Method for treating tissue sample and method for high-throughput transcriptome sequencing of single-cell subcellular structure
Patent Information
- Application Number
- PCT/CN2025/079706
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-04
- Filing Date
- 2025-02-28
- Publication Date
- 2025-10-02
AI Technical Summary
In existing high-throughput single-cell nucleus transcriptome sequencing technologies, the efficiency of cell nucleus centrifugation recovery is unstable, and the adhesion loss between the cell nucleus and the centrifuge tube and the gun tip is large, resulting in abnormal cell type distribution and cross-diffusion signals, affecting the accuracy of analysis.
By permeabilizing tissue samples to enhance the permeability of tissue gaps, in situ RNA labeling and capture linker addition are performed, and then subcellular structures are dissociated and separated, reducing centrifugation operations, and a microfluidic system is used to perform single-cell subcellular structure segmentation and sequencing.
It improves the recovery efficiency of subcellular structures, reduces damage during the centrifugation process, enhances the integrity of cell types and the accuracy of sequencing, is suitable for fresh, frozen and fixed tissue samples, and supports automated analysis of multiple tissue types.
Smart Images

Figure CN2025079706_02102025_PF_FP_ABST
Abstract
Description
A method for processing tissue samples and a method for high-throughput single-cell subcellular structure transcriptome sequencing Technical Field
[0001] The present invention belongs to the field of biotechnology, and in particular relates to a method for processing tissue samples and a method for high-throughput single-cell subcellular structure transcriptome sequencing. Background technology:
[0002] High-throughput single-cell nuclear transcriptome sequencing has been a hot research area in recent years and has a very wide range of application scenarios.
[0003] In the snRandom-seq method of Chinese patent applications CN202210174619.9 and CN202210550351.4, the cell nuclei of the tissue are isolated, the cell nuclei are fixed with formaldehyde, and the nucleic acids (DNA and RNA) and proteins are cross-linked. The cell nuclei are then used as containers for reverse transcription reactions. The reverse transcription primers can combine with RNA reverse transcription to produce cDNA. The newly generated cDNA is cross-linked with the RNA complementary chain in the cell nucleus. A capture adapter is then added to the end of the cDNA. The cell nuclei are collected and separated into single cell nuclei using a microfluidic system. A label microsphere and the cell nucleus are encapsulated in the droplet. The label sequence carried by the microsphere can be paired with the cDNA capture adapter, and the two-strand synthesis is completed under the action of the polymerase, so that the cDNA obtains the label sequence. The aqueous phase sample is demulsified and the cDNA is purified from it. The cDNA is enriched and the sequencing library is constructed by PCR for high-throughput sequencing and analysis.
[0004] However, snRandom-seq requires a high starting amount of nuclei due to the high number of centrifugation cycles, unstable nuclear recovery efficiency, and significant adhesion loss between nuclei and the centrifuge tube and pipette tip. This severe adhesion between nuclei leads to a high degree of cross-diffusion between different populations, compromising the accuracy of subsequent analysis. Furthermore, the nuclei of different cell types in a tissue vary in size, and during multiple centrifugation cycles, the centrifugal speeds can cause multiple selections of nuclei, leading to an abnormal distribution of cell types. A better approach is needed to achieve high-throughput single-cell nuclear transcriptome sequencing. Summary of the invention:
[0005] Based on the above requirements, the present invention provides a method for processing tissue samples and a method for high-throughput single-cell subcellular structure transcriptome sequencing. The present invention performs an optimized permeabilization treatment on the tissue sample, performs in situ RNA labeling and adds capture adapters in the tissue, and then dissociates the subcellular structures from the tissue for single-cell subcellular structure isolation, thereby achieving high-throughput single-cell transcriptome sequencing.
[0006] The present invention first provides a method for processing a tissue sample to obtain subcellular structures, which comprises the following steps:
[0007] S1-1: Fix and permeabilize tissue samples;
[0008] S1-3: Labeling the RNA of the tissue sample, specifically, immersing the tissue sample in a labeling reagent, which includes a nucleotide chain, a tool enzyme, and a reaction buffer. The nucleotide chain binds to the RNA fragment, and a polymerization reaction or a ligation reaction occurs after the nucleotide chain binds to the RNA chain, so that the nucleotide chain carries the RNA information and the capture linker;
[0009] Preferably, labeling and linker addition are achieved by reverse transcription of the RNA of the tissue sample; specifically, RNA labeling is achieved by adding reverse transcriptase, nucleotide chain, and reaction buffer, and capture linker addition is achieved by adding terminal transferase and a deoxyribonucleoside triphosphate;
[0010] S1-4: Add dissociation solution to the tissue sample, then disperse the tissue slices and centrifuge to remove the supernatant to obtain subcellular structures.
[0011] In S1-1, there is no restriction on the order of fixation and permeabilization of the tissue sample. The fixation is to cross-link the nucleic acid molecules in the tissue. The permeabilization is to make the tissue gaps and biological membranes permeable, allowing proteins and nucleic acid molecules to pass through.
[0012] Specifically, the specific operation method of S1-1 is: for example, for paraffin samples, dewaxing, hydration and permeabilization are performed; for fixed samples, permeabilization is performed; for fresh or frozen tissue samples, fixation and permeabilization are performed, preferably, the permeabilization treatment is a surfactant, enzyme, acid, high temperature or a combination thereof, and the fixative used in the fixation is a simple fixative or a mixed fixative; preferably, the simple fixative includes but is not limited to paraformaldehyde, formaldehyde, formalin, methanol, acetone, ethanol, acetic acid, picric acid, chromic acid, potassium dichromate, and mercuric chloride, and the mixed fixative includes but is not limited to acetic acid-alcohol mixture, formalin-acetic acid-alcohol solution, and Boyne's fixative;
[0013] More preferably, the fixed tissue sample is immersed in a permeabilization reagent for treatment, or treated at a temperature of 70°C-90°C.
[0014] In a specific embodiment, the permeabilization treatment uses a permeabilization agent that is a protease, preferably a 0.1 M hydrochloric acid solution of 1 mg / ml pepsin; the treatment is placed at 35-39° C. (36-38° C., specifically 37° C.) for 5-30 minutes, for example, 8-12 minutes, specifically 10 minutes;
[0015] Preferably, the protease may be one or more of pepsin, trypsin, neutral protease, papain or collagenase.
[0016] In one embodiment, step S-2 is further included between steps S-1 and S-3: blocking the single-stranded DNA in the tissue sample with a blocking reagent, wherein the blocking method includes using a polymerase to fill in the single-stranded DNA into a double-stranded DNA, or using a DNase to degrade the single-stranded DNA. More preferably, the blocking reaction is performed by adding a DNA polymerase, a blocking primer, dNTPs, and a reaction buffer;
[0017] Preferably, the blocking reagent contains 1-10 U / μl DNA polymerase, 5-50 mM blocking primer, 1-10 mM dNTPs, and 1X DNA polymerase buffer; the blocking reaction is carried out at 35-39° C. (36-38° C., specifically 37° C.) for 20-45 minutes.
[0018] In a specific embodiment, in S1-3, the nucleotide chain is a polyT sequence, a target gene sequence, a random sequence or a combination thereof, and the random sequence can be composed of 2 bases, 3 groups of bases or 4 bases; the tool enzyme can be a reverse transcriptase, a polymerase, a ligase, a transposase, a terminal transferase or a combination thereof.
[0019] In a specific embodiment, in S1-3, the incubation is at 8-60°C (36-38°C, specifically 37°C) for 1-8 hours, preferably 3-5 hours, specifically 4 hours.
[0020] In one embodiment, the dissociation solution in S1-4 is a surfactant, a salt ion solution, a dissociation enzyme or a mixture thereof, wherein the dissociation enzyme is selected from proteinase K, collagenase, neutral protease, trypsin, elastase, hyaluronidase, papain; the salt ion solution is selected from PBS, HEPES, TRIS or SSC buffer; the surfactant is selected from NP-40, CA-630, TritonX-100, Tween-20, Tween-80, CHAPS detergent, Brij-58, octylthioglucosidoside (OTG);
[0021] Preferably, the dissociation solution contains 0.5%-2% NP-40 ionic surfactant, 1-5mM MgCl2 in 2X SSC buffer, and 0.1-15mg / ml proteinase K;
[0022] In a preferred embodiment, the dispersion treatment of the tissue sample in S1-4 is to mechanically disrupt the tissue to dissociate the subcellular structures; preferably, the tissue is disrupted by homogenization, more specifically, the homogenization is performed by adding the tissue to a Dounce homogenizer and homogenizing for 10-30 times;
[0023] In a preferred embodiment, the subcellular structure isolated in S1-4 is the nucleus.
[0024] Optionally, the step of purifying the subcellular structure is further included, preferably washing with a buffer solution, and then filtering with a 10-40 μm cell sieve to remove tissue debris; further preferably, each step S1-1 to S1-4 is washed 2-5 times, preferably 3 times, with a buffer solution before proceeding to the next step; the buffer solution is selected from PBS, HEPES, TRIS or SSC buffer;
[0025] In some specific embodiments, the tissue sample is in the form of a tissue slice, and the specific thickness of the tissue slice is 5-100 μm, preferably 10-60 μm.
[0026] The present invention also provides a method for high-throughput single-cell subcellular structure transcriptome sequencing, which includes the step of performing high-throughput single-cell subcellular structure transcriptome sequencing on the subcellular structure obtained by the method.
[0027] In a specific embodiment, a microfluidic droplet or microplate system is used to segment subcellular structures. When a microfluidic droplet system is used to segment subcellular structures, the specific steps are as follows:
[0028] S2-1: connecting the subcellular structure sample, extension reaction reagent, encoding microsphere, and oil phase to corresponding liquid inlets of a microfluidic chip, respectively, to form a single water-in-oil droplet containing the single-cell subcellular structure, the single encoding microsphere, and the extension reaction reagent; collecting the single droplet to form a single chamber containing a cell compartment of the single-cell subcellular structure;
[0029] S2-2: The collected single droplets are divided into different tubes and then subjected to extension reaction to synthesize the second strand of the barcoded cDNA in the single droplet;
[0030] After the S2-3 extension reaction is completed, the single droplet is broken, and the cDNA in the extraction tube is purified and amplified by PCR;
[0031] The cDNA amplified by S2-4 was end-repaired and A-tailed using the TA cloning adapter library construction method.
[0032] Connect the adapter using the library construction kit;
[0033] The constructed library S2-5 was sequenced using the Illumina sequencing platform for high-throughput sequencing.
[0034] In more specific embodiments, S2-1 is connected to the corresponding liquid inlets of the microfluidic chip through flexible pipes; and S2-3 takes part of the cDNA as a template to perform qPCR experiments to detect the total cDNA content captured.
[0035] The present invention enhances the permeability of the interstitial tissue and biological membrane by performing a pre-permeabilization treatment on the tissue during the early stage of single-cell subcellular structure sequencing, and then hybridizes the nucleotide chain with the RNA in the tissue block to capture and label the RNA in the cell. The operation on the tissue avoids a large number of centrifugation processes that exist in the process of processing the subcellular structure of the cell. The subcellular structures in the tissue are of different sizes. During the multiple centrifugation processes, the size of the subcellular structure of the cell will be screened multiple times due to the centrifugal speed. The centrifugal recovery efficiency of the subcellular structure is different. In addition, the adhesion loss in the centrifuge tube and the gun tip during the subcellular structure operation is relatively large, and there is more adhesion between the subcellular structures, which causes inconvenience in operation and affects the final effect.
[0036] When labeling RNA in the subcellular structure of a cell, a variety of reagents need to be used. Before switching different reagents, a buffer solution needs to be used to wash away the previous reagent to reduce the interference of residual reagents on the next reaction. The diameter of the pipette used in the conventional cleaning process is about 0.36-1.5mm, so the existing technology needs to use centrifugal enrichment of subcellular structures to prevent the subcellular structures from being accidentally aspirated by the pipette during the cleaning process. The RNA labeling stage of the subcellular structure of the cell of the present invention still stays in the tissue. The size of the tissue exceeds the diameter of the conventional pipette. The waste liquid can be directly sucked away with a pipette with a diameter of 0.36-1.5mm. There is no need to worry about the pipette sucking away the tissue blocks, which reduces the centrifugation operation during the cleaning process. After the RNA labeling is completed, the sample of the present invention is dissociated into subcellular structures, and only 2-3 centrifugation and cleaning operations are required. Compared with the existing technology, the number of centrifugation times is reduced, the damage to the subcellular structure caused by the centrifugation process is reduced, the recovery efficiency of the subcellular structure is improved, the integrity of the cell type is improved, and the subcellular structure agglomeration caused by the centrifugation process is reduced.
[0037] Current mainstream high-throughput single-cell transcriptome sequencing technologies include: conventional microfluidics 10XGenomics, inDrop, Drop-seq; fixed sample MATQ-DropSEQ (U.S. Patent, WO 2023 / 034913 A2) and snRandom-seq (Chinese Patent CN202210174619.9). Compared with MATQ-DropSEQ and snRandom-seq (fixed samples), the present invention uses fewer centrifugation steps for single-cell subcellular structures, reduces damage to subcellular structures during centrifugation, improves the recovery efficiency of subcellular structures, improves the integrity of cell types, and reduces the aggregation of subcellular structures caused by centrifugation. Furthermore, the present invention operates on tissues and can analyze fresh, frozen, fixed, and FFPE samples, making it applicable to a variety of tissue types and easy to automate. Description of the drawings:
[0038] FIG1 is a schematic diagram of the experimental process of the present invention.
[0039] Figure 2 is a schematic diagram of the snRandom-seq experimental process.
[0040] Figure 3 is a schematic diagram of in situ reverse transcription.
[0041] FIG4 is a schematic diagram of in situ capture linker addition.
[0042] Figure 5 Schematic diagram of the microfluidic chip.
[0043] FIG6 is a gene distribution diagram of the present invention and snRandom-seq mouse brain sample sequencing.
[0044] FIG7 shows tSNE clustering of mouse brain samples of the present invention and snRandom-seq.
[0045] FIG8 is a comparison of the clustering types of mouse brain samples between the present invention and snRandom-seq.
[0046] FIG9 shows the results of analyzing gastric samples using different single cell nucleus dissociation methods according to the present invention.
[0047] FIG10 shows the results of the present invention in treating frozen mouse brain samples.
[0048] Figure 11 Single-cell ribosome and mitochondrial sequencing analysis.
[0049] FIG12 shows the results of analyzing a small amount of liver puncture FFPE samples in Example 6.
[0050] FIG13 shows the results of parallel analysis of two kidney FFPE samples in one experiment in Example 7.
[0051] FIG14 shows the results of analyzing breast FFPE samples using the template replacement strategy to add capture adapters in Example 8. Specific implementation method:
[0052] The present invention will be further described below through specific embodiments in order to better understand the present invention, but it does not constitute a limitation of the present invention.
[0053] Example 1: Processing of FFPE tissue samples and obtaining cell nuclei
[0054] Prepare mouse brain FFPE samples, use a microtome to cut 50um tissue slices, divide into two parts, 1 piece each. Use tweezers to transfer the tissue slices to a 1.5ml centrifuge tube, add 1ml of environmentally friendly dewaxing solution (Solabo, YA0031), place it in a constant temperature mixer (Youning, HH-100), 500 rpm at room temperature for 10 minutes, directly use a pipette (caliber 0.75mm, biosharp 1ml gun tip) to aspirate the dewaxing solution, add new dewaxing solution, repeat 1-2 times until dewaxing is complete. After dewaxing, use a pipette to aspirate the dewaxing solution directly, and add gradient concentrations of ethanol (100%, 95%, 80%, 70%, 50%, 30%) to rehydrate. Use a pipette to aspirate the waste liquid during the dehydration process.
[0055] The present invention operates as follows ( FIG1 ): After rehydration, the tissue slice is immersed in a permeabilization reagent (1 mg / ml pepsin (Sigma), 0.1 M hydrochloric acid) and placed at 37° C. for 10 minutes. Rinse three times with PBST. For the following tissue slice operations, the waste liquid is directly aspirated and discarded using a pipette. Blocking reagent (containing DNA polymerase (1-10 U / μl), blocking primer GAGAATGTGAGTGAAGATGTATGGTGANNNNNNN (5-50 mM), dNTPs (1-10 mM), 1X polymerase reaction buffer, and RNase inhibitor) is added, and the reaction is carried out in a PCR instrument at 37° C. for 20-45 minutes. After blocking, the tissue slice is washed three times with PBST. The tissue slice is immersed in a reverse transcription reagent (containing reverse transcriptase, reverse transcription reaction buffer, dNTPs, and reverse transcription primer GGAGTTGGAGTGAGTGGATGAGTGATGNNNNNNN) for reverse transcription ( FIG3 ). After the reaction, the tissue slice is washed three times with PBST. Terminal transferase, dATP, and reaction buffer were added to the sample and incubated at 37°C for 30 minutes (Figure 4). After the reaction, the sample was washed three times with PBST. 1 ml of single-cell nuclei dissociation buffer (2X SSC buffer containing 0.5-2% NP-40 ionic surfactant and 1-5 mM MgCl2) was added to the tissue slice. The tissue slice and dissociation buffer mixture was homogenized in a Dounce homogenizer 10-30 times and allowed to stand on ice for 5-15 minutes. 100 μl of proteinase K (0.1-15 mg / ml) was added to the homogenized mixture and reacted at 25-50°C for 5-30 minutes. The nuclei were filtered through a 10-40 μm cell sieve to remove tissue debris, the supernatant was aspirated, and the sample was washed three times with washing buffer. A portion of the nuclei was stained with the nucleus-specific dye DAPI and counted under a microscope.
[0056] As a control, the snRandom-seq method in the prior art was used (Figure 2). The operation was performed according to the literature High-throughput single nucleus total RNA sequencing of formalin-fixed paraffin-embedded tissues by snRandom-seq (magazine Nature Communications 2023), including tissue nucleus dissociation, blocking, in situ reverse transcription, capture linker addition, and washing for microfluidic droplet packaging. Specifically, the rehydrated tissue slices were immersed in 900μl single cell nucleus dissociation buffer (1X PBS buffer, 0.1% Triton X-100, 1U / μL RNase Inhibitor), placed in a Dounce homogenizer for homogenization, homogenized 30 times, and allowed to stand on ice for 10 minutes. 100μl proteinase K (10mg / ml) was added to the homogenized mixture and reacted at 37°C for 5 minutes. The cell nuclei were filtered through a 40μm cell sieve to remove tissue residues, the supernatant was aspirated and centrifuged, and the centrifugation was repeated twice with PBST. Nuclei were collected and stained with the nuclear-specific dye DAPI and counted under a microscope. One million nuclei were collected, centrifuged, and suspended in 25.5 μl of PBST. Blocking reagent (2 μl of T4 DNA polymerase (1–10 U / μl), 5 μl of blocking primer (10 μM), 5 μl of dNTPs (100 mM), 10 μl of 5X polymerase reaction buffer, and 2.5 μl of RNase inhibitor) was added. The reaction was allowed to react at 37°C for 30 minutes. After blocking, the reaction was washed three times with PBST by centrifugation and aspiration. Nuclei were collected and suspended in 22.5 μl of PBST. Reverse transcription was performed using a reverse transcription reagent (2.5 μl of reverse transcriptase, 10 μl of 5X reverse transcription buffer, 2.5 μl of dNTPs, 10 μl of random sequence reverse transcription primer, and 2.5 μl of RNase inhibitor). The reaction was repeated for 12 cycles (8–42°C), with the reaction temperature at 42°C for 30 minutes. After reverse transcription, collect the nuclei and wash three times with PBST by centrifugation to remove excess primers. Resuspend the nuclei in 39 μl of PBST, add 0.5 μl of terminal transferase, 0.5 μl of dATP, and 10 μl of terminal transferase reaction buffer to the sample, and incubate at 37°C for 30 minutes. After the reaction, wash three times with PBST by centrifugation to remove the supernatant. Filter the nuclei through a 10 μm cell sieve to remove clumps. Stain a portion of the nuclei with the nucleus-specific dye DAPI and observe and count them under a microscope.
[0057] Example 2: Single-cell nucleus isolation and high-throughput sequencing
[0058] The cell nuclei prepared by the method of the present invention and the cell nuclei prepared by the snRandom-seq method were subjected to microfluidic droplet production using the same conditions.
[0059] A 50 μl single-cell nucleus sample and 50 μl OptiPrep (Sigma) were mixed to prepare a cell nucleus suspension. 100 μl of extension reaction reagent (including 7.5 μl DNA polymerase, 7.5 μl RNase H (NEB), 7.5 μl USER (NEB), 7.5 μl dNTPs, 20 μl 10x polymerase reaction buffer, and 50 μl ddH2O) was then added. 100 μl of cell suspension, 100 μl of extension reaction reagent, 50 μl of encoded microspheres, and 200 μl of 7500 oil were then added to syringes. These syringes were connected to the corresponding inlets of the microfluidic chip (Figure 5) via flexible tubing. Appropriate flow rates were set to form single droplets of oil-in-water containing a single cell nucleus, a single encoded microsphere, and the extension reaction reagent. The single droplets were then collected to form a single chamber containing a single cell.
[0060] The collected single droplets were aliquoted into separate 200 μl centrifuge tubes and placed in a PCR instrument (program: 37°C for 1 hour, 50°C for 30 minutes, 60°C for 30 minutes, and 75°C for 20 minutes). Extension reactions were performed during which RNase H digested the RNA, releasing cDNA from the nucleus. The tag sequences on the microspheres were then cleaved by a USER. The free tag sequences were then bound to the cDNA via adapter sequences, forming a second-stranded cDNA with a barcode. After the extension reaction, PFO was added to break the single droplets apart, and the cDNA in the extraction tube was purified using a magnetic bead method. A portion of the double-stranded cDNA was used as template for qPCR, and the total cDNA content captured was assessed using the Ct value. The remaining cDNA was amplified by PCR. The amplified cDNA was end-repaired and A-tailed using the TA cloning and ligation adapter library construction method, and adapters were ligated using a library construction kit. The constructed library was subjected to high-throughput sequencing using the Illumina sequencing platform.
[0061] Sequencing results show that when comparing snRandom-seq and the present method on the same mouse brain FFPE sample, with the same sequencing data volume (similar sequencing depth and cell number), the number of reads mapped to different regions such as coding, intron, and intergenic regions, as well as the number of detected genes and gene types, are highly similar (Figure 6) (see RSeQC: quality control of RNA-seq experiments). Furthermore, the present method detected more coding RNAs and fewer intergenic regions, providing more effective gene information for downstream analysis. Cluster analysis of the data (see the official Seurat software website https: / / satijalab.org / seurat / ) showed that the present method achieved cleaner clustering (Figure 7). Due to the high number of centrifugation cycles in snRandom-seq, internuclear adhesion is more severe, resulting in more cross-diffusion signals between different clusters, affecting the accuracy of subsequent analysis. By counting the number of cell types in Figure 7, it can be seen that excessive centrifugation cycles in snRandom-seq can lead to an uneven distribution of cell types, with fewer cell types (Figure 8). The present method yielded a more uniform and diverse cell type distribution.
[0062] Example 3: Comparison of single cell nucleus dissociation methods
[0063] Using the scheme of the present invention described in Example 1, the gastric FFPE sample was dewaxed, rehydrated, permeabilized, blocked, reverse transcribed, and reacted with a linker. The tissue block was then divided into two parts, one of which was added with a surfactant to dissociate the nuclei, and the tissue was broken up using a homogenizer. The nuclei were filtered using a 10-40 μm cell sieve to remove tissue debris and washed three times by centrifugation with PBST to obtain single nuclei, which were labeled as the mechanical dissociation group. The second part was added with a surfactant and proteinase K (0.1-15 mg / ml) to dissociate the nuclei, and the reaction was carried out at 25-50 ° C for 5-30 minutes. The dissociation was assisted by pipetting, and the nuclei were filtered using a 10-40 μm cell sieve to remove tissue debris. The nuclei were washed three times by centrifugation with PBST to obtain single nuclei, which were labeled as the enzyme dissociation group. The two groups of nuclei were subjected to single-cell nuclear transcriptome analysis as described in Example 2. The results are shown in Figure 9. Both dissociation methods can obtain relatively good single-cell clustering (Figure 9a), and the genes detected in the two groups are highly consistent (Figure 9b), and the cell type distribution is also relatively consistent (Figure 9c).
[0064] Example 4: Processing of frozen samples and single cell nucleus analysis
[0065] Prepare frozen mouse brain tissue, cut 30um tissue slices using a microtome, fix the tissue with 4% PFA for 15 minutes, wash the tissue slices three times with PBST, and directly use a pipette to discard the waste liquid. Soak the tissue slices in permeabilization reagent (containing 0.1% Triton-100, PBS) and place them at 4°C for 10 minutes. Wash them three times with PBST and directly use a pipette to discard the waste liquid. Soak the tissue slices in reverse transcription reagent (including reverse transcriptase, reverse transcription reaction buffer, dNTPs, and reverse transcription primers) for reverse transcription. After the reaction is completed, wash them three times with PBST and directly use a pipette to discard the waste liquid. Add terminal transferase, dATP, and reaction buffer to the sample and incubate at 37°C for 30 minutes. After the reaction is completed, wash them three times with PBST and directly use a pipette to discard the waste liquid. Add 1 ml of single-cell nucleus dissociation solution to the tissue slice. The single-cell nucleus dissociation solution consists of 2X SSC buffer containing 0.5-2% NP-40 ionic surfactant, MgCl2 (1-5 mM), and proteinase K (0.1-15 mg / ml). Homogenize the tissue slice and dissociation solution mixture in a Dounce homogenizer 10-30 times. Incubate at 25-50°C for 5-30 minutes. Filter the nuclei using a 10-40 μm cell sieve to remove tissue debris. Centrifuge and discard the supernatant. Repeat the centrifugation and wash three times with PBST. Single-cell nucleus transcriptome analysis was performed on the nuclei as described in Example 2. The results are shown in Figure 10. Clear single-cell clustering can be obtained from frozen mouse brain tissue (Figure 10).
[0066] Example 5: Single-cell ribosome and mitochondrial sequencing analysis
[0067] Using the protocol of the present invention described in Example 1, breast FFPE samples were dewaxed, rehydrated, permeabilized, blocked, reverse transcribed, and linker-added. A dissociation solution containing collagenase was added to the tissue slices, and the tissue was disrupted using a homogenizer. The tissue was incubated at 37°C for 30 minutes, filtered using a 10-40 μm cell sieve to remove tissue debris, and washed three times by centrifugation with PBST to obtain a single-cell nuclear mitochondrial ribosome complex. Microfluidic separation and sequencing analysis were performed as described in Example 2. The results are shown in Figure 11. A large number of ribosomes and mitochondria were retained in the isolated subcellular structures. The single-cell nuclear mitochondrial ribosome complex had relatively good clustering, of which approximately 59.8% of the signal came from ribosomes, and the proportion of mitochondria in the coding RNA signal was also relatively high.
[0068] Example 6: Single-cell nuclear transcriptome analysis of biopsy samples
[0069] Take 2-3 volumes of FFPE liver puncture samples and use the method described in Example 1 to perform dewaxing, rehydration, permeabilization, blocking, reverse transcription, and linker addition reaction. During the operation of the tissue slices, because the tissue slices are small, it is necessary to use a desktop centrifuge to briefly centrifuge and collect the tissue before aspirating the liquid. Then, use the method described in Example 1 to dissociate and wash the nuclei of the puncture samples, collect the nuclei, and count them. Microfluidic separation and sequencing analysis are performed as described in Example 2. The sequencing data are shown in Table 1 below, and the results are shown in Figure 12. For trace puncture samples, the scheme of the present invention can also effectively perform single-cell nuclear transcriptome analysis, and clear single-cell clustering can be obtained for liver puncture samples.
[0070] Table 1
[0071] Example 7: Parallel single-cell nuclear transcriptome analysis of FFPE samples
[0072] Take one volume of each of two human kidney FFPE section samples and use the method described in Example 1 to perform dewaxing, rehydration, permeabilization, blocking, reverse transcription, and linker addition reactions. The reverse transcription primers used in the two samples carry different tag sequences (reverse transcription primer structure: PCR linker + tag sequence + RNA binding sequence GAGA ATGTGAGTGAAGATGTATGGTGA+GAAGGAAT+NNNNNNN; GAGAATGTGAGTGAAGATGTATGGTGA+GATGAATG+NNNNNNN). After reverse transcription, the two samples are mixed together for subsequent linker addition and cell nucleus dissociation, washing, and counting operations. Microfluidic separation and sequencing analysis are performed as described in Example 2. The sequencing data are shown in Table 2. The raw data can be split in the sequencing data according to the tag sequence on the reverse transcription primer to obtain data for the two samples. The results are shown in Figure 13. Both samples were effectively analyzed for single-cell nuclear transcriptomes, and clear single-cell clustering can be obtained.
[0073] Table 2
[0074] Example 8: Single-cell nucleus analysis by template displacement plus capture adapter
[0075] One volume of breast FFPE specimen was deparaffinized and rehydrated using the method described in Example 1. The specimen was then washed three times with 0.1M HCl and once with TE (pH 9.0). The specimen was then resuspended in TE (pH 9.0) and treated in a metal bath at 95°C for 30 minutes. The specimen was then slowly cooled to room temperature and washed three times with 2X SSC (room temperature). Reverse transcription was performed by immersing the tissue slice in reverse transcription reagent (containing reverse transcriptase, reverse transcription reaction buffer, dNTPs, reverse transcription primer, and template displacement primer (template displacement primer structure: TTTTTTTTTTTTTTTTrGrG / iXNA_G / ). After completion of the reaction, the specimen was washed three times with PBST. 1 ml of single cell nucleus dissociation buffer (2X SSC buffer containing 0.5-2% NP-40 ionic surfactant and 1-5 mM MgCl2) was added to the tissue slice. The tissue slices and the dissociation solution mixture were added to a Dounce homogenizer for homogenization 10 to 30 times, and the mixture was allowed to stand on ice for 5 to 15 minutes. 100 μl of proteinase K (0.1 to 15 mg / ml) was added to the homogenized mixture and reacted at 25 to 50°C for 5 to 30 minutes. The cell nuclei were filtered using a 10-40 μm cell sieve to remove tissue debris, the supernatant was discarded by centrifugation, and the mixture was washed three times with washing solution. Some cell nuclei were stained with the nucleus-specific dye DAPI and then observed and counted under a microscope. Microfluidic separation and sequencing analysis were performed as described in Example 2. The sequencing data are shown in Table 3 below. The results are shown in Figure 14. By template replacement, rather than by terminal transferase plus ployA, it is also possible to effectively add capture adapters to the ends of single-cell nuclear cDNAs, realize single-cell nuclear transcriptome analysis, and obtain clear single-cell clustering.
[0076] Table 3 Industrial Applicability
[0077] The subcellular structure obtained by the present invention is very beneficial for high-throughput single-cell subcellular structure transcriptome sequencing and therefore has great practical value.
Claims
1. A method for processing tissue samples to obtain single-cell subcellular structures, characterized in that: The steps include: S1-1: Fix and permeabilize tissue samples; S1-3: Labeling the RNA of the tissue sample, specifically, immersing the tissue sample in a labeling reagent, which includes a nucleotide chain, a tool enzyme, and a reaction buffer. The nucleotide chain binds to the RNA fragment, and a polymerization reaction or a ligation reaction occurs after the nucleotide chain binds to the RNA chain, so that the nucleotide chain carries the RNA information and the capture linker; Preferably, the RNA of the tissue sample is labeled by reverse transcriptase, specifically by adding reverse transcriptase, nucleotide chain, and reaction buffer to reverse transcribe the RNA to produce cDNA carrying the RNA information label, adding terminal transferase and a deoxyribonucleoside triphosphate to add a cDNA capture adapter, or adding a capture adapter to the end of the cell cDNA by template displacement; S1-4: adding a dissociation solution to the tissue slice, then dispersing the tissue slice, and centrifuging to remove the supernatant to obtain a subcellular structure; the subcellular structure is a cell nucleus, organelles (such as mitochondria, ribosomes, lysosomes, endoplasmic reticulum, Golgi apparatus), cytoplasmic condensates, plastids, lysosomes, physical structures secreted by cells (such as extracellular vesicles) or a combination thereof; preferably, the subcellular structure is a cell nucleus.
2. The method according to claim 1, wherein The original sample of the tissue sample is a paraffin-embedded sample, a frozen sample, a fresh sample, a refrigerated sample, a sample preserved in a fixative solution or a sample preserved in a sample preservation solution, or a puncture sample; S1-1 The specific operation method is as follows: for paraffin-embedded samples, dewax, hydrate and permeabilize; for fixed samples, permeabilize; for fresh or frozen tissue samples, fix and permeabilize; Preferably, the permeabilization treatment is a treatment with a surfactant, an enzyme, an acid, a high temperature or a combination thereof, and the fixative used in the fixation is a simple fixative or a mixed fixative; preferably, the simple fixative includes but is not limited to paraformaldehyde, formaldehyde, formalin, methanol, acetone, ethanol, acetic acid, picric acid, chromic acid, potassium dichromate, and mercuric chloride; the mixed fixative includes but is not limited to an acetic acid-alcohol mixture, a formalin-acetic acid-alcohol solution, and Boyne's fixative; More preferably, the permeabilization treatment is performed by immersing the tissue sample in a permeabilization reagent, or performing the treatment at a temperature of 70° C.-90° C.
3. The method according to claim 2, wherein The permeabilization treatment in S1-1 is performed using a protease treatment, preferably a 0.1 M hydrochloric acid solution of 1 mg / ml pepsin; the treatment is carried out at 35-39° C. (36-38° C., specifically 37° C.) for 5-30 minutes, for example, 8-12 minutes, specifically 10 minutes; Preferably, the protease may be one or more of pepsin, trypsin, neutral protease, papain or collagenase.
4. The method according to claim 1, wherein Between steps S-1 and S-3, step S-2 is also included: blocking the single-stranded DNA in the tissue sample with a blocking reagent, wherein the blocking method includes using a polymerase to fill in the single-stranded DNA into a double-stranded DNA, or using a DNase to degrade the single-stranded DNA. More preferably, the blocking reaction is performed by adding a DNA polymerase, a blocking primer, dNTPs, and a reaction buffer; Preferably, the blocking reagent contains 1-10 U / μl DNA polymerase, 5-50 mM blocking primer, 1-10 mM dNTPs, and 1X DNA polymerase reaction buffer; the blocking reaction is carried out at 35-39° C. (36-38° C., specifically 37° C.) for 20-45 minutes.
5. The method according to claim 1, wherein The nucleotide chain in S1-3 is a polyT sequence, a target gene sequence, a random sequence or a combination thereof, wherein the random sequence may be composed of 2 bases, 3 bases or 4 bases; the tool enzyme may be a reverse transcriptase, a polymerase, a ligase, a transposase, a terminal transferase or a combination thereof.
6. The method according to claim 1, wherein RNA labeling in S1-3 is performed by incubating at 8-60° C. (36-38° C., specifically 37° C.) for 1-8 hours, preferably 3-5 hours, specifically 4 hours.
7. The method according to claim 1, wherein The dissociation solution in S1-4 is a surfactant, a salt ion solution, a dissociation enzyme or a mixture thereof, wherein the dissociation enzyme is selected from proteinase K, collagenase, neutral protease, trypsin, elastase, hyaluronidase, papain; the salt ion solution is selected from PBS, HEPES, TRIS or SSC buffer; the surfactant is selected from NP-40, CA-630, TritonX-100, Tween-20, Tween-80, CHAPS detergent, Brij-58, octylthioglucosidoside (OTG); Preferably, the dissociation solution contains 0.5%-2% NP-40 ionic surfactant, 1-5mM MgCl2 in 2X SSC buffer, and 0.1-15mg / ml proteinase K.
8. [Corrected 19.03.2025 under Rule 26] The method according to claim 1, characterized in that The dispersion treatment of the tissue sample in S1-4 is to break the tissue by mechanical action to dissociate the subcellular structure; preferably, the tissue is broken by homogenization, and the tissue fragments are reacted at 25-50°C for 5-30 minutes.
9. [Corrected 19.03.2025 under Rule 26] The method according to claim 8, characterized in that The method further comprises the step of purifying the obtained subcellular structure, preferably washing with a buffer solution, and then filtering with a 10-40 μm cell sieve to remove tissue debris; preferably, each step S1-1 to S1-4 is washed 2-5 times, preferably 3 times, with a buffer solution before proceeding to the next step; the buffer solution is selected from PBS, HEPES, TRIS or SSC buffer.
10. The method according to any one of claims 1 to 9, characterized in that The tissue sample is in the form of a tissue slice, and the specific thickness of the tissue slice is 5-100 μm, preferably 10-60 μm; Optionally, the tissue sample is a mixed sample of two or more samples labeled with tag sequences on different reverse transcription primers.
11. A method for high-throughput single-cell subcellular structure transcriptome sequencing, characterized in that: The method comprises the step of performing high-throughput single-cell subcellular structure sequencing on the subcellular structure obtained by the method according to any one of claims 1 to 10.
12. The method according to claim 11, wherein Single-cell subcellular structure segmentation using microfluidic droplet or microplate systems; Preferably, the steps for single-cell subcellular structure segmentation using a microfluidic droplet system are as follows: S2-1: connecting the subcellular structure sample, extension reaction reagent, encoding microsphere, and oil phase to corresponding liquid inlets of the microfluidic chip, respectively, to form a single water-in-oil droplet containing the single-cell subcellular structure, the single encoding microsphere, and the extension reaction reagent; collecting the single droplet to form a single chamber containing the single-cell subcellular structure; S2-2: The collected single droplets are divided into different tubes and then subjected to extension reaction to synthesize the second strand of the barcoded cDNA in the single droplet; After the S2-3 extension reaction is completed, the single droplet is broken, and the cDNA in the extraction tube is purified and amplified by PCR; The cDNA amplified by S2-4 was end-repaired and A-tailed using the TA cloning adapter library construction method, and then connected to the adapter using the library construction kit; The constructed library S2-5 was sequenced using the Illumina sequencing platform for high-throughput sequencing.