Precise adeno-associated virus-protein conjugates and uses thereof

Genetically-modified AAV-protein conjugates with site-specific bioorthogonal handles address the issue of wild-type AAV's tissue tropism control, achieving enhanced targeting and reduced off-target effects, with improved infectivity and tissue specificity.

WO2025188967A1PCT designated stage Publication Date: 2025-09-11BOSTON COLLEGE
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/018695
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-03-06
Filing Date
2025-03-06
Publication Date
2025-09-11

AI Technical Summary

Technical Problem

Wild-type adeno-associated virus (AAV) vectors lack precise control over tissue tropism, leading to off-target delivery and toxicity in unintended organs, limiting their effectiveness in gene therapy.

Method used

Genetically-modified AAV-protein conjugates are created through site-specific incorporation of engineered amino acids with bioorthogonal handles, allowing precise targeting of cells and tissues using bioconjugation with retargeting components like antibodies, maintaining or enhancing infectivity.

Benefits of technology

The modified AAV-protein conjugates demonstrate significantly improved tissue tropism, achieving up to 85 times better viral transduction in targeted tissues and 50 times lower liver transduction compared to wild-type AAV, with retained or enhanced infectivity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025018695_12092025_PF_FP_ABST
    Figure US2025018695_12092025_PF_FP_ABST
Patent Text Reader

Abstract

A virus conjugate comprising a genetically-modified adeno-associated virus (AAV), wherein the virus is mutated to incorporate an engineered amino acid in a site-specific manner and a genetically-modified protein of interest, wherein the protein is mutated to incorporate an engineered amino acid in a site-specific manner, wherein the engineered amino acids can further comprise orthogonal bioconjugation groups suitable for attachment of a bifunctional linking reagent, whereby the virus and protein are cross-linked via the bifunctional chemical linker reagent to form a virus conjugate is described.
Need to check novelty before this filing date? Find Prior Art

Description

PRECISE ADENO-ASSOCIATED VIRUS-PROTEIN CONJUGATES AND USES THEREOFGOVERNMENT SUPPORT

[0001] This invention was made with Government support under contract number R35 GM136437, awarded by the National Institutes of Health / National Institute of General Medical Sciences (NIH / NIGMS), and under contract number 1817893, awarded by the National Science Foundation (NSF). The Government has certain rights in the invention.RELATED APPLICATIONS

[0002] This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 63 / 561,830, filed on March 6, 2024, which is incorporated herein by reference in its entirety.SEQUENCE LISTING

[0003] A Sequence Listing conforming to the rules of WIPO Standard ST.26 is hereby incorporated by reference. Said Sequence Listing has been filed as an electronic document via PatentCenter encoded as XML in UTF-8 text. The electronic document, created on February 25, 2025, is entitled “0342.0018W01_ST26.xml”, and is 91,979 bytes in size.BACKGROUND OF THE INVENTION

[0004] Adeno-associated virus (AAV), a parvovoridae virus, is a small, singlestranded DNA virus encapsulated in a naked protein capsid. The AAV genome contains 4.7 Kb, single-stranded DNA with three open reading frames enclosed by two inverted terminal repeats (ITR)1. Rep genes encode for four non -structural Rep proteins which are responsible for genome replication, and packaging. Cap genes encode for capsid proteins VP1, VP2, and VP3 with a ratio of 1 : 1 : 10 making up an icosahedral particle2. Cap gene also encodes for non- structural proteins AAP, and MAAP for capsid assembly2and secretion3, respectively. AAV has been widely used as a leading vector in gene therapy due to its high stability, wide tissue tropism, low immunogenicity, and absence of known pathogenicity.

[0005] The use of AAV has greatly revolutionized the field of gene therapy, enabling safer manufacturing processes and doses in humans. FDA has approved 3 AAV based gene therapy including AAV2 based vector Luxturna to treat inherited retinal disease, the AAV9-based vector Zolgensma to treat spinal muscular dystrophy, and AAV5 based vector by Hemgenix to treat hemophilia B. Nevertheless, most of the ongoing clinical trials and industry have been utilizing the wild-type AAV that lacks control over tissue tropism. For example, AAV2 is detected in a wide variety of tissue brain, eye, liver, kidney, and muscle4. As a notorious target of AAV, transduction in the liver is dramatic across all the serotypes, while transduction in other tissue remains minimal. Thus, the wild-type AAV vector has a major drawback in that it lacks control over tissue tropism. This can lead to off-target delivery of the therapeutic gene, causing toxicity in unintended organs and limiting the effectiveness of AAV-based treatments. There is a great need to develop AAV vectors with therapeutically desirable traits such as cell-specificity and immune evasion in order for the AAV vector to be used precisely and efficiently in selective viral transduction for the treatment of disease in mammals.SUMMARY OF THE INVENTION

[0006] As discussed above, the wild-type adeno-associated virus (referred to herein as AAV) vector has a major drawback in that it lacks precise control over tissue tropism. This can lead to off-target delivery of the therapeutic gene, causing toxicity in unintended cells, organs and tissues, and limits the effectiveness of AAV-based treatments. Described herein is an innovative chemical approach to genetically-modify (selectively site and stoichiometrically modify) AAV, thus producing virus-protein conjugates that enable selective, precise, specific and efficient targeting of cells and tissues with specific infectivity rates comparable to, or greater than, unconjugated wild-type AAV.Specifically, these virus-protein conjugates target mammalian cells, tissues or organs, and more specifically target human cells, tissues or organs. The present invention provides virus-protein conjugates, and methods to chemically functionalize AAV by covalent attachment of a protein of interest for next-generation gene therapy. Such virus-protein conjugates are a significant improvement over wild-type AAV vectors for diagnostic procedures and therapeutic treatments.

[0007] These genetically-engineered virus-protein conjugates, wherein the viralcomponent of the conjugate exhibits comparable, or increased, bioactivity relative to wildtype virus (e.g., comparable or increased rates of infectivity of targeted, specific cells tissues or organs as compared to the infectivity rates of non-genetically-engineered, wildtype virus) was accomplished by employing genetic code expansion to incorporate engineered amino acids or non-canonical amino acids (ncAAs, also referred to herein as non-naturally occurring, or unnatural (UAA) amino acids, or amino acid analogs) thereby incorporating bioorthogonal handles e.g., in the AAV, specifically in one, or more of the AAV capsid proteins, VP1, VP2 or VP3. Bioorthogonal handles are reactive molecular or chemical entities / components or reagents introduced into a biomotecute of interest, such as a protein, that binds to, couples with or reacts with a complementary chemical or molecular target (e,g., a binding partner). The handles are “biorthogonal” as their specific chemical or molecular reactions do not interfere with the normal cellular mechanisms. The use of biorthogonal handles can result in the covalent tagging, modification or labeling of the biomolecule of interest. For example, these bioconjugation handles facilitate subsequent covalent chemical crosslinking with a retargeting component / scaffold, for example, such as antibody fragments, nanobodies or full-length antibodies, that direct the AAV to a targeted cell, tissue or organ other than its wild-type target.

[0008] The virus was fine-tuned with precise site-specific modification, yielding the optimal conjugate with approximately 5 nanobody attachments at site 588 of VP1 protein, through a flexible cross-linker. The number of protein molecules cross-linked to the virus can be from anywhere from one molecule to about 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more protein molecules, depending on the specific protein used, and the optimal number of attached proteins can be determined using assay methods described herein. As described herein, the modified AAV exhibited a significant reduction in infecting its natural target HEK293T cells (human embryonic kidney cells) while displaying superior infectivity compared to the wild-type virus when conjugated with HER2 antibody in breast cancer cell lines.

[0009] Importantly, using the methods described herein, the adeno-associated virus (AAV) shows nearly complete modification with the protein of interest / targeting protein. That is, greater than, about 50% of the engineered amino acids incorporated into AAV capsid protein VP1 (SEQ ID NO: 1) or VP2 (SEQ ID NO:2) are attached / linked to / conjugated to the targeting protein via the bifunctional linker. More specifically, greater than about 55%, 60%, 65%, 70%, 75% , 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% oreven 100% of the engineered amino acids of the AAV are attached to the protein of interest through the bifunctional linker.

[0010] Furthermore, as described herein, xenograft models in mice demonstrated a remarkable viral transduction of the modified virus with about 85 times better (e.g., anywhere from about 10 to about 25 to about 50 to about 75 to about 100 times better) than that of wild-type (WT) virus at the peak of infection. The shift in tissue tropism was elucidated by transgene titer, reaching levels up to about 20 times (e.g., about 5 to about 10 to about 15 to about 20 to about 30, to about 40 to about 50 times) higher in tumors despite rapid expansion of tumor volume and approximately 50 times lower in livers than wildtype, unmodified AAV.

[0011] The present invention encompasses a virus conjugate comprising a genetically- modified adeno-associated virus (AAV), wherein the virus incorporates an engineered amino acid in a site-specific manner at a predetermined / predefmed site of the virus, and a genetically-modified protein of interest, wherein the protein also incorporates an engineered amino acid in a site-specific manner at a predetermined / predefmed site. The engineered amino acids further comprise orthogonal bioconjugation groups suitable for attachment of a functional molecule, such as a bifunctional linking reagent, whereby the virus and protein are cross-linked via / through the bifunctional linker reagent to form a virus-protein conjugate. As described herein, site-specific incorporation refers to substitution at a specific amino acid residue site of a virus or protein, wherein, for example, the naturally-occurring amino acid residue is substituted for a non-native cysteine or a ncAA.

[0012] As used herein, the term “engineered amino acid” can include any amino acid that comprises / contains a bioconjugation handle (also referred to herein as an orthogonal or bioorthogonal conjugation group). Bioorthogonal conjugation groups of the engineered amino acid include, for example, azide, alkynes, aldehydes, ketones , alkenes, tetrazine and 5-hydroxytryptophan. The conjugation handles of the engineered amino acid are bioorthogonal, that is, they do not interfere with native biochemical processes. Such engineered amino acids comprising a bioconjugation handle can include, for example, a cysteine amino acid residue that is naturally present in the wild-type / native virus or protein, or wherein the virus or protein has been mutated to introduce / incorporate a nonnative cysteine residue into a specific site of the virus or protein. Engineered amino acidsdescribed herein also include non-canonical amino acids (ncAA). In one embodiment, the ncAA is the lysine analog, AzK.

[0013] In one embodiment, the genetically-modified adeno-associated virus (AAV) comprises a variant VP1 or VP2 capsid protein wherein the VP1 or VP2 capsid protein is mutated to incorporate an engineered amino acid in a site-specific manner at a predetermined / predefined site of the VP1 or VP2 capsid protein, wherein the engineered amino acid comprises a bioorthogonal conjugation group suitable for attachment of a bifunctional linking reagent.

[0014] The AAV VP1 capsid protein comprises SEQ ID NO:1, or a sequence comprising at least about 80% sequence identity of SEQ ID NO: 1 and the AAV VP2 capsid protein comprises SEQ ID NO: 2, or a sequence comprising at least about 80%, 85% sequence identity of SEQ ID NO:2. In particular, the variant VP1 capsid protein of is mutated at one of more locations at positions 263, 454, 456, 585, 587 or 58. More particularly, the VP1 capsid protein is a surface-exposed amino acid residue site selected from the group consisting of: Q264, T454, T456 or R588.

[0015] As described herein, the AAV VP1 or VP2 capsid protein is linked to a protein of interest, typically a targeting protein to direct the AAV to the desired targeted mammalian cell, tissue or organ. The protein of interest can be, for example, a full-length antibody, an antibody fragment, a nanobody an enzyme, a cytokine, a serum protein or an immune-modulating protein.

[0016] The virus conjugate of the present invention incorporates a bifunctional linker moiety / reagent to link / conjugate the adeno-associated virus to the protein of interest. In one embodiment, the bifunctional linker is a chemical linker. For example, the chemical linker comprises a functional group such as Tetrazine (Tz), or a strained alkene, by which the adeno-associated virus VP1 or VP2 capsid protein and the protein of interest are chemically cross-linked via a Tz and strained alkene linkage, resulting in a virus-protein conjugate. Examples of a strained alkene of the bifunctional linker reagent include cyclopropenes, norbornenes, cyclooctenes or cyclooctynes.

[0017] In one embodiment, the bifunctional linker reagent of the virus conjugate comprises dibenzocyclooctyne (DBCO) - tetrazine (Tz) or DBCO-trans-cyclooctene (TCO). In a particular embodiment, the DBCO of the bifunctional linker further comprises a sulfide moiety / is sulfonated (DBCO-sulfo) or a flexible linker moiety (DBCO-linker).Examples of the flexible linker moiety of the bifunctional linker are polyethylene glycom (PEG), a peptide, an oligonucleotide, a polycarbohydrate, or other suitable polymer. In a particular embodiment, the flexible linker moiety comprises a PEG moiety comprising 1 to about 24 PEG molecules.

[0018] The bifunctional linkers of the virus conjugate are paired combinations of linkers, wherein, for example, in one combination the engineered amino acid of the virus is linked to a DBCO-sulfo-Tz or DBCO-PEG-Tz bifunctional linker and the engineered amino acid of the protein of interest is linked to a DBCO-sulfo-TCO or DBCO-PEG-TCO bifunctional linker, or an alternate combination wherein engineered amino acid of the virus is linked to a DBCO-sulfo-TCO or DBCO-PEG-TCO linker and the engineered amino acid of the protein of interest is linked to a DBCO-sulfo-Tz or an DBCO-PEG-Tz.

[0019] More specifically, the present invention encompasses a virus conjugate of two essential components: a genetically-modified adeno-associated virus (AAV) comprising a non-canonical occurring amino acid (ncAA) residue incorporated into the AAV at one, or more, specific sites at one, or more, of the virus capsid proteins, and a genetically-modified protein of interest comprising a non-canonical occurring amino acid (ncAA). In a particular embodiment the ncAA is the lysine analog, azido-lysine or AzK. To produce the virusprotein conjugate, the genetically- engineered AAV and genetically-engineered protein are chemically cross-linked via a bifunctional chemical linker reagent comprising Tetrazine (Tz) or trans-Cyclooctene (TCO) modifying the AzK ncAA residues, thereby producing a virus-protein conjugate. The chemical cross-linking reaction is preferably an inverse electron demand Diels-Alder reaction (IEDDA), but other suitable cross-linking reactions can be used also. Other non-essential components can also be included in the virus conjugate.

[0020] The virus of the conjugate is a genetically-modified AAV, wherein the AAV capsid protein comprises SEQ ID NO: 1, or a sequence comprising at least about 80% sequence identity of SEQ ID NO: 1. More specifically, the genetically-modified AAV capsid protein VP1 comprises SEQ ID NO: 1, or a sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 95% , 99%, or between 90% and 99%, sequence identity of SEQ ID NO: 1. The AAV capsid protein is mutated (e.g., genetically-modified, genetically- engineered or also referred to herein as a variant capsid protein) at a surface-exposed site selected from the group consisting of: Q264, T454, T456 or R588. These sites are suitableto incorporate a stop codon such as TAG, TAA or TGA, to permit incorporation of the ncAA in a specific, site-selected manner. In a particular embodiment the position T454 of the sequence is selected to incorporate a stop codon using the techniques described herein to incorporate a ncAA. Such techniques are also described in, for example, PCT / US2020 / 055834; PCT / US2020 / 038766, PCT / US2020 / 029567 or US2023 / 0175013, the teachings of which are incorporated herein in their entirety, by reference.

[0021] Specifically, the genetically-modified AAV can comprise the mutated VP1 amino acid sequence SEQ ID NO: 1, or a sequence with at least about 80% sequence identity with SEQ ID NO: 1, wherein the variant VP1 capsid protein is mutated at one, or more position(s) located at 263, 454, 456, 587 and / or 588 of the VP1 sequence and relative to the wild-type VP1 sequence. The VP1 sequence can also be mutated at positions 263, 454, 456 and 588 but not 587. Alternatively, the VP1 sequence can be mutated at positions 263, 454, 456 but not 585 nor 588.

[0022] In another embodiment the genetically-modified AAV comprises a mutated VP2 amino acid sequence comprises SEQ ID NO:2, or a sequence with at least about 80%, 85%, 90%, 95 or 99% sequence identity with SEQ ID NO:2. In another embodiment, the VP3 amino acid sequence comprises SEQ ID NO:3, or a sequence with at least about 80%, 84%, 90%, 95% or 99% sequence identity with SEQ ID NO:3. In some embodiments, both the VP1 and VP2 capsid proteins are mutated to incorporate engineered amino acids as described above.

[0023] The virus-protein conjugate described herein comprises a genetically-modified protein of interest that acts, for example, as a re-targeting scaffold (also referred to herein as a targeting agent, entity, components or molecule). This re-targeting agent directs the AAV to a specific cell receptor other than the native, wild-type AAV cell receptor target heparan sulfate proteoglycan, which is present on many cells. Specifically encompassed by the present invention are protein re-targeting components such as a full-length antibody, or an antibody fragment such as a nanobody. Additional examples, of proteins of interest are enzymes, cytokines, serum proteins such as albumin, lipoprotein, glycoprotein, and a, 0, and y globulins, or immune-modulating proteins.

[0024] The bifunctional chemical cross-linker reagent of the present invention can comprise any suitable chemical cross-linker that reacts with (e.g., attaches to or binds with) the selected engineered amino acid (e.g., cysteine or ncAA) incorporated into the virus andprotein, where the reaction occurs under conditions that do not alter or decrease the bioactivity of the virus or the protein. For example, the virus AAV should still exhibit sufficient specific infectivity (bioactivity) of the target cells or tissues as comparable to, or better than, the wild-type AAV infectivity. The targeting protein should still comprise the affinity / avidity activity to bind to the selected receptor on targeted cells or tissues for sufficient time for cellular uptake (transduction) of the virus conjugate to enter the targeted cells. Importantly the virus-protein conjugate can further comprise a cargo (additional entity / moiety such as a drug, a diagnostic or therapeutic agent or a detectable label) to be delivered to the targeted cell / tissue for therapeutic purposes, or for diagnostic procedures such as following the course of delivery of an agent to the targeted cell / tissue. Such a cargo can be an organic molecule, a nucleic acid or protein, or biologically-active fragments of a protein or a detectable label. Modifications to the virus and protein of the conjugate should not inhibit or decrease delivery of such cargo to the cell / tissue nor interfere with the activity of the cargo delivered.

[0025] Specifically encompassed by the present invention are bifunctional chemical cross-linkers comprising dibenzocyclooctyne (DBCO) - tetrazine (Tz) or DBCO-trans- cyclooctene (TCO). More specifically, the DBCO of the bifunctional linker further comprises a sulfide moiety / is sulfonated (DBCO-sulfo) or a flexible polyethylene glycol (PEG) spacer moiety (DBCO-PEG) wherein the linker comprises a PEG moiety / spacer comprising 1 to about 50 PEG molecules, and in a preferred embodiment the PEG spacer is about 24 PEG molecules in length. The number of the PEG molecules of the spacer can be shorter, or longer as determined by the techniques described herein.

[0026] In the present invention the bifunctional linkers are paired in combinations of Tz and TCO for the chemical cross-linking reaction to occur. For example, in one combination the AzK of the VP1 capsid protein is linked to a DBCO-sulfo-Tz or DBCO- PEG-Tz bifunctional linker and the AzK of the protein of interest is linked to a DBCO- sulfo-TCO or DBCO-PEG-TCO bifunctional linker, or an alternate combination wherein the VPI capsid protein is linked to a DBCO-sulfo-TCO or DBCO-PEG-TCO linker and the protein of interest is linked to a DBCO-sulfo-Tz or an DBCO-PEG-Tz.

[0027] Also encompassed by the present invention are methods of producing a virus conjugate comprising a genetically-modified adeno-associated virus (AAV) and a genetically-modified protein of interest. In general, the method comprises the steps of:a.) incorporating an engineered amino acid residue with a bioconjugation group / handle at a specific site of the VP1 or VP2 capsid protein of the AAV and modifying the bioconjugation handle with a bifunctional linker reagent comprising either tetrazine or a strained-alkene; b.) incorporating an engineered amino acid residue with a bioconjugation handle at a specific site of a protein of interest and modifying the bioconjugation handle with a bifunctional linker reagent comprising either tetrazine or strained alkene; and c.) combining / reacting the genetically-modified AAV comprising VP1 or VP2 capsid protein and the genetically-modified protein of interest of steps a.) and b.) under conditions suitable for the cross-linking of the tetrazine and transcyclooctene linker reagents, thereby producing an adeno-associated virus (AAV)-protein conjugate.

[0028] More specifically, the present invention encompasses a method of producing an adeno-associated virus (AAV)-protein of interest as follows a.) incorporating an AzK bioconjugate handle at a specific site of the VP1 capsid protein of the AAV and modifying the AzK site with a bifunctional linker reagent comprising either tetrazine or transcyclooctene; b.) incorporating an AzK bioconjugate handle at a specific site of a protein of interest and modifying the AzK site with a bifunctional linker reagent comprising either tetrazine or trans-cyclooctene; and c.) combining or reacting the modified AAV VP1 capsid protein and the modified protein of interest of steps a.) and b.) under conditions suitable for the cross-linking of the tetrazine and trans-cyclooctene linker reagents, thereby producing an adeno-associated virus (AAV)-protein of interest conjugate.

[0029] In one embodiment, the site of incorporation of the engineered amnio acid or AzK residue in the VP1 capsid protein is a surface-exposed site selected from the group consisting of: Q264, T454, T456 or R588. In a particular embodiment, the site of incorporation of the AzK is T454. As described herein, the protein of interest of theconjugate is a full-length antibody, an antibody fragment, a nanobody, an enzyme, a cytokine, a serum protein or an immunomodulating protein.

[0030] Importantly, the adeno-associated virus-protein conjugates produced by the methods described herein retains high levels of specific infectivity (i.e., bioactivity). As described herein, the infectivity of the of the adeno-associated virus-protein conjugate is comparable to, or higher than the unconjugated wild-type adeno-associated virus.

[0031] An adeno-associated-protein conjugate produced by the methods described herein can comprise an AAV VPI capsid protein that is mutated at R585A and R588A to delete the AAV wild-type heparan sulfate receptor binding site. For the virus-protein conjugate produced by described methods, AzK is incorporated at VPI capsid protein site 454. As described herein, the VP2 capsid protein of AAV can also be genetically -modified to incorporate an engineered amino acid such as a cysteine or ncAA.

[0032] The virus-protein conjugates of the present invention can be detectably labelled for use in diagnostic methods, for example detecting the location, or estimating the size or volume of a tumor.

[0033] Also encompassed by the present invention are therapeutic or diagnostic compositions comprising an adeno-associated virus-protein conjugate described herein and further comprising a cargo molecule such as a therapeutic agent that can be delivered, for example, to a tumor in a mammal. Examples of such therapeutic agents are drugs such as organic or inorganic molecules / compounds; nucleic acids, or other protein and peptides. Further encompassed by the present invention are methods of diagnosis or treatment using the virus-protein conjugates comprising a cargo as described herein. A method of treating a disease or condition in a subject comprises administering to the subject the therapeutic composition of as described herein, wherein the composition comprises a gene construct encoding the adeno-associated virus-protein conjugate as a targeting agent and the therapeutic agent cargo in an amount sufficient / capable of decreasing or alleviating the disease or condition. Such conditions can be, for example, cancer or metabolic conditions.

[0034] Also encompassed by the present invention is a kit comprising an adeno- associated virus-protein of interest conjugate described herein. Such a kit can also comprise instructions for using the kit such as for administration of the virus-protein conjugate for certain diseases or conditions.

[0035] The above and other features of the invention including various novel details of construction and combinations of parts, and other advantages, will now be more particularly described with reference to the accompanying drawings and pointed out in the claims. It will be understood that the particular method and device embodying the invention are shown by way of illustration and not as a limitation of the invention. The principles and features of this invention may be employed in various and numerous embodiments without departing from the scope of the invention.BRIEF DESCRIPTION OF THE DRAWINGS

[0036] FIG.1 : A) Attempt to couple sfGFP using DBCO-PEG4-DBCO through SPAAC. B) New strategy to couple sfGFP by converting the slow-kinetic azide handle to extremely-fast-kinetic Tz / TCO handles, followed by protein coupling in 1 : 1 molar ratio. C) SDS page analysis of coupling product by DBCO-PEG4-DBCO, described in panel A, the asterisk indicates the protein coupling band. D) SDS page analysis of coupling product by the new strategy described in panel B, the asterisk indicates the protein coupling band. E) LC-MS analysis of sfGFP-151AzK 1, the intermediate adducts 4 &5, and the final coupling product 6, as described in panel B.

[0037] FIG. 2: A) Conjugation of AAV with nanobody: Azide handle at VP1 protein of the virus was converted to Tz by reacting with DBCO-sulfo-Tz; Azide handle at nanobody was converted to TCO by reacting with DBCO-PEG4-TCO; virus-nanobody conjugation was done in IpM nanobody at RT for 4 hours. B) 3-plasmid system to incorporate used to selectively produce AzK-containing AAV2 at VP1 protein. C) Production (Left) and infectivity (Right) of virus containing AzK at site 454 of VP1 protein in the presence or absence of 0.5 mM AzK in the media; Virus titer (packaged genome copies measured by qPCR) was normalized to the percentage of WT AAV2 titer; Infectivity was normalized to the percentage infectivity of WT AAV2, measured by the expression of an encoded EGFP reporter, upon infecting HEK293T cells at a constant MOI 50. D) SDS-PAGE analysis of nanobody conjugation at site 454 of VP1 protein. E) Infectivity of WT, unmodified and modified virus, measured by the percentage of positive GFP cells by flow cytometry, upon infecting SKBR3 cells at a constant MOI 125. F) Infectivity of WT, unmodified and modified virus, measured by the percentage of positive GFP cells by flow cytometry, upon infecting HEK293T cells at a constant MOI 50. G) Infectivity of AAV2-KO.T454AzK functionalized with nanobody in the presence of freeanti-HER2 nanobody, measured by the percentage of positive GFP cells by flow cytometry, upon infecting SBKBR3 cells at a constant MOI 500. Data given as the mean ± s.d. of n = 3 replicates.

[0038] FIG. 3: A) Optimization of site for retargeting: Left: A color-coded depiction of the distribution of sites targeted for AzK incorporation in the AAV2 capsid; Right: Infectivity of WT, unmodified and modified virus at various sites of VP1 protein with AntiHer2 -Nanobody, measured by the percentage of positive GFP cells by flow cytometry, upon infecting SKBR3 cells at a constant MOI 2500. B) Optimization of linker for retargeting: Left: Structure of DBCO-Tz / TCO bifunctional linkers used in this experiment; Right: Infectivity of WT and modified virus with various linker combination, measured by percentage of positive GFP cells by flow cytometry, upon infecting SKBR3 cells at a constant MOI 125. C) Optimization of stoichiometry for retargeting: Left: genetic elements to produce virus containing AzK at either everywhere or both VP1+VP2 of the capsid. Middle: SDS-PAGE analysis of virus-nanobody conjugation at VP1, VP1+VP2, and all VP1+VP2+VP3 of the capsid; Right: Infectivity of WT and modified virus with various stoichiometry, measured by the percentage of positive GFP cells by flow cytometry, upon infecting SKBR3 cells at a constant MOI 125. D) Left: genetic elements to produce virus with either loop insertion of nanobody to VP1 or N-terminus fusion to VP2 protein. Middle: SDS-PAGE analysis of functionalizing AAV-KO using chemical modification or genetic engineering. Right: Infectivity of AAV2-WT, chemically modified virus, genetically modified virus with nanobody, AAV2-KO, measured by the percentage of positive GFP cells by flow cytometry, upon infecting SKBR3 cells at a constant MOI 125 or HEK293T cells at a constant MOI 50. Data given as the mean ± s.d. of n = 3 replicates.

[0039] FIG. 4 A) Infectivity of AAV2-WT, unmodified and modified mutant virus with nanobody, measured by the percentage of positive GFP cells by flow cytometry, upon infecting BT474 cells at various MOI 125, 250, 500, 1000, 2500. Data given as the mean ± s.d. of n = 3 replicates. B) Schematic demonstrating experimental timeline of AAV2-WT, unmodified and modified mutant virus with nanobody dosing. Eight mice per group were intravenously injected with 1 .0 xlO11gc virus. In vivo imaging was done everywhere starting week #2, where infection peak was found. Mice were sacrificed 5 weeks post-injection. C) Transgene expression of AAV2-WT, unmodified and modified mutant virus with nanobody in whole body animal, measured by the total flux of luciferinduring the course of in vivo study (Left), and at the peak of infection (Right). D) Ventral images of mice treated with AAV2-WT, unmodified and modified mutant virus with nanobody at the peak of infection. E) Left: Transgene titering at target tumor (Right), and off-target liver (Left) at the end of the in vivo study, measured by genome copies per pg DNA sample by qPCR. Data given as the mean ± s.d. of n= 8 mice for WT, KO. VP 1 - 588AzK viruses and n=7 mice for KO.VPl-588Nb (one mouse found dead at day 12 with no detectable obvious cause of death).

[0040] FIG. 5: A) Attachment of full-length trastuzumab onto AAV. Azide handle at minor capsid protein of AAV was converted to Tz by reacting with DBCO-PEG12-Tz. Azide handle at light chain of antibody was converted to TCO by reacting with DBCO- PEG12-TCO. Virus-antibody conjugation was done in 0.5pM antibody at RT for 4 hours. B) SDS-PAGE analysis of full-length antibody conjugation at site 588 of VP1 protein. C) Infectivity of WT, unmodified and modified virus, measured by the percentage of positive GFP cells by flow cytometry, upon infecting SKBR3 cells at a constant MOI 250 (left) and upon infecting HEK293T cells (right) at a constant MOI 50. Data given as the mean ± s.d. of n = 3 replicates.

[0041] FIG. 6: The amino acid sequence of adeno-associated virus VP1 capsid protein (SEQ ID NO: 1).

[0042] FIG. 7: The amino acid sequence of adeno-associated virus VP2 capsid protein (SEQ ID NO:2).

[0043] FIG. 8: The amino acid sequence of adeno-associated virus VP3 capsid protein (SEQ ID NO:3).DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0044] The invention now will be described more fully hereinafter with reference to the accompanying drawings, in which illustrative embodiments of the invention are shown. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

[0045] As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items. Also, all conjunctions used are to be understood in themost inclusive sense possible. Thus, the word "or" should be understood as having the definition of a logical "or" rather than that of a logical "exclusive or" unless the context clearly necessitates otherwise. Further, the singular forms and the articles "a", "an" and "the" are intended to include the plural forms as well, unless expressly stated otherwise. It will be further understood that the terms: includes, comprises, including and / or comprising, when used in this specification, specify the presence of stated features, integers, steps, operations, elements, and / or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof. Further, it will be understood that when an element, including component or subsystem, is referred to and / or shown as being connected or coupled to another element, it can be directly connected or coupled to the other element or intervening elements may be present.

[0046] It will be understood that although terms such as “first” and “second” are used herein to describe various elements, these elements should not be limited by these terms. These terms are only used to distinguish one element from another element. Thus, an element discussed below could be termed a second element, and similarly, a second element may be termed a first element without departing from the teachings of the present invention.

[0047] Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein.

[0048] For an efficient transgene delivery, a high viral dose is required, and the viral load can increase in the liver and cause toxicity4. With the demand for more precise and more potent transduction, AAV capsids have been intensively engineered by various strategies. For example, directed evolution by error -prone PCR5,6, capsid shuffling7,8and synthetic library9,10of AAV have greatly enhanced AAV specificity toward tissue of interest. As a mammalian virus, the evolution of AAV often requires evolutions in animal models with an intrinsic slow pace of evolution, rendering the process expensive, timeconsuming, and laborious. Due to the nature of evolution, an optimal outcome is notguaranteed and the selection of a host species is not always translatable to humans as the final host1,11. Rational design by inserting a small retargeting peptide sequence into the capsid proteins has been tried12. However, small peptides generally do not exhibit high affinity toward the target for efficient virus-receptor binding. To incorporate larger proteins with strong receptor binding affinity, they need to be fused to the N terminus of VP2 proteins13. Since the N-terminus of VP2 is naturally buried inside the capsid, the protein fusion may be trapped inside the capsid and become nonfunctional.

[0049] Recently, efforts have been made to insert a nanobody into the loop of minor capsid proteins14, but this requires intensive optimization of linkers and the restriction of inserted proteins at both terminus is not necessarily optimal for binding activity. Although the aforementioned AAV engineering methods via genetic modifications can be done and yield successful retargeting, the number of sites that tolerate modifications is very limited. With the very intricate nature of the AAV capsid, those methods can potentially disrupt the capsid assembly, and genome packaging and, thus render viruses with compromised infectivity and hardly satisfy the demand in high gene transduction. Chemical modification of viruses, on the other hand, takes place at the protein level and allows viruses to package and assemble in the most endogenous condition, which can avoid the aforementioned problems caused by genetic engineering methods. For example, surface-exposed lysines, arginines, and tyrosines were used to attach a wide array of molecule of interest onto the AAV capsid15-17. However, this method totally lacks the control of stoichiometry and site of modifications and is limited to chemistry.

[0050] Alternatively, genetic code expansion has been used to create AAV vectors containing ncAAs for various applications including retargeting18’19, tracking and controlling AAV infection20’21, reducing AAV immunogenicity22’23, and directed evolution of biomolecules24’25. Previously, a retargeting platform was developed by changing the receptor binding of AAV2 capsid to a new target cell line18. That was done by charging the viral capsid with azido lysine (AzK), followed by chemical conjugation with DBCO- cGRDFC moiety. The functionalized AAV vectors were de-targeted from its natural receptor heparan sulfate while showing up to 80% WT infectivity toward cell target overexpressing av3 integrins. Recently, we further studied the retargeting profile of this system by optimizing both the site and stoichiometry of attaching targeting moieties22. By minimizing the number of AzK to selective capsid proteins for functionalization, theretargeting was done in a more controlled manner. It was observed, however, that a great number of cRGDs is needed for efficient retargeting, but the over-modification of the virus dramatically compromises the infectivity. This necessitates the need for retargeting scaffolds / moieties with a stronger binding affinity toward the target receptor. Kay et al. have reported the attachment of aptamers and folic acid to retarget AAV2 to different cancer cell lines27. However, the instability of aptamers did not result in good transduction in vivo. Furthermore, the limited number of available aptamers and their immunogenicity overall limits the scope of this approach.

[0051] Antibodies and antibody fragments, on the other hand, are greatly versatile, robust, non-immunogenic, and possess excellent binding affinity toward their receptors. Antibodies and antibody fragments have been intensively utilized as useful toolboxes for receptor-mediated retargeting. Attachment of antibodies against specific receptors onto the virus would efficiently drive the virus tropism to the target of interest. However, antibodyvirus conjugation is challenging due to the intrinsically low concentration of proteins and, thus slow reaction rate. Schmidt et al. described the use of an mMobA HUH tag and DNA linkers to conjugate AAV2 with full-length antibody28. Nevertheless, this method requires the insertion of a 21 kDa-bacteria-derived HUG tag onto the virus and the subsequent introduction of a DNA linker is complicated and raises concern about the immune response against DNA upon in vivo delivery. Moreover, the non-covalent nature of DNA tag -DNA may result in the loss of conjugation and render poorly infectious viruses toward target tissues.

[0052] As described herein, a new method to covalently conjugate antibodies and antibody fragments to AAV via genetic code expansion and bioorthogonal click chemistry has been developed. Importantly, the method of conjugation described herein does not compromise the biological activity / infectivity of the virus and allows / permits efficient cellular transduction. Also as described herein, the conjugates retain comparable, or greater infectivity activity as compared to the wild-type virus. Moreover, the protein retains its targeting activity to attach virus-protein conjugates efficiently and precisely to the targeted cell or tissue.

[0053] Development of a new method for protein-protein crosslinking.

[0054] A suitable chemistry for crosslinking virus and proteins is elucidated. First, the possibility of using bifunctional DBCO to crosslink two sfGFP molecules together wastested as proof of concept (FIG. 1 A). The proteins were ribosomally incorporated with AzK using PyRStR at site Y151, yielding sfGFP-151AzK 1. 1 was allowed to react with excess DBC0-PEG4-DBC0 in strain-promoted azide--alkyne cycloaddition manner (SPAAC) to fully drive the reaction to completion. The resulting adduct 2 with the remaining DBCO handle was allowed to react with sfGFP-Y151AzK 1 at 1 :1 ratio at an attempt to form the coupling product 3. Even though it was observed that the formation of the product as the formation of the coupling band with higher MW, the conversion remained inefficient after 24 hours, as analyzed by SDS page (FIG. 1C). However, it was reasoned that the intrinsic slow reaction rate of SPAAC would be problematic to conjugate virus with a protein and it was decided to move on with another strategy. Alternatively, inverse electron demand Diels Alder reaction (IEDDA) exhibits an ultrafast reaction rate, up to 10,000 M^s’1, and a strategy was developed to convert the Azide handle to either a Tetrazine (Tz) or a trans-Cyclooctene (TCO) which allows rapid Tz -TCO ligation (FIG. IB). sfGFP- Y151AzK 1 was reacted with an excess of bifunctional linker DBCO-sulfo-Tz or DBCO-Peg4-TCO to fully conjugate the Tz / TCO handles onto the proteins. Mixing of the resulting products 4 and 5 with 1 : 1 ratio allows rapid formation of GFP coupling product 6 within 10 minutes as confirmed by the disappearance of sfGFP bands and the appearance of a strong band at higher molecular weight in SDS-PAGE (FIG. ID) LC-MS analysis of the product 6 revealed a complete coupling of sfGFP (M+H=56675) and the minor band at SDS page was of the reduced azide to NH2 (M+H=27647).

[0055] Although Tz and TCO were ribosomally incorporated into proteins in mammalian cells, it was envisioned that it would be more beneficial to follow up the aforementioned strategy for the following reasons. First, Tz and TCO are greatly hydrophobic and relatively large in size and are not necessarily readily incorporated in intricate proteins. Indeed, AAV capsid is very intricate with 60 interlocked proteins and so far researchers have only been able to incorporate AzK and analogs to the virus capsid. Second, Tz and TCO are difficult to synthesize, rendering the production of proteins in cell culture more expensive. The amount of Tz and TCO needed for reacting with concentrated proteins would be significantly less, making this more reasonable for large-scale protein engineering. Third, post modification of Azide with user-design DBCO-probe would be versatile with many options of linker design, providing more flexibility and increased solubility of the protein conjugates.

[0056] Virus-antibody fragment conjugation allows selective transduction in vitro.

[0057] Next the ability to crosslink AAV to a protein of interest was tested. To have better control of stoichiometry of virus labeling to avoid overcrowding the capsid, AzK was selectively incorporated into minor capsid protein VP1 using a 3 -plasmid transient transfection system we previously developed (FIG. 2B)18. In brief, VP1 was uncoupled from the AAV2 genome by mutating the start codon to ATGto CTC and individually reexpressed in trans driven by a CMV promoter. A site of interest at VP1 was mutated to TAG that shall be suppressed with AzK by an MbPylRS and a cassette of evolved 4xPyOtR-TAG29. The virus containing AzK selectively at the most surface-exposed site 454 of VP1 protein, termed VPl-454AzK were made with comparable infectivity and titer as of WT virus (FIG. 2C).

[0058] The possibility of retargeting AAV to a cell line target by switching its natural receptor to a new receptor was explored. To delete the natural tropism of AAV2, the 2 key binding residues of AAV2 to its primary receptor heparan sulfate were mutated, R585A and R588A, yielding KO.VPl-AzK construct. AzK was selectively incorporated at site 454 of VP1 of the capsid with WT titer, but compromised infectivity (FIG. 2C). HER2 is a member of the epidermal growth factor family and is overexpressed in subsets of breast, ovarian, gastric, colorectal, pancreatic, and endometrial cancers. With the well-established knowledge of HER2 receptor and the availability of its corresponding antibody fragments, it was decided to retarget AAV2 to HER2 positive cell line using HER2 nanobody conjugation as retargeting scaffolds. HER2 nanobody (clone 5F7) was mutated with TAG at site 69 for the incorporation of AzK using an orthogonal A / mPylRS tRNA pair.KO.VPl-454AzK and 5F7-69-AzK were allowed to react with excess DBCO-sulfo-Tz and DBCO-PEG4-TCO, respectively to convert the Azide to either Tz or TCO for subsequent protein-virus conjugation (FIG. 2A). Upon mixing the virus-bearing Tz handles and nanobody -bearing TCO handle for 4 hours, the complete conjugation of VP1 protein to nanobody was observed, confirmed by the shifting of VP1 band to a higher molecular weight in SDS-PAGE (FIG. 2D). Next the retargeting efficiency of the mutant virus, modified virus and WT virus against a HER2 -positive cell line (FG. 2E) was tested. Upon constant titer infection of SKBR3 cells, AAV2 wild-type showed minimal infectivity, while KO.VPl-454AzK was found to be non-infectious due to the detrimental mutation atthe heparan sulfate binding domain. Encouragingly, the modified virus, termed KO.VP1- 454-Nb showed superior infectivity to WT (~8 times) without any optimization. By contrast, the modified virus maintained minimal infectivity toward HEK293T cells, which is around 7 times weaker than WT virus (FIG. 2F). It is noted that the conjugation of HER2 nanobody to the capsid slightly increased viral infectivity toward HEK293T cells due to their low expression level of HER2 receptors.

[0059] To confirm the new target tropism of modified AAV was caused by receptor switching, an inhibition assay was performed where SKBR3 cells were infected with constant MOI of nanobody-conjugated KO. AAV and different concentrations of free nanobody as inhibitors (FIG. 2G). As expected, the addition of free Nanobody inhibits the transduction of nanobody-conjugated AAV in a dose-dependent manner starting from 0.05ug / ml. This validated that the infectivity of nanobody conjugated virus was mediated by HER2 receptor and anti-Her2 antibody fragments.

[0060] Optimization: Precise control modification of site, linker length, and stoichiometry of AAV.

[0061] Prior studies suggested that the site of modification greatly influences the retargeting efficiency of AAV. Incorporation of AzK into three more surface-exposed sites Q264, T456, and R588 of VP1 protein was tested, followed by attachment of anti-HER2 nanobody as described above with site T454AzK. Upon infection of SKBR3 cells, successful retargeting with greater efficiency than WT (FIG. 3 A) was determined and significant de-targeting from HEK293 cells at all the tested sites. In the same line with attaching cRGD for retargeting, conjugation of nanobody at the second highest spike (site 588) is deemed to be the best site for retargeting with -10-25 times better than WT with low MOI and high MOI, respectively. This makes sense due to the fact that this is the natural key binding residue to WT AAV to its primary receptor. Next the optimal linker between AAV bearing Azide handle at the best tested site and nanobody for more efficient retargeting was probed. A combination of linkers with different lengths was used: KO.VPl-588AzK was allowed to react with either DBCO-sulfo-Tz or DBCO-PEG12-Tz; anti-HER2 Nanobody was allowed to react with either BDCO-PGE4-TCO or DBCO- PEG12-TCO (FIG. 3B). This combination yielded virus-nanobody conjugates with different linker structures. Even though there was no dramatic difference in retargeting efficiency, it was observed that the linker combinations with longer PEG lengths havesome positive effect (~1.5x better than the shortest linker combination) in retargeting, probably by dint of greater flexibility.

[0062] The question of how many nanobodies decorated on the virus capsid are optimal for retargeting was determined. Besides the construct to charge AzK at minor capsid VP1, AzK was incorporated to both VP1+VP2, or everywhere of the capsid protein, using previously described plasmid constructs (FIG. 3C, Left). The resulting virus containing 5, 10, or 60 azide handles was converted to tetrazine and subsequently functionalized with Nanobody-TCO. SDS page confirmed the shifting of all capsid proteins VP1, VP2, VP3 to higher molecular weight bands, confirming successful conjugation with nanobody (FIG. 3C, Middle). Whereas AAV with 5 and lOAzK showed nearly complete conjugation, virus with 60 AzK’ s indicated around 60% modification. Nanobody decoration caused steric hindrance on the virus capsid and subsequently prevented the conjugation of all capsid proteins. Upon infecting SKBR3 cells, a dramatic decrease was observed in the infectivity when more nanobody was conjugated at VP1+VP2 or everywhere of the capsid: KO.VPl-588-Nb~10x WT infectivity; KO.VP1,2- 588-Nb~2x WT infectivity; KO.588-Nb was non-infectious (FIG. 3C, Right). Surprisingly, this trend differs from previous stoichiometry optimization using cRGD for retargeting, which indicated an optimal number of ~12 retargeting scaffolds per capsid26. The data suggested that in the case of a strong binder like nanobody, there was no need for multiple retargeting scaffolds. Additionally, considering the steric effect caused by nanobodies to avoid over-modification, solely functionalizing VP1 is enough and optimal for retargeting.

[0063] Using genetic code expansion and bioorthogonal chemistry, modification of AAV can be performed with precise control over site, stoichiometry, and linker. Would such unprecedented control modification be advantageous over genetic fusion strategies? Furthering the work of Koch-Nolte14and Buchholz et al.13, either HER2 nanobody was inserted at the loop of the variable region IV of VP1 or fused HER2 Nanobody inserted to the N terminus of VP2, while the rest of the capsid proteins have R585,588A mutation for de-targeting from heparan sulfate receptor (FIG. 3D, Left). The resulting virus, termed KO.VPl-Loop-Nb and KO.VP2-N-term-Nb were analyzed by SDS-PAGE, showing successful fusion / insertion of nanobody to minor capsid protein of interest (FIG. 3D, Middle). They possessed appreciable re-targeting toward SKBR3 cells (~3xWT infectivity and ~WT infectivity respectively), while de-targeted virus (KO) showed only backgroundinfectivity (FIG. 3D, Right). By comparison, our modified virus using GCE showed the best retargeting efficiency while having lower off-target to HEK293T cells than Nanobody loop insertion at VP1 construct (FIG. 3D, Right). This is not surprising, given countless ways to control engineer AAV using GCE at site, stoichiometry, and linker for optimal infectivity. Even though it seems straightforward to genetically modify AAV, the restriction of VP2-N terminus fusion, IV loop insertion, and restrained degree of freedom of the fusion protein do not promise an optimal retargeting efficiency.

[0064] Virus-antibody fragment conjugation allows selective transduction in vivo

[0065] The possibility of using the modified virus optimized in SKBR3 cells to retarget different HER2-positive cell lines was tested. Even though the infectivity of the modified virus toward SKOV3 and BT474 cells is not as impressive as SKBR3 cells, it was possible to translate the modified virus optimized in SKBR3 cells to another HER2- positive cell line. Indeed, the nanobody conjugated virus KO.VPl-588-nb preferably transduced other HER2 positive cells with greater efficiency than WT (3 to 8 folds) with various MOI (125-2500) (FIG. 4A). It was rationalized that the weaker retargeting efficiency than that of SKBR3 cells to these new targets makes sense due to the lower expression level of HER2 receptors of the former.

[0066] To demonstrate the utility of AAV -bearing ncAAs for next-generation gene therapy, the viral transduction in vivo was tested. Three groups of mice (n=8, each group) were xenografted with 5.00 x 106HER2 positive cells / mouse, and tumor volume was expanded to 100 cm3for dosing. BT474 cells were chosen for this in vivo study due to the well-established protocol to form xenografts in mouse models. Same dose of WT, KO.VPl-588AzK and KO.VPl-588-Nb viruses bearing a firefly luciferase reporter gene were intravenously delivered to each group of mice. In vivo imaging was done every week starting from week #2 (FIG. 4D). Surprisingly, the modified KO.VPl-588-Nb exhibited impressive transgene expression which is ~85 times better than WT in whole animal imaging at the peak of infection (FIG. 4C). The luminescence signal was observed nowhere else, but perfectly overlays with where the tumor was xenografted, suggesting a high selectivity of the modified virus (FIG.4D). By contrary, WT virus and KO.VP1- 588AzK imaging showed luminescence signal scattering around the whole animal body with the majority at liver and heart, respectively. It was reasoned that the superior infectivity in vivo, by comparison to in vitro testing on BT474 cell culture was granted bythe circulation of blood in animal models, magnifying the transduction of the retargeted virus. An alternative explanation is the long flexible linker between the virus and the nanobody helps increase the half-life of the virus in the bloodstream and overall increase the viral transduction. A dramatic drop in luminescence signal was observed during the course of in vivo imaging due to the rapid expansion of the tumor, leading to the loss of transgene in this study. The animals were sacrificed at week#5, tumors and livers were harvested for transgene titering. Despite the dramatic dilution of transgene due to tumor expansion, remarkable transgene was observed in the animal group dosed with K0.VP1- 588-Nb, which is ~20 times higher than WT virus (FIG. 4E). It should be noted that although KO.VPl-588-AzK showed no infectivity in cell culture, the data presented here indicated its conceivable infectivity in animal testing30,31. As a notorious target of AAV2 WT, high transgene was observed in liver in mice dosed with WT virus, while double G— >A mutation at 585, 588 was sufficient to de-target the virus from liver ~16 times (FIG. 4F). Interestingly, attaching of Nb to the virus, continued to de-target the virus from liver ~3 more times and overall ~50 times lower than WT.

[0067] Attachment of full-length antibody enables selective AAV retargeting.

[0068] While nanobody is highly efficient for retargeting AAV to target of interest, the conjugation of full-length antibodies to the virus would be beneficial. For example, full-length antibodies are stronger binders than Antibody fragments, and the Fc domain of antibody is known to significantly increase the circulation time of AAV in the bloodstream. The possibility of crosslinking trastuzumab to AAV was tested and showed the re-targeting efficiency of the conjugate in SKBR3 cells. Virus was charged with AzK at site 588 of VP1, followed by reacting with DBCO-PEG12-Tz. AzK was incorporated into site 122 of the light chain of trastuzumab using Expi293 expression system, followed by reacting with DBCO-PEG12-TCO. The Tz-converted virus and TCO-converted antibody were mixed at RT for 4 hours to allow full conjugation of trastuzumab to VP1 protein, as confirmed by SDS page. Upon infecting SKBR3 cells, the modified virus showed significant retargeting efficiency, which is ~10 times greater than WT virus. Interestingly, the attachment of HER2 antibody to the AAV capsid itself had some effect on de-targeting the virus from normal cell lines without deleting heparan binding domain of the capsid.

[0069] As described herein, a new strategy to couple two proteins together by converting the slow kinetic azide group to highly reactive tetrazine / TCO for an extremelyfast electron demand Diels Alder reaction has been demonstrated. The aforementioned strategy is beneficial in the production of protein-containing azide which is more stable and relatively easy to incorporate into highly intricate proteins. It also reduces the cost of protein expression with the lower cost of azido lysine and the minimal amount of Tetrazine / TCO required to modify concentrated proteins. Using such a strategy, AAV was fully conjugated with antibody fragments with unprecedented control in site, stoichiometry, and linker structure. The optimized conjugate was found to have roughly 5 nanobodies attached to VP1 protein at site 588 and a combination of 24 PEG in the linker. The modified virus exhibited superior infectivity toward target cell lines overexpressing HER2 receptors compared to WT, while retaining minimal infectivity to HEK293T cells. The optimal conjugate by chemical engineering performed better in two tested genetic engineering constructs where nanobody was fused to either N-terminus of VP2 or loop inserted at VP1 protein. The total viral transduction of the modified virus was magnified to 85 times of WT in animal models where blood circulation plays a critical role. The observation in vivo imaging is aligned with the transgene titering data.

[0070] Despite the dramatic dilution of transgene expression at the end of the in vivo study due to tumor expansion, ~20 times higher AAV gene in the target tumor was observed with ~50 times de-target from liver. Importantly, while it is impossible to fuse a full-length antibody into the viral capsid, using GCE, it was possible to cross-link the two together with nearly 100% conversion. The antibody-conjugated virus showed great retargeting efficiency toward a Her2 overexpressing cell line. Thus, a novel strategy was developed to manipulate AAV with unprecedented control modification. The chemical- modified virus exhibited remarkable infectivity and selectivity in animal models and is a potential candidate for next-generation gene therapy.

[0071] Materials and Methods

[0072] Cell Culture. HEK293T cells, SKOV3 cells, Expi293 were obtained previously18,32. SKBR3 cells were a gift from Prof. Eranthie Weerapana, Boston College Chemistry, and BT-474 cells was a gift from Charles River Laboratory. All cell lines were cultured at 37°C and 5% CO2 in DMEM-high glucose (HyClone) supplemented with penicillin / streptomycin (HyClone, final concentration of 100 U / mL penicillin and 100 pg / mL streptomycin) and 10% fetal bovine serum (Corning). Expi293 cells were cultured at 37°C, 8% CO2, in Expi293™ Expression Medium (Gibco) supplemented with 0.5xantibiotic-antimycotic (Thermo Fisher) in shaken ventilated Erlenmeyer flasks at 125 rpm.

[0073] Cloning and Plasmids.

[0074] Transformation was done in ToplO cells using BioRad electroporator. DNA oligo synthesis and Sanger Sequencing were performed by Genewiz. Phusion polymerase was purchased from Thermo Scientific™, PrimeSTAR® Max DNA Polymerase was purchased from Takara, T4 DNA Ligase was purchased from Qiagen.

[0075] pET22b-T5-sfGFP-151TAG was obtained previously33. pET22b-T5-5F7- 69TAG was generated by QuickChange site-directed mutagenesis from pET22b-T5-5F7- 69TGA32using 5F7-69TAG-F and 5F7-69TAG-R primers. pcDNA3.1-Her2-Ab-LC- 122TAG was generated by overlap extension PCR on pcDNA3.1 -Her2-Ab32using pcDNA- LC-Spel-F, HerAb-LC-122TAG-R, HerAb-LC-122TAG-F, pcDNA-LC-Sbfl-R primers. The PCR product was digested and cloned into pcDNA3.1-Her2-Ab using Spel and Sbfl restriction sites.

[0076] pIDTSmart-MbPylRS-4xPyOtR-ITR-GFP was generated from original plasmid pIDTsmart-MbPylRS18. 4xPyOtR cassette was amplified by PrimeStar polymerase on pIDTsmart-4xPyOtR29using NheI-HTS25-F and Sbfl-HTS25-R primers. The PCR product was digested with restriction enzymes Nhel and Sbfl and cloned into pIDTsmart- MbPylRS using Spel and Sbfl restriction sites, yielding the intermediate plasmid pIDTSmart-MbPylRS-4xPyOtR. Next, ITR-EFGP was digested from the plasmid pIDTSmart-SxPyltR-ITR-GFP1with restriction enzymes Sbfl, and cloned into pIDTSmart- A7 / ?PylRS-4xPyOtR using Sbfl restriction site. ITR-FLUC was amplified by PrimeStar polymerase from pAAV.CMV.ffLuciferase.SV40 (Addgene) using FLUC-cargo-Sbfl-F and FLUC-cargo-Sbfl-R primers. The PCR product was digested and cloned into pIDTSmart-MbPylRS-4xPyOtR-ITR-GFP using Sbfl restriction site, yielding pIDTSmart- MbPylRS-4xPyOtR-ITR-FLUC.

[0077] pHelper, pIDTSmart-RC2-WT, pIDTSmart-RC2-AVPl-CMV-VPl, pIDTSmart-RC2-AVP12-CMV-VP12 clonings were obtained previously. To de-target AAV from heparan sulfate, two mutations R585A and R588A were made by QuickChange site-directed mutagenesis from pIDTSmart-RC2-WT using 585A / 588A-F, 585A / 588A-R primers, yielding pIDTsmart-RC2.KO. The resulting plasmid was used as a template to clone pIDTSmart-RC2-AVPl-CMV-VPl, pIDTSmart-RC2-AVP12-CMV-VP12 with R585A and R588A mutations at all VP1,2,3 as previously described26. For theincorporation of ncAA into different sites of VP1, overlap -extension PCR on pIDTSmart- RC2-AVP1-CMV-VP1 was done to introduce TAG codon to CMV-VP1 gene using Sbfl- CMV-F, Cap2-Bsu36I-R, and suitable overlap primers. The PCR products were digested and cloned into pIDTSmart-RC2-AVPl-CMV-VPl using Nhel, Bsu36I restriction sites. For the incorporation of ncAA into different sites of VP1+VP2, overlap-extension PCR on pIDTSmart-RC2-AVP2-CMV-VP2 was done to introduce TAG codon to CMV-VP2 gene using Sbfl-CMV-F, Cap2-Mlul-R, and suitable overlap primers.

[0078] pIDTSmart-RC2-AVPl-CMV-VPl -loop-Nb was generated by 2 steps overlapextension PCR, and cloned into pIDTSmart-RC2.KO-AVPl-CMV-VPl using Sbfl and Bsu36I restriction sites. The first overlap-extension PCR was done to fuse CMV-N terminus- VP 1 (codons 1-452) with anti-Her2 Nanobody (clone 5F7) gene, flanked by 5xGGGGS flexible linker using CMV-Sbfl-F, VPlhalf-GS-R, GS-5F7-F, 5F7-GA-Bsu-R primers. The second overlap-extension PCR was done to fuse CMV-N terminus-VPl-Nb with C terminus-VPl genes (codons 450-735) using CMV-Sbfl-F, VPl-2ndhalf-F, 5F7- overlapVP-R, Cap2-Bsu36I-R primers. pIDTSmart-RC2-AVP2-CMV-5F7-VP2 was generated by overlap-extension PCR to fuse anti-Her2 Nanobody to N terminus of VP2, flanked by IxGGGGS linker, using NheI-5F7-F, 5F7-VP2 overlap-F, 5F7-VP2 overlap-R, Cap2-Bsu36I-R primers. The PCR product was digested and cloned into pIDTSmart-RC2- AVP2-CMV-VP2 using Nhel and Bsu36I restriction sites.

[0079] Table of Primers used in this study:

[0080] Production of ncAA containing AAV.

[0081] AAV2 was produced by transfecting HEK293T cells with pHelper, pIDTsmart-A7APylR.S-4xPyOtR.-ITR.-GFP, and plasmid containing suitable AAV Rep-Cap genes in 1 : 1 : 1 molar ratio26. The DNAs were premixed in serum free media (DMEM) and PEI (sigma) was added (3.5 pL per ug DNA). The mixture was allowed to sit at RT for 15 minutes before adding dropwise to the cells, followed by the addition of AzK (Iris Biotech) to the final concentration of 1 mM. 57 pg total DNAs were used for a 15 cm dish and viruses were harvested 120 hours post transfection. Virus was extracted from cells by 2 cycles of snap freeze-thaw in dry ice-ethanol and 37C water bath. Cell lysate was combined with media and was mixed with 30% volume of 40% PEG 8000 (Fisher BioReagents) to precipitate the virus overnight at 4°C. On the next day, virus was spun down at 5,000xg for 30 minutes, then resuspended in 2 mL of salty PBS (300mM NaCl), supplemented with 2 pL universal nuclease and nutated at RT for 15 minutes. During that time, 250 pL slurry of AVB-agarose was packed in a column and equilibrated with lOx column volume of dPBS. Virus was loaded to the column and flowed down by gravity and then reloaded twice. The column was washed with 3 Ox column volume of dPBS. Virus was quickly eluted by 2 mL 0.1M Glycine pH 2.8 and neutralized with 200 pL IM Tris pH 8. Virus was concentrated and buffer-exchanged to AAV buffer (IxdPBS, 300 pM NaCl, 0.001% Pluronic F68) using ultracentrifugal device Amicon lOOkDa. Glycerol was addedto the final concentration of 10% and virus was titered by AAVpro® Titration Kit Ver.2 (Takara), followed the manufacturer's instructions. For animal study, the viruses were sterile filtered by passing through a 0.2um, 4mm filter. The content of endotoxic in the virus samples were assayed and found to be < 0.900 EU / ml using the ToxinSensor TM Chromogenic LAL Endotoxin Assay Kit (Genscript).

[0082] Protein expression

[0083] sfGFP-151-AzK33, AntiHer2 -Nanobody (Clone 5F7)-69-Az32, and full lengthTrastuzumab-LC-122-AzK34expression was done using the previously described methods.

[0084] For animal study, AntiHer2 -Nanobody was sterile filtered by passing through a 0.2 pm, 4mm filter. Endotoxin was removed from AntiHer2 -Nanobody sample by Pierce™ High Capacity Endotoxin Removal Spin Columns, Capacity=0.5 mL (Thermo Scientific), followed the manufacturer's instructions.

[0085] Protein-protein conjugation and LC-MS analysis

[0086] GFP coupling: lOOpM sfGFP-151AzK and 50 mM DBCO-PEG4-DBCO (Broadpharm) or DBCO-sulfo-Tz (Broadpharm) or DBCO-PEG4-TCO (Broadpharm) were diluted in 1% DMSO in DPBS (pH = 7.4) to a final concentration of 10 pM and 100 pM, respectively. Conjugations were done in 50 pL scale in 0.5 mL tubes by nutating the mixtures at 22°C for 12h. The modified proteins were buffer exchanged in DPBS using ultracentrifugal device 0.5mL lOkDa to remove excess DBCO probes. sfGFP containing DBCO and sfGFP-151-AzK concentration were adjusted to 10 uM and mixed together in 1 : 1 molar ratio. GFP coupling was done by nutating the mixture at RT for 16 hours. sfGFP containing TCO and Tz concentration were adjusted to lOpM and mixed together in 1 : 1 molar ratio. GFP coupling was done by nutating the mixture at RT and quenched by the addition of 50-fold excess DBCO-sulfo-Tz. LC-MS was done using Agilent Technologies, 1260 Infinity ESI-TOF, Phenomenex, Aeris™ 3.6 pm WIDEPORE XB-C8 column, LC Column 100 x 4.6 mm. Separation was performed with a flow rate of 0.2 mL / min, and with mobile phase of solvent A (water-MeCN-0.1% trifluoroacetic acid in 95:5:0.1 ratio) and solvent B (MeCN-water-0.1% trifluoroacetic acid in 95:5:0.1 ratio); 0-1 min 5% B, 1-8 min 99% B, 8-9 min 99% B to 1% B, 9-10 min 1% B to 5% B, 10-14 min 5% B. Deconvolution was done using Magtran software, and peak intensities for Azido-lysine containing proteins and their corresponding drug conjugated products were compared.

[0087] Nanobody-virus conjugation: 100 pM AntiHer2-Nb-69AzK and 50mM DBCO-PEG4-TCO or DBCO-PEG12-TCO (Broadpharm) were diluted in 1% DMSO in DPBS (pH = 7.4) to final concentration of 10 pM and 100 pM, respectively. Conjugations were done in 200 pL scale in 0.5 mL tubes by nutating the mixtures at 22°C for 16h. The modified proteins were buffer exchanged in DPBS using ultracentrifugal device 0.5 mL lOkDa to remove excess DBCO probes. 50 mM DBCO-sulfo-Tz or DBCO-PEG12-Tz (Broadpharm) were diluted in AzK-containing virus solutions to a final concentration of 100 pM. Reactions were done in 1.5 mL tubes by nutating the mixtures at 22°C for 16h, before complete buffer exchange into AAV buffer by ultracentrifugal device Amicon 100 kDa to remove excess DBCO probes. Virus containing Tz was retitered and nanobody containing TCO was added to the final concentration of 1 pM. Conjugation was done in 1.5 mL tubes by nutating the mixtures at 22°C for 4h.

[0088] F ull-length Antibody-virus conj ugation

[0089] 5 mg / mL AntiHer2-Ab-LC-122-AzK and 50mM DBCO-PEG12-TCO were diluted in 1% DMSO in DPBS (pH = 7.4) to final concentration of 1 mg / mL and 100 pM, respectively. Conjugations were done in 200 pL scale in 0.5 mL tubes by nutating the mixtures at 22°C for 16h. The modified proteins were buffer exchanged in DPBS using ultracentrifugal device 0.5 mL 50 kDa to remove excess DBCO probes. 50 mM DBCO- PEG12-Tz was diluted in AzK-containing virus solutions to a final concentration of 100 pM. Reactions were done in 0.5 mL tubes by nutating the mixtures at 22°C for 16h, before complete buffer exchange into AAV buffer by ultracentrifugal device Amicon 100 kDa to remove excess DBCO probes. Virus containing Tz was retitered and Antibody containing TCO was added to the final concentration of 0.5 pM. Conjugation was done in 0.5 mL tubes by nutating the mixtures at 22°C for 4h.

[0090] SDS Page

[0091] Approximately 5 pg of sfGFP and 1010genome copies of viruses were loaded per lane. The samples were heated in SDS-loading buffer for 1 min, then analyzed with 10% SDS-PAGE gel. sfGFP were stained with Commasie brilliant Blue and imaged on the ChemiDoc MP (BioRad) under Commassie blue setting. Proteins were stained with SYPRO™ Orange Protein Stain (Thermo Fisher Scientific), followed the manufacturer's instructions, and imaged with Dylight 540.

[0092] Assaying the infectivity of AAV2 in vitro and flow cytometry.

[0093] Infectivity in HEK293T, and SKOV3 cells was assayed as previously described18. For SKBR3 cells, 2.5 xlO6cells (counted by Bio-Rad TC20™ Automated Cell Counter) were seeded per 24-well plate 3 Oh prior to infection. For BT474 cells, 5.0xl06cells were seeded per 24-well plate 24 hours prior to infection. When cells had reached the desired confluency, viruses were added to each well in a constant MOI, along with 5 mM sodium butyrate (Sigma-Aldrich) to enhance the expression of AAV2-encoded transgenes. 48 h post-infection, media was removed and 200 pL RT DPBS was added per well. Infectivity was visualized by EGFP expression using a Zeiss Axio Observer fluorescence microscope with an XCite Series 120Q light source and Zeiss filter 44 (excitation 475 / 40nm, beamsplitter 500nm, emission 530 / 50nm). Cells were harvested by 5 incubation in 100 pL warm 0.25% trypsin-EDTA at 37°C, followed by quenching with 200 pL of cold DMEM supplemented with 10% FBS. Cells were resuspended and pelleted in 2 mL eppi tubes by centrifugation at 2,500 xg for five minutes at 4°C. The supernatant was discarded and cells were gently resuspended in 200 pL of cold PBS and passed through a 35 pm strainer cap of a 5 mL tube (Falcon). Flow cytometry was performed on a BD Accuri C6 Plus flow cytometer (BD Biosciences) using the FITC and PerCP settings (excitation wavelength: 488 nm, standard filter: 533 / 30, 670LP, respectively). Data were processed using FlowJo, version 10.8.1.

[0094] Animal studies, in vivo imaging, and transgene titering.

[0095] Animals were prepared and in vivo imaging was performed by Charles River Laboratories. 40 female mice (8 weeks old) were xenografted with 5.0 xlO6BT-474 cells. Tumors were allowed to expand and 8 mice were randomly pooled such that the average tumor per group volume is 100mm3. LOxlO11gc each of WT, KO.VPl-588-AzK, and KO. VPl-588-Nb cargoing the firefly luciferase reporter was intravenously infected to the tail of the animals. Starting on day 14 after AAV injection, luminescence was measured weekly using the IVIS Lumina III imaging system. Animals were sacrificed at day 70 and tumors, livers were collected and stored in RNA later. Whole mouse livers and tumors were ground and homogenized in a BeadbugTM3 microtube homogenizer, 115V (Benchmark Scientific) using prefilled 2.0 mL tubes with impact zirconium Beads (Benchmark Scientific). Total DNAs were isolated from about 25 mg sample using DNeasy Blood & Tissue Kit (Qiagen), following the manufacturer's instructions. DNAs were ethanol precipitated for an hour and resuspended in milliQ water. AAV transgene wastitered by AAVpro® Titration Kit Ver.2 (Takara), following the manufacturer's instructions.

[0096] Plasmid maps

[0097] pIDTsmart-7W6PylRS-4xPyOtR-ITR-GFP (SEQ ID NO:31)

[0098] Annotation: AAV2 ITR, GFP, PyOtR, A / APylRS

[0099] cccgtgtaaaacgacggccagtttatctagtcagcttgattctagctgatcgtggaccggaaggtgagccagtga gttgattgcagtccagttacgctggagtctgaggctcgtcctgaatgatatgcgaccgccggagggttgcgtttgagacgggcgac agatccagtcgcgctgctctcgtcgatccgctagggcggccgcaaatacctgcaggcagctgcgcgctcgctcgctcactgagg ccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtgg ccaactccatcactaggggttcctgcggccgctcggtccgcacgtggttacctacaaaatcagaaggacagggaagggagcagt ggttcacgcctgtaatcccagcaatttgggaggccaaggtgggtagatcacctgagattaggagttggagaccagcctggccaat atggtgaaaccccgtctctaccaaaaaaacaaaaattagctgagcctggtcatgcatgcctggaatcccaacaactcgggaggctg aggcaggagaatcgcttgaacccaggaggcggagattgcagtgagccaagattgtgccactgcactccagcttggttcccaatag accccgcaggccctacaggttgtcttcccaacttgccccttgctccataccacccccctccaccccataatattatagaaggacacct agtcagacaaaatgatgcaacttaattttattaggacaaggctggtgggcactggagtggcaacttccagggccaggagaggcact ggggaggggtcacagggatgccacccgtagatctctcgagcagcgctgctcgaggcaagcttacttgagctcgagatctgagta cttgtacagctcgtccatgccgagagtgatcccggcggcggtcacgaactccagcaggaccatgtgatcgcgcttctcgttggggt ctttgctcagggcggactgggtgctcaggtagtggttgtcgggcagcagcacggggccgtcgccgatgggggtgttctgctggta gtggtcggcgagctgcacgctgccgtcctcgatgttgtggcggatcttgaagttcaccttgatgccgttcttctgcttgtcggccatga tatagacgttgtggctgttgtagttgtactccagcttgtgccccaggatgttgccgtcctccttgaagtcgatgcccttcagctcgatgc ggttcaccagggtgtcgccctcgaacttcacctcggcgcgggtcttgtagttgccgtcgtccttgaagaagatggtgcgctcctgga cgtagccttcgggcatggcggacttgaagaagtcgtgctgcttcatgtggtcggggtagcggctgaagcactgcacgccgtaggt cagggtggtcacgagggtgggccagggcacgggcagcttgccggtggtgcagatgaacttcagggtcagcttgccgtaggtgg catcgccctcgccctcgccggacacgctgaacttgtggccgtttacgtcgccgtccagctcgaccaggatgggcaccaccccggt gaacagctcctcgcccttgctcaccattcagaattcaatcgatgttcgaatcccaattctttgccaaagtgatgggccagcacacaga ccagcacgttgcccaggagctgtgggaggaagataagaggtatgaacatgattagcaaaagggcctagcttggactcagaataat ccagccttatcccaaccataaaataaaagcagaatggtagctggattgtagctgctattagcaatatgaaacctcttacatcagttaca atttatatgcagaaatatttatatgcagaaatattgctattgccttaacccagaaattatcactgttattctttagaatggtgcaaagaggc atgatacattgtatcattattgccctgaaagaaagagattagggaaagtattagaaataagataaacaaaaaagtatattaaaagaag aaagcattttttgtgggcctatagactctataggcggtacttacgtcactcttggcacggggaatccgcgttccaatgcaccgttcccg gccgggattcgaatccgcggaggctggatcggtcccggtgtcttctatggaggtcaaaacagcgtggatggcgtctccaggcgat ctgacggttcactaaacgagctctgcttatatagacctcccaccgtacacgcctaccgcccatttgcgtcaatggggcggagttgttacgacattttggaaagtcccgttgattttggtgcaaaacaaactcccattgacgtcaatggggtggagacttggaaatccccgtgagtc aaaccgctatccacgcccattgatgtactgccaaaaccgcatcaccatggtaatagcgatgactaatacgtagatgtactgccaagt aggaaagtcccataaggtcatgtactgggcataatgccaggcgggccatttaccgtcattgacgtcaatagggggcgtacttggca tatgatacacttgatgtactgccaagtgggcagtttaccgtaaatactccacccattgacgtcaatggaaagtccctattggcgttacta tgggaacatacgtcattattgacgtcaatgggcgggggtcgttgggcggtcagccaggcgggccatttaccgtaagttatgtaacg cggaactccatatatgggctatgaactaatgaccccgtaattgattactattaataactagacgcgtgcggccgcaggaacccctagt gatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgc ccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcaggctcgatccgctcgcacccctaggggtacctcgggcagg aagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacac aaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatat gcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgggcggctgatcatgtagatcga acggactctaaatccgttcagccgggttagattcccgggctgcccgttttttgctaggggtacctcgggcaggaagagggcctattt cccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtac aaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaactt gaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgggcggctgatcatgtagatcgaacggactctaaat ccgttcagccgggttagattcccgggctgcccgttttttgctaggggtacctcgggcaggaagagggcctatttcccatgattccttc atatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacg tagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatt tcttggctttatatatcttgtggaaaggacgaaacaccgggcggctgatcatgtagatcgaacggactctaaatccgttcagccgggt tagattcccgggctgcccgttttttgctaggggtacctcgggcaggaagagggcctatttcccatgattccttcatatttgcatatacga tacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataattt cttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatc ttgtggaaaggacgaaacaccgggcggctgatcatgtagatcgaacggactctaaatccgttcagccgggttagattcccgggct gcccgttttttgctagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggta aatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaataggga ctttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccct attgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgt attagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtc tccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgac gcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaacccactgcttactggcttat cgaaattaatacgactcactatagggagacccaagctggctagcgccaccatggataaaaaaccattagatgttttaatatctgcga ccgggctctggatgtccaggactggcacgctccacaaaatcaagcaccatgaggtctcaagaagtaaaatatacattgaaatggc gtgtggagaccatcttgttgtgaataattccaggagttgtagaacagccagagcattcagacatcataagtacagaaaaacctgcaaacgatgtagggtttcggacgaggatatcaataattttctcacaagatcaaccgaaagcaaaaacagtgtgaaagttagggtagtttct gctccaaaggtcaaaaaagctatgccgaaatcagtttcaagggctccgaagcctctggaaaattctgtttctgcaaaggcatcaacg aacacatccagatctgtaccttcgcctgcaaaatcaactccaaattcgtctgttcccgcatcggctcctgctccttcacttacaagaag ccagcttgatagggttgaggctctcttaagtccagaggataaaatttctctaaatatggcaaagcctttcagggaacttgagcctgaa cttgtgacaagaagaaaaaacgattttcagcggctctataccaatgatagagaagactacctcggtaaactcgaacgtgatattacg aaatttttcgtagaccggggttttctggagataaagtctcctatccttattccggcggaatacgtggagagaatgggtattaataatgat actgaactttcaaaacagatcttccgggtggataaaaatctctgcttgaggccaatgcttgccccgactctttacaactatctgcgaaa actcgataggattttaccaggcccaataaaaattttcgaagtcggaccttgttaccggaaagagtctgacggcaaagagcacctgga agaatttactatggtgaacttctgtcagatgggttcgggatgtactcgggaaaatcttgaagctctcatcaaagagtttctggactatct ggaaatcgacttcgaaatcgtaggagattcctgtatggtctttggggatactcttgatataatgcacggggacctggagctttcttcgg cagtcgtcgggccagtttctcttgatagagaatggggtattgacaaaccatggataggtgcaggttttggtcttgaacgcttgctcaa ggttatgcacggctttaaaaacattaagagggcatcaaggtccgaatcttactataatgggatttcaaccaatctgtaagaattcaacg cgttaagtcgactttaactcgagtctagagggcccgtttaaacccgctgatcagcctcgactgtgccttctagttgccagccatctgtt gtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgt ctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgct ggggatgcggtgggctctatggcttctgaggcggaaagaaccctaggggtgcgagcggatcgagcagtgtcgatcactactgga ccgcgagctgtgctgcgacccgtgatcttacggcattatacgtatgatcggtccacgatcagctagattatctagtcagcttgatgtca tagctgtttcctgaggctcaatactgaccatttaaatcatacctgacctccatagcagaaagtcaaaagcctccgaccggaggcttttg acttgatcggcacgtaagaggttccaactttcaccataatgaaataagatcactaccgggcgtattttttgagttatcgagattttcagg agctaaggaagctaaaatgagccatattcaacgggaaacgtcttgcttgaagccgcgattaaattccaacatggatgctgatttatat gggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgattgtatgggaagcccgatgcgccagagttgttt ctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcaggctaaactggctgacggaatttatgcctcttccg accatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatcccagggaaaacagcattccaggtattagaag aatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaac ggcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttggtgcgagtgattttgatgacgagcgtaatg gctggcctgttgaacaagtctggaaagaaatgcataaactcttgccattctcaccggattcagtcgtcactcatggtgatttctcacttg ataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatc ctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgca gtttcacttgatgctcgatgagtttttctaatgaggacctaaatgtaatcacctggctcaccttcgggtgggcctttctgcgttgctggcg tttttccataggctccgcccccctgacgagcatcacaaaaatcgatgctcaagtcagaggtggcgaaacccgacaggactataaag ataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctccctt cgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacg aaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggcta cactagaagaacagtatttggtatctgcgctctgctgaagccagttacctcggaaaaagagttggtagctcttgatccggcaaacaa accaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgattttcta ccgaagaaaggccca

[0100] pIDTsmart-RC2.KO-AVPl-CMV-VPl (SEQ ID NO:32)

[0101] Annotation: Rep2, Cap2AVPl, VP1

[0102] cccgtgtaaaacgacggccagtttatctagtcagcttgattctagctgatcgtggaccggaaggtgagccagtga gttgattgcagtccagttacgctggagtctgaggctcgtcctgaatgatatgcgaccgccggagggttgcgtttgagacgggcgac agatccagtcgcgctgctctcgtcgatccgctagggcggccgctctagaactagtggatcccccggaagatcagaagttcctattc cgaagttcctattctctagaaagtataggaacttctgatctgcgcagccgccatgccggggttttacgagattgtgattaaggtcccca gcgaccttgacgagcatctgcccggcatttctgacagctttgtgaactgggtggccgagaaggaatgggagttgccgccagattct gacatggatctgaatctgattgagcaggcacccctgaccgtggccgagaagctgcagcgcgactttctgacggaatggcgccgtg tgagtaaggccccggaggcccttttctttgtgcaatttgagaagggagagagctacttccacatgcacgtgctcgtggaaaccacc ggggtgaaatccatggttttgggacgtttcctgagtcagattcgcgaaaaactgattcagagaatttaccgcgggatcgagccgact ttgccaaactggttcgcggtcacaaagaccagaaatggcgccggaggcgggaacaaggtggtggatgagtgctacatccccaat tacttgctccccaaaacccagcctgagctccagtgggcgtggactaatatggaacagtatttaagcgcctgtttgaatctcacggag cgtaaacggttggtggcgcagcatctgacgcacgtgtcgcagacgcaggagcagaacaaagagaatcagaatcccaattctgat gcgccggtgatcagatcaaaaacttcagccaggtacatggagctggtcgggtggctcgtggacaaggggattacctcggagaag cagtggatccaggaggaccaggcctcatacatctccttcaatgcggcctccaactcgcggtcccaaatcaaggctgccttggacaa tgcgggaaagattatgagcctgactaaaaccgcccccgactacctggtgggccagcagcccgtggaggacatttccagcaatcg gatttataaaattttggaactaaacgggtacgatccccaatatgcggcttccgtctttctgggatgggccacgaaaaagttcggcaag aggaacaccatctggctgtttgggcctgcaactaccgggaagaccaacatcgcggaggccatagcccacactgtgcccttctacg ggtgcgtaaactggaccaatgagaactttcccttcaacgactgtgtcgacaagatggtgatctggtgggaggaggggaagatgac cgccaaggtcgtggagtcggccaaagccattctcggaggaagcaaggtgcgcgtggaccagaaatgcaagtcctcggcccaga tagacccgactcccgtgatcgtcacctccaacaccaacatgtgcgccgtgattgacgggaactcaacgaccttcgaacaccagca gccgttgcaagaccggatgttcaaatttgaactcacccgccgtctggatcatgactttgggaaggtcaccaagcaggaagtcaaag actttttccggtgggcaaaggatcacgtggttgaggtggagcatgaattctacgtcaaaaagggtggagccaagaaaagacccgc ccccagtgacgcagatataagtgagcccaaacgggtgcgcgagtcagttgcgcagccatcgacgtcagacgcggaagcttcgat caactacgcagacaggtaccaaaacaaatgttctcgtcacgtgggcatgaatctgatgctgtttccctgcagacaatgcgagagaat gaatcagaattcaaatatctgcttcactcacggacagaaagactgtttagagtgctttcccgtgtcagaatctcaacccgtttctgtcgt caaaaaggcgtatcagaaactgtgctacattcatcatatcatgggaaaggtgccagacgcttgcactgcctgcgatctggtcaatgt ggatttggatgactgcatctttgaacaataaatgatttaaatcaggtctcgctgccgatggttatcttccagattggctcgaggacactctctctgaaggaataagacagtggtggaagctcaaacctggcccaccaccaccaaagcccgcagagcggcataaggacgacagc aggggtcttgtgcttcctgggtacaagtacctcggacccttcaacggactcgacaagggagagccggtcaacgaggcagacgcc gcggccctcgagcacgacaaagcctacgaccggcagctcgacagcggagacaacccgtacctcaagtacaaccacgccgacg cggagtttcaggagcgccttaaagaagatacgtcttttgggggcaacctcggacgagcagtcttccaggcgaaaaagagggttctt gaacctctgggcctggttgaggaacctgttaagacggctccgggaaaaaagaggccggtagagcactctcctgtggagccagac tcctcctcgggaaccggaaaggcgggccagcagcctgcaagaaaaagattgaattttggtcagactggagacgcagactcagta cctgacccccagcctctcggacagccaccagcagccccctctggtctgggaactaatacgatggctacaggcagtggcgcacca atggcagacaataacgagggcgccgacggagtgggtaattcctcgggaaattggcattgcgattccacatggatgggcgacaga gtcatcaccaccagcacccgaacctgggccctgcccacctacaacaaccacctctacaaacaaatttccagccaatcaggagcct cgaacgacaatcactactttggctacagcaccccttgggggtattttgacttcaacagattccactgccacttttcaccacgtgactgg caaagactcatcaacaacaactggggattccgacccaagagactcaacttcaagctctttaacattcaagtcaaagaggtcacgca gaatgacggtacgacgacgattgccaataaccttaccagcacggttcaggtgtttactgactcggagtaccagctcccgtacgtcct cggctcggcgcatcaaggatgcctcccgccgttcccagcagacgtcttcatggtgccacagtatggatacctcaccctgaacaac gggagtcaggcagtaggacgctcttcattttactgcctggagtactttccttctcagatgctgcgtaccggaaacaactttaccttcag ctacacttttgaggacgttcctttccacagcagctacgctcacagccagagtctggaccgtctcatgaatcctctcatcgaccagtac ctgtattacttgagcagaacaaacactccaagtggaaccaccacgcagtcaaggcttcagttttctcaggccggagcgagtgacatt cgggaccagtctaggaactggcttcctggaccctgttaccgccagcagcgagtatcaaagacatctgcggataacaacaacagtg aatactcgtggactggagctaccaagtaccacctcaatggcagagactctctggtgaatccgggcccggccatggcaagccacaa ggacgatgaagaaaagttttttcctcagagcggggttctcatctttgggaagcaaggctcagagaaaacaaatgtggacattgaaaa ggtcatgattacagacgaagaggaaatcaggacaaccaatcccgtggctacggagcagtatggttctgtatctaccaacctccagg ccggcaacgcccaagcagctaccgcagatgtcaacacacaaggcgttcttccaggcatggtctggcaggacagagatgtgtacc ttcaggggcccatctgggcaaagattccacacacggacggacattttcacccctctcccctcatgggtggattcggacttaaacacc ctcctccacagattctcatcaagaacaccccggtacctgcgaatccttcgaccaccttcagtgcggcaaagtttgcttccttcatcaca cagtactccacgggacaggtcagcgtggagatcgagtgggagctgcagaaggaaaacagcaaacgctggaatcccgaaattca gtacacttccaactacaacaagtctgttaatgtggactttactgtggacactaatggcgtgtattcagagcctcgccccattggcacca gatacctgactcgtaatctgtaattgcttgttaatcaataaaccgtttaattcgtttcagttgaactttggtctctgcgtatttctttcttatcta gtttccatggctacgtagataagtagcatggcgggttaatcattaactacagcccgggcgtttaaacagcgggcggaggggtgga gtcgtgacgtgaattacgtcatagggttagggaggtcctgtattagaggtcacgtgagtgttttgcgacattttgcgacaccatgtggt ctcgctgggggggggggcccgagtgagcacgcagggtctccattttgaagcgggaggtttgaacgagcgctggcgcgctcact ggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctg gcgtaatagcgaagaggcccgcaccgatcgcccttcccatgcatcggccgcaaatacctgcaggatccgttttgcgctgcttcgcg atgtacgggccagatatacgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatat ggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggactatttacggtaaactgcccacttggcagtacatcaa gtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatggg actttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagc ggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaa tgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaac tagagaacccactgcttactggcttatcgaaattaatacgactcactatagggagacccaagctggctagcatggctgccgatggtt atcttccagattggctcgaggacactctctctgaaggaataagacagtggtggaagctcaaacctggcccaccaccaccaaagcc cgcagagcggcataaggacgacagcaggggtcttgtgcttcctgggtacaagtacctcggacccttcaacggactcgacaaggg agagccggtcaacgaggcagacgccgcggccctcgagcacgacaaagcctacgaccggcagctcgacagcggagacaacc cgtacctcaagtacaaccacgccgacgcggagtttcaggagcgccttaaagaagatacgtcttttgggggcaacctcggacgagc agtcttccaggcgaaaaagagggttcttgaacctctgggcctggttgaggaacctgttaagaccgctccgggaaaaaagaggccg gtagagcactctcctgtggagccagactcctcctcgggaaccggaaaggcgggccagcagcctgcaagaaaaagattgaattttg gtcagactggagacgcagactcagtacctgacccccagcctctcggacagccaccagcagccccctctggtctcggaactaatac cctcgctacaggcagtggcgcaccactcgcagacaataacgagggcgccgacggagtgggtaattcctcgggaaattggcattg cgattccacatggctcggcgacagagtcatcaccaccagcacccgaacctgggccctgcccacctacaacaaccacctctacaa acaaatttccagccaatcaggagcctcgaacgacaatcactactttggctacagcaccccttgggggtattttgacttcaacagattc cactgccacttttcaccacgtgactggcaaagactcatcaacaacaactggggattccgacccaagagactcaacttcaagctcttt aacattcaagtcaaagaggtcacgcagaatgacggtacgacgacgattgccaataaccttaccagcacggttcaggtgtttactga ctcggagtaccagctcccgtacgtcctcggctcggcgcatcaaggatgcctcccgccgttcccagcagacgtcttcatggtgccac agtatggatacctcaccctgaacaacgggagtcaggcagtaggacgctcttcattttactgcctggagtactttccttctcagatgctg cgtaccggaaacaactttaccttcagctacacttttgaggacgttcctttccacagcagctacgctcacagccagagtctggaccgtc tcatgaatcctctcatcgaccagtacctgtattacttgagcagaacaaacactccaagtggaaccaccacgcagtcaaggcttcagtt ttctcaggccggagcgagtgacattcgggaccagtctaggaactggcttcctggaccctgttaccgccagcagcgagtatcaaag acatctgcggataacaacaacagtgaatactcgtggactggagctaccaagtaccacctcaatggcagagactctctggtgaatcc gggcccggccatggcaagccacaaggacgatgaagaaaagttttttcctcagagcggggttctcatctttgggaagcaaggctca gagaaaacaaatgtggacattgaaaaggtcatgattacagacgaagaggaaatcaggacaaccaatcccgtggctacggagcag tatggttctgtatctaccaacctccaggccggcaacgcccaagcagctaccgcagatgtcaacacacaaggcgttcttccaggcat ggtctggcaggacagagatgtgtaccttcaggggcccatctgggcaaagattccacacacggacggacattttcacccctctcccc tcatgggtggattcggacttaaacaccctcctccacagattctcatcaagaacaccccggtacctgcgaatccttcgaccaccttcag tgcggcaaagtttgcttccttcatcacacagtactccacgggacaggtcagcgtggagatcgagtgggagctgcagaaggaaaac agcaaacgctggaatcccgaaattcagtacacttccaactacaacaagtctgttaatgtggactttactgtggacactaatggcgtgt attcagagcctcgccccattggcaccagatacctgactcgtaatctgtaattgcttgttaatcaataaaccgtttaattcgtttcagttga actttggtctctgcgtatttctttcttatctagtttccatggctacgtagataagtagcatggcgggttaatcattaactacagccctaggggtgcgagcggatcgagcagtgtcgatcactactggaccgcgagctgtgctgcgacccgtgatcttacggcattatacgtatgatcg gtccacgatcagctagattatctagtcagcttgatgtcatagctgtttcctgaggctcaatactgaccatttaaatcatacctgacctcca tagcagaaagtcaaaagcctccgaccggaggcttttgacttgatcggcacgtaagaggttccaactttcaccataatgaaataagat cactaccgggcgtattttttgagttatcgagattttcaggagctaaggaagctaaaatgagccatattcaacgggaaacgtcttgcttg aagccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatct atcgattgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatgg tcaggctaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactg cgatcccagggaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcg ccggttgcattcgattcctgtttgtaattgtccttttaacggcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggt ttggttggtgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaactcttgccattctc accggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacga gtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttca aaaatatggtattgataatcctgatatgaataaattgcagtttcacttgatgctcgatgagtttttctaatgaggacctaaatgtaatcacc tggctcaccttcgggtgggcctttctgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgatgctc aagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccga ccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcg gtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtctt gagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggt gctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttacct cggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcg cagaaaaaaaggatctcaagaagatcctttgattttctaccgaagaaaggccca

[0103] pIDTsmart-RC2.KO-AVP2-CMV-VP2-N-term-Nb (SEQ ID NO:33)

[0104] Annotation: Rep2, Cap2AVP2, AntiHer2-Nb, VP2

[0105] cccgtgtaaaacgacggccagtttatctagtcagcttgattctagctgatcgtggaccggaaggtgagccagtga gttgattgcagtccagttacgctggagtctgaggctcgtcctgaatgatatgcgaccgccggagggttgcgtttgagacgggcgac agatccagtcgcgctgctctcgtcgatccgctagggcggccgctctagaactagtggatcccccggaagatcagaagttcctattc cgaagttcctattctctagaaagtataggaacttctgatctgcgcagccgccatgccggggttttacgagattgtgattaaggtcccca gcgaccttgacgagcatctgcccggcatttctgacagctttgtgaactgggtggccgagaaggaatgggagttgccgccagattct gacatggatctgaatctgattgagcaggcacccctgaccgtggccgagaagctgcagcgcgactttctgacggaatggcgccgtg tgagtaaggccccggaggcccttttctttgtgcaatttgagaagggagagagctacttccacatgcacgtgctcgtggaaaccacc ggggtgaaatccatggttttgggacgtttcctgagtcagattcgcgaaaaactgattcagagaatttaccgcgggatcgagccgact ttgccaaactggttcgcggtcacaaagaccagaaatggcgccggaggcgggaacaaggtggtggatgagtgctacatccccaattacttgctccccaaaacccagcctgagctccagtgggcgtggactaatatggaacagtatttaagcgcctgtttgaatctcacggag cgtaaacggttggtggcgcagcatctgacgcacgtgtcgcagacgcaggagcagaacaaagagaatcagaatcccaattctgat gcgccggtgatcagatcaaaaacttcagccaggtacatggagctggtcgggtggctcgtggacaaggggattacctcggagaag cagtggatccaggaggaccaggcctcatacatctccttcaatgcggcctccaactcgcggtcccaaatcaaggctgccttggacaa tgcgggaaagattatgagcctgactaaaaccgcccccgactacctggtgggccagcagcccgtggaggacatttccagcaatcg gatttataaaattttggaactaaacgggtacgatccccaatatgcggcttccgtctttctgggatgggccacgaaaaagttcggcaag aggaacaccatctggctgtttgggcctgcaactaccgggaagaccaacatcgcggaggccatagcccacactgtgcccttctacg ggtgcgtaaactggaccaatgagaactttcccttcaacgactgtgtcgacaagatggtgatctggtgggaggaggggaagatgac cgccaaggtcgtggagtcggccaaagccattctcggaggaagcaaggtgcgcgtggaccagaaatgcaagtcctcggcccaga tagacccgactcccgtgatcgtcacctccaacaccaacatgtgcgccgtgattgacgggaactcaacgaccttcgaacaccagca gccgttgcaagaccggatgttcaaatttgaactcacccgccgtctggatcatgactttgggaaggtcaccaagcaggaagtcaaag actttttccggtgggcaaaggatcacgtggttgaggtggagcatgaattctacgtcaaaaagggtggagccaagaaaagacccgc ccccagtgacgcagatataagtgagcccaaacgggtgcgcgagtcagttgcgcagccatcgacgtcagacgcggaagcttcgat caactacgcagacaggtaccaaaacaaatgttctcgtcacgtgggcatgaatctgatgctgtttccctgcagacaatgcgagagaat gaatcagaattcaaatatctgcttcactcacggacagaaagactgtttagagtgctttcccgtgtcagaatctcaacccgtttctgtcgt caaaaaggcgtatcagaaactgtgctacattcatcatatcatgggaaaggtgccagacgcttgcactgcctgcgatctggtcaatgt ggatttggatgactgcatctttgaacaataaatgatttaaatcaggtatggctgccgatggttatcttccagattggctcgaggacactc tctctgaaggaataagacagtggtggaagctcaaacctggcccaccaccaccaaagcccgcagagcggcataaggacgacagc aggggtcttgtgcttcctgggtacaagtacctcggacccttcaacggactcgacaagggagagccggtcaacgaggcagacgcc gcggccctcgagcacgacaaagcctacgaccggcagctcgacagcggagacaacccgtacctcaagtacaaccacgccgacg cggagtttcaggagcgccttaaagaagatacgtcttttgggggcaacctcggacgagcagtcttccaggcgaaaaagagggttctt gaacctctgggcctggttgaggaacctgttaagaccgctccgggaaaaaagaggccggtagagcactctcctgtggagccagac tcctcctcgggaaccggaaaggcgggccagcagcctgcaagaaaaagattgaattttggtcagactggagacgcagactcagta cctgacccccagcctctcggacagccaccagcagccccctctggtctgggaactaatacgatggctacaggcagtggcgcacca atggcagacaataacgagggcgccgacggagtgggtaattcctcgggaaattggcattgcgattccacatggatgggcgacaga gtcatcaccaccagcacccgaacctgggccctgcccacctacaacaaccacctctacaaacaaatttccagccaatcaggagcct cgaacgacaatcactactttggctacagcaccccttgggggtattttgacttcaacagattccactgccacttttcaccacgtgactgg caaagactcatcaacaacaactggggattccgacccaagagactcaacttcaagctctttaacattcaagtcaaagaggtcacgca gaatgacggtacgacgacgattgccaataaccttaccagcacggttcaggtgtttactgactcggagtaccagctcccgtacgtcct cggctcggcgcatcaaggatgcctcccgccgttcccagcagacgtcttcatggtgccacagtatggatacctcaccctgaacaac gggagtcaggcagtaggacgctcttcattttactgcctggagtactttccttctcagatgctgcgtaccggaaacaactttaccttcag ctacacttttgaggacgttcctttccacagcagctacgctcacagccagagtctggaccgtctcatgaatcctctcatcgaccagtac ctgtattacttgagcagaacaaacactccaagtggaaccaccacgcagtcaaggcttcagttttctcaggccggagcgagtgacattcgggaccagtctaggaactggcttcctggaccctgttaccgccagcagcgagtatcaaagacatctgcggataacaacaacagtg aatactcgtggactggagctaccaagtaccacctcaatggcagagactctctggtgaatccgggcccggccatggcaagccacaa ggacgatgaagaaaagttttttcctcagagcggggttctcatctttgggaagcaaggctcagagaaaacaaatgtggacattgaaaa ggtcatgattacagacgaagaggaaatcaggacaaccaatcccgtggctacggagcagtatggttctgtatctaccaacctccagg ccggcaacgcccaagcagctaccgcagatgtcaacacacaaggcgttcttccaggcatggtctggcaggacagagatgtgtacc ttcaggggcccatctgggcaaagattccacacacggacggacattttcacccctctcccctcatgggtggattcggacttaaacacc ctcctccacagattctcatcaagaacaccccggtacctgcgaatccttcgaccaccttcagtgcggcaaagtttgcttccttcatcaca cagtactccacgggacaggtcagcgtggagatcgagtgggagctgcagaaggaaaacagcaaacgctggaatcccgaaattca gtacacttccaactacaacaagtctgttaatgtggactttactgtggacactaatggcgtgtattcagagcctcgccccattggcacca gatacctgactcgtaatctgtaattgcttgttaatcaataaaccgtttaattcgtttcagttgaactttggtctctgcgtatttctttcttatcta gtttccatggctacgtagataagtagcatggcgggttaatcattaactacagcccgggcgtttaaacagcgggcggaggggtgga gtcgtgacgtgaattacgtcatagggttagggaggtcctgtattagaggtcacgtgagtgttttgcgacattttgcgacaccatgtggt ctcgctgggggggggggcccgagtgagcacgcagggtctccattttgaagcgggaggtttgaacgagcgctggcgcgctcact ggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctg gcgtaatagcgaagaggcccgcaccgatcgcccttcccatgcatcggccgcaaatacctgcaggatccgttttgcgctgcttcgcg atgtacgggccagatatacgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatat ggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgt atgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggactatttacggtaaactgcccacttggcagtacatcaa gtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatggg actttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagc ggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaa tgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaac tagagaacccactgcttactggcttatcgaaattaatacgactcactatagggagacccaagctggctagcatggaagtgcagctg gtggaaagcggcggcggccttgtgcaggcgggcggcagcctgcgcctgagctgcgcggcgagcggcattacctttagcattaa cacgatgggctggtatcgccaggcgccgggcaaacagcgcgaactggtggcgctgattagcagcattggcgatacctattatgc ggatagcgtgaaaggccgctttacaattagccgcgataacgcgaaaaacaccgtgtatctgcaaatgaacagcctgaaaccggaa gataccgcggtgtattattgcaaacgctttcgcaccgcggcgcagggcaccgattattggggccagggcacccaagtgaccgtga gcagcggtggcggtggatccaccgctccgggaaaaaagaggccggtagagcactctcctgtggagccagactcctcctcggga accggaaaggcgggccagcagcctgcaagaaaaagattgaattttggtcagactggagacgcagactcagtacctgacccccag cctctcggacagccaccagcagccccctctggtctcggaactaataccctcgctacaggcagtggcgcaccactcgcagacaata acgagggcgccgacggagtgggtaattcctcgggaaattggcattgcgattccacatggctcggcgacagagtcatcaccacca gcacccgaacctgggccctgcccacctacaacaaccacctctacaaacaaatttccagccaatcaggagcctcgaacgacaatca ctactttggctacagcaccccttgggggtattttgacttcaacagattccactgccacttttcaccacgtgactggcaaagactcatcaacaacaactggggattccgacccaagagactcaacttcaagctctttaacattcaagtcaaagaggtcacgcagaatgacggtacg acgacgattgccaataaccttaccagcacggttcaggtgtttactgactcggagtaccagctcccgtacgtcctcggctcggcgcat caaggatgcctcccgccgttcccagcagacgtcttcatggtgccacagtatggatacctcaccctgaacaacgggagtcaggcag taggacgctcttcattttactgcctggagtactttccttctcagatgctgcgtaccggaaacaactttaccttcagctacacttttgagga cgttcctttccacagcagctacgctcacagccagagtctggaccgtctcatgaatcctctcatcgaccagtacctgtattacttgagca gaacaaacactccaagtggaaccaccacgcagtcaaggcttcagttttctcaggccggagcgagtgacattcgggaccagtctag gaactggcttcctggaccctgttaccgccagcagcgagtatcaaagacatctgcggataacaacaacagtgaatactcgtggactg gagctaccaagtaccacctcaatggcagagactctctggtgaatccgggcccggccatggcaagccacaaggacgatgaagaa aagttttttcctcagagcggggttctcatctttgggaagcaaggctcagagaaaacaaatgtggacattgaaaaggtcatgattacag acgaagaggaaatcaggacaaccaatcccgtggctacggagcagtatggttctgtatctaccaacctccaggccggcaacgccc aagcagctaccgcagatgtcaacacacaaggcgttcttccaggcatggtctggcaggacagagatgtgtaccttcaggggcccat ctgggcaaagattccacacacggacggacattttcacccctctcccctcatgggtggattcggacttaaacaccctcctccacagatt ctcatcaagaacaccccggtacctgcgaatccttcgaccaccttcagtgcggcaaagtttgcttccttcatcacacagtactccacgg gacaggtcagcgtggagatcgagtgggagctgcagaaggaaaacagcaaacgctggaatcccgaaattcagtacacttccaact acaacaagtctgttaatgtggactttactgtggacactaatggcgtgtattcagagcctcgccccattggcaccagatacctgactcgt aatctgtaattgcttgttaatcaataaaccgtttaattcgtttcagttgaactttggtctctgcgtatttctttcttatctagtttccatggctac gtagataagtagcatggcgggttaatcattaactacagccctaggggtgcgagcggatcgagcagtgtcgatcactactggaccg cgagctgtgctgcgacccgtgatcttacggcattatacgtatgatcggtccacgatcagctagattatctagtcagcttgatgtcatag ctgtttcctgaggctcaatactgaccatttaaatcatacctgacctccatagcagaaagtcaaaagcctccgaccggaggcttttgact tgatcggcacgtaagaggttccaactttcaccataatgaaataagatcactaccgggcgtattttttgagttatcgagattttcaggagc taaggaagctaaaatgagccatattcaacgggaaacgtcttgcttgaagccgcgattaaattccaacatggatgctgatttatatggg tataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgattgtatgggaagcccgatgcgccagagttgtttctg aaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcaggctaaactggctgacggaatttatgcctcttccgacc atcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatcccagggaaaacagcattccaggtattagaagaata tcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacggcg atcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttggtgcgagtgattttgatgacgagcgtaatggctg gcctgttgaacaagtctggaaagaaatgcataaactcttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataa ccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctat ggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagttt cacttgatgctcgatgagtttttctaatgaggacctaaatgtaatcacctggctcaccttcgggtgggcctttctgcgttgctggcgttttt ccataggctccgcccccctgacgagcatcacaaaaatcgatgctcaagtcagaggtggcgaaacccgacaggactataaagata ccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgg gaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcag cagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacact agaagaacagtatttggtatctgcgctctgctgaagccagttacctcggaaaaagagttggtagctcttgatccggcaaacaaacca ccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgattttctaccga agaaaggccca

[0106] pIDTsmart-RC2.KO-AVPl-CMV-VPl-Loop-Nb (SEQ ID NO:34)

[0107] Annotation: Rep2, Cap2AVPl, AntiHer2-Nb, VP1

[0108] cccgtgtaaaacgacggccagtttatctagtcagcttgattctagctgatcgtggaccggaaggtgagccagtga gttgattgcagtccagttacgctggagtctgaggctcgtcctgaatgatatgcgaccgccggagggttgcgtttgagacgggcgac agatccagtcgcgctgctctcgtcgatccgctagggcggccgctctagaactagtggatcccccggaagatcagaagttcctattc cgaagttcctattctctagaaagtataggaacttctgatctgcgcagccgccatgccggggttttacgagattgtgattaaggtcccca gcgaccttgacgagcatctgcccggcatttctgacagctttgtgaactgggtggccgagaaggaatgggagttgccgccagattct gacatggatctgaatctgattgagcaggcacccctgaccgtggccgagaagctgcagcgcgactttctgacggaatggcgccgtg tgagtaaggccccggaggcccttttctttgtgcaatttgagaagggagagagctacttccacatgcacgtgctcgtggaaaccacc ggggtgaaatccatggttttgggacgtttcctgagtcagattcgcgaaaaactgattcagagaatttaccgcgggatcgagccgact ttgccaaactggttcgcggtcacaaagaccagaaatggcgccggaggcgggaacaaggtggtggatgagtgctacatccccaat tacttgctccccaaaacccagcctgagctccagtgggcgtggactaatatggaacagtatttaagcgcctgtttgaatctcacggag cgtaaacggttggtggcgcagcatctgacgcacgtgtcgcagacgcaggagcagaacaaagagaatcagaatcccaattctgat gcgccggtgatcagatcaaaaacttcagccaggtacatggagctggtcgggtggctcgtggacaaggggattacctcggagaag cagtggatccaggaggaccaggcctcatacatctccttcaatgcggcctccaactcgcggtcccaaatcaaggctgccttggacaa tgcgggaaagattatgagcctgactaaaaccgcccccgactacctggtgggccagcagcccgtggaggacatttccagcaatcg gatttataaaattttggaactaaacgggtacgatccccaatatgcggcttccgtctttctgggatgggccacgaaaaagttcggcaag aggaacaccatctggctgtttgggcctgcaactaccgggaagaccaacatcgcggaggccatagcccacactgtgcccttctacg ggtgcgtaaactggaccaatgagaactttcccttcaacgactgtgtcgacaagatggtgatctggtgggaggaggggaagatgac cgccaaggtcgtggagtcggccaaagccattctcggaggaagcaaggtgcgcgtggaccagaaatgcaagtcctcggcccaga tagacccgactcccgtgatcgtcacctccaacaccaacatgtgcgccgtgattgacgggaactcaacgaccttcgaacaccagca gccgttgcaagaccggatgttcaaatttgaactcacccgccgtctggatcatgactttgggaaggtcaccaagcaggaagtcaaag actttttccggtgggcaaaggatcacgtggttgaggtggagcatgaattctacgtcaaaaagggtggagccaagaaaagacccgc ccccagtgacgcagatataagtgagcccaaacgggtgcgcgagtcagttgcgcagccatcgacgtcagacgcggaagcttcgat caactacgcagacaggtaccaaaacaaatgttctcgtcacgtgggcatgaatctgatgctgtttccctgcagacaatgcgagagaat gaatcagaattcaaatatctgcttcactcacggacagaaagactgtttagagtgctttcccgtgtcagaatctcaacccgtttctgtcgt caaaaaggcgtatcagaaactgtgctacattcatcatatcatgggaaaggtgccagacgcttgcactgcctgcgatctggtcaatgtggatttggatgactgcatctttgaacaataaatgatttaaatcaggtctcgctgccgatggttatcttccagattggctcgaggacactc tctctgaaggaataagacagtggtggaagctcaaacctggcccaccaccaccaaagcccgcagagcggcataaggacgacagc aggggtcttgtgcttcctgggtacaagtacctcggacccttcaacggactcgacaagggagagccggtcaacgaggcagacgcc gcggccctcgagcacgacaaagcctacgaccggcagctcgacagcggagacaacccgtacctcaagtacaaccacgccgacg cggagtttcaggagcgccttaaagaagatacgtcttttgggggcaacctcggacgagcagtcttccaggcgaaaaagagggttctt gaacctctgggcctggttgaggaacctgttaagacggctccgggaaaaaagaggccggtagagcactctcctgtggagccagac tcctcctcgggaaccggaaaggcgggccagcagcctgcaagaaaaagattgaattttggtcagactggagacgcagactcagta cctgacccccagcctctcggacagccaccagcagccccctctggtctgggaactaatacgatggctacaggcagtggcgcacca atggcagacaataacgagggcgccgacggagtgggtaattcctcgggaaattggcattgcgattccacatggatgggcgacaga gtcatcaccaccagcacccgaacctgggccctgcccacctacaacaaccacctctacaaacaaatttccagccaatcaggagcct cgaacgacaatcactactttggctacagcaccccttgggggtattttgacttcaacagattccactgccacttttcaccacgtgactgg caaagactcatcaacaacaactggggattccgacccaagagactcaacttcaagctctttaacattcaagtcaaagaggtcacgca gaatgacggtacgacgacgattgccaataaccttaccagcacggttcaggtgtttactgactcggagtaccagctcccgtacgtcct cggctcggcgcatcaaggatgcctcccgccgttcccagcagacgtcttcatggtgccacagtatggatacctcaccctgaacaac gggagtcaggcagtaggacgctcttcattttactgcctggagtactttccttctcagatgctgcgtaccggaaacaactttaccttcag ctacacttttgaggacgttcctttccacagcagctacgctcacagccagagtctggaccgtctcatgaatcctctcatcgaccagtac ctgtattacttgagcagaacaaacactccaagtggaaccaccacgcagtcaaggcttcagttttctcaggccggagcgagtgacatt cgggaccagtctaggaactggcttcctggaccctgttaccgccagcagcgagtatcaaagacatctgcggataacaacaacagtg aatactcgtggactggagctaccaagtaccacctcaatggcagagactctctggtgaatccgggcccggccatggcaagccacaa ggacgatgaagaaaagttttttcctcagagcggggttctcatctttgggaagcaaggctcagagaaaacaaatgtggacattgaaaa ggtcatgattacagacgaagaggaaatcaggacaaccaatcccgtggctacggagcagtatggttctgtatctaccaacctccagg ccggcaacgcccaagcagctaccgcagatgtcaacacacaaggcgttcttccaggcatggtctggcaggacagagatgtgtacc ttcaggggcccatctgggcaaagattccacacacggacggacattttcacccctctcccctcatgggtggattcggacttaaacacc ctcctccacagattctcatcaagaacaccccggtacctgcgaatccttcgaccaccttcagtgcggcaaagtttgcttccttcatcaca cagtactccacgggacaggtcagcgtggagatcgagtgggagctgcagaaggaaaacagcaaacgctggaatcccgaaattca gtacacttccaactacaacaagtctgttaatgtggactttactgtggacactaatggcgtgtattcagagcctcgccccattggcacca gatacctgactcgtaatctgtaattgcttgttaatcaataaaccgtttaattcgtttcagttgaactttggtctctgcgtatttctttcttatcta gtttccatggctacgtagataagtagcatggcgggttaatcattaactacagcccgggcgtttaaacagcgggcggaggggtgga gtcgtgacgtgaattacgtcatagggttagggaggtcctgtattagaggtcacgtgagtgttttgcgacattttgcgacaccatgtggt ctcgctgggggggggggcccgagtgagcacgcagggtctccattttgaagcgggaggtttgaacgagcgctggcgcgctcact ggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctg gcgtaatagcgaagaggcccgcaccgatcgcccttcccatgcatcggccgcaaatacctgcaggatccgttttgcgctgcttcgcg atgtacgggccagatatacgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgt atgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggactatttacggtaaactgcccacttggcagtacatcaa gtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatggg actttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagc ggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaa tgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaac tagagaacccactgcttactggcttatcgaaattaatacgactcactatagggagacccaagctggctagcatggctgccgatggtt atcttccagattggctcgaggacactctctctgaaggaataagacagtggtggaagctcaaacctggcccaccaccaccaaagcc cgcagagcggcataaggacgacagcaggggtcttgtgcttcctgggtacaagtacctcggacccttcaacggactcgacaaggg agagccggtcaacgaggcagacgccgcggccctcgagcacgacaaagcctacgaccggcagctcgacagcggagacaacc cgtacctcaagtacaaccacgccgacgcggagtttcaggagcgccttaaagaagatacgtcttttgggggcaacctcggacgagc agtcttccaggcgaaaaagagggttcttgaacctctgggcctggttgaggaacctgttaagaccgctccgggaaaaaagaggccg gtagagcactctcctgtggagccagactcctcctcgggaaccggaaaggcgggccagcagcctgcaagaaaaagattgaattttg gtcagactggagacgcagactcagtacctgacccccagcctctcggacagccaccagcagccccctctggtctcggaactaatac cctcgctacaggcagtggcgcaccactcgcagacaataacgagggcgccgacggagtgggtaattcctcgggaaattggcattg cgattccacatggctcggcgacagagtcatcaccaccagcacccgaacctgggccctgcccacctacaacaaccacctctacaa acaaatttccagccaatcaggagcctcgaacgacaatcactactttggctacagcaccccttgggggtattttgacttcaacagattc cactgccacttttcaccacgtgactggcaaagactcatcaacaacaactggggattccgacccaagagactcaacttcaagctcttt aacattcaagtcaaagaggtcacgcagaatgacggtacgacgacgattgccaataaccttaccagcacggttcaggtgtttactga ctcggagtaccagctcccgtacgtcctcggctcggcgcatcaaggatgcctcccgccgttcccagcagacgtcttcatggtgccac agtatggatacctcaccctgaacaacgggagtcaggcagtaggacgctcttcattttactgcctggagtactttccttctcagatgctg cgtaccggaaacaactttaccttcagctacacttttgaggacgttcctttccacagcagctacgctcacagccagagtctggaccgtc tcatgaatcctctcatcgaccagtacctgtattacttgagcagaacaaacactccaagtggaggaggaggttcaggaggaggaggt tcaggaggtggtggatcaggtggcggtggttctggaggaggaggttctgaagtgcagctggtggaaagcggcggcggccttgtg caggcgggcggcagcctgcgcctgagctgcgcggcgagcggcattacctttagcattaacacgatgggctggtatcgccaggc gccgggcaaacagcgcgaactggtggcgctgattagcagcattggcgatacctattatgcggatagcgtgaaaggccgctttaca attagccgcgataacgcgaaaaacaccgtgtatctgcaaatgaacagcctgaaaccggaagataccgcggtgtattattgcaaacg ctttcgcaccgcggcgcagggcaccgattattggggccagggcacccaagtgaccgtgagcagcggtggcggtggagcccttc agttttctcaggccggagcgagtgacattcgggaccagtctaggaactggcttcctggaccctgttaccgccagcagcgagtatca aagacatctgcggataacaacaacagtgaatactcgtggactggagctaccaagtaccacctcaatggcagagactctctggtgaa tccgggcccggccatggcaagccacaaggacgatgaagaaaagttttttcctcagagcggggttctcatctttgggaagcaaggct cagagaaaacaaatgtggacattgaaaaggtcatgattacagacgaagaggaaatcaggacaaccaatcccgtggctacggagc agtatggttctgtatctaccaacctccagagaggcaacagacaagcagctaccgcagatgtcaacacacaaggcgttcttccaggcatggtctggcaggacagagatgtgtaccttcaggggcccatctgggcaaagattccacacacggacggacattttcacccctctcc cctcatgggtggattcggacttaaacaccctcctccacagattctcatcaagaacaccccggtacctgcgaatccttcgaccaccttc agtgcggcaaagtttgcttccttcatcacacagtactccacgggacaggtcagcgtggagatcgagtgggagctgcagaaggaaa acagcaaacgctggaatcccgaaattcagtacacttccaactacaacaagtctgttaatgtggactttactgtggacactaatggcgt gtattcagagcctcgccccattggcaccagatacctgactcgtaatctgtaattgcttgttaatcaataaaccgtttaattcgtttcagttg aactttggtctctgcgtatttctttcttatctagtttccatggctacgtagataagtagcatggcgggttaatcattaactacagccctagg ggtgcgagcggatcgagcagtgtcgatcactactggaccgcgagctgtgctgcgacccgtgatcttacggcattatacgtatgatc ggtccacgatcagctagattatctagtcagcttgatgtcatagctgtttcctgaggctcaatactgaccatttaaatcatacctgacctcc atagcagaaagtcaaaagcctccgaccggaggcttttgacttgatcggcacgtaagaggttccaactttcaccataatgaaataaga tcactaccgggcgtattttttgagttatcgagattttcaggagctaaggaagctaaaatgagccatattcaacgggaaacgtcttgctt gaagccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaat ctatcgattgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagat ggtcaggctaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccac tgcgatcccagggaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctg cgccggttgcattcgattcctgtttgtaattgtccttttaacggcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataac ggtttggttggtgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaactcttgccatt ctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggac gagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggcttttt caaaaatatggtattgataatcctgatatgaataaattgcagtttcacttgatgctcgatgagtttttctaatgaggacctaaatgtaatca cctggctcaccttcgggtgggcctttctgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgatgc tcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttcc gaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagtt cggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtc ttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcg gtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttac ctcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgc gcagaaaaaaaggatctcaagaagatcctttgattttctaccgaagaaaggccca

[0109] References[oono] The following references are herein incorporated by reference in their entirety.

[0111] (1) Pupo, A.; Fernandez, A.; Low, S. H.; Francois, A.; Suarez-Amaran,L.; Samulski, R. J. AAV Vectors: The Rubik’s Cube of Human Gene Therapy. MolecularTherapy 2022, 30 (12), 3515-3541. https: / / doi.Org / 10.1016 / j.ymthe.2022.09.015.

[0112] (2) Samulski, R. J.; Muzyczka, N. AAV-Mediated Gene Therapy forResearch and Therapeutic Purposes. Annual Review of Virology 2014, 1 (1), 427-451. https: / / doi.Org / 10.l 146 / annurev-virology-031413-085355.

[0113] (3) Elmore, Z. C.; Patrick Havlik, L.; Oh, D. K.; Anderson, L.; Daaboul,G.; Devlin, G. W .; Vincent, H. A.; Asokan, A. The Membrane Associated Accessory Protein Is an Adeno-Associated Viral Egress Factor. Nat Commun 2021, 12 (1), 6239. https: / / doi.org / 10.1038 / s41467-021-26485-4.

[0114] (4) Issa, S. S.; Shaimardanova, A. A.; Solovyeva, V. V.; Rizvanov, A.A. Various AAV Serotypes and Their Applications in Gene Therapy: An Overview. Cells 2023, 12 (5), 785. https: / / doi.org / 10.3390 / cellsl2050785.

[0115] (5) Maheshri, N.; Koerber, J. T.; Kaspar, B. K.; Schaffer, D. V. DirectedEvolution of Adeno-Associated Virus Yields Enhanced Gene Delivery Vectors. Nat Biotechnol 2006, 24 (2), 198-204. https: / / doi.org / 10.1038 / nbtl l82.

[0116] (6) Qian, R.; Xiao, B ; Li, J.; Xiao, X. Directed Evolution of AAVSerotype 5 for Increased Hepatocyte Transduction and Retained Low Humoral Seroreactivity. Molecular Therapy -Methods & Clinical Development 2021, 20, 122-132. https: / / doi.Org / 10.1016 / j.omtm.2020.10.010.

[0117] (7) Li, W.; Asokan, A.; Wu, Z.; Dyke, T. V.; DiPrimio, N.; Johnson, J.S.; Govindaswamy, L.; Agbandje-McKenna, M.; Leichtle, S.; Jr, D. E. R.; McCown, T. J.; Petermann, K. B.; Sharpless, N. E.; Samulski, R. J. Engineering and Selection of Shuffled AAV Genomes: A New Strategy for Producing Targeted Biological Nanoparticles.Molecular Therapy 2008, 16 (fl), 1252-1260. https: / / doi.org / 10.1038 / mt.2008.100.

[0118] (8) Liu, Y. B.; Xu, B. C.; Chen, Y. T.; Yuan, X.; Liu, J. Y.; Liu, T.; Du,G. Z.; Jiang, W.; Yang, Y.; Zhu, Y.; Chen, L. J.; Ding, B. S.; Wei, Y. Q.; Yang, L.Directed Evolution of AAV Accounting for Long-Term and Enhanced Transduction of Cardiovascular Endothelial Cells in Vivo. Molecular Therapy Methods & Clinical Development 2021, 22, 148-161. https: / / doi.Org / 10.1016 / j.omtm.2021.05.015.

[0119] (9) Deverman, B. E.; Pravdo, P. L.; Simpson, B. P.; Kumar, S. R.; Chan,K. Y.; Banerjee, A.; Wu, W.-L.; Yang, B.; Huber, N.; Pasca, S. P.; Gradinaru, V. Cre- Dependent Selection Yields AAV Variants for Widespread Gene Transfer to the AdultBrain. Nat Biotechnol 2016, 34 (2), 204-209. https: / / doi.org / 10.1038 / nbt.3440.

[0120] (10) Ravindra Kumar, S.; Miles, T. F.; Chen, X.; Brown, D.; Dobreva,T.; Huang, Q.; Ding, X.; Luo, Y.; Einarsson, P. H.; Greenbaum, A.; Jang, M. J.; Deverman, B. E.; Gradinaru, V. Multiplexed Cre-Dependent Selection Yields Systemic AAVs for Targeting Distinct Brain Cell Types. Nat Methods 2020, 17 (5), 541-550. https: / / doi.org / 10.1038 / s41592-020-0799-7.

[0121] (11) Li, C.; Samulski, R. J. Engineering Adeno- Associated Virus Vectors for Gene Therapy. Nat Rev Genet 2020, 21 (4), 255-272. https: / / doi.org / 10.1038 / s41576- 019-0205-4.

[0122] (12) Biining, H.; Srivastava, A. Capsid Modifications for Targeting andImproving the Efficacy of AAV Vectors. Molecular Therapy Methods & Clinical Development 2019 , 72, 248-265. https: / / doi.Org / 10.1016 / j.omtm.2019.01.008.

[0123] (13) Munch, R. C.; Janicki, H.; Volker, I.; Rasbach, A.; Hallek, M.;Biining, H.; Buchholz, C. J. Displaying High-Affinity Ligands on Adeno- Associated Viral Vectors Enables Tumor Cell-Specific and Safe Gene Transfer. Molecular Therapy 2013, 27 (1), 109-118. https: / / doi.org / 10.1038 / mt.2012.186.

[0124] (14) Eichhoff, A. M.; Borner, K.; Albrecht, B.; Schafer, W .; Baum, N.;Haag, F.; Korbelin, J.; Trepel, M.; Braren, I.; Grimm, D.; Adriouch, S.; Koch-Nolte, F. Nanobody-Enhanced Targeting of AAV Gene Therapy Vectors. Molecular Therapy - Methods & Clinical Development 2019, 75, 211-220. https: / / doi.Org / 10.1016 / j.omtm.2019.09.003.

[0125] (15) Lee, G. K.; Maheshri, N.; Kaspar, B.; Schaffer, D. V. PEGConjugation Moderately Protects Adeno- Associated Viral Vectors against Antibody Neutralization. Biotechnol Bioeng 2005, 92 (1), 24-34. https: / / doi.org / 10.1002 / bit.20562.

[0126] (16) Horowitz, E. D.; Weinberg, M. S.; Asokan, A. Glycated AAVVectors: Chemical Redirection of Viral Tissue Tropism. Bioconjug Chem 2011, 22 (4), 529-532. https: / / doi.org / 10.1021 / bcl00477g.

[0127] (17) Depienne, S.; Bouzelha, M.; Courtois, E.; Pavageau, K.; Lalys, P -A.; Marchand, M.; Alvarez-Dorta, D.; Nedellec, S.; Marin-Fernandez, L.; Grandjean, C.; Boujtita, M.; Deniaud, D.; Mevel, M.; Gouin, S. G. Click -Electrochemistry for the Rapid Labeling of Virus, Bacteria and Cell Surfaces. Nat Commun 2023, 14 (1), 5122.https: / / doi.org / 10.1038 / s41467-023-40534-0.

[0128] (18) Kelemen, R. E.; Mukherjee, R.; Cao, X.; Erickson, S. B.; Zheng, Y.;Chatteijee, A. A Precise Chemical Strategy To Alter the Receptor Specificity of the Adeno-Associated Virus. Angew Chem Int Ed Engl 2016, 55 (36), 10645-10649. https: / / doi.org / 10.1002 / anie.201604067.

[0129] (19) Zhang, C.; Yao, T.; Zheng, Y.; Li, Z.; Zhang, Q.; Zhang, L.; Zhou,D. Development of next Generation Adeno-Associated Viral Vectors Capable of Selective Tropism and Efficient Gene Delivery. Biomaterials 2016, 80, 134-145. https: / / doi.Org / 10.1016 / j.biomaterials.2015. l l.066.

[0130] (20) Zhang, C.; Zhou, X.; Yao, T.; Tian, Z.; Zhou, D. PrecisionFluorescent Labeling of an Adeno-Associated Virus Vector to Monitor the Viral Infection Pathway. Biotechnology Journal 2018, 13 (4), 1700374. https: / / doi.org / 10.1002 / biot.201700374.

[0131] (21) Erickson, S. B.; Mukherjee, R.; Kelemen, R. E.; Wrobel, C. J. J.;Cao, X.; Chatterjee, A. Precise Photoremovable Perturbation of a Virus-Host Interaction. Angewandte Chemie International Edition 2017, 56 (15), 4234-4237. https: / / doi.org / 10.1002 / anie.201700683.

[0132] (22) Yao, T.; Zhou, X.; Zhang, C.; Yu, X.; Tian, Z.; Zhang, L.; Zhou, D.Site-Specific PEGylated Adeno-Associated Viruses with Increased Serum Stability and Reduced Immunogenicity. Molecules 2017, 22 (7), 1155. https: / / doi.org / 10.3390 / molecules22071155.

[0133] (23) Katrekar, D.; Moreno, A. M.; Chen, G.; Worlikar, A.; Mali, P.Oligonucleotide Conjugated Multi-Functional Adeno-Associated Viruses. Sci Rep 2018, 8 (1), 3589. https: / / doi.org / 10.1038 / s41598-018-21742-x.

[0134] (24) Jewel, D.; Pham, Q.; Chatteijee, A. Virus-Assisted DirectedEvolution of Biomolecules. Current Opinion in Chemical Biology 2023, 76, 102375. https: / / doi.Org / 10.1016 / j.cbpa.2023.102375.

[0135] (25) Jewel, D.; Kelemen, R. E.; Huang, R. L.; Zhu, Z.; Sundaresh, B.;Cao, X.; Malley, K.; Huang, Z.; Pasha, M.; Anthony, J.; van Opijnen, T.; Chatteijee, A. Virus- Assisted Directed Evolution of Enhanced Suppressor tRNAs in Mammalian Cells. Nat Methods 2023, 20 (1), 95-103. https: / / doi.org / 10.1038 / s41592-022-01706-w.

[0136] (26) Erickson, S. B.; Pham, Q.; Cao, X.; Glicksman, J.; Kelemen, R. E.;Shahraeini, S. S.; Bodkin, S.; Kiyam, Z.; Chatterjee, A. Precise Manipulation of the Site and Stoichiometry of Capsid Modification Enables Optimization of Functional Adeno- Associated Virus Conjugates. Bioconjugate Chem. 2024, 35 (1), 64-71. https : / / doi . org / 10.1021 / acs.bioconj chem .3 c00411.

[0137] (27) Puzzo, F.; Zhang, C.; Gray, B. P.; Zhang, F.; Sullenger, B. A.; Kay,M. A. Aptamer-Programmable Adeno-Associated Viral Vectors as a Novel Platform for Cell-Specific Gene Transfer. Molecular Therapy - Nucleic Acids 2023, 31, 383-397. https: / / doi.Org / 10.1016 / j.omtn.2023.01.007.

[0138] (28) Zdechlik, A. C.; He, Y.; Aird, E. J.; Gordon, W. R.; Schmidt, D.Programmable Assembly of Adeno-Associated Virus- Antibody Composites for Receptor- Mediated Gene Delivery. Bioconjug Chem 2020, 31 (4), 1093-1106. https: / / doi.org / 10.1021 / acs.bioconjchem.9b00790.

[0139] (29) Jewel, D.; Kelemen, R. E.; Huang, R. L.; Zhu, Z.; Sundaresh, B.;Malley, K.; Pham, Q.; Loynd, C.; Huang, Z.; van Opijnen, T.; Chatterjee, A. Enhanced Directed Evolution in Mammalian Cells Yields a Hyperefficient Pyrrolysyl tRNA for Noncanonical Amino Acid Mutagenesis. Angewandte Chemie International Edition n / a (n / a), e202316428. https: / / doi.org / 10.1002 / anie.202316428.

[0140] (30) Gorbatyuk, O. S.; Warrington, K. H.; Gorbatyuk, M. S.; Zolotukhin,I.; Lewin, A. S.; Muzyczka, N. Biodistribution of Adeno-Associated Virus Type 2 with Mutations in the Capsid That Contribute to Heparan Sulfate Proteoglycan Binding. Virus Research 2019, 274, 197771. https: / / doi.Org / 10.1016 / j.virusres.2019.197771.

[0141] (31) Sullivan, J. A.; Stanek, L. M.; Lukason, M. J.; Bu, J.; Osmond, S.R.; Barry, E. A.; O’Riordan, C. R.; Shihabuddin, L. S.; Cheng, S. H.; Scaria, A. Rationally Designed AAV2 and AAVrh8R Capsids Provide Improved Transduction in the Retina and Brain. Gene Ther 2018, 25 (3), 205-219. https: / / doi.org / 10.1038 / s41434-018-0017-8.

[0142] (32) Singha Roy, S. J.; Loynd, C.; Jewel, D.; Canarelli, S. E.; Ficaretta,E. D.; Pham, Q. A.; Weerapana, E.; Chatterjee, A. Photoredox-Catalyzed Labeling of Hydroxyindoles with Chemoselectivity (PhotoCLIC) for Site-Specific Protein Bioconjugation. Angewandte Chemie International Edition 2023, 62 (27), e202300961. https: / / doi.org / 10.1002 / anie.202300961.

[0143] (33) Italia, J. S.; Addy, P. S.; Wrobel, C. J. J.; Crawford, L. A.; Lajoie,M. J.; Zheng, Y.; Chatterjee, A. An Orthogonalized Platform for Genetic Code Expansion in Both Bacteria and Eukaryotes. Nat Chem Biol 2017, 13 (4), 446-450. https: / / doi.org / 10.1038 / nchembio.2312.

[0144] (34) Zhao, C.; Wang, Y.; Pham, Q.; Dai, C.; Chatterjee, A.; Wasa, M.Chemical Tagging of Bioactive Amides by Cooperative Catalysis: Applications in the Syntheses of Drug Conjugates. J. Am. Chem. Soc. 2023, 145 (26), 14233-14250. https: / / doi.org / 10.1021 / jacs.3c00169.

[0145] While this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims.

Claims

CLAIMSWhat is claimed is:

1. A virus conjugate comprising a genetically-modified adeno-associated virus (AAV), wherein the virus is mutated to incorporate an engineered amino acid in a site-specific manner at a predetermined / predefined site of the virus, and a genetically-modified protein of interest, wherein the protein is mutated to incorporate an engineered amino acid in a site-specific manner at a predetermined / predefined site of the protein, wherein the engineered amino acids comprise orthogonal bioconjugation groups suitable for attachment of a bifunctional linking reagent, whereby the virus and protein are crosslinked via the bifunctional linker reagent to form a virus conjugate.

2. The virus conjugate of claim 1, where the engineered amino acid of the virus is a cysteine, or a non-naturally occurring amino acid (ncAA), comprising a bioorthogonal conjugation group selected from the group consisting of: azide, alkyne, aldehyde, ketone, alkenes, tetrazine, 5 -hydroxytryptophan.

3. The virus conjugate of claim 1, where the engineered amino acid of the protein is a cysteine, or a non-naturally occurring amino acid (ncAA) containing bioorthogonal conjugation groups selected from the group consisting of: an azide, alkyne, aldehyde, ketone, alkenes, tetrazine, 5 -hydroxytryptophan.

4. The virus conjugate of any of claims 1-3, wherein the genetically-modified adeno- associated virus (AAV) comprises a variant VP1 or VP2 capsid protein mutated to incorporate an engineered amino acid in a site-specific manner at a predetermined / predefined site of the VP1 or VP2 capsid protein, wherein the engineered amino acid comprises a bioorthogonal conjugation groups suitable for attachment of a bifunctional linking reagent.

5. The virus conjugate of claim 4, wherein the bifunctional linker reagent is a chemical linker reagent comprising Tetrazine (Tz) or a strained alkene by which the adeno- associated virus VP1 or VP2 capsid protein and the protein of interest are chemically cross-linked via a Tz and strained alkene linkage, resulting in a virus-protein conjugate.

6. The virus conjugate of any of claims 1-5, comprising a genetically-modified AAV, wherein the AAV VP1 capsid protein comprises SEQ ID NO:1, or a sequence comprising at least about 80% sequence identity of SEQ ID NO: 1 and the AAV VP2 capsid protein comprises SEQ ID NO: 2, or a sequence comprising at least about 80% sequence identity of SEQ ID NO:2.

7. The virus conjugate of claim 6, wherein the mutated VP1 capsid protein of is mutated at one of more locations at positions 263, 454, 456, 585, 587 or 588.

8. The virus conjugate of either of claims 6 or 7, wherein the site of incorporation of the engineered amino acid in the AAV VP1 capsid protein is a surface-exposed site selected from the group consisting of: Q264, T454, T456 or R588.

9. The virus conjugate of any of claims 1-8, wherein the genetically-modified protein of interest is selected from the group consisting of: a full-length antibody, an antibody fragment, a nanobody an enzyme, a cytokine, a serum protein or an immune- modulating protein.

10. The virus conjugate of any of claims 1-9, wherein the strained alkene of the bifunctional linker reagent is selected from a group consisting of: cyclopropenes, norbomenes, cyclooctenes or cyclooctynes.

11. The virus conjugate of claim 10, wherein the bifunctional linker reagent comprises dibenzocyclooctyne (DBCO) - tetrazine (Tz) or DBCO-trans-cyclooctene (TCO).

12. The virus-protein conjugate of claim 11, wherein the DBCO of the bifunctional linker further comprises a sulfide moiety / is sulfonated (DBCO-sulfo) or a flexible linker moiety (DBCO-linker).

13. The virus conjugate of claim 12, wherein the flexible linker moiety of the bifunctional linker is selected from the group consisting of: polyethylene glycom (PEG), a peptide, an oligonucleotide, a polycarbohydrate, or other suitable polymer.

14. The virus conjugate of either claims 12 or 13, wherein the flexible linker moiety comprises a PEG moiety comprising 1 to about 24 PEG molecules.

15. The virus conjugate of any of claims 1-14, wherein the bifunctional linkers are a paired combination of linkers, wherein in one combination the engineered amino acid of the virus is linked to a DBCO-sulfo-Tz or DBCO-PEG-Tz bifunctional linker and the engineered amino acid of the protein of interest is linked to a DBCO-sulfo-TCO or DBCO-PEG-TCO bifunctional linker, or an alternate combination wherein engineered amino acid of the virus is linked to a DBCO-sulfo-TCO or DBCO-PEG-TCO linker and the engineered amino acid of the protein of interest is linked to a DBCO-sulfo-Tz or an DBCO-PEG-Tz.

16. The virus conjugate of any of claims 1-15, where in the engineered amino acid is the non-canonical amino acid (ncAA) AKz.

17. A virus-protein conjugate comprising a genetically-modified adeno-associated virus (AAV) comprising the non-canonical amino acid (ncAA) residue AzK, and a genetically-modified protein of interest comprising the non-canonical amino acid (ncAA) residue AzK, wherein the AAV and protein are chemically cross-linked via a bifunctional chemical linker reagent comprising Tetrazine (Tz) or trans-Cyclooctene (TCO) modifying the AzK ncAA residues, thereby producing a virus-protein conjugate.

18. A virus-protein conjugate comprising a genetically-modified adeno-associated virus (AAV) wherein the AAV comprises a variant VP1 or VP2 capsid protein selectively mutated to incorporate the non-canonical occurring amino acid (ncAA) AzK residue (bioconjugation handle) at a specific site of the VP1 capsid protein or the VP2 capsid protein, and a genetically-modified protein of interest wherein the protein is selectively mutated to incorporate the non-canonical-occurring amino acid (ncAA) AzK residue (bioconjugation handle) at a specific site of the protein, wherein the AzK residues of VP1 capsid protein or the VP2 capsid protein and the protein are further modified with a bifunctional linker reagent comprising Tetrazine (Tz) or trans-Cyclooctene (TCO) by which the adeno-associated virus VP 1 capsid protein or the VP2 capsid protein and the protein of interest are chemically cross-linked via a Tz and TCO linkage, resulting in a virus-protein conjugate.

19. The virus-protein conjugate of either claim 17 or 18, comprising a genetically-modified AAV, wherein the AAV VP1 capsid protein comprises SEQ ID NO:1, or a sequence comprising at least about 80% sequence identity of SEQ ID NO: 1 , or wherein the AAV VP2 capsid protein comprises SEQ ID NO:2, or a sequence comprising at least about 80% sequence identity of SEQ ID NO:2.

20. The virus-protein conjugate of any of claims 17 -19, wherein the mutated VP1 capsid protein is mutated at one of more locations at positions 263, 454, 456, 585, 587 or 588.

21. The virus-protein conjugate of any of claims 17-20, wherein the site of incorporation of the AzK residue is a surface-exposed site selected from the group consisting of: Q264, T454, T456 or R588.

22. The virus-protein conjugate of any of claims 17-21, wherein the genetically-modified protein of interest is selected from the group consisting of: a full-length antibody, an antibody fragment, a nanobody an enzyme, a cytokine, a serum protein or an immune- modulating protein.

23. The virus-protein conjugate of any of claims 17-22, wherein the bifunctional linker reagent comprises dibenzocyclooctyne (DBCO) - tetrazine (Tz) or DBCO-trans- cyclooctene (TCO).

24. The virus-protein conjugate of any of claims 17-23, wherein the DBCO of the bifunctional linker further comprises a sulfide moiety / is sulfonated (DBCO-sulfo) or a flexible polyethylene glycol (PEG) moiety (DBCO-PEG).

25. The virus-protein conjugate of any of claims 17-24, wherein the bifunctional linkers are a paired combination of linkers, wherein in one combination the VP1 capsid protein AzK is linked to a DBCO-sulfo-Tz or DBCO-PEG-Tz bifunctional linker and the protein of interest is linked to a DBCO-sulfo-TCO or DBCO-PEG-TCO bifunctional linker, or an alternate combination wherein the VPI capsid protein is linked to a DBCO-sulfo-TCO or DBCO-PEG-TCO linker and the protein of interest is linked to a DBCO-sulfo-Tz or an DBCO-PEG-Tz.

26. The virus-protein conjugate of any of claims 17-25, wherein the linker comprising a PEG moiety comprises 1 to about 24 PEG molecules.

27. A method of producing a virus conjugate comprising a genetically-modified adeno- associated virus (AAV) and a genetically-modified protein of interest, the method comprising: a.) incorporating an engineered amino acid residue with a bioconjugation group / handle at a specific site of the VP1 or VP2 capsid protein of the AAV and modifying the bioconjugation handle with a bifunctional linker reagent comprising either tetrazine or a strained-alkene; b.) incorporating an engineered amino acid residue with a bioconjugation handle at a specific site of a protein of interest and modifying the bioconjugation handle with a bifunctional linker reagent comprising either tetrazine or strained alkene; and c.) combining / reacting the genetically-modified AAV comprising VP1 or VP2 capsid protein and the genetically-modified protein of interest of steps a.) and b.) under conditions suitable for the cross-linking of the tetrazine and transcyclooctene linker reagents, thereby producing an adeno-associated virus (AAV)-protein of interest conjugate.

28. The virus conjugate of claim 27, wherein the site of incorporation of the engineered amino acid residue in the VP1 capsid protein is a surface-exposed site selected from the group consisting of: Q264, T454, T456 or R588.

29. The virus conjugate of either of claims 27 or 28, wherein the protein of interest is selected from a group consisting of: a full-length antibody, an antibody fragment, a nanobody, an enzyme, a cytokine, a serum protein or an immune-modulating protein.

30. A method of producing an adeno-associated virus (AAV)-protein conjugate, the conjugate comprising a genetically-modified adeno-associated virus and a genetically- modified protein of interest, the method comprising:a.) incorporating an AzK residue with a bioconjugate handle at a specific site of the VP1 or VP2 capsid protein of the AAV and modifying the AzK site with a bifunctional linker reagent comprising either tetrazine or transcyclooctene; b.) incorporating an AzK residue with a bioconjugate handle at a specific site of a protein of interest and modifying the AzK site with a bifunctional linker reagent comprising either tetrazine or trans-cyclooctene; and c.) combining / reacting the genetically-modified AAV comprising VP1 or VP2 capsid protein and the genetically- modified protein of interest of steps a.) and b.) under conditions suitable for the cross-linking of the tetrazine and trans-cyclooctene linker reagents, thereby producing an adeno-associated virus (AAV)-protein conjugate.

31. The AAV-protein conjugate of claim 30, wherein the site of incorporation of the AzK residue in the VP1 capsid protein is a surface-exposed site selected from the group consisting of: Q264, T454, T456 or R588.

32. The AAV-protein conjugate of either of claims 30 or 31 , wherein the protein of interest is a full-length antibody, an antibody fragment, a nanobody an enzyme, a cytokine, a serum protein or an immune-modulating protein.

33. The adeno-associated virus-protein conjugate of any of claims 1-26, or an adeno- associated virus-protein conjugate produced by the method of any of claims 27-32, wherein the infectivity of the of the adeno-associated virus-protein conjugate is comparable or higher than the unconjugated wild-type adeno-associated virus.

34. The adeno-associated virus-protein conjugate of any of claims 1-26, or claim 33, or a adeno-associated virus-protein conjugate produced by the method of any of claims 27- 32, wherein the AAV VPI capsid protein is mutated R585A and R588A to delete the wild-type heparan sulfate receptor binding site and AzK is incorporated at VPI capsid protein site 454.

35. The adeno-associated virus-protein conjugate of any of claims 1-26, or claims 33-34, or an adeno-associated virus-protein conjugate produced by the method of any of claims 27-32, wherein the adeno-associated virus-protein conjugate is detectably labelled.

36. The adeno-associated virus-protein conjugate of any of claims 1-26, or claims 33-34, or an adeno-associated virus-protein conjugate produced by the method of any of claims 27-32, wherein at least about 50% of the engineered amino acid residues of the adeno- associated virus VP1 or VP2 capsid protein are linked to the protein of interest via the bifunctional linker.

37. A therapeutic composition comprising an adeno-associated virus-protein conjugate of any of claims 1-26, or claims 33-36, or an adeno-associated virus-protein conjugate produced by the method of any of claims 27-32, further comprising a cargo of one or more therapeutic agents.

38. A method of treating a disease of condition in a subject comprising administering to the subject the therapeutic composition of claim 37, wherein the composition comprises a gene construct encoding the adeno-associated virus-protein conjugate as a targeting agent and the therapeutic agent in an amount sufficient / capable of decreasing or alleviating the disease or condition.

39. A kit comprising the adeno-associated virus-protein of interest conjugate of any of claims 1-26, or claims 33-37, or an adeno-associated virus-protein conjugate produced by any of claims 27-32.

Citation Information

Patent Citations

  • Controlled modification of adeno-associated virus (AAV) for enhanced gene therapy

    US20230175013A1

  • Genetically encoded tyrosine sulfation of proteins in eukaryotes

    WO2020219708A1

  • Enhanced platforms for unnatural amino acid incorporation in mammalian cells

    WO2020257668A1

  • Chimeric thermostable aminoacyl-TRNA synthetase for enhanced unnatural amino acid incorporation

    WO2021076795A1

  • Controlled modification of adeno-associated virus (AAV) for enhanced gene therapy

    WO2021222899A1