at 1 pM in experiments) or solvent control (dimethyl sulfoxide-DMSO) was added to cells, which were then returned to 37°C for the appropriate amount of time.Plaque Assays
[0101] One day priorto experiment, 4.2x105MDCK cells were plated per well of a 6 well plate. The next day, cells were nearing 100% confluency. The morning of the experiment, 2X MEM was prepared using the following recipe: to prepare 50mL, 10mL of 10X MEM, 1 mL of pen / strep, 500pL of L-Glutamine (200mM), 3mL of NaHCOs (7.5%), and 35.5mL of autoclaved double distilled water were mixed in a tube. Immediately prior to use, 100pL of TPCK trypsin (1 mg / mL) was added. Agarose was also prepared prior to starting the experiment; 1.2g of Agarose was dissolved in 100ml od double distilled autoclaved water. The mixture wasmicrowaved until agarose was completely dissolved, and left in a water bath at 56°C for at least 50 minutes before use. Media samples were thawed on ice and tenfold serially diluted 8 times in PBS+. Media was removed from cells, and cells were washed twice with PBS+. In duplicate wells, 400pL of inoculum was added to cells and incubated at 37°C for one hour, rocking every 15 minutes. Once the adsorption phase complete, inoculum was removed and 2mL of a 1 :1 Agarose:2xMEM mixture was gently pipetted onto the cells. Importantly, this mixture was allowed to slightly cool before adding to cells, to avoid killing them. After addition of the agarose mixture, plates were incubated in the hood for 5-10 minutes (until agarose solidified and fully cooled), then returned to the incubator for 48-72 hours. Once plaques were visible (distinguishable due to CPE and cell death in a distinct circle), plates were fixed by adding 2m L of a 75% ethanol:25% acetic acid mix on top of the agarose layer. This incubated at room temperature for 30 minutes and fixative was removed. Agarose plug was removed using a spatula and monolayer was stained by covering monolayer with a 0.5% cystal violet solution for 15 minutes or more. After staining complete, crystal violet was removed by pipetting and excess stain was removed by gently washing plates with water. Plates were dried overnight and the number of plaques were counted the following day to calculate the titer. Dilutions yielding wells with more than 10 but less than 150 plaques were used for calculation of titer. To determine viral titer of lung samples from infected mice, the same procedure was used but instead of using an aliquot of media, lungs were homogenized in PBS+ (1 mL / 100mg), debris pelleted by centrifuging at 400g for 5 minutes at 4°C, and resulting supernatant was used for serial dilutions.In vitro LPS treatment
[0102] LPS from E. Coli O111 :B4 was obtained from Sigma (L2630) and reconstituted to 1 mg / mL in sterile ddF . This stock was aliquoted and stored at - 20°C. 1.5x105endothelial cells or 1.4x105RAW264.7 cells were plated per well in a 12 well plate. The following day, media with or without LPS, and with or without drug was prepared; LPS was diluted in DMEM+FBS or complete EMB-2, for raw cells or HMECs respectively, to a concentration of 0.1 ug / ml of LPS. DMSO or Ap (1 pM) was diluted in media with and without LPS. Existing media was removed from plated cells and replaced with the media of the appropriate condition. Cells were returned to the incubator for the appropriate amount of time. In all cases, cells werelysed according to the method used for downstream analysis (cell lysis methods are described in the appropriate section)Griess assay
[0103] One day prior to experiment, 8.4x104RAW264.7 cells / well were seeded in 24 well plates. The following day, media was removed and replaced with media containing DMSO or Ap (1 pM), with or without LPS prepared as described above. Cells were returned to the incubator and 24 hours later media was collected for a Griess assay and cells were collected for western blotting. Griess assays were performed as follows; Griess reagent was prepared by mixing NNED solution (0.1g N-(1-naphthyl)ethylenediamine hydrochloride (Sigma) in 100mL ddF ) and SULF solution (1g of sulfanimide (sigma) in 100mL of 5% v / v phosphoric acid (Sigma)) at a 1 :1 ratio immediately prior to use. 100uL of media samples were dispensed in triplicate wells of a 96 well plate, as well as nitrite standards (34.5mg of sodium nitrite dissolved in 500pL of DMEM, creating a 1 M solution that was serially diluted in media) and blank. 100uL of Griess reagent was added to each well, and incubated for 30 minutes at room temperature shielded from light. Absorbance was measured on a plate reader at 540nm.Immunoblotting
[0104] For blots using cell lysates, cells were washed three times with PBS+ to remove any trace of media prior to lysis. After the last wash was removed, cells were lysed by adding lysis buffer containing 62.5mM Tris-HCI, pH 6.8, 2% SDS, 10% glycerol and 10mM dithiothreitol (DTT) to wells. Lysates were scraped using a sterile cell scraper, transferred into an Eppendorf tube and stored at-20°C until use. Lysates were thawed on ice. All raw cell lysates were shredded with a 25G needle prior to use. Samples were prepared by transferring 32pL of lysate into an Eppendorf tube containing 8pL of loading buffer. Samples were boiled at 95°C for five minutes, then cooled on ice for five to ten minutes. Samples were briefly centrifuged at max speed and then loaded into gels. Proteins were separated with 10% polyacrylamide gels, at 85V for 25 minutes followed by 150-175V until dye front ran out. Samples were transferred onto nitrocellulose membranes (0.45uM pores, Bio Rad #1620115) by wet transfer, 110V for an hour and ten minutes. Membranes were blocked for 30min-1 h in 5% milk in Tris-buffered saline +0.1 %Tween20 (TBST), after which they were washed five times with TBST to remove residual milk. Membranes were incubated at 4C overnight with primary antibody diluted in TBST. The following morning, membranes were washed five time with TBST for 5-10 minutes each, and incubated with horseradish peroxidase (HRP)- conjugated secondary antibodies for 1 h (anti-mouse IgG HPRT CST#70763 or antirabbit IgG HPRT CST#7074). They were then washed 5 times, incubated with ECL (Bio Rad #170-5061) for 5 minutes and imaged using the ChemiDoc Imaging system (Bio-Rad). Band intensity was quantified using ImageLab software (Biorad), normalized to actin loading control and then normalized to appropriate control to determine the fold change. Antibodies used are as follows: SQSTM1 / p62 (Cell Signaling #39749), Keapl (Cell Signaling #8047), Ho-1 (Cell Signaling #43966), p- actin (Santa-Cruz, sc-47778), a-actinin (Cell Signaling, #3134), GAPDH (Santa Cruz, sc-365062), ICAM-1 (Santa Cruz, sc-107), iNOS (NB300-605), TLR4 (sc- 10741), Nrf2 (GeneTex, GTX103322), VE-Cadherin (Santa Cruz sc-9989), IKB-O (Cell Signaling #9242), anti-mouse IgG, HRP linked (Cell Signaling, #7076) and anti-Rabbit IgG, HRP linked (Cell Signaling #7074). qPCR
[0105] Total RNA was isolated from HPMECs seeded on 6 well plates (3.8x105cells / well), and influenza infections were performed as described above. Lysates were prepared by washing cells twice with PBS+, then cells were lysed in recommended volume of RLT Lysis buffer from the Qiagen rNeasy RNA Isolation Kit (Cat. No. I ID: 74104) and collected by scraping with a sterile cell scraper. Lysates were vortexed for 20 seconds, centrifuged at max speed for 3 minutes at room temperature at stored at -80C for up to two weeks prior to extraction according to manufacturer’s instructions. 1 pg of RNA was used to perform cDNA synthesis using Applied Biosystems High Capacity cDNA Reverse Transcription Kit (4368814). A master mix of water, primers and PowerUp SYBR Green (Applied Biosystems) was prepared, and 36pL were added to 4pL of cDNA. Mixture was vortexed, spun down at 7000rpm for two minutes, and added to the qPCR plate in triplicates (10pL per well). Quantitative polymerase chain reaction (qPCR) was performed using an Applied Biosystems QuantStudio 7 Flex Real-Time PCR system with the following cycling parameters : 95°C for 10 mins followed by 40 cycles of 95°C for 15 seconds then 60°C for 1 minute. mRNA abundance ispresented relative to 18S. Primers for 18S and ICAM1 are as follows : 18S F- GATGGAAAATACAGCCAGGTCCTA, 18S R-TTCTTCAGTCGCTCCAGGTCTT, ICAM-1 F-ATGCCCAGACATCTGTGTCC, ICAM-1 R-GGGGTCTCTATGCCCAACAA.RNA sequencing (RNASeq)
[0106] Total RNA was isolated from HPMECs seeded on 6 well plates (3.8x105cells / well) or RAW264.7 cells (9.2x105cells / well). HPMECs were infected with influenza as described above and treated with DMSO, Ap (1 pM) or Ap-1 (a modified, nonfunctional version of Ap) for two hours. RAW264.7 cells were stimulated with LPS as described above, in conjunction with DMSO, Ap (1 pM), Ap- 7 (1 pM, a nonfunctional derivative) or Ap-9 (1 pM, functional derivative). Each condition was performed in triplicates. Lysates were prepared by washing cells twice with PBS+, lysed in recommended volume of RLT Lysis buffer from the Qiagen rNeasy RNA Isolation Kit (Cat. No. I ID: 74104) and collected by scraping with a sterile cell scraper. Lysates were vortexed for 20 seconds, centrifuged at max speed for 3 minutes at room temperature at stored at -80C for up to two weeks prior to extraction according to manufacturer’s instructions.
[0107] RNA samples were submitted to the Center for Applied Genomics Next Generation Sequencing Facility at SickKids for quality control on the bioanalyzer, library prep and sequencing. Samples had an Agilent Bioanalyzer RNA integrity number above 7 and an QD260 / 230 ratio of 2.0-2.2. Library prep was performed using the NEB Ultra II Directional mRNA kit for both experiments. Sequencing was performed with the Illumina Hiseq2500 platform with high throughput flowcell PE2x125bp (paired end 2x125 base pair configuration), with 25- 30 million reads per sample.
[0108] Reference-based count-based differential gene expression with STAR+hTseq+edgeR, comparing the following 9 sets of samples for HPMECs; (1) DMSO Flu vs Ap Flu, (2) DMSO Flu Vs Ap1 Flu, (3) Ap Flu vs Ap1 flu, (4) DMSO no flu vs Ap no flu, (5)DMSO No flu vs Ap1 no flu, (6) Drug no flu vs Ap1 no flu, (7) DMSO no flu vs DMSO Flu, (8) Ap no flu vs Ap flu, (9) Ap 1 no flu vs Ap1 flu. The genome reference sequence was GRCh37 primary assembly, Gencode v.28lift37 gene models, downloaded fromhttps: / / www.gencodegenes.org / human / release_28lift37.html. The following small RNA species, which should be excluded by size from the RNA-Seq libraries, are removed from the annotation file to avoid spurious results: Mt_tRNA, miRNA, scRNA, snRNA, snoRNA, vaultRNA.
[0109] For RAW264.7 cells, reference-based count-based differential gene expression with STAR+Htseq+DESeq2, comparing the following groups; (1)DMSO no LPS vs Ap no LPS, (2) DMSO no LPS vs Ap7 no LPS, (3) Ap7 no LPS vs Ap no LPS, (4) Ap no LPS vs Ap9 no LPS, (5) DMSO LPS vs Ap LPS, (6) DMSO LPS vs Ap7 LPS, (7) Ap7 LPS vs Ap LPS and Ap LPS vs Ap9 LPS. The library was a standard paired end library, the genome reference sequence was GRCh38, Gencode annotations, Release 36 for RAW264.7 cells. The sequencing data is in FASTQ format. The quality of the data was assessed using FastQC v.0.11.5 (http: / / www.bioinformatics.babraham.ac.uk / projects / fastqc / ).Ingenuity Pathway Analysis (IPA)
[0110] RNASeq data obtained from influenza infected primary lung endothelial cells or LPS stimulated RAW264.7 cells were imported into Ingenuity Pathway Analysis (IPA) for pathway analysis (QIAGEN Inc.). For each biological function, an activation z-score computed. This is used to infer likely activation states of biological functions / enriched pathways (increased activation=positive z score or decreased activation=negative z score). Differentially expressed genes (False discovery rate, FDR<0.05) were used for IPA enrichment comparisons. The following comparisons were performed: 1 . Flu DMSO vs flu Ap, 2. Flu DMSO vs flu Ap1 , 3. Flu Ap vs flu Ap1 , 4. No flu DMSO vs no flu Ap, 5. No flu DMSO vs no flu Ap1 , 6. No flu Ap vs no flu Ap1 for the endothelial experiment. For the RAW267.4 cells, the following comparisons were performed: 1 . LPS DMSO vs LPS Ap, 2. LPS Ap vs LPS Ap7, 3. LPS AP9 vs LPS Ap, 4. No LPS DMSO vs no LPS AP, 5. No LPS Ap9 vs no LPS Ap, 6. No LPS Ap7 vs No LPS DMSO. The following analyses were performed: 1 . Canonical pathways which produces a list of enriched canonical pathways among differentially expressed genes, 2. Networks which provides a list of gene regulatory networks showing the interactions between differentially expressed genes, and 3. Chemical compounds which provides a list of chemical compounds that show a consistent effect at target genes.SiRNA knockdown
[0111] Depletion of Keapl and Nrf2 (Nfe2l2) was accomplished by transfection of siRNA with Lipofectamine RNAiMAX transfection reagent from Invitrogen. Small interfering RNA or short interfering RNA (siRNA) for mouse and human Keapl (GeneSolution GS50868 for Keapl catalogue number 1027416 and GS9817 catalogue number 1027416 respectively) and Nrf2 (flexitube gene solution GS 18024 for Nfe2l2 catalogue number 1027416 and GS4780 for Nfe2l2 Catalogue number 1027416 respectively) were obtained from Qiagen and reconstituted as per manufacturers instructions. Transfection was performed as per manufacturers instruction, but using 5.5uL of lipofectamine RNAiMAX Reagent (thermofisher) and 3uL of prepared siRNA stock or nontargeting control siRNA. 150pL of the master mix was added per well of a 12 well plate. HMECs or RAW 264.7 cells were transfected at 70% confluency in complete media. 24 hours post transfection media was changed, and experiments were performed 48 hours post transfection. Knockdown efficiency was assessed by western blot.Co-immunoprecipitations
[0112] HEK293Ts were transfected with 2.5pg of Keapl and Nrf2 plasmids using lipofectamine 3000, according to manufacturers’ instructions. Following DMSO or Ap treatment, co-immunoprecipitations or reverse coimmunoprecipitations were performed. Cells were washed with cold PBS+ and then lysed on ice in non-denaturing lysis buffer containing 20m M Tris HCI pH8, 150mM NaCI, 1 % Nonidet P-40 (NP-40) and 2mM EDTA. Protease inhibitors were added to the lysis buffer immediately prior to lysis. Lysates were transferred from the dish to a microcentrifuge tube and maintained at constant agitation for 30 minutes at 4°C. Lysates were centrifuged and supernatant transferred to a new tube. Lysate pre-clearing was performed to reduce non-specific binding and background. Briefly, 100uL of bead slurry was added to the lysate and incubated for 10-30 minutes at 4°C for 10 minutes, then centrifuged at 14000xg at 4°C for 10 minutes. Supernatant was transferred to a new tube to use for immunoprecipitations. 500ug of cell lysate was added to a microcentrifuge tube on ice, followed by addition of 1 ug of antibody. The mixture was incubated overnight at 4°C under gentle agitation. The following morning, 50uL of protein G-coupled Sepharose beads were added to each sample,then incubated under rotary agitation at 4°C for one hour. Tubes were centrifuged and supernatant removed from the beads. Beads were washed five times with wash buffer containing 10mM Tris pH7.4, 1 mM EDTA, 400mM NaCI, 1 % TritonX-100 and protease inhibitor cocktail. Elution of the complex from the beads was performed by heating the 50uL of beads in 50uL of 2x SDS loading buffer for 10 minutes at 50°C.Mice
[0113] 11-12 week old C57BL / 6J male mice were purchased from JacksonLaboratories (strain 000664) and housed in the vivarium at St. Michael’s hospital on a standard light:dark cycle. Mice had free access to food and water at all times. All influenza infections were performed in a dedicated Biosafety Level 2 (BSL-2) facility, while E. Coli and LPS experiments were performed in the regular animal manipulation areas. All experimental procedures were in accordance with the St. Michael’s Hospital Animal Care Committee guidelines for animal use, under approved animal protocol ACC120. In experiments requiring sedation, mice were anesthetized with 5% isoflurane.In vivo influenza infections
[0114] One day prior to infection, hair was removed from necks of mice by shaving then using depilatory cream to allow monitoring by pulse oximeter. For influenza infections of mice, animals were sedated with 5% isoflurane and infected intranasally with 64 HAU (hemagglutinatin unit) in 80uL of influenza virus X31 . After infection, mice were separated into weight matched groups. One day post infection, mice received DMSO or Ap by intraperitoneal (I.P.) injection at a dose of 0.78mg / kg of Ap or equivalent amount of DMSO, diluted in PBS-. Mice received one injection / dayfor4 days. Weight, temperature, oxygen saturation and activity of mice were monitored daily. Mice were sacrificed if they reached two of four of the following end points: lost 30% or more of their initial body weight, reached a temperature below 31 C, oxygen saturation below 75% or activity of 111. Oxygen saturation was only monitored until day 6, as after this time mice have lost too much weight or their hair began to regrow, leading to inaccurate measurements. The oxygen saturation was measured using the Mouse Ox Plus device and software from Starr Life Sciences on awake, non anesthetized mice using a small collar clip.Zebrafish
[0115] Zebrafish were raised as previously described. Briefly, embryos were obtained by mating, and cultured in embryo media. Embryonic zebrafish were raised in a 28.5±0.5°C incubator with normal oxygen concentrations (20%) in embryo water (E2, 13,7mM NaCI, 5.4mM KCI, 0.25mM Na2HPO4, 1.3mM CaCL2, 1 mM MgSO4, 4.2mM NaHCO3, pH7.2 with NaOH). Embryonic fish were kept in 5 cm petri dishes until infection and treatment. Mating pairs were set up and eggs were collected (=0 days post fertilization dpf). Once fish embryos reached three days post fertilization (3dpf), embryos were anesthetized using clove oil, and infected with influenza A (H1 N1 , PR8) by microinjection of 4pL of influenza into the common cardinal veins (CCV) site of zebrafish. Fish were placed in 96 well plates in 100pL of embryo water with 0.5% DMSO, with three to five fish per well. Compounds were from chemical libraries obtained from Dr. Raymond Andersen and contained marine derived compounds60. T reatments were applied 5 hours post infection by adding compounds to the water. Ap was used at a concentration of 4pM. Compounds and embryo water was refreshed two days post injection. Fish were observed daily and scored for levels of edema and survival. Embryos were scored two-three times on day three post infection as edema was most severe and greatest differences were observed. Edema severity was scored on a scale of 1-6, with 1 being least severe, 5 most severe and 6 being dead.E. Coli in vivo
[0116] Escherichia coli (E. coli) from the American Type Culture Collection 25922 was grown in luria broth (LB) overnight at 37°C at 250 rotations per minute (rpm). The optical density (OD) of the E. coil was measured with a spectrophotometer (DU™ 800 spectrophotometer, Beckman Coulter) prior to experiments and cultures were used in late exponential phase, with an OD between 0.85-1. 1x107colony forming units (CFU) was delivered intratracheally to each mouse in a final volume of 130pL. Mice were recovered from anesthesia on their backs on a warming blanket and returned to their cages. Oxygen saturation was continuously monitored using the MouseOx system. Wild type C57BL / 6 or global Nrf2 knock out (KO) mice on the C57BL / 6 background were both from Jackson. Forsome experiments, lungs were collected for histological analysis 5-6 hours post infection.LPS In vivo
[0117] LPS from E. Coli O111 :B4 or O55:B5 was acquired (Sigma) and dissolved in saline to a concentration of 1 mg / mL. LPS was administered intraperitoneally (I.P.) at a dose of 10mg / kg to 11-12 week old male C57BL / 6 mice, at the same time as DMSO or Ap (0.78mg / kg). Oxygen saturation of mice was continuously monitored using the MouseOx system until it returned to baseline.Leukocytes
[0118] For the isolation of leukocytes from murine blood, Ficoll-Paque PLUS was used according to previously described protocols61 62. Briefly, 3m L of Ficoll- Paque PLUS was added to a centrifuge tube. 4mL of blood sample was carefully added on top of the Ficoll-Paque Plus, then centrifuged at 400xg for 30-40 minutes at 18-20°C. A Pasteur pipette was used to remove the upper layer of plasma. To remove platelets, the next layer containing the lymphocytes and platelets was transferred to a clean centrifuge tube and cells were resuspended in three volumes of balanced salt solution, then centrifuged at 60-1 OOxg for 10 minutes at 18-20°C. Supernatant was removed and lymphocytes were resuspended in 8mL of balanced salt solution, then centrifuged again. The supernatant was removed and isolated lymphocytes were used for in vitro experiments (i.e. treatment with DMSO / Ap then lysis for western blot). Treatments with compounds were for two hours, using a concentration of 1 pM.Murine in vivo hemorrhagic shock / resuscitation model
[0119] Hemorrhagic shock / resuscitation (HSR) surgery was performed using previously described methods63. The mouse model is a pressure-controlled hypovolemic shock / resuscitation model. Briefly, male wild-type (WT) C57BL / 6J mice (Jackson Laboratories) (10-12 weeks, 26.3±0.5g) were anesthetized to surgical plane via intraperitoneal injection of sodium pentobarbital (70mg / kg) (euthanyl, Bimeda-MTC Animal Health Inc., Cambridge, ON) and allowed to rest for 15 minutes before first incision. Animals were taped on a warming pad throughout the procedure with constant temperature monitoring through a rectal thermometerlubricated with 100% white petroleum (Type K Thermometer, Fischer Scientific). Body temperature was maintained at 37±1 °C. A 1-1 ,5cm incision was made at the neck for access to the carotid artery, dissection to the right carotid artery was performed and the vagus nerve was dissected away from the carotid artery. A 1 .5- 2cm incision was made on the left hindlimb, and dissection was performed to access the femoral artery. Under 20-40X microscopic examination, microvascular cannulation of the right carotid and left hindlimb femoral arteries were achieved with stretched polyethylene-10 tubing (BD Intramedic, PE10 #427401) infused with sterile heparin-0.9% saline solution (10U / mL, Fresenius Kabi, Toronto, ON). Incision sites were both subcutaneously injected with 50uL of 0.05% bupivacaine hydrochloride-saline for local analgesia and kept hydrated with sterile 0.9% saline (SteriMax, Oakville, ON). Mean arterial pressure (MAP) was constantly monitored using the carotid cannula connected to a pressure transducer (DTXPIus, DT-XX, #682018) and physiologic monitor (PM-9000Vet, Mindray Biomedical Technologies). MAP was brought down to 30mmHg by controlled hemorrhage from the femoral cannula over a 30min stabilization / compensation period and maintained at 30mmHg for two more hours. Mice were treated with Aeroplysinin-1 (Ap, 0.8mg / kg) or DMSO control through the femoral cannula at the end of the two-hour shock period. Mice were fluid resuscitated using all shed blood and Lactated Ringer’s Solution equal to two volumes of shed blood, over ~15 mins through the femoral artery cannula. Animals were monitored for a time course of 0.5-2h after resuscitation and were sacrificed by exsanguination from the carotid artery canula; blood was collected, and organs were flash frozen in liquid nitrogen and stored at - 80°C. Animals were maintained in surgical plane with sodium pentobarbital as required (70mg / kg) throughout the procedure.Murine liver and lower extremity ischemia / reperfusion injury model
[0120] Wild-type mice (8-16w, 27±3g) were acclimated to the animal room racks for at least 1 week before surgery. Littermate or cagemate controls were used for experiments. Partial 70% warm liver l / R was accomplished using previously described methods. Briefly, mice were weighed and injected with DMSO, Ap or Ap9 (0.78mg / kg) I.P. 15 minutes prior to surgery. Surgical plane of anesthesia was induced using isoflurane (2.5-4% delivered in 100mL / min O2) for 3mins. Mice were placed supine with limbs gently taped down. Mice were placed on a self-regulatedwarming pad throughout the procedure with constant temperature monitoring (37°C) through a rectal thermometer lubricated with 100% white petroleum. Eyes were lubricated with sterile ophthalmic ointment to prevent dehydration. The abdomen was shaved with clippers and rubbed down with 70% isopropyl alcohol. Surgical tools were sterilized using the Germinator 500 Glass Bead Sterilizer (CellPoint Scientific) for 30s. A 2-3cm midline laparotomy was conducted through the skin and peritoneum. The abdominal wall was retracted transversely and a blunt two-pronged retractor was placed atop the Xiphoid cartilage to achieve proximal retraction. All lobes of the liver were exposed, and sterile saline (0.9%) soaked cotton swabs were used to gently reposition digestive organs (stomach and intestines) from the field of view. The liver was lifted upwards to visualize the portal vein, bile duct and major hepatic artery branches. Under microscopic examination (20-40X), using micro-scissors, the ligamentum venosum was dissected in order to fully mobilize the left lobe and permit clear visualization of the branches of the hepatic artery. Further dissection was performed as needed. An atraumatic microvascular clamp was placed with clamp forceps at the leftward branch of the hepatic artery (which leads to the left lobe), this disrupted blood flow hence blanching both the left and median lobes and rendering them ischemic, whereas the other liver lobes do not blanch and are therefore not ischemic. Warm liver ischemia was timed for 1 h. Following the ischemic period, the clamp was removed, and the liver was reperfused for two hours. During the ischemic period and the reperfusion period, all retractors were removed, and a sterile-saline (0.9%) soaked cotton gauze was placed over the incision site to prevent dehydration of abdominal organs. Sham mice underwent all surgical manipulations except atraumatic clamp placement. Ischemia-only mice underwent 1 h of ischemia followed by sacrifice. Mice were sacrificed by exsanguination from the carotid artery for blood collection using a 23-gauge needle attached to a 1 mL syringe containing heparinized saline (2.5U / mL) as anticoagulant. Blood was gently mixed by inversion and placed on ice for no more than 15mins until centrifugation. Liver was collected for histology.
[0121] For the limb ischemia model, mice were anesthetized and the hind limbs were shaved. A tourniquet was used to clamp the left hindlimb. Ischemia was confirmed using laser doppler. Ischemia was maintained for 2 hours. At the end of the 2 hours, the tourniquet was released and Ap25 (0.78 mg / kg) / solvent control wasadministered IP. Mice were allowed to recover from anesthesia. 2 hours postreperfusion, mice were anesthetized and sacrificed via cardiac puncture. Blood was collected for downstream serum creatine kinase analysis. Distal hindlimb sections were collected for processing of wet / dry ratio, protein analysis, and histology.Liver histology H&E staining and Suzuki Liver Injury Score quantification
[0122] Liver tissue was cut into ~5mm3and fixed by immersion in 10% neutral buffered formalin for 24h, then washed three times with PBS and stored in 70% EtOH until processing. Tissue was prepared using an automatic tissue processor (Leica TP1020). Tissue was embedded in paraffin wax (Leica EG1160), cut into 5pm sections (Leica RM2235) and auto-stained with hematoxylin and eosin (Leica Autostainer XL). Coverslips were placed using toluene (Permount, Fischer Chemical). Using the Zeiss Axio Scan (v2.1 ) system, images of entire slides were captured and analyzed in HALO (v2.3.2089.23). The Suzuki Liver Injury Score (SLIS) (Behrends et al. J Gastrointest Surg. 2010 Mar;14(3):528-35) was utilized to quantify liver histopathology by a blinded observer. The SLIS quantifies the following hepatocellular pathological features: (1) hepatic congestion, (2) cytoplasmic vacuolization and (3) liver necrosis on a numerical scale.Plasma ALT and AST measurement
[0123] Fresh heparinized mouse blood was centrifuged (Sorvall LegendMicro 21 R, Thermo Scientific) at 2,500 x g for 10mins at 4°C, and plasma supernatant was collected. Alanine transaminase (ALT) and Aspartate transaminase (AST) concentration was quantified by the St. Michael’s Hospital Diagnostic Laboratory (Toronto, ON).Creation of Derivatives - General Methods
[0124] Optical rotations were measured using a Jasco P-1010 Polarimeter with sodium light (589 nm). UV spectra were recorded with a Waters 996 Photodiode Array Detector. The1H and13C NMR spectra were recorded on either a Bruker AV600txi spectrometer or a Bruker AV-600 spectrometer with a 5 mm CPTCI cryoprobe.1H chemical shifts are referenced to the residual DMSO-cfe, MeOH-d4, acetone-cfe or CDCh (52.49. 3.30, 2.05 and 7.24 ppm, respectively) and13C chemical shifts are referenced to the DMSO-de, MeOH-ck, acetone-cfe or CDChsolvent peak (5 39.5. 49.0, 206.7 / 29.9 and 77.0 ppm, respectively). Low and high resolution EIMS were recorded on a Kratos MS-50 mass spectrometer. Low and high resolution ESI-QIT-MS were recorded on a Bruker-Hewlett Packard 1100 Esquire-LC system mass spectrometer. Merck Type 5554 silica gel plates and Whatman MKC18F plates were used for analytical thin layer chromatography. Cis reversed-phase and chiral HPLC purifications were performed on a Waters 1525 Binary HPLC pump attached to a Waters 2998 Photodiode Array Detector using a flow rate of 2.0 mL / min. All solvents used for HPLC were Fisher HPLC grade and were filtered through a 0.45 pm filter (Osmonics Inc.) prior to use.
[0125] Example 2 - Preparation ofAp9p-Cresol2.3.6-Tribromo-p-Cresol4:1 - 1 :4
[0126] To 5 mmole of p-cresol (540.7 mg) in 90 mL MeCN was added 570 pL of concentrated H2SO4 (2.1 equiv). After stirring the reaction mixture at 0°C for 15 min 5.6 mmole of N-bromosuccinimide (1 .0 g) dissolved in 10 mL of MeCN was added dropwise over a period of 2 min. After 2 hours an additional 1 g of N- bromosuccinimide dissolved in 5 mL MeCN was added dropwise at 0 °C. Subsequent 1 g additions of N-bromosuccinimide resulted in the di / tri bromo ratio of the product to vary from 4: 1 - 1 :4. The sample was then allowed to warm to RT and stirred overnight. The reaction mixture was evaporated to near dryness and then extracted between H2O (100 mL) and CH2CI2 (3 x 50 mL). The combined CH2CI2 extracts were washed with H2O (2 x 200 mL), followed by brine (1 x 100 mL) and dried over MgSO4, filtered and evaporated. The crude reaction mixture was fractionated by flash silica gel column chromatography using 1 :4 EtOAc / hexanes as eluent. The mixture of the di- and tri-bromo products with an overall yield of > 80% (that were separable on C18 reversed-phase HPLC using a InertSustain, 5 pm, 25 x 1 cm column, with 4:1 MeCN / H2O as eluent to give material for characterization) were as described below for the preparation of Ap7 (7) treated with oxone. The desired products eluted with 1 :19 EtOAc / Hexanes from a flashsilica gel column using a step gradient of hexanes to 1 :3 EtOAc / hexanes as eluent. The crude products were then separated via Cis reversed-phase HPLC using a InertSustain, 5 pm, 25 x 1 cm column, with 13:7 MeCN / F as eluent to give Ap9 as a clear viscous oil with an overall yield of < 7%.
[0127] 9: UV [13:7 MeCN / H2O] Amax 195, 263, 299 nm;1H NMR (CDCh, 600MHz): 7.53 (s, 1 H), 2.79 (bs, 1 H), 1.63 (s, 3H) ppm;13C NMR (CDCh, 150 MHz): 170.8, 154.9, 151.6, 126.1 , 120.2, 74.5, 28.3 ppm; HRESIMS [M-Hp m / z 356.7761 (C7H4Br3O2, calcd 356.7767).
[0128] Example 3 - Second Preparation ofAp92.62.3.6-Tribromo-p-Cresol1 :4
[0129] Following procedures previously described64, to a stirred suspension of a 1 :4 mixture of 2,6-tribromo-4-p-cresol and 2,3,6-tribromo-p-cresol (150 mg) in acetic acid (5 ml) at RT was added rapidly fuming nitric acid (1 mL). After 3 hr HPLC analysis indicated that all the starting material had been consumed and 50 mL of H2O was added to the reaction mixture and then extracted with CH2CI2 (3 x 20 mL). The combined organic extract was washed with H2O (2 x30 mL), dried over MgSO4, filtered and evaporated. The crude products were then purified via C18 reversed- phase HPLC using a InertSustain, 5 pm, 25 x 1 cm column, with 1 :1 MeCN / H2O as eluent to give 92.1 mg (255.2 pmole) of Ap9 for an overall yield of >70 %.
[0130] Example 4 - Preparation ofAp74-Hydroxyphenyl- acetamide
[0131] 1 mmole of 4-hydroxyphenylacetamide was similarly treated with oxone; to 1 mmole of 4-hydroxyphenylacetamide in 10 mL 1 :1 MeCN / F was added 8.0 equivalents of oxone and 24.8 equivalents of NaHCOs. The reaction mixture was stirred for 15 min at RT and then diluted with 15 mL H2O. This was followed by the addition of 10.0 mmole of solid sodium thiosulfate (Na2S20s, 1.58 g) and the resulting mixture stirred at RT for 30 min. An additional 25 mL of H2O was added and the reaction mixture was then extracted with EtOAc (3 x 20 mL). The combined organic extracts were evaporated to dryness and the crude reaction mixture was fractionated by flash silica gel column chromatography using a step gradient of 1 :19 EtOAc / hexanes to EtOAc as eluent. The material obtained after flash silica gel column chromatography was purified via C18 reversed-phase HPLC using a InertSustain, 5 pm, 25 x 1 cm column, with 1 :9 MeCN / F as eluent to give Ap7, in low yield (1 .5 mg, 8.9 pmole, 0.9% yield), as a pale yellow oil.
[0132] 7: UV [1 :1 MeCN / FW] Amax 229 nm;1H NMR (MeOH-ch, 600 MHz):7.04 (d, J = 10.1 Hz, 2H), 6.13 (d, J = 10.1 Hz, 2H), 2.57 (s, 2H) ppm; HREIMS [M]+m / z 167.0583 (CsHgNOs, calcd 167.0577).
[0133] Example 5 - Preparation of Ap252-(3,5,Dibromo-4- 2,6-Dibromo-4- hydroxyphenyl)-1 - (2-morpholinoethyl) morpholinoethan-1-one phenol
[0134] 4-Hydroxy-phenylacetic acid (200 mg, 1.31 mmole) was dissolved in 30 mL of 2:1 CH2CI2 / THF and cooled in an ice bath. Over a period of 12 hours 12 equivalents of pyridinium tribromide (5.03 g, 15.72 mmole) were added and the reaction mixture was allowed to slowly warm to RT and left to stir for 4 days. The reaction was quenched with the drop wise addition of ~40 ml of 2M sodium bisulfite. An additional 40 mL of CH2CI2 was added and the solution then extracted with H2O (2 x 40 mL). The CH2CI2 extract was dried over MgSO4, filtered and evaporated andthe product purified by flash silica gel column chromatography using a step gradient of 1 :19 - 1 :1 EtOAc / hexanes as eluent in >80% yield. To a portion of the resulting 3,5-dibromo-4-hydroxy-phenylacetic acid (311.7 mg, 1.01 mmole) dissolved in 30 mL of DMF was added 1.2 equiv of HATU (hexafluorophosphate azabenzotriazole tetramethyl uranium) (458.7 mg, 1.21 mmole) and 10 equiv of morpholine (875.9 mg, 10.05 mmole). The reaction mixture was left to stir at RT for 16 hours. After the volume was reduced to ~5mL, H2O (70 mL) was added and the solution extracted with EtOAc (3 x 40 mL). The organic extract was evaporated to dryness and the desired product, 2-(3,5-dibromo-4-hydroxyphenyl)-1- morpholinoethan-1-one (188.1 mg, 496.2 pmole, 49% yield), eluted with 1 :1 EtOAc / hexanes from a flash silica gel column using a step gradient of 1 :19 EtOAc / hexanes to EtOAc as eluent. The acetamide (61.0 mg, 160.9 pmole) was dissolved in 7 mL of THF and then at 0°C reduced with 4-5 equiv of LiAl H4 which was added as a slurry in 4 mL THF and the temperature allowed to warm to RT. The reaction mixture was stirred for a total of 4 h and then quenched with 40 mL of H2O and then stirred at RT for 1 h and extracted with EtOAc (3 x 15 mL). Without purification the combined and dried organic extract was at RT dissolved in acetic acid (5 ml) and rapidly fuming nitric acid (1 mL) was added to the stirred solution. After 30 min the reaction mixture was diluted with H2O (20 mL) and neutralized to pH~7 by the careful addition of saturated NaHCOs followed by solid NaHCOs. The reaction mixture was then extracted with EtOAc (3 x 10 mL). The organic extract was evaporated to dryness and the desired product, the free base of Ap25, eluted with 1 : 1 EtOAc / hexanes from a flash silica gel column using a step gradient of 1 : 19 EtOAc / hexanes to EtOAc as eluent. The crude product resulting from the flash silica gel column chromatography was fractionated via C18 reversed-phase HPLC using a InertSustain, 5 pm, 25 x 1 cm column, with 17:3 (0.05% TFA / H2O) / MeCN as eluent to give a pure sample of the TFA salt of Ap25 (10.3 mg, 20.8 pmole, 13% yield over two steps). For the in-vivo studies the TFA salt was converted to the HCI salt by repeated evaporation from 1 N HCI.
[0135] 3,5-Dibromo-4-hydroxy-phenylacetic acid: White solid; UV [13:7 MeCN / H2O] Amax 216, 283 nm;1H NMR (1 :1 Acetone-d6 / CDCI3, 600 MHz): 7.37 (s, 2H), 3.49 (s, 2H) ppm;13C NMR (1 :1 Acetone-cfe / CDCIs, 150 MHz): 171 .2, 148.6,132.3, 128.0, 109.5, 38.2 ppm; LRESIMS [M-H]’ m / z 306.9 (CsHsB^Os, calcd 306.8611).
[0136] 2-(3,5-Dibromo-4-hydroxyphenyl)-1 -morpholinoethan-1 -one:White solid; UV [13:7 H2O / MeCN] Amax 207, 289 nm;1H NMR (DMSO-cfe, 600 MHz): 9.76 (bs, 1 H), 7.37 (s, 2H), 3.62 (s, 2H), 3.53 (m, 4H), 3.48 (m, 2H), 3.43 (m, 2H) ppm;13C NMR (DMSO-d6, 150 MHz): 168.9, 149.2, 133.1 , 130.6, 111.8, 66.1 , 41.9, 37.0 ppm; HRESIMS [M+Na]+m / z 399.9154 (Ci2Hi3Br2NO3Na, calcd 399.9154).
[0137] Ap25 TFA salt: Pale yellow amorphous solid; UV [17:3 (0.05% TFA / H2O) / MeCN] Amax 203, 259 nm;1H NMR (DMSO-d6, 600 MHz): 9.88 (bs, 1 H), 7.60 (s, 2H), 3.96 (bm, 2H), 3.61 (bm, 2H), 3.41 (bm. 2H), 3.22 (bm, 2H), 3.04 (bm, 2H), 2.13 (m, 2H) ppm;13C NMR (DMSO-cfe, 150 MHz): 172.0, 152.6, 120.2, 71.8,63.4, 51.2, 50.9, 32.2 ppm; HRESIMS [M+H]+m / z 372.9492 (Ci2Hi6Br2NO3, calcd 372.9491). (See Figures 13-17, for Ap25 TFA salt1H NMR spectrum,13C NMR spectrum, COSY spectrum, HSQC spectrum, and HMBC spectrum).
[0138] Ap25 Free Base: Pale yellow glass;1H NMR (1 :1 CDCI3 / MeOH-d4, 600 MHz): 7.35 (s, 2H), 3.66 (m, 4H), 2.54 (t, J = 6.5 Hz, 2H), 2.45 (bs, 4H), 1.87 (t, J = 6.5 Hz, 2H) ppm;13C NMR (1 :1 CDCI3 / MeOH-d4, 150 MHz): 172.7, 152.5,120.4, 73.8, 66.7, 54.0, 53.3, 35.0 ppm.
[0139] Example 6 - A phenotypic screen in larval zebrafish infected with influenza A identifies a protective effect of Aeroplysinin-1 (Ap)Larval zebrafish were infected with human influenza A (H1 N1 , PR8) three days post fertilization by injection of virus into the common cardinal veins (CCV). In this model, infected fish develop progressively worsening edema, craniofacial abnormalities, lordosis, and over 50% mortality by 5 days after infection2021. Using 96 well plates containing infected fish, chemical libraries were screened to identify compounds with potential protective effects against infection; approximately 700 compounds were tested (Figure 1A, B). Of these, a number of separate compounds delayed the development of edema, such as for example, aeroplysinin-1 (Ap), which decreased edema (Figure 1 C) and prolonged survival of the fish (Figure 1 D).
[0140] Figure (1A) is a schematic depicting the zebrafish drug screen model. Larval zebrafish were infected with H3N2 influenza A and compounds from chemical libraries were added to their water and changed daily. Figure (1 B) shows representative images of progression of edema observed in zebrafish and associated scores used for phenotypic screening. In Figure (1 C), edema was assessed twice daily, day 3 post infection shown here, ****p<0.0001 . In Figure (1 D), survival was assessed daily, day 3 post infection shown here. The data represents average ±SEM from 5 independent experiments with 20 fish per experiment. *p<0.05.
[0141] Example 7— Aeroplysinin-1 (Ap) is beneficial in multiple models of lung injury
[0142] To validate these findings in another organism, we infected C57BL / 6 mice with human influenza A (H3N2, x31) and administered Ap intraperitoneally once daily starting 24 hours post infection. In this model, mice exhibit alveolar neutrophilia, lung edema and hypoxemia, mimicking human ARDS. Ap significantly improved oxygen saturation of mice despite having no antiviral effect as measured by viral titers from lung homogenates (Figures 2A, B). There was a trend towards prolonged survival, but this did not achieve statistical significance (Figure 2C).
[0143] Given the lack of an antiviral effect, we reasoned that Ap was likely to be beneficial in other models of acute inflammation. To test this hypothesis, we determined the effect of Ap in an E. Coli model of acute lung injury22-24. In this non- lethal model, oxygen saturation rapidly drops in the first two hours, after which it gradually returns to baseline as the mice spontaneously recover. Mice received Ap intraperitoneally and then were administered E. Coli intratracheally to induce direct lung injury. Ap improved oxygen saturation of mice, with most significant difference at 2 hours post infection when the oxygen saturation of the control mice is at its lowest (Figure 2D). To exclude the possibility that Ap acts through a direct antipathogen effect, an indirect model of sterile lung injury was tested using lipopolysaccharide (LPS). In this model, LPS is injected intraperitoneally in conjunction with Ap. Intraperitoneal injection of LPS triggers release of inflammatory mediators into the circulation, culminating in indirect lung injury2526. Similar to with E. Coli, oxygen saturation drops rapidly and returns to baseline within a few hours. As observed in the direct lung injury models, Ap improved oxygen saturation in micethat received LPS (Figure 2E). These data also indicate that Ap exerts its effects within hours of administration.
[0144] Excessive inflammation contributes to tissue injury in numerous pathological conditions including pathogen-induced ARDS and ischemiareperfusion. Moderation of the inflammatory response is a potential therapeutic approach. A phenotypic screen of chemical libraries in influenza A-infected zebrafish was performed and Aeroplysinin-1 (Ap) was identified as a compound capable of reducing edema and improving survival. In murine models of lung injury, Ap improved oxygen saturation; the compound also reduced liver injury in a murine model of hepatic ischemia-reperfusion. RNASeq and Western blotting on Ap- treated monocytes and endothelial cells indicated that the compound acts via the Nrf2 antioxidant pathway. Knockdown of Keapl or Nrf2 by siRNA attenuated its effects in cells. Ap was unable to improve oxygen saturation in Nrf2 KO mice, and had no effect in leukocytes isolated from KO animals. A novel derivative of Ap was generated that exhibited increased in vitro and in vivo effects. This compound or its derivatives may be useful for the treatment of inflammation.
[0145] Figure (2A) shows that Ap improves oxygen saturation in mice infected intranasally with H3N2, n=8 mice for control n=7 mice for Ap, *** p<0.001 . Figure (2B) shows that Ap does not affect viral titer in lungs of mice. C57BL / 6 mice were infected intranasally with H3N2 and received Ap (0.78mg / kg) or vehicle control intraperitoneally (IP) starting 24 hours after infection then once daily for 4 days. Lungs were collected 5 days post infection, homogenized and used for plaque assay to determine viral titer. Data represents average ±SEM, n=6 mice per group. Figure (2C) shows that Ap did not significantly improve survival in mice infected intranasally with H3N2, n=8 mice for control n=7. Figure (2D) shows that Ap improves oxygen saturation in E. coli treated mice. C57BL / 6 mice were injected with Ap and given E. coli intra-tracheally. Oxygen saturation was recorded hourly until 4 hrs, at which point mice begin to recover, n=7 mice / group, *p<0.05. Lastly, Figure (2E) shows that Ap improves oxygen saturation in mice injected with LPS I.P. (18mg / kg). C57BL / 6 mice were injected with Ap and LPS I.P. Oxygen saturation was continuously monitored until 3 hrs later, at which point mice begin to recover, n=12 mice / group, ***p<0.001 by two way ANOVA.
[0146] Example 8— Ap and Ap20 decreases ischemia-reperfusion induced liver injury
[0147] Ap was further tested in a model of hemorrhagic shock / resuscitation- induced liver injury. This model is characterized by severe inflammation and liver damage and does not require any pathogen. Shock was induced in male C57BL / 6 by withdrawing blood until mice reached a mean arterial blood pressure of 30mmHg, and held in shock for 2 hours. Ap was administered at the time of resuscitation (Figure 3A). Ap was able to reduce plasma alanine transaminase (ALT) levels 1 and 2 hours post resuscitation, with a trend to lowered ALT as early as 30 minutes post resuscitation (Figure 3B). Plasma AST was also reduced 30 minutes post resuscitation (Figure 3C). Ap also reduced hepatocellular injury and the Suzuki liver injury score (sinusoidal congestion, hepatocyte vacuolation and necrosis) 30 minutes post resuscitation (Figure 3D). Taken together, these data indicate that Ap exerts a beneficial effect on tissue damage across a variety of clinically-relevant, infectious and sterile inflammatory models.
[0148] Similarly, Ap20 decreases ischemia-reperfusion induced liver injury. Wild type C57BL / 6 mice treated with Ap20 had lower AST and ALT levels in comparison to those treated with DMSO control.
[0149] Figure (3A) is a schematic describing the timeline of the hemorrhagic shock / resuscitation model. Ap is administered at the time of resuscitation. Figure (3B) shows that plasma ALT is significantly reduced in Ap treated animals 1 and 2 hours post resuscitation, with a trend towards reduced ALT as early as 30 minutes post resuscitation. ****p<0.0001 , *p<0.05. Figure (3C) shows that plasma AST is significantly reduced in Ap treated animal 30 minutes post resuscitation. Figure (3D) shows representative post-resuscitation (0.5h) histology images at 20X magnification, scale bars are at 100pm. The arrows point at regions of centrilobular / midzonal (zone 2 / 3) necrosis, and asterisks denote a central vein. In Figure (3E), the Suzuki Liver Injury Score (SLIS) blinded quantification shows that Ap-treated mice had significantly lowered hepatocellular injury at 0.5h of resuscitation (n=2-3 mice per group). Mean±SEM is displayed, n.s. = not significant. All times are post-resuscitation. Post-hoc statistical significance is denoted by t-test per time point: *p<0.05, **p<0.01 , ***p<0.001 , ****p<0.0001 .
[0150] Example 9— Ap decreases macrophage and endothelial activation in response to influenza and endotoxin
[0151] Macrophages are an important component of the innate immune response and play a role in inflammation and defense against pathogens. Upon activation by toll-like receptors (TLR) ligands and cytokines, macrophages undergo classical activation and can be classified as M1 macrophages, which induce proinflammatory mediators such as inducible nitric oxide synthase (iNOS) to participate in host defense2728. To determine if Ap affects iNOS expression and production of reactive nitrogen intermediates (RNI), RAW264.7 murine macrophage-like cells were stimulated with LPS and treated with Ap for 24 hours. Ap reduced iNOS protein levels without completely ablating iNOS expression. Furthermore, Ap also reduced RNI production by activated RAW264.7 cells (Figure 10 A-C). Given the role of endothelial activation in the inflammatory response, Ap was tested to determine if it exerted any anti-inflammatory effects on endothelial cells. To test this, human primary lung endothelial cells were infected with influenza A29and treated with Ap for 2, 6, 12 or 24 hours. Infected cells displayed a marked increase in ICAM-1 protein levels, which were significantly reduced by treatment with Ap (Figure 9A) by 24 hours post infection (Figure 9B). ICAM-1 mRNA was also significantly reduced by the compound by 12 hours post infection (Figure 9C). To determine if the effect of Ap was stimulus-dependent, endothelial cells were treated with LPS in addition to Ap. Ap was able to significantly reduce ICAM-1 expression in endothelial cells stimulated with endotoxin 24 hours post stimulation (Figure 9D, E). Of note, endothelial TLR4 levels remained unchanged, indicating that the drug is not reducing LPS receptor expression, and likely not interfering with the initial detection of endotoxin (Figure 9F).
[0152] Figure (9A) shows that primary human lung microvascular endothelial cells were infected with influenza (H3N2) and treated with Ap (1 pM) or solvent control. Cells were lysed 2, 6, 12 and 24 hours later (hpi) and probed for ICAM-1 by western blot. In Figures (9A and 9B) the histogram shows ICAM-1 protein levels. Data represents average ±SEM from 3 independent experiments, normalised to influenza infected control treated cells. ***p<0.001 for flu-infected control vs Ap. Figure (9C) shows that ICAM-1 mRNA was assessed by qPCR 2, 6 and 12 hours post infection. Values were normalised to uninfected, solvent treated controls. Datarepresents average+SEM from 4 independent experiments; P=0.0337 by one way ANOVAI) Primary human lung microvascular endothelial cells treated with Lipopolysaccharide (LPS) from E. coli and Ap (1 pM) or solvent control. Cells were lysed 24 hours later and probed for ICAM-1. Histogram shows ICAM-1 protein levels, data represents average ± SEM of 4 independent experiments, normalised to LPS solvent treated cells. **P<0.01 for LPS control treated cells vs Ap. Figure (9F) shows that Ap does not affect TLR4 expression in endothelial cells.
[0153] Figures (10A and 10B) show that Ap reduces the expression of inducible nitric oxide synthase (iNOS) and the production of reactive nitrogen intermediates (10C). RAW264.7 macrophages were treated with LPS (0.1 pg / mL) and with Ap (1 pM) or solvent control. In Figures (10A and 10B), cells were lysed 24 hours later and lysates were probed for iNOS expression by western blot. Histogram shows iNOS expression from four different experiments. Data represent average±SEM. P=0.0033 by one-way ANOVA and *p<0.05. In Figure (10C) cells were treated as described above and media was collected 24 hours later to determine the concentration of nitrite in the media by Griess assay. Histogram shows pooled data from 4 independent experiments (average±SEM). ***P<0.001 for LPS solvent control vs Ap.
[0154] Together, these data indicate that Ap reduces both leukocyte and endothelial activation in response to pathogens, without completely ablating it.
[0155] Example 10 - Ap activates the Nrf2 oxidative stress response
[0156] Bulk RNASeq was performed in RAW264.7 murine macrophage-like cells stimulated with LPS and treated with Ap. Given the speed at which Ap acts in vitro and in vivo, cells were harvested two hours post treatment. In addition to the solvent (DMSO) control, a modified version of AP (Ap7) was used that is nonfunctional. Ingenuity Pathway Analysis (I PA) was then used to identify pathways that were predicted to be activated or inactivated by Ap, but not by DMSO or Ap7. In both stimulated and non-stimulated conditions, Ap was predicted to activate the Nrf2-mediated oxidative stress response pathway compared to DMSO and Ap7 (Figure 4A). Key players in the Nrf2 oxidative stress response pathway such as HMOX1 , GCLM, and SXRN1 and others were upregulated upon Ap treatment (Figure 4B). This experiment was also performed in primary human lung endothelialcells infected with influenza A and treated with Ap or another non-functional version of the drug denoted here as Ap1 . In both mock infected and IAV infected endothelial cells, Ap was predicted to activate the Nrf2-mediated oxidative stress response pathway (Figure 11 A). Similar to the macrophages, some of the most significantly upregulated genes by Ap in flu infected cells are important players in the Nrf2 pathway (Figure 1 1 B). Importantly, in both cell types, Ap did not consistently affect other inflammation-related signaling pathways such as NF-KB, ERK / MAP and JAK / STAT (Figure 4A, S3A).
[0157] In Figure (4A), RAW264.7 cells were treated with Ap (1 pM) or vehicle control as well as with and without LPS (0.1 pg / ml) for two hours. RNA was extracted for RNASeq and subsequent Ingenuity Pathway Analysis (I PA). Pathways displayed are the most significantly altered canonical pathways, as sorted by FDR. NF-kB, JAK / Stat and ERK / MAOK signaling are also included however are not among the most significantly altered pathways. A z score <0 is depicted in dark grey and indicates downregulation of the pathway, while a z score >0 is in light grey and indicates upregulation. Figure (2B) shows a heat map of Nrf2 regulated genes. Genes from the RNASeq analysis were sorted according to adjusted p value from smallest to largest. Genes involved in the Nrf2 pathway are displayed here, all of which are within the top 15 most significantly altered genes.
[0158] In Figure (11 A), primary human lung endothelial cells were infected with influenza A (H3N2) with an MOI of 1 and treated with Ap (1 pM) or vehicle control or dummy drug (Ap1 ) for two hours. RNA was extracted for RNASeq and subsequent Ingenuity Pathway Analysis (I PA). Pathways displayed are the most significantly altered canonical pathways, as sorted by FDR. NF-kB, JAK / Stat and ERK / MAOK signaling are also included however are not among the most significantly altered pathways. A z score <0 is depicted in dark grey and indicates downregulation of the pathway, while a z score >0 is in light grey and indicates upregulation. Figure (1 1 B) shows the heat map of Nrf2 regulated genes. Genes from the RNASeq analysis were sorted according to adjusted p value from smallest to largest. Genes involved in the Nrf2 pathway are displayed here, all of which are within the top 50 most significantly altered genes.
[0159] Example 11 - Ap rapidly induces loss of Keapl and increases Nrf2 levels
[0160] Under basal conditions Nrf2 is bound by Keapl , which leads to the ubiquitination and proteasomal degradation of Nrf2 (and hence its inhibition). Nrf2 activation occurs when it is released from Keapl , leading to its translocation to the nucleus and transcription of downstream effector genes such as heme oxygenase 1 (HO-1 ), which has anti-inflammatory and anti-oxidative effects30. Chemical inducers of Nrf2 have been shown to have anti-inflammatory effects, and the induction of Nrf2 expression has been proposed as a potential therapeutic strategy for multiple inflammatory conditions31. To confirm the RNASeq findings, the protein levels of Nrf2 and Keapl upon treatment with Ap was investigated. Treatment of endothelial cells or macrophages with Ap lead to a rapid drop in Keapl protein levels accompanied by a rise in Nrf2 levels as early as 30 minutes post treatment (Figure 5 A, C, E and B, D, F respectively).
[0161] Immortalized human endothelial cells as shown in Figures (5A, 5C, and 5E) or RAW264.7 macrophages as shown in Figures (5B, 5D, and 5F) were treated with LPS (0.1 pg / mL) and Ap (1 pM) for 30 minutes and lysed for western blot. The histogram in Figures 5C and 5D shows Keapl levels (endothelial cells and macrophages respectively), *p<0.05, **p<0.01 . n=3 independent experiments. The histogram in Figures 5E and 5F shows Nrf2 levels (endothelial cells, macrophages respectively), *p<0.05, n=3 independent experiments.
[0162] Example 12 - Knockdown of Keapl orNrf2 prevents induction ofHO- 1 byAp
[0163] Heme oxygenase 1 (HO-1) is a stress inducible protein with many anti-inflammatory effects, a major effector function being the reduction of bioavailability of inflammatory free heme and generation of antioxidant, antiinflammatory and cytoprotective products. While HO-1 was not significantly induced at 30 minutes (not shown), Ap treatment led to a significant increase of HO-1 protein levels by two hours post treatment (Figure 6A, B). To further confirm the involvement of Keapl and Nrf2 in the effect of Ap, Keapl in RAW264.7 macrophages were knocked down by siRNA and cells were treated with Ap and LPS. Knockdown of Keapl prevented the Ap induced increase of Nrf2 levels, as well as prevented the induction of HO-1 in Ap treated macrophages (Figure 6C, D). Similarly, knockdown of Nrf2 also prevented induction of HO-1 even though Keapl levels were still lowered by treatment with the drug (Figure 6E, F). These datasupport that Ap induces the Nrf2 pathway and indicates that the effect is both Keapl and Nrf2 dependent.
[0164] Figure (6A) shows that HO-1 , a Nrf2 inducible gene, is increased two hours post treatment with Ap. RAW264.7 cells were treated with Ap (1 pM) and LPS (0.1 pg / mL) for two hours and lysates were probed for HO-1 by western blot. In Figure (6B), the histogram shows data from 4 independent experiments, *p<0.05. Figure (6C) shows that knockdown of Keapl prevents induction of HO-1 by Ap. Cells were transfected with Keapl targeting siRNA, 48 hours later cells were stimulated with LPS and treated with Ap or solvent control and lysed two hours later. In figure (6D), the histogram depicts quantified HO-1 of three independent experiments, *p<0.05. Figure (6E) shows that knockdown of Nrf2 prevents induction of HO-1 by Ap. Cells were transfected with Nrf2 targeting siRNA, 48 hours later cells were stimulated with LPS and treated with Ap or solvent control and lysed two hours later. In Figure (6F), the histogram depicts quantified HO-1 of three independent experiments normalised to control siRNA, *p<0.05.
[0165] Example 13 - Ap decreases the interaction between Keapl and Nrf2
[0166] Given that other Nrf2 inducers are known to bind to and modify Keapl allowing for Nrf2 induction, the ability of whether Ap could bind directly to Keapl was considered32using surface plasmon resonance (SPR)33. However, after multiple attempts, no binding between Ap and Keapl was detected (data not shown). Nonetheless, the ability of whether Ap affects the interaction between Nrf2 and Keapl by co-immunoprecipitation was considered. In Ap treated cells, less Nrf2 was bound to precipitated Keapl , once normalized for increased Nrf2 expression in Ap treated cells (Figure 12 A, B). Similarly, Ap treatment reduced Keapl levels bound to precipitated Nrf2 (Figure 9C, D). Interestingly, Ap induced the formation of a high molecular weight Keapl complex. These findings suggest that Ap interferes with the interaction of Nrf2 and Keapl without necessarily binding to Keapl itself.
[0167] As Shown in Figure 12, HEK293 cells were transfected with Keapl and Nrf2 plasmids and Keapl (12A and 12B), or Nrf2 (12C and 12D) were immunoprecipitated. Beads were treated in medium with Ap (1 pM) or DMSO for 2 hours and then lysates were analysed by western blot. For Keapl pulldowns, Nrf2was normalised to Keapl , which was normalised to input Keapl . The number was then normalised to DMSO control. *P<0.05., For Nrf2 pulldowns, total Keapl was first normalised to Nrf2 for a given treatment. This ratio was normalised to Nrf2 input, and then the Ap treatment normalised to DMSO control. *p<0.05.
[0168] Example 14 - Nrf2 is used for the protective effect ofAp in lung injury and the induction of HO-1 in leukocytes
[0169] To determine if ability of Ap to induce Nrf2 contributes to its mechanism of protection in vivo, Nrf2 global KO mice were obtained and infected intratracheally with E. Coli. While Ap prevented hypoxia in WT mice, it had no effect on oxygen saturation levels in the KO mice (Figure 7A). Leukocytes from the blood of uninfected WT or NRF2 KO mice were also extracted and treated ex vivo with AP and LPS. As observed in RAW264.7 cells, Ap caused a loss of Keapl , increase of Nrf2 and of HO1 in WT cells. However, in leukocytes from Nrf2 KO cells, Ap was unable to induce Nrf2 and HO1 (Figure 7B-E).
[0170] Figure (7A) shows global Nrf2 knockout mice were injected with Ap or vehicle control and infected intratracheally with E. Coli. *p<0.05, n=5 per group in WT mice, n=4 / group in KO mice. Figure (7B) shows that leukocytes of WT or global Nrf2 KO mice were extracted and treated with Ap or DMSO and LPS (0.1 pg / mL) for two hours. Lysates were probed for Keapl , Nrf2 and HO-1 and quantified in Figures 7C, 7D and 7E respectively. *p<0.05, **p<0.01. Data from n=3-5 individual experiments.
[0171] Example 15- Ap9 and Ap25, novel derivatives ofAp induces the Nrf2 pathway
[0172] Ap is a naturally occurring compound that is isolated from a marine sponge but is somewhat unstable; its major degradation product is 3,5- dibromoverogiaquinol and this formed the basis for subsequent derivatives. One of these, termed Ap9, caused the loss of Keapl and induction of HO1 in macrophages, similar to the parent compound (Figure 8A, B). RNASeq confirmed that Ap9 (Figure 8A) induced the Nrf2 pathway in both LPS stimulated and non stimulated RAW cells. Accordingly, the effect of Ap9 was tested in vivo using a model of liver warm ischemia / reperfusion injury, which is characterized by hepatocellular damage and sterile inflammation34. Treatment with Ap reduced plasma ALT and AST comparedto DMSO. This effect was amplified with Ap9 treatment, with greater reduction in plasma ALT and AST as well as reduced hepatocellular injury, as determined by blinded histological analysis (Figure 8 E-G). Finally, Ap9 was able to prevent hypoxia during E.co / / -induced lung injury (Figure 8H) similar to the parent compound. Taken together, these findings indicate that Ap9 is a functional derivative that can induce the Nrf2 pathway similar to Ap. Similarly, Ap25 protected RAW264.7 macrophages from hypoxia-reperfusion injury and murine leg muscle from ischemia / reperfusion. Like Ap, Ap25 also worked through the Nrf2 pathway, since depletion of Nrf2 by siRNA knockdown prevents it from inducing HO-1 expression.
[0173] Figure (8A) shows that RAW264.7 cells were treated with Ap9 (1 pM) or vehicle control as well as with and without LPS (0.1 pg / ml) for two hours. RNA was extracted for RNASeq and subsequent Ingenuity Pathway Analysis (IPA). Heat map of Nrf2 regulated genes is presented. Figure (8B) is a representative blot of RAW264.7 cells treated for 2 hours with DMSO, Ap, Ap7 or Ap9 (1 pM) and LPS (0.1 pg / mL). Histogram depicts quantification of Keapl (8C) and HO-1 (8D). *p<0.05, **p<0.01 . Figure (8E) shows representative histology images of the liver after one hour ischemia followed by two hours reperfusion. Mice were treated with Ap and Ap9 I.P. (0.78mg / mg) prior to surgery. Scale bars are at 1 mm (top) and 100pm (bottom). (F, G) Plasma ALT and AST are significantly reduced in Ap9 treated animals 2 hours post reperfusion. *p<0.05. Figure (8H) shows that Ap9 improves oxygen saturation in E. coli treated mice. Oxygen saturation was recorded hourly until 4 hrs, at which point mice begin to recover, n=6 mice / group for DMSO and Ap9, n=3 for Ap. **p<0.01 by two way ANOVA. Figure (8I) shows the structure of Ap. Figure (8J) shows the structure of Ap7 (non functional derivative). Figure (8K) shows the structure of Ap9 (functional derivative). Figure (18) shows improved cell survival after l / R (ischemia (hypoxia) followed by reperfusion) when treating with Ap25. Murine RAW 264.7 macrophages were grown in low O2 (0%) for 24 hours followed by change to fresh media and normoxic conditions, and DMSO (solvent control) or Ap or Ap25 (both at 1 uM) for 24 hours. Cell viability was assessed by Trypan blue exclusion. Figures (19)-(21 ) depict that Ap25 works through the Nrf2 pathway.
[0174] Example 16 - Effects ofAp25 in mice
[0175] In one example, leg ischemia was induced in mice using a tourniquet on one leg. After 2 hours the tourniquet was removed and Ap25 (or solvent control, DMSO) was administered intraperitoneally (IP), Two hours later, animals were sacrificed. Muscle edema of the ischemic leg (IR) was measured by wet / dry ratio. Data as shown in Figure (22) are from two animals per group, normalized to the contralateral healthy (H) leg. Figure (23) shows that Ap25 reduces leg edema after ischemia reperfusion.
[0176] In another example, leg ischemia was induced in mice using a tourniquet on one leg. After 2 hours the tourniquet was removed and Ap25 0.78 mg / kg (or solvent control, DMSO) was administered intraperitoneally (IP). Two hours later, animals were sacrificed. Serum was collected for measurement of creatine kinase (CK) levels as a marker of muscle damage. Data as shown in Figure (23) are from two animals per group (2 DMSO, 2 Ap25) except serum from one healthy control animal (H). Figure (23) shows that Ap25 reduces creatine kinase levels after leg ischemia reperfusion.
[0177] In yet another example, leg ischemia was induced in mice using a tourniquet on one leg. After 2 hours the tourniquet was removed and Ap25 (or solvent control, DMSO) was administered IP. Two hours later, animals were sacrificed and leg muscle was harvested for immunoblotting. Expression of hemeoxygenase-1 (HO-1 ) was measured in the ischemic leg (l / R, i.e. ischemiareperfusion) and the contralateral healthy (H) leg; levels were normalized to GAPDH as the loading control. Data as shown in Figure (24) are from 2 animals per group and are normalized to the matching DMSO animal. Figure (24) shows the induction of HO-1 by Ap25 in mice.V. Discussion
[0178] The recent COVID-19 pandemic has highlighted the development of ARDS as a serious complication of lung infections. Lung injury can occur after both bacterial and viral infections but regardless of the specific pathogen, antimicrobial therapy is typically insufficient to reduce mortality once ARDS develops35 36. Instead, innovative approaches to improve the host response are needed. These include anti-inflammatory approaches (e.g. corticosteroids37, IL-6 inhibition38 39) and efforts to improve lung vascular stability (e.g. Slit, Vasculotide11 40).
[0179] Using a phenotypic screen in influenza-infected zebrafish, the marine compound Aeroplysinin-1 as protective against edema and death was identified. The compound has no anti-viral effect, indicating that its benefit involves amelioration of the host response. Although Ap has no antiviral effect against flu, others have reported growth inhibition of gram-positive bacteria. While Ap improved oxygenation from E. coli-induced lung injury, benefit when lung injury was induced by LPS in the absence of a live pathogen was observed. Furthermore, it was shown that Ap reduces liver injury in a model of hemorrhagic shock / resuscitation which does not involve pathogens. Together, these data indicate that Ap is modulating the host response rather than inhibiting microbial proliferation.
[0180] In both endothelial cells and macrophages, it was found that Ap quickly reduced expression of proteins associated with a pro-inflammatory state. For instance, rapid decreases in ICAM-1 protein and mRNA levels were observed in stimulated endothelial cells, suggesting a mechanism by which Ap might reduce the recruitment of leukocytes to the lungs. The effect was not endothelial specific, as Ap also reduced expression of iNOS and production of reactive nitrogen intermediates in stimulated murine macrophages. The ability to reduce iNOS expression may be beneficial in the context of lung injury in vivo as it has been previously reported that iNOS is an important contributor to the pathogenesis of acute lung injury. For instance, iNOS deficient mice have been shown to display reduced morbidity, mortality and cytokine production following infection with H5N1 or pandemic H1 N1 influenza41. However, there are conflicting reports as others have shown that iNOS may contribute to early lung injury but may play an important role for the resolution of acute lung injury at later time points16’42 43.
[0181] To identify the mechanism of action of Ap, RNASeq and IPA analysis were employed. Ap rapidly leads to loss of Keapl and activation of the Nrf2 signaling pathway in both endothelial cells and leukocytes. Given the rapidity of induction of Nrf2 signaling in macrophages (30 minutes) and the rapid benefit observed in animal models (within hours), leukocyte rather than endothelial Nrf2 is likely to be the more important target of the drug, at least early on. During prolonged inflammation such as in influenza A virus infections, endothelial activation contributes to morbidity and mortality and plays an important role in orchestrating both immune cell infiltration and cytokine production16. In this setting, stimulation ofthe endothelial Nrf2 pathway by Ap is likely to account for at least some of the benefit43-45. Activation of Nrf2 has also been shown to improve endothelial dysfunction in other pathological conditions such as sepsis and atherosclerosis46-48. Ultimately, mice with tissue-specific deletion of Nrf2 will be needed to resolve the issue of which cell type is most important for the benefit of Ap in specific models of injury.
[0182] In vitro data and the data from Nrf2-deficient mice strongly support the notion that the mechanism of action of Ap involves the Keap1-Nrf2 axis. Ap did not show a consistent trend of activation or deactivation of other inflammatory pathways such as NF-KB, JAK / STAT or ERK / MAPK at an early time point. However, the effect of Ap on Nrf2 is very likely to influence these and other pathways either directly or indirectly. For instance, there is known crosstalk between Nrf2 and NF-KB; NF-KB is also a redox-regulated transcription factor. When Nrf2 is induced, intracellular ROS levels are reduced, thereby reducing NF- KB activation mediated by oxidative stress. Nrf2 has also been shown to reduce nuclear translocation of NF-KB and DNA binding31. In addition, both NF-KB and Nrf2 compete for the transcription co-activator cAMP response element (CREB) binding protein (CBP) which plays an important role in acetylation of histones to expose DNA for transcription, which enhances gene transcription49. Work with Resveratrol has shown that activation of Nrf2 leads to inhibition of STAT phosphorylation50and the JAK / STAT pathway. As such, the activation of Nrf2 by Ap may represent only the beginning of its anti-inflammatory signaling.
[0183] Under normal conditions, Nrf2 is bound by its negative regulator Keapl , an adaptor component of the Cul3-based ubiquitin E3 ligase. This leads to the ubiquitination and proteasomal degradation of Nrf251’52. There are two Keapl binding domains in the Neh2 domain of Nrf2, the low affinity DLGex motif and the high affinity ETGE motif, both of which must be bound by Keapl for the degradation of Nrf253. Many electrophilic compounds have been reported to induce Nrf2 via covalent binding to cysteine residues on Keapl5455. While some electrophilic compounds such as Dimethyl fumarate are used clinically, they have off target effects due to their nonspecific reaction with nucleophiles. There has been considerable interest in developing non-covalent inhibitors of the Keapl -Nrf2 protein interaction. Such compounds would in theory have fewer side effects56. Theprecise mechanism by which Ap interferes with Keap1-Nrf2 binding remains uncertain. Direct binding of Ap to Keapl was not detected, although it was observed that Ap reduces the binding of Keapl and Nrf2 in co-immunoprecipitation experiments. Ap appears to interfere with the Nrf2-Keap1 interaction without directly binding to and modifying Keapl and may be a non-electrophilic disruptor of the Nrf2-Keap1 protein interaction.
[0184] While many electrophilic modifiers do not affect Keapl levels, Ap reduces the intensity of the Keapl band by western blotting. Exposure to Ap lead to a high molecular weight band that was positive for both Keapl and p62 in cell lysates and increased p62 mRNA as early as two hours post treatment (Figure 12 and data not shown). P62 is known to compete with Nrf2 for binding to Keapl and contains a Keapl interacting domain (KIR) that is similar to the ETGE domain of Nrf2. A potential mechanism for the Ap mediated induction of Nrf2 may be by promoting the binding between Keapl and p62.
[0185] Ap9 and Ap25 activate the Nrf2 pathway and protect mice against lung injury and ischemia reperfusion injury.
[0186] Although the disclosure has been described in conjunction with specific embodiments thereof, if is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present disclosure.
[0187] While the present disclosure has been described with reference to what are presently considered to be the preferred examples, it is to be understood that the application is not limited to the examples described herein. To the contrary, the present disclosure is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims.
[0188] All publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety. Where a term in the presentdisclosure is found to be defined differently in a document incorporated herein by reference, the definition provided herein is to serve as the definition for the term.REFERENCES CITED HEREIN AND INCORPORATED BY REFERENCE1. Matthay, M. A. et al. Acute respiratory distress syndrome. Nat. Rev. Dis. Prim. 5, (2019).2. Bos, L. D. J. & Ware, L. B. Acute respiratory distress syndrome: causes, pathophysiology, and phenotypes. Lancet 400, 1145-1156 (2022).3. Li, H. et al. Hypothesis SARS-CoV-2 and viral sepsis : observations and hypotheses. Lancet 2019, 8-11 (2020).4. Hasan, S. S. et al. Mortality in COVID-19 patients with acute respiratory distress syndrome and corticosteroids use: a systematic review and metaanalysis. Expert Rev. Respir. Med. 14, 1149-1163 (2020).5. Kao, K. C. et al. Coinfection and Mortality in Pneumonia-Related Acute Respiratory Distress Syndrome Patients with Bronchoalveolar Lavage: A Prospective Observational Study. Shock 47, 615-620 (2017).6. Guan, W. et al. Clinical Characteristics of Coronavirus Disease 2019 in China. N. Engl. J. Med. 1-13 (2020). doi:10.1056 / NEJMoa20020327. Li, S. H. etal. Outcomes of severe H1 N1 pneumoniae: A retrospective study at intensive care units. J. Formos. Med. Assoc. 119, 26-33 (2020).8. Strasfeld, L. & Chou, S. Antiviral drug resistance: Mechanisms and clinical implications. Infect. Dis. Clin. North Am. 24, 809-833 (2010).9. Chih-Yuan Chiang, A. & Ijeoma Uzoma, a Richard T. Moore, a Merle Gilbert, a Allen J. Duplantier, a R. G. P. Mitigating the Impact of Antibacterial Drug Resistance and Challenges. MBio 9, 1-14 (2018).10. B R, A., G, R., B S, A. & Gandhi, V. A Review on Antibiotic Resistance in Bacteria. Int. J. Res. Appl. Sci. Eng. Technol. 10, 536-542 (2022).H . Sugiyama, M. G. et al. The Tie2-agonist Vasculotide rescues mice from influenza virus infection. Sci. Rep. (2015). doi:10.1038 / srep1103012. Yang, S. C., Tsai, Y. F., Pan, Y. L. & Hwang, T. L. Understanding the role of neutrophils in acute respiratory distress syndrome. Biomed. J. 44, 439-446 (2021 ).13. Ware, L B, Matthay, M. A. The Acute Respiratory Distress Syndrome. N. Engl. J. Med. 342, 1334, 1349 (2000).14. Grammes, J. & Soehnlein, O. Contribution of neutrophils to acute lung injury. Mol. Med. 17, 293-307 (2011).15. Xu, S. wen, Ilyas, I. & Weng, J. ping. Endothelial dysfunction in COVID-19:an overview of evidence, biomarkers, mechanisms and potential therapies. Acta Pharmacol. Sin. 44, 695-709 (2023). Teijaro, J. R. et al. Endothelial cells are central orchestrators of cytokine amplification during influenza virus infection. Cell 146, 980-991 (2011). Fosse, J. H., Haraldsen, G., Falk, K. & Edelmann, R. Endothelial Cells in Emerging Viral Infections. Front. Cardiovasc. Med. 8, (2021 ). Vlahos, R., Stambas, J. & Selemidis, S. Suppressing production of reactive oxygen species (ROS) for influenza A virus therapy. Trends Pharmacol. Sci. 33, 3-8 (2012). To, E. E. et al. Mitochondrial Reactive Oxygen Species Contribute to Pathological Inflammation during Influenza A Virus Infection in Mice. Antioxidants Redox Signal. 32, 929-942 (2020). Gabor, K. A. et al. Influenza A virus infection in zebrafish recapitulates mammalian infection and sensitivity to anti-influenza drug treatment. Dis. Model. Meeh. 7, 1227-1237 (2014). Sullivan, C. et al. Using zebrafish models of human influenza A virus infections to screen antiviral drugs and characterize host immune cell responses. J. Vis. Exp. 2017, 1-8 (2017). Bastarache, J. A. & Blackwell, T. S. Development of animal models for the acute respiratory distress syndrome. DMM Dis. Model. Meeh. 2, 218-223 (2009). Sugiyama, M. G. et al. Lung ultrasound and microbubbles enhance aminoglycoside efficacy and delivery to the lung in Escherichia coli-induced pneumonia and acute respiratory distress syndrome. Am. J. Respir. Crit. Care Med. 198, 404-408 (2018). Yilmaz Sipahi, E. & Atalay, F. Experimental Models of Acute Lung Injury. Eurasian J. Pulmonol. 16, 69-77 (2014). Menezes, S. L. S. et al. Pulmonary and extrapulmonary acute lung injury: Inflammatory and ultrastructural analyses. J. Appl. Physiol. 98, 1777-1783 (2005). Domscheit, H., Hegeman, M. A., Carvalho, N. & Spieth, P. M. Molecular Dynamics of Lipopolysaccharide-Induced Lung Injury in Rodents. Front. Physiol. 11 , (2020). Yunna, C., Mengru, H., Lei, W. & Weidong, C. Macrophage M1 / M2polarization. Eur. J. Pharmacol. 877, 173090 (2020). Lu, G. et al. Myeloid cell-derived inducible nitric oxide synthase suppresses M1 macrophage polarization. Nat. Commun. 6, (2015). Armstrong, S. M. et al. Influenza Infects Lung Microvascular Endothelium Leading to Microvascular Leak : Role of Apoptosis and Claudin-5. PLoS One 7, (2012). Qiang Ma. Role of Nrf2 in Oxidative Stress and Toxicity. Annu Rev Pharmacol Toxicol 53, 401-426 (2013). Saha, S., Buttari, B., Panieri, E., Profumo, E. & Saso, L. An Overview of Nrf2 Signaling Pathway and Its Role in Inflammation, molecules 25, (2020). Baird, L. & Yamamoto, M. The Molecular Mechanisms Regulating the KEAP1-NRF2 Pathway. Mol. Cell. Biol. 40, e00099-20 (2020). Journet, L. & Cascales, E. Bacterial Protein Secretion Systems Methods and Protocols Methods in Molecular Biology. Methods in Molecular Biology 1615, (2017). Olthof, P. B. et al. Warm ischemia time-dependent variation in liver damage, inflammation, and function in hepatic ischemia / reperfusion injury. Biochim. Biophys. A-ta - Mol. Basis Dis. 1863, 375-385 (2017). Henao-Restrepo, A. M. et al. Remdesivir and three other drugs for hospitalised patients with COVID-19: final results of the WHO Solidarity randomised trial and updated meta-analyses. Lancet 399, 1941-1953 (2022). Harsha Banavasi, M., , Paul Nguyen, D., , Heba Osman, D. and & Ayman O. Soubani, M. Management of ARDS - What Works and What Does Not Harsha. Am J Med Sci 362, 13-23 (2021). Group, T. R. C. Dexamethasone in Hospitalized Patients with Covid-19 — Preliminary Report. N. Engl. J. Med. (2020). doi:10.1056 / NEJMoa2021436 Aziz, M. S. et al. Tocilizumab in Hospitalized Patients with Severe Covid-19 Pneumonia. 1503-1516 (2021 ). doi:10.1056 / NEJMoa2028700 Group, R. C. Tocilizumab in patients admitted to hospital with COVID-19 ( RECOVERY ): a randomised , controlled , open-label , platform trial. 19, 1637-1645 London, N. R. et al. Targeting Robo4-Dependent slit signaling to survive the cytokine storm in sepsis and influenza. Sci Transl Med 2, 23ra19 (2010).Laubach, V. E., Sheselyt, E. G., Smithiest, O. & Sherman, P. A. Mice lacking inducible nitric oxide synthase are not resistant to lipopolysaccharide- induced death. 92, 10688-10692 (1995). Wei, J. et al. Nrf2 activation protects against intratracheal LPS induced mouse / murine acute respiratory distress syndrome by regulating macrophage polarization. Biochem. Biophys. Res. Commun. 500, 790-796 (2018). Fodor, A. etal. Endothelial Dysfunction , Inflammation , and Oxidative Stress in COVID-19 — Mechanisms and Therapeutic Targets. 2021 , (2021). Chang, R., Mamun, A., Dominic, A. & Le, N. SARS-CoV-2 Mediated Endothelial Dysfunction : The Potential Role of Chronic Oxidative Stress. 11 , 1-27 (2021). Hellman, J. Oxidative Stress and Endothelial Dysfunction. 35, (2021). Huang, Z., Wu, M., Zeng, L. & Wang, D. The Beneficial Role of Nrf2 in the Endothelial Dysfunction of Atherosclerosis. 2022, (2022). Gunne, S. et al. Nrf2 — A Molecular Target for Sepsis Patients in Critical Care. Biomolecules 10, (2020). Sharma, A. et al. The nuclear factor ( erythroid - derived against diabetes - induced endothelial dysfunction. Cardiovasc. Diabetol. 1-13 (2017). doi: 10.1186 / sl 2933-017-0513-y Wardyn, J. D., Ponsford, A. H. & Sanderson, C. M. Dissecting molecular cross-talk between Nrf2 and NF- K B response pathways. 621-626 (2015). doi:10.1042 / BST20150014 Article, O. Anti-in fl ammatory effect of resveratrol through the suppression of NF- K B and JAK / STAT signaling pathways. 47, 207-213 (2015). Itoh, K. et al. Keapl represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino-terminal Neh2 domain. 76- 86 (1999). Kobayashi, A. etal. Oxidative Stress Sensor Keapl Functions as an Adaptor forCul3-Based E3 Ligase To Regulate Proteasomal Degradation of Nrf2. 24, 7130-7139 (2004). Mizushima, T., Dinkova-kostova, A. T., Kasai, T. & Kamei, T. Molecular basis for the disruption of Keap1-Nrf2 interaction via Hinge & Latch mechanism. Commun. Biol. 1-11 (2021). doi: 10.1038 / s42003-021 -02100-6Dinkova-kostova, A. T. et al. Direct evidence that sulfhydryl groups of Keapl are the sensors regulating induction of phase 2 enzymes that protect against carcinogens and oxidants. (2002). doi:10.1073 / pnas.172398899 Hong, F., Freeman, M. L. & Liebier, D. C. Identification of Sensor Cysteines in Human Keapl Modified by the Cancer Chemopreventive Agent Sulforaphane. 1917-1926 (2005). Crisman, E. et al. KEAP1 - NRF2 protein - protein interaction inhibitors : Design , pharmacological properties and therapeutic potential. 237-287 (2023). doi:10.1002 / med.21925 Influenza X:31 , A / Aichi / 68 (H3N2) / PURIFIED. 68, 10100375 Balish, A. L., Katz, J. M. & Klimov, A. I. Influenza: Propagation, Quantification, and Storage. Curr. Protoc. Microbiol. 15G.1.1-15G.1.24 (2013). doi: 10.1002 / 9780471729259.mc15g01 s29 Arnie J. Eisfeldl , Gabriele Neumannl , and Y. K. Influenza A Virus Isolation, Culture and Identification Arnie. Nat protoc 9, 2663-2681 (2014). Tarling, C. A. et al. The search for novel human pancreatic a-amylase inhibitors: High-throughput screening of terrestrial and marine natural product extracts. ChemBioChem 9, 433-438 (2008). Sciences, C. L. Ficoll-Paque PLUS Cell preparation Instructions for Use Table of Contents. Kong, B. S., Lee, C. & Cho, Y. M. Protocol for the assessment of human T cell activation by real-time metabolic flux analysis. STAR Protoc. 3, 101084 (2022). Leung, C. H. et al. Nuclear Factor (Erythroid-Derived 2)-Like 2 Regulates the Hepatoprotective Effects of Remote Ischemic Conditioning in Hemorrhagic Shock. Antioxidants Redox Signal. 30, 1760-1773 (2019). Gray, M. J., Hartshorn, M. P., Penfold, B. R. & Vaughan, J. The nitration of some substituted 4-methylphenols; X-Ray crystal structure of (z)-3-bromo-5- (bromonitromethylene)furan-2(5h)-one. Aust. J. Chem. 37, 55-63 (1984).
Claims
CLAIMS1. A compound of Formula (I)wherein:R’ is H, (Ci-Ce)-alkyl or (Ci-Ce)-acyl;R1is selected from H, halo, -CN, and (Ci-Ce)-alkyl;R2is selected from halo, -CN, (Ci-Ce)-alkyl and -O-(Ce-Cio) aryl, wherein the aryl is optionally substituted with one or more of halo, -CN, (Ci-C3)-alkyl or-(Co- C6)-alkylene-C(O)-N(R’)2 wherein each R’ is individually or simultaneously H or (Ci-C3)-alkyl;R3is selected from H, halo, and (Ci-Ce)-alkyl wherein the alkyl is optionally substituted with halo and nitrile;R4is selected from:- optionally substituted (C1-C1 o)-alkyl, wherein the optional substituents are halo, or CN;y(Ci-Ce)-alkyl;wherein X is (Ci-Ce)-alkylene and each R” is H orwherein X is (Ci-Ce)-alkylene and Ring A is an optionally substituted, saturated or unsaturated 5-10-membered heterocycle containing 1-3 heteroatoms, wherein the optional substituents are halo, -CN, (=0), or (Ci-Ce)-alkyl; and, wherein X is (Co-Ce)-alkylene and Ring B is an optionally substituted, saturated or unsaturated 5-10-membered heterocycle containing 1-3 heteroatoms, wherein the optional substituents are halo, -CN, (=0) or (Ci-Ce)-alkyl; wherein, the compound of Formula (I) is not2. The compound of claim 1 , wherein R1is Br or methyl.
3. The compound of claim 1 or 2, wherein R2is Br, methyl or O-phenyl, wherein phenyl is optionally substituted with one or more Br, methyl or -CH2-C(O)- N(R’)2, wherein each R’ is individually or simultaneously H or methyl.
4. The compound of claim 3, wherein phenyl is optionally substituted with one or more Br, and -(CH2)-C(O)-N(CH3)2or -(CH2)-C(O)-NH(CH3).
5. The compound of any one of claims 1-4, wherein R3is H, Br or methyl.
6. The compound of any one of claims 1-5, wherein R4is optionally substituted(Ci-C6)-alkyl.
7. The compound of claim 6, wherein R4is -CH3, -CH2CH3or -CH2CF3.
8. The compound of any one of claims 1-5, wherein when R4is, X is (Ci-C3)-alkylene and R’ is (Ci-C3)-alkyl.
9. The compound claims 8, wherein10. The compound of any one of claims 1-5, wherein when R4is, wherein X is (Ci-C3)-alkylene and each R” is H or (Ci-C3)-alkyl.11 . The compound of claim 10, wherein R4is12. The compound of any one of claims 1-5, wherein when R4iswherein X is (Ci-C3)-alkylene and each R” is H or (Ci-C3)-alkyl.
13. The compound of claim 12, wherein14. The compound of any one of claims 1-5, wherein when R4iswherein X is (Ci-C3)-alkylene and each R” is H or (Ci-C3)-alkyl.
15. The compound of claim 14, wherein16. The compound of any one of claims 1-5, whereinwherein X is (Ci-C3)-alkylene and Ring A is an optionally substituted 5-10- membered heterocycle containing 1-2 heteroatoms, wherein the optional substituents are halo, -CN, (=0), or (Ci-Ce)-alkyl.
17. The compound of claim 16, wherein Ring A is optionally substituted18. The compound of any one of claims 1-5, wherein R4iswherein X is (Co-C3)-alkylene and Ring B is an optionally substituted, saturated or unsaturated heterocycle containing 1-3 heteroatoms, wherein the optional substituents are halo, -CN, (=0) or (Ci-Ce)-alkyl.
19. The compound of claim 18, wherein Ringor (Ci-Ce)-alkyl.
20. The compound of any one of claims 1-19, wherein the compound of Formula, wherein Raand Rbare independently H or (Ci-Ce)-alkyl.
21. The compound of any of one of claims 1-19, wherein the compound ofFormula (I) is selected from the group consisting of:
2. Use of a compound of Formula (III)as an anti-inflammatory agent, wherein:R’ is H, (Ci-Ce)-alkyl or (Ci-Ce)-acyl;R1is selected from H, halo, -CN, and (Ci-Ce)-alkyl;R2is selected from halo, -CN, (Ci-Ce)-alkyl and -O-(Ce-Cio) aryl, wherein the aryl is optionally substituted with one or more of halo, -CN, (Ci-C3)-alkyl or-(Co- C6)-alkylene-C(O)-N(R’)2 wherein each R’ is individually or simultaneously H or (Ci-C3)-alkyl;R3is selected from H, halo, and (Ci-Ce)-alkyl wherein the alkyl is optionally substituted with halo and nitrile;R4is selected from:- optionally substituted (C1-C1 o)-alkyl, wherein the optional substituents are halo, or CN;(Ci-Ce)-alkyl;wherein X is (Ci-Ce)-alkylene and Ring A is an optionally substituted, saturated or unsaturated 5-10-membered heterocycle containing 1-3 heteroatoms, wherein the optional substituents are halo, -CN, (=0), or (Ci-Ce)-alkyl; and, wherein X is (Co-Ce)-alkylene and Ring B is an optionally substituted, saturated or unsaturated 5-10-membered heterocycle containing 1-3 heteroatoms, wherein the optional substituents are halo, -CN, (=0) or (Ci- Ce)-alkyl.
23. The use of claim 22, wherein R1is Br or methyl.
24. The use of claim 22 or 23, wherein R2is Br, methyl or O-phenyl, wherein phenyl is optionally substituted with one or more Br, methyl or-CH2-C(O)- N(R’)2, wherein each R’ is individually or simultaneously H or methyl.
25. The use of claim 24, wherein phenyl is optionally substituted with one or more Br, and -(CH2)-C(O)-N(CH3)2or -(CH2)-C(O)-NH(CH3).
26. The use of any one of claims 22-25, wherein R3is H, Br or methyl.
27. The use of any one of claims 22-26, wherein R4is optionally substituted (Ci- Ce)-alkyl.
28. The use of claim 27, wherein R4is -CH3, -CH2CH3or -CH2CF3.
29. The use of any one of claims 22-26, wherein when, X is (Ci-C3)-alkylene and R’ is (Ci-C3)-alkyl.
30. The use of claim 29, wherein31 . The use of any one of claims 22-26, wherein when, wherein X is (Ci-C3)-alkylene and each R” is H or (Ci-C3)-alkyl.
32. The use of claim 31 , wherein R4is33. The use of any one of claims 22-26, wherein when R4iswherein X is (Ci-C3)-alkylene and each R” is H or (Ci-C3)-alkyl.
34. The use of claim 33, wherein35. The use of any one of claims 22-26, wherein when R4iswherein X is (Ci-C3)-alkylene and each R” is H or (Ci-C3)-alkyl.
36. The use of claim 35, wherein37. The use of any one of claims 22-26, whereinwhereinX is (Ci-C3)-alkylene and Ring A is an optionally substituted 5-10-membered heterocycle containing 1-2 heteroatoms, wherein the optional substituents are halo, -CN, (=0), or (Ci-C6)-alkyl.
38. The use of claim 37, wherein Ring A is optionally substituted39. The use of any one of claims 22-26, wherein R4is, whereinX is (Co-C3)-alkylene and Ring B is an optionally substituted, saturated or unsaturated heterocycle containing 1-3 heteroatoms, wherein the optional substituents are halo, -CN, (=0) or (Ci-Ce)-alkyl.
40. The use of claim 39, wherein Ringor (Ci-Ce)-alkyl.
41. The use of any one of claims 22-40, wherein the compound of Formula (III) is, wherein Raand Rbare independently H or (Ci-Ce)-alkyl.
42. The use of any of one of claims 22-40, wherein the compound of Formula (III) is selected from the group consisting of:
3. The use of any one of claims 22-42, wherein the anti-inflammatory agent is for treating or preventing a disease, disorder or conditions selected from the group consisting of atherosclerosis, auto-immune diseases, psoriasis, multiple sclerosis, transplant rejection, asthma, bacterial infection, rhinovirus infection, brain ischemia, ischemia-reperfusion injury, limb ischemia, acute kidney injury, diabetic nephropathy, sepsis, acute respiratory distress syndrome (ARDS), cancer, osteoarthritis, sepsis-induced kidney injury, liver disease, and septic and cardiogenic shock.