Expression vector, insulin production model animal, method for producing insulin production model animal, and insulin production method
The expression vector using Glis1, Neurogenin3, MafA, and Pdx1 genes addresses the limitations of current insulin-producing cell production by enabling controlled in vivo generation with reduced side effects and improved diabetes research efficacy.
Patent Information
- Application Number
- PCT/JP2025/010564
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-19
- Filing Date
- 2025-03-18
- Publication Date
- 2025-09-25
AI Technical Summary
Current methods for producing insulin-producing cells in vivo are limited, facing challenges such as tumorigenicity, immune rejection, high production costs, and risks of genetic mutations, making them unsuitable for effective diabetes research and treatment.
An expression vector containing the Glis1, Neurogenin3, MafA, and Pdx1 genes, regulated by a Tet-controlled system, is used to directly produce insulin-producing cells in vivo by administering doxycycline and tamoxifen, allowing controlled gene expression and nuclear translocation.
This method enables the direct production of insulin-producing cells in animals with minimal side effects, reducing production costs and genetic risks, and effectively lowers blood glucose levels, providing a valuable model for diabetes research.
Smart Images

Figure JP2025010564_25092025_PF_FP_ABST
Abstract
Description
Expression vector, insulin-producing model animal, method for producing insulin-producing model animal, and method for producing insulin
[0001] The present invention relates to an expression vector for producing insulin-producing cells directly in vivo in an animal, a model animal or insulin-producing model animal used in research on diabetes produced using the vector, a method for producing the same, and a method for producing insulin.This application claims priority based on Japanese Patent Application No. 2024-042492 filed on March 18, 2024, and Japanese Patent Application No. 2024-068690 filed on April 19, 2024, the contents of which are incorporated herein by reference.
[0002] Insulin is a peptide hormone produced in the pancreas that reduces blood glucose levels, and its ineffectiveness is the cause of diabetes. Therefore, there is a strong demand for research into the behavior of insulin in vivo, especially in research into diabetes treatments. Systems for expressing insulin in cells or animals are useful for insulin research. For example, it is thought that cells or animals that express insulin can be obtained by differentiating cells or animal tissues into a form similar to pancreatic cells.
[0003] Direct reprogramming (DR) or direct cell fate conversion is a method of direct differentiation of somatic cells into target cells without the need for stem cell generation processes such as iPS or ES cells. It has been reported that several types of cells, including exocrine pancreatic cells, hepatocytes, alpha cells, and intestinal cells, can be differentiated into pancreatic beta cells in vivo, raising hopes that DR could be used to treat type 1 diabetes.
[0004] For example, Patent Document 1, filed by the present inventors, discloses a method for producing pancreatic endocrine cells, comprising an introduction step of introducing a GLIS family gene or its gene product and a Neurogenin3 gene or its gene product into somatic cells (excluding precursor cells of pancreatic endocrine cells), wherein the GLIS family gene or its gene product is at least one of a GLIS1 gene or its gene product and a GLIS3 gene or its gene product. Patent Document 1 also discloses a method for producing pancreatic endocrine cells, wherein the introduction step further introduces a Pdx1 gene or its gene product into somatic cells. This technology aims to provide a method for producing pancreatic endocrine cells that is simple, easily reproducible, has excellent production efficiency, and can be produced in a short period of time, as well as pancreatic endocrine cells produced by the production method, and a transdifferentiation agent that transdifferentiates somatic cells into pancreatic endocrine cells.
[0005] Furthermore, Patent Document 2 by the present inventors discloses a method for producing pancreatic endocrine cells, comprising an introduction step of introducing any one of the following genes or gene products into somatic cells: (A) a mutant GLIS1 gene or its gene product, a Neurogenin3 gene or its gene product, a Pdx1 gene or its gene product, and a MafA gene or its gene product; (B) a mutant GLIS1 gene or its gene product, a Neurogenin3 gene or its gene product, and a Pdx1 gene or its gene product; (C) a GLIS1 gene or its gene product, a Neurogenin3 gene or its gene product, a Pdx1 gene or its gene product, and a MafA gene or its gene product; or (D) a mutant GLIS1 gene or its gene product, a Neurogenin3 gene or its gene product, and a MafA gene or its gene product. This technology aims to solve the above-mentioned problems of the past and achieve the above-mentioned objectives, and to provide a method for producing pancreatic endocrine cells that is simple, easy to reproduce, has excellent production efficiency, and can be produced in a short period of time, as well as a differentiation transduction agent that transdifferentiates somatic cells into pancreatic endocrine cells.
[0006] Patent No. 6822837 International Publication No. WO2017 / 073740
[0007] The technology of Patent Document 1 enables highly efficient transdifferentiation of 80% or more. Furthermore, the technology of Patent Document 2 enables highly efficient production of pancreatic endocrine cells in a short period of time. Hepatic cell therapy has also been developed to generate β cells derived from iPS cells, and the pancreatic endocrine cells produced by the technology can be introduced into a living body for use in these therapies.
[0008] However, the therapeutic approach of introducing transdifferentiated cultured cells into the body is expected to result in tumorigenicity and immune rejection during allogeneic cell transplantation, and large amounts of immunosuppressants are required to avoid these risks. Therefore, when actually used for treatment, many issues remain regarding side effects such as infection and cancer. Furthermore, this approach requires high cell production costs, and there are risks of unwanted genetic mutations and changes in cell phenotype when producing cells in vitro, as well as many difficulties and challenges in developing drug discovery technologies.
[0009] Therefore, apart from the research advantages of the in vitro production of pancreatic endocrine cells described in Patent Documents 1 and 2, there is a strong demand for in vivo techniques in animals, particularly techniques that can directly produce insulin-producing cells in vivo. However, no such research has been reported.
[0010] The present invention has been made in view of the above circumstances, and its object is to provide an expression vector that can directly produce insulin-producing cells in vivo in an animal, that can produce an animal having insulin-producing tissues by a simple procedure, and that is useful for medical research, an insulin-producing model animal, a method for producing the same, and a method for producing insulin using the same.
[0011] In order to achieve the above object, the present invention has the following aspects. [1] An expression vector for enabling expression of an insulin-producing cell-inducing factor comprising the Glis1 gene or a mutant Glis1 gene, the Neurogenin3 gene, the MafA gene, and the Pdx1 gene, wherein the expression vector comprises a Tet-controlled expression regulatory vector having a region including a TRE3G promoter, and the MafA gene and the Pdx1 gene are inserted upstream of the TRE3G promoter, and the Neurogenin3 gene and the Glis1 gene or the mutant Glis1 gene are inserted downstream of the TRE3G promoter. [2] The expression vector according to [1], wherein the mutant Glis1 gene is the ΔK2 gene set forth in SEQ ID NO: 1. [3] The expression vector according to [1] or [2], wherein at least a portion of the gene constituting the insulin-producing cell-inducing factor is a fusion gene with the Ert gene. [4] The expression vector according to [3], wherein the expression vector is a pTRE-OKAP vector into which genes have been inserted so that, from upstream, they are the Pdx1 gene, the MafA gene, the TRE3G promoter, the Neurogenin3 gene, and the Glis1 gene or a fusion gene of the mutant Glis1 gene and the Ert gene. [5] The expression vector according to [1] or [2], wherein the expression vector further comprises an rtTA or tTS gene. [6] An insulin-producing model animal into which the expression vector according to [1] or [2] has been introduced. [7] The insulin-producing model animal according to [6], wherein the insulin-producing cell-inducing factor can be expressed by administering doxycycline to the insulin-producing model animal. [8] The insulin-producing model animal according to [6], wherein at least a part of the gene constituting the insulin-producing cell-inducing factor is designed so that its gene product is translocated into the cell nuclei of the model animal upon administration of tamoxifen to the insulin-producing model animal. [9] The insulin-producing model animal according to [6], wherein the insulin-producing model animal is a mouse.
[10] A method for producing an insulin-producing model animal, comprising introducing the expression vector according to [1] or [2] into an animal.
[11] A method for producing insulin using the insulin-producing model animal according to [6], comprising introducing the insulin-producing cell-inducing factor into the insulin-producing model animal to cause the insulin-producing model animal to produce insulin.
[12] The method for producing insulin according to
[11] , comprising administering doxycycline or tamoxifen to the insulin-producing model animal through a tissue in which insulin is to be induced.
[13] The method for producing insulin according to
[12] , comprising administering the doxycycline or tamoxifen by contacting it with the body surface of the insulin-producing model animal.
[14] The method for producing insulin according to
[11] , wherein the insulin-producing cell-inducing factor is introduced into the insulin-producing model animal so that it can be expressed by a Tet on / off system, and wherein doxycycline is administered to the insulin-producing model animal, followed by administering tamoxifen to the insulin-producing model animal.
[0012] The present invention also has the following aspects. [1A] An insulin-producing model animal, which is a model animal capable of expressing an insulin-producing gene consisting of a mutant Glis1 gene, a Neurogenin3 gene, a MafA gene, and a Pdx1 gene, or a gene product thereof. [2A] The insulin-producing model animal according to [1A], wherein the mutant Glis1 gene is the ΔK2 gene set forth in SEQ ID NO: 1. [3A] The insulin-producing model animal according to [1A] to [2A], wherein the insulin-producing gene can be expressed by administering doxycycline to the model animal. [4A] The insulin-producing model animal according to [1A] to [2A], wherein at least a portion of the insulin-producing gene is designed so that the gene product is translocated into the cell nucleus of the model animal by administering tamoxifen to the model animal. [5A] The insulin-producing model animal according to [1A] to [4A], wherein the model animal is a mouse. [6A] A method for producing an insulin-producing model animal according to any one of [1A] to [5A], comprising introducing an insulin-producing gene comprising a mutant Glis1 gene, a Neurogenin3 gene, a MafA gene, and a Pdx1 gene into the model animal. [7A] A method for producing insulin using the insulin-producing model animal according to any one of [1A] to [5A], comprising expressing the insulin-producing gene comprising the mutant Glis1 gene, the Neurogenin3 gene, the MafA gene, and the Pdx1 gene in the insulin-producing model animal. [8A] The method for producing insulin according to [7A], comprising administering doxycycline or tamoxifen to the insulin-producing model animal via a tissue where insulin is to be induced. [9A] The method for producing insulin according to any one of [7A] to [8A], comprising administering the doxycycline or tamoxifen by contacting it with the body surface of the insulin-producing model animal.[10A] The insulin production method according to any one of [7A] to [9A], wherein a fusion gene of the Neurogenin3 gene, the MafA gene, the Pdx1 gene, the mutant Glis1 gene, and the Ert gene is introduced into the model animal so that it can be expressed by a Tet on / off system, and doxycycline is administered to the insulin-producing model animal, and then tamoxifen is administered to the insulin-producing model animal.
[0013] According to the present invention, insulin-producing cells can be produced directly in vivo in an animal, and animals having insulin-producing tissues can be produced by simple procedures. It is also possible to provide an expression vector useful for medical research, an insulin-producing model animal, a method for producing the same, and an insulin production method using the same.
[0014] Schematic diagram of the introduction site of the vector designed in this example. Diagram of the DOX and TAM administration test to OD mice in this example. Analysis results of insulin expression levels in each organ of mice administered using a pump container. Analysis results of insulin expression levels in each organ of mice administered using a sponge. Photographs of the morphology of OC-134 and OC-142 mice at the time of administration. Photographs of the skin of an OC-134 mouse administered DOX using a sponge. Photographs of the skin of an OC-142 mouse administered DOX using a pump container. Photographs of a mouse with a pump placed and a mouse administered subcutaneously. Photographs showing the induction of ectopic insulin-producing cells in OCL mice. Graphs of insulin pg / mg protein in each fascia sample. Photographs showing the sustained ectopic insulin production in OCL mice. Graphs showing a comparison of blood glucose lowering effects. Graphs showing a comparison of blood glucose lowering effects for multiple model mice. Graphs showing the amount of insulin in plasma. Graphs showing the amount of insulin in each organ. FIG. 1 is a graph showing the amount of insulin RNA in each organ. FIG. 2 is a graph showing the blood glucose lowering effect of T1D-OKAP-introduced mice. FIG. 3 is a photograph of an immunostained image of duodenal tissue from an OC mouse. FIG. 4 is a photograph of an immunostained image of small intestinal tissue from an OC mouse. FIG. 5 is another photograph of an immunostained image of small intestinal tissue from an OC mouse. FIG. 6 is yet another photograph of an immunostained image of small intestinal tissue from an OC mouse.
[0015] The expression vector, insulin-producing model animal, method for producing the same, and method for producing insulin using the same according to the present invention will be described below with reference to embodiments, although the present invention is not limited to the following embodiments.
[0016] [Expression Vector] The expression vector of this embodiment is an expression vector for enabling expression of an insulin-producing cell-inducing factor, which comprises the Glis1 gene or mutant Glis1 gene, the Neurogenin3 gene, the MafA gene, and the Pdx1 gene, and is an expression vector in which the MafA gene and the Pdx1 gene are inserted upstream of the TRE3G promoter, and the Neurogenin3 gene and the Glis1 gene or the mutant Glis1 gene are inserted downstream of the TRE3G promoter, into a Tet-controlled expression regulatory vector having a region including the TRE3G promoter.
[0017] The expression vector of this embodiment is used to create an insulin-producing model animal by introducing the expression vector into an animal, causing the animal to express the insulin-producing cell-inducing factor, and directly producing insulin-producing cells in the animal's body.
[0018] In this specification, the Glis1 gene or mutant Glis1 gene may be referred to as the "K factor," the Neurogenin3 gene as the "O factor," the MafA gene as the "A factor," and the Pdx1 gene as the "P factor." These four genes may also be collectively referred to as the "OKAP factors." The insulin-producing cell-inducing factor includes all of the OKAP factors. These four OKAP factor genes induce insulin-producing cells, as described in Patent Document 2. In this specification, the insulin-producing cell-inducing factor may also be referred to as the insulin-producing gene, since it ultimately induces insulin production.
[0019] (Mutated Glis1 Gene) The Glis1 gene or mutant Glis1 gene contained in the insulin-producing cell-inducing factor is a gene having partial to complete homology with a known Glis1 gene. Examples of the Glis1 gene include an unmutated Glis1 gene, and examples of the mutant Glis1 gene include a Glis1 gene or a mutant Glis1 gene having a mutation in a part of the Glis1 gene. The origin of the Glis1 gene is not particularly limited and can be appropriately selected depending on the purpose, and examples include human and mouse. Sequence information for the Glis1 gene can be obtained from known databases, and for example, it is available from NCBI under accession numbers NM_147193 (human) and NM_147221 (mouse).
[0020] The mutant Glis1 gene is preferably a part of the Glis1 gene or a gene having 85% or more sequence identity with the Glis1 gene. The part of the Glis1 gene is more preferably the nucleotide sequence represented by SEQ ID NO: 1. The nucleotide sequence represented by SEQ ID NO: 1 is the sequence of a gene encoding a protein in which 360 amino acid residues at the N-terminus of mouse GLIS1 protein are deleted.
[0021] Furthermore, the part of the mutant Glis1 gene may be a gene sequence encoding a protein in which 190 to 359 amino acid residues are deleted from the N-terminus of the human GLIS1 protein, for example, a gene sequence encoding a protein in which 190 amino acid residues are deleted from the N-terminus of the human GLIS1 protein.
[0022] Accession number 1 (ΔK2 gene): ATGGCTGGAGACATGAGAGCTGCCAACCTTTGGCCAAGCCCGCTCATGATCAAACGCTCT AAGAAGAACAGCCTGGCCTTGTCCCTGACGGCCGACCAGATGGTCAGTGCCTTGTTGGAT GCTGAGCCCCCCATACTCTATTCCGAGTATGATCCTACCAGACCCTTCAGTGAAGCTTCG ATGATGGGCTTACTGACCAACCTGGCAGACAGGGAGCTGGTTCACATGATCAACTGGGCG AAGAGGGTGCCAGGCTTTGTGGATTTGACCCTCCATGATCAGGTCCACCTTCTAGAATGT GCCTGGCTAGAGATCCTGATGATTGGTCTCGTCTGGCGCTCCATGGAGCACCCAGTGAAG CTACTGTTTGCTCCTAACTTGCTCTTGGACAGGAACCAGGGAAAATGTGTAGAGGGCATG GTGGAGATCTTCGACATGCTGCTGGCTACATCATCTCGGTTCCGCATGATGAATCTGCAG GGAGAGGAGTTTGTGTGCCTCAAATCTATTATTTTGCTTAATTCTGGAGTGTACACATTT CTGTCCAGCACCCTGAAGTCTCTGGAAGAGAAGGACCATATCCACCGAGTCCTGGACAAG ATCACAGACACTTTGATCCACCTGATGGCCAAGGCAGGCCTGACCCTGCAGCAGCAGCAC CAGCGGCTGGCCCAGCTCCTCCTCATCCTCTCCCACATCAGGCACATGAGTAACAAAGGC ATGGAGCATCTGTACAGCATGAAGTGCAAGAACGTGGTGCCCCTCTATGACCTGCTGCTG GAGGCGGCGGACGCCCACCGCCTACATGCGCCCACTAGCCGTGGAGGGGCATCCGTGGAG GAGACGGACCAAAGCCACTTGGCCACTGCGGGCTCTACTTCATCGCATTCCTTGCAAAAG TATTACATCACGGGGGAGGCAGAGGGTTTCCCTGCCACAGCTTCAGGTGGCGGAGGGTCGGGAGGTGGCGGGTCTGGAGGCGGTggaGTTGCCGGTCGGCAGGCATGCCGCTGGGTGGAC TGCTGCGCAGCCTACGAGCAGCAGGAGGAGCTGGTGCGGCACATCGAGAAGAGCCACATC GACCAGCGCAAGGGCGAAGACTTCACCTGCTTCTGGGCCGGGTGTGTGCGGCGCTACAAG CCCTTCAATGCCCGCTACAAGCTGCTCATCCACATGAGGGTACACTCAGGCGAGAAGCCC AACAAGTGCATGTTCGAAGGCTGCAGTAAAGCCTTTTCCCGTCTGGAGAACCTGAAGATC CATCTGCGGAGCCACACAGGCGAGAAACCATACCTGTGCCAGCACCCAGGCTGCCAGAAG GCCTTCAGCAACTCCAGCGACCGTGCCAAGCACCAACGCACCCACCTCGACACGAAGCCA TATGCTTGTCAGATCCCTGGCTGCTCCAAGCGCTACACGGACCCCAGCTCCCTCCGCAAG CACGTGAAGGCCCACTCAGCCAAAGAGCAGCAGGTGCGTAAGAAGCTGCACACAGGTGCC GACCCAGAGGCTGATGTTCTGTCCGAGTGTCTGTCCCTGCAGCAGCTCCAAGCATCCACA CTGTTGCCGGCCAGCAGAGGGAAGGGCAGCCAAACCCTGAGCCAGGAGCTCCTCCCAGGT GTGTATCCTGGCTCCGTCACCCCACAAAACGGGCTTGCTTCAGGCATCCTGTCCCCCTCC CACGATGTCCCTTCCAGGCACCACCCACTGGAGGTCCCCACTGGTTCCCACCACCACCTG TCCCCTCTGCCCACAGCTGAGAGCACCAGGGATGGCCTGGGGCCCAGTCTCCTTTCACCC ATGGTCAGCCCACTGAAGGGGCTTGGTCCCCCACCGCTACCACCAGCCTCCCAGAGTCAG TCTCCAGGGGGACAGTCATTCTCTACAGTCCCCAGCAAGCCTACCTACCCATCCTTCCAAAGCCCACCACCTCTGCCCAGCCCCCAAGGCTACCAAGGCAGTTTCCATTCCATCCAGAAC TGCTTCCCCTACGCTGACTGCTACCGGGCCACTGAGCCAGCAGCCTCCAGGGATGGACTG GTGGGTGATGCCCACGGTTTCAACCCCTTGCGACCCAGCACATACTCCAGCCTCAGCACA CCTTTATCCGCACCAGGCTACGAGACCCTGGCAGAAACGCCGTGTCCCAGCGCTGCAG CCACAGCCAGCTGAAGACCTGGTACCTAGTGGTCCTGAGGACTGTGGCTTCTTCCCCAAT GGGGCCTTTGACCACTGTCTGAGTCACATCCCGTCCATCTACACTGACACCGGATCCACT AGTGGCGTTGCCATGCCAGGTGCCGAAGATGATGTGGTGTAA
[0023] The sequence identity between the mutant Glis1 gene and the base sequence of a portion of the Glis1 gene (such as sequence number: 1) is not particularly limited as long as it is 85% or more and can be selected appropriately depending on the purpose, but 90% or more is preferred, 95% or more is more preferred, 98% or more is even more preferred, and 99% or more is particularly preferred.
[0024] The method for determining the sequence identity is not particularly limited, and any known method can be appropriately selected. For example, the sequence identity can be determined using the BLAST algorithm by Karlin and Altschul (Karlin, S. & Altschul, S.F. (1990) Proc. Natl. Acad. Sci. USA 87: 2264-2268, Karlin, S. & Altschul, S.F., Proc. Natl. Acad. Sci. USA 90: 5873).
[0025] (Neurogenin3 Gene) The origin of the Neurogenin3 gene is not particularly limited and can be appropriately selected depending on the purpose, and examples thereof include human, mouse, etc. Sequence information of the Neurogenin3 gene can be obtained from a known database, and for example, it is available from NCBI under accession numbers NM_009719 (mouse) and NM_020999 (human).
[0026] (Pdx1 Gene) The origin of the Pdx1 gene is not particularly limited and can be appropriately selected depending on the purpose, and examples thereof include human, mouse, etc. Sequence information of the Pdx1 gene can be obtained from a known database, and for example, it is available from NCBI under accession numbers NM_000209 (human) and NM_008814 (mouse).
[0027] (MafA Gene) The origin of the MafA gene is not particularly limited and can be appropriately selected depending on the purpose, and examples thereof include human, mouse, etc. Sequence information of the MafA gene can be obtained from a known database, and for example, it is available from NCBI under accession numbers NM_201589 (human) and NM_194350 (mouse).
[0028] (Other Genes or Gene Products Thereof) In this embodiment, the other genes or gene products thereof are not particularly limited and can be appropriately selected depending on the purpose, as long as they do not impair the effects of this embodiment. The sequences of the mutant Glis1 gene, Neurogenin3 gene, Pdx1 gene, MafA gene, and other genes may consist of only the protein-encoding portion of each gene's sequence, or may include sequences other than the protein-encoding portion. Furthermore, the mutant Glis1 gene and its gene products, Neurogenin3 gene and its gene products, Pdx1 gene and its gene products, MafA gene and its gene products, and other genes and their gene products may further contain mutations as long as the effects of the present invention are not impaired. Examples of such mutations include mutations that do not affect the amino acid sequence of the protein of each gene, and mutations in which one or several (2 to 5) amino acids are deleted, substituted, inserted, or added in the amino acid sequence of the protein of each gene. The sequence identity of the mutant Glis gene or its gene product, Neurogenin3 gene or its gene product, Pdx1 gene or its gene product, MafA gene or its gene product, and other genes or their gene products with mutations to the wild type is not particularly limited as long as it does not impair the effects of the present invention and can be selected appropriately depending on the purpose, but in the base sequence of the part translated into protein, 70% or more is preferred, 80% or more is more preferred, and 90% or more is particularly preferred.
[0029] (Configuration of Expression Vector) As described above, the expression vector of this embodiment is a Tet-controlled expression regulatory vector having a region including the TRE3G promoter, and has the MafA gene and the Pdx1 gene inserted upstream of the TRE3G promoter, and the Neurogenin3 gene and the Glis1 gene or the mutant Glis1 gene inserted downstream of the TRE3G promoter.
[0030] A preferred example of this expression vector is the pTRE-OKAP vector into which genes are inserted in the following order from upstream: the Pdx1 gene, the MafA gene, the TRE3G promoter, the Neurogenin3 gene, and a fusion gene of the Glis1 gene or the mutant Glis1 gene and the Ert gene.
[0031] In the expression vector, at least a part of the gene constituting the insulin-producing cell-inducing factor may be a fused gene with the Ert gene.
[0032] Preferably, the expression vector further contains the rtTA or tTS gene. By incorporating an expression cassette for the rtTA gene into the same vector, expression can be under the control of a tissue-specific promoter. By incorporating an expression cassette for the tTS gene into the same vector, expression can be under the control of a ubiquitous promoter.
[0033] [Insulin-producing model animal] The insulin-producing model animal of this embodiment is an animal into which the expression vector has been introduced. That is, it is a model animal capable of expressing the insulin-producing cell-inducing factor. The model animal can be appropriately selected as long as it is in a form that expresses the insulin-producing cell-inducing factor. Specifically, the insulin-producing model animal of this embodiment is an insulin-producing model animal that is a model animal capable of expressing an insulin-producing cell-inducing factor consisting of a mutant Glis1 gene, a Neurogenin3 gene, a MafA gene, and a Pdx1 gene.
[0034] Known methods can be used to enable the model animal to express the insulin-producing cell-inducing factor, for example, by introducing the expression vector into the model animal.
[0035] For example, it is preferable that the insulin-producing cell-inducing factor be expressed by administering doxycycline (DOX) to the model animal. As such a means, in this embodiment, a certain gene is introduced into the model animal using a Tet on / off system, and the expression is enabled by administering doxycycline to the model animal. A known plasmid vector can be used as a means for introducing a certain gene into the model animal using the Tet on / off system. In this embodiment, a Tet-regulated expression vector is used.
[0036] Furthermore, for example, at least a part of the insulin-producing cell-inducing factor is preferably designed so that the gene product is transferred into the cell nucleus of the model animal when tamoxifen (TAM) is administered to the model animal. Here, tamoxifen also includes its derivatives (e.g., 4-hydroxytamoxifen (4OHT)).
[0037] Insulin-producing cell-inducing factors produce insulin when all genes are expressed, but by administering another compound, it is possible to express only a portion of the genes or allow them to migrate into the cell nucleus, thereby shifting the timing of the expression of each gene. Therefore, it has the advantage of safely expressing a portion of the genes in the living body of a model animal, and since it can function for a long period of time, it is useful for in vivo research. Specifically, when the gene to be migrated into the cell nucleus by tamoxifen is introduced into the plasmid vector, it is introduced as a gene fused with the Ert2 gene. The ERT2 protein, a mutant of the tamoxifen-responsive estrogen receptor, does not migrate into the nucleus before tamoxifen administration, but migrates upon receiving tamoxifen, so the product of the fused gene can be migrated into the nucleus by tamoxifen.
[0038] In this embodiment, the Neurogenin3 gene, the MafA gene, and the Pdx1 gene are introduced into a vector capable of expression using the Tet on / off system, and the mutant Glis1 gene is fused with the Ert2 gene and introduced into the vector (Ert2-K, a combination of Ert2 and K factor). In a model animal into which these genes have been introduced, upon administration of doxycycline, the Neurogenin3 gene, the MafA gene, the Pdx1 gene, and Ert2-K are expressed, but Ert2-K does not translocate into the nucleus, resulting in the production of insulin. Furthermore, upon administration of tamoxifen to this model animal, Ert2-K translocates into the nucleus, resulting in the production of insulin.
[0039] The animal used as the model animal in this embodiment is not particularly limited as long as it is an animal other than a human, but is preferably a mammal, and more preferably a rodent (Rodentia). Animals classified as mammals include goats, pigs, dogs, cats, mice, rats, guinea pigs, hamsters, and rabbits. Animals classified as rodents include mice, rats, guinea pigs, and hamsters. In this embodiment, mice are particularly used as the model animal.
[0040] [Method for producing insulin-producing model animal] In the method for producing an insulin-producing model animal of this embodiment, an insulin-producing cell-inducing factor containing a mutant Glis1 gene, a Neurogenin3 gene, a MafA gene, and a Pdx1 gene is introduced into the animal to produce an insulin-producing model animal.
[0041] Known methods may be used to introduce the insulin-producing cell-inducing factor into the model animal. For example, known methods for designing and introducing the various vectors may be used. In this embodiment, an insulin-producing model animal is obtained by introducing the expression vector. A specific method for introduction may be, for example, introducing a gene containing the vector into a fertilized egg of the model animal. More specifically, the gene may be introduced into a fertilized egg of the model animal by microinjection or the like.
[0042] [Insulin Production Method] In the insulin production method using the insulin-producing model animal of this embodiment, an insulin-producing cell-inducing factor including the mutant Glis1 gene, the Neurogenin3 gene, the MafA gene, and the Pdx1 gene is expressed in the insulin-producing model animal.
[0043] Specifically, the gene may be expressed by administering doxycycline or tamoxifen to the insulin-producing model animal in the tissue where insulin is to be induced. As described above, when each gene is introduced into a vector capable of expression using the Tet on / off system and then introduced into a model animal, the insulin-producing cell-inducing factor can be expressed by administering doxycycline to the model animal. Furthermore, when some genes, such as the mutant Glis1 gene in the above example, are fused with the Ert2 gene and expressed, the mutant Glis1 gene can be translocated into the cell nucleus by administering tamoxifen to the model animal, allowing insulin to be produced.
[0044] The conditions for administering the compound that triggers insulin production to the model animal, i.e., the amount and frequency of administration of doxycycline and / or tamoxifen in this embodiment, may be appropriately selected for each model animal into which the gene has been introduced, depending on factors such as the efficiency of insulin production. As a guideline, the dose of doxycycline can be selected from 0.5 to 5.0 mg / kg, more preferably 1.0 to 2.0 mg / kg, and more preferably 1.1 to 1.6 mg / kg. This amount may be administered in multiple divided doses. The dose of hydroxytamoxifen (4OHT) can be selected from 0.5 to 10 mg / kg, more preferably 1.0 to 5.0 mg / kg, and even more preferably 1.78 to 3.6 mg / kg. This amount may be administered in multiple divided doses. The dose of tamoxifen can be selected from 1.0 to 50 mg / kg, preferably 2.0 to 10 mg / kg, and more preferably 1.78 to 4 mg / kg.
[0045] In this embodiment, doxycycline or tamoxifen, which triggers insulin production, is effective even in very small doses as described above, and insulin is produced in various tissues of the model animal, such as the skin where it is administered, as well as in organs and serum. Therefore, there is an advantage in that side effects that occur when a large amount of the compound is administered are unlikely to occur.
[0046] In the insulin production method of this embodiment, the doxycycline or tamoxifen may be administered by contacting it with the body surface of the insulin-producing model animal. Specifically, when doxycycline or tamoxifen is administered to express the gene or translocate it into the nucleus to function, doxycycline or tamoxifen may be rapidly absorbed into the body if administered by injection, etc. As a result, the drug may reach multiple organs via capillaries in a short time, making analysis difficult. Therefore, a method of localized expression was developed. Furthermore, doxycycline has been known to have side effects in the body, so rapid absorption may be undesirable in some cases. Therefore, by contacting these compounds with the body surface of the model animal, for example, and allowing them to be ingested through the body surface, gradual absorption can be suppressed, thereby suppressing rapid absorption.
[0047] The doxycycline or tamoxifen is preferably administered in a sustained-release or similar form. For example, the administration may be performed by soaking a structure such as a sponge, gauze, or compress with the doxycycline or tamoxifen and applying it to the skin to allow it to soak in. Alternatively, the doxycycline or tamoxifen may be administered using a pump container that releases its contents in small amounts over time. For example, a pump container that releases 0.1 to 10 μl of aqueous solution every hour may be fixed to the model animal, and administration may be performed.
[0048] A specific aspect of the insulin production method of this embodiment, for example, is a technique using the above-mentioned insulin-producing animal and its production method, in which a fusion gene of the Neurogenin3 gene, the MafA gene, the Pdx1 gene, the mutant Glis1 gene, and the Ert gene is introduced into the model animal so that it can be expressed by a Tet on / off system, doxycycline is administered to the insulin-producing model animal, and then tamoxifen is administered to the insulin-producing model animal.
[0049] (Effects of this embodiment) According to this embodiment, insulin-producing cells can be produced directly in vivo in an animal, and animals having insulin-producing tissues can be produced by simple procedures. It is therefore possible to provide an expression vector useful for medical research, an insulin-producing model animal, a method for producing the same, and an insulin production method using the same.
[0050] By creating an insulin-producing model animal using the expression vector of this embodiment, insulin can be produced with high reproducibility simply by administering compounds such as doxycycline and tamoxifen. Furthermore, administration of a very small dose of doxycycline, such as 1.1 to 1.6 mg / kg, can induce insulin production almost throughout the body, minimizing the side effects of doxycycline and other compounds. Insulin production by this embodiment has also been confirmed to reduce blood glucose levels in diabetic model mice, making it useful for diabetes research.
[0051] Other insulin production methods exist, primarily based on stem cell therapy (in vitro) to generate iPS cell-derived β cells (e.g., US 10,253,298 B2 , US 985,917 B2 ). Compared to these conventional techniques, the present embodiment allows for the direct generation of insulin-producing cells in vivo, which is expected to avoid the difficulties and challenges inherent in drug discovery technology development, such as avoiding the high cost of cell production and the risks of in vitro genetic mutation and cell phenotype changes. Furthermore, because allogeneic cell transplantation requires large amounts of immunosuppressants to avoid tumorigenicity and immune rejection, this model offers a valuable cell fate conversion model that surpasses conventional technology models and reduces side effects such as infection and carcinogenesis.
[0052] As shown in the examples, the reproducibility of the blood glucose level improvement effect was confirmed in the insulin-producing animal model of this embodiment. Insulin protein was detected in tissues other than the pancreas, demonstrating that this is a highly reproducible technique. These results suggest that this method can be used to develop or apply highly efficient and sustainable blood glucose improvement treatments through early intervention using in vivo DR therapy.
[0053] Although the embodiment of the present invention has been described above, the present invention is not limited to the above embodiment and various modifications can be made.
[0054] The effects of the present invention will be made clearer by the following examples and comparative examples. Note that the present invention is not limited to the following examples, and can be practiced by making appropriate changes within the scope of the present invention.
[0055] (Generation of insulin-producing model mice) A vector was designed using the Tet-regulated expression regulatory vector pTRE-Tight-BI-ZsGreen1 Vector (TAKARA Bio, PT3875-5, catalog number 631067). FIG. 1 is a schematic diagram of the introduction site of the designed vector. The MafA gene (A factor) and Pdx1 gene (P factor) were inserted upstream of the TRE3G promoter region of the vector. The Neurogenin3 gene (O factor) and a fusion gene (Ert2-K) of the Ert2 gene and a mutant Glis1 gene (K factor), which is the ΔK2 gene set forth in SEQ ID NO: 1, were inserted downstream of the region to create the pTRE-OKAP vector. The pTRE-OKAP vector was introduced into fertilized eggs by microinjection to generate OKAP mice.
[0056] Dlx5-tet3G mice (expressing Dlx5 specifically in mesenchymal stem cells) and CAG-rtTA3 mice (expressing reverse tetracycline transactivator 3 throughout the body) were generated, and ins-Luc mice (in which luciferase is inserted downstream of insulin) were generated based on T. Katsumata et al., Plos One 2013 Apr 4;8(4):e60411. By mating these mice, the following mice were obtained: OmDm, or OD (OKAP (+ / +) / Dlx5-tet3G (+ / +)), OtCt, or OC (OKAP (+ / -) / CAG-rtTA3 (+ / -)), OtCtLt, or OCL (OKAP (+ / -) / CAG-rtTA3 (+ / -) / ins-Luc (+ / -)), OtLt, or OL (OKAP (+ / -) / ins-Luc (+ / -)). Since the pTRE-Tight-BI-ZsGreen1 Vector is expressed in response to tetracycline, OKAP can be expressed in mice carrying the tetracycline-expressing gene, in this example, Dlx5-tet3G, CAG-rtTA3.
[0057] (Test Example 1) (DOX and TAM Administration Test for Insulin-Producing Model Mice) Figure 2 shows the DOX and TAM administration test for OD mice in this example. For the individual shown as OD-75 in the figure, a resin pump container was implanted onto the skin of the back and abdomen, and the DOX solution from the pump container came into contact with the mouse and was gradually administered through the skin. TAM was injected subcutaneously separately. A volume of 200 μl of doxycycline (DOX) was adjusted to 43.16 mg / kg and injected into the resin dorsal pump container, which was then tightly capped with a metal fastener and fixed to the back. Simultaneously, 28.11 mg / kg of tamoxifen (TAM) was administered subcutaneously at the same site. In addition, a total of 21.45 mg / kg of DOX was prepared in a separate abdominal pump container to a volume of 100 μl and fixed to the abdominal cavity side. The pump released 3.06 mg / kg of DOX per day. At the same time, 28.11 mg / kg of TAM was administered subcutaneously at the same site. 43.15 mg / kg of DOX and 28.11 mg / kg of TAM were administered orally (p.o. in the figure).
[0058] In the animals shown as OD-77 and OD-78 in the figure, DOX was slowly released into the skin using a sponge soaked in it, and TAM was injected subcutaneously. The sponge was made of silk with a mesh size of 100-200 μm, and was approximately 4 × 9 × 10 mm 3 The sponge was cut into pieces and gas sterilized. 200 μl of a predetermined amount (mg / ml) of DOX was placed in a 24-well, and the sponge was immersed in the liquid to absorb it. The amount of residual liquid was measured to calculate the amount absorbed by the sponge. The sponge was then implanted into the right shoulder of the back.
[0059] The pump container and sponge were implanted into mice by administering 5 μl / g of triple-anesthesia, shaving with an electric shaver, and thoroughly removing hair with depilatory cream. After disinfection with isodine, a few millimeters of hair were cut around the right shoulder with scissors, and the subcutaneous space was opened with curved forceps, into which the pump or sponge was inserted. For subcutaneous injection (s.c. in the figure), 100 μl of insulin was taken into a syringe containing a predetermined amount of insulin dissolved in 1 ml, and slowly injected subcutaneously over approximately 10 seconds.
[0060] Next, various organs were collected from each mouse, and insulin expression levels were examined. Because OD mice express both OKAP and ZSGreen, they glowed green under a stereofluorescence microscope. The glowing areas were collected, and non-glowing areas were also collected as controls. The collected tissues were collected as RNA samples in 1.5 ml tubes containing 500 μl of RNAiso Plus (Takara). The tissues were homogenized using a homogenizer and stored at -80°C until RNA extraction. The tissues were then fixed in 4% PFA and collected for use in paraffin tissue sections. RNA extraction was performed according to the protocol, and cDNA synthesis was performed using RevetraAce (Toyobo). Expression analysis of various mRNAs was performed using the synthesized cDNA (equivalent to 500 ng / 10 -> 1 / 10 = 10 ng) for qPCR. Normalization was performed using GAPDH.
[0061] Figure 3 shows the results of an analysis of insulin expression levels in each organ of mice administered via a pump container. (a) shows the RNA expression levels of mIns1 and mIns2 (mouse insulin) in the skin of an OD-75 mouse, and (b) in the intestine. Both figures show control tissue from an OD-82 mouse that does not glow green. (c) shows the site of OD-75 mouse skin where the tissue in (a) was administered. The results of the figure show that two types of mouse insulin RNA were expressed in the skin and intestine of mice administered DOX via skin contact via a pump container and TAM subcutaneously, resulting in tissue luminescence and OKAP factor expression. Furthermore, insulin was not expressed in the skin and intestine of OD-82 mice where OKAP factor was not expressed. These results demonstrate that insulin expression occurs in OD mice upon administration of DOX and TAM, and that this expression correlates with OKAP factor expression.
[0062] Figure 4 shows the results of an analysis of insulin expression levels in each organ of mice administered with sponges. (a) is a diagram showing the RNA expression levels of mIns1 and mIns2 (mouse insulin) in the skin of OD-77 mice. As a control, the back tissue of an OD-82 mouse that did not glow green is shown. (b) shows the skin of an OD-75 mouse where tissue was administered in (a) (skin 1-3). The results in the figure show that two types of mouse insulin RNA were expressed in the tissues and organs of mice administered DOX via skin contact with a sponge and TAM subcutaneously, resulting in tissue luminescence and OKAP factor expression. Furthermore, insulin was not expressed in the areas of OD-82 mice where OKAP factor expression was not observed. These results demonstrate that insulin expression occurs in OD mice upon administration of DOX and TAM, and that this expression correlates with OKAP factor expression.
[0063] (Test Example 2) (Comparative Test of Body Surface Administration by Pump and Sponge) Using OC(OKAP x CAG-rtTA3) (OtCt hetero) mice, tests were conducted on administration conditions such as body surface implantation of a pump container and a sponge. For OC-134 mice (male, 15 weeks old), a gas-sterilized sponge similar to that used in Test Example 1 was immersed in 400 μl of 1 mg / ml DOX, and the amount of DOX permeated into the sponge was calculated from the remaining amount. This sponge was then implanted into the back and groin of OC-134 mice (male, 15 weeks old). A pump container was implanted into the back of OC-142 mice (male, 14 weeks old) to administer DOX from the pump container at 1.6 mg / kg / day. Day 0 was defined as the day of implantation, and administration was performed from days 1 to 3 for OC-134 and from days 1 to 6 for OC-142.
[0064] OC-134 received 230 μl of 1 mg / ml DOX administered to the back and 355 μg administered to the groin, for a total of 675 μg, or 21 / 87 mg / kg. Additionally, 200 μg of 1 mg / ml 4OHT (4-hydroxytamoxifen) was subcutaneously injected, for a total of 6.48 mg / kg. OC-142 received 200 μl of 2 mg / ml DOX administered to the back, for a total of approximately 1.6 mg / kg / day. 1 mg / ml of 4OHT was equivalent to 0.6 mg, for a total of 19.3 mg / kg. Figure 5 shows photographs of the morphology of OC-134 and OC-142 mice upon administration.
[0065] After administration, skin and surrounding tissues around the administration site were collected as in Test Example 1, and the expression of ZsGreen (i.e., OKAP factors) was examined. Figure 6 shows photographs of the skin of an OC-134 mouse to which DOX was administered via sponge. (a) shows the area around the sponge implanted on the back, and (b) shows the area after the sponge was removed, at a magnification of 6.3x. As shown in the figure, green coloration can be observed around the sponge and the area that had been in contact with it after its removal, confirming the expression of ZsGreen, i.e., the expression of OKAP factors. (c) is a partial enlarged view of the area around the sponge in (b), at a magnification of 6.3x. Green coloration can also be observed in the fascia surrounding the area that had been in contact with the sponge, confirming the expression of ZsGreen, i.e., the expression of OKAP factors. (d) is a view of the area around the sponge implanted in the groin, at a magnification of 1.0x. (e) is a partial enlarged view of (d), at a magnification of 6.3x. In both cases, strong expression of ZsGreen, ie, expression of OKAP factors, was confirmed.
[0066] Figure 7 is a photograph of the skin of an OC-142 mouse to which DOX was administered via a pump container. (a) shows the area around the pump implanted on the back, at a magnification of 1.0x. As shown in the figure, green coloring can be confirmed in the area that had been in contact with the pump, confirming the expression of ZsGreen, i.e., the expression of OKAP factors. (b) is a partial enlargement of the area around the area in (a) that had been in contact with the pump, at a magnification of 8.0x. A pronounced green coloring can be confirmed, confirming the expression of ZsGreen, i.e., the expression of OKAP factors.
[0067] (Test Example 3) (Investigation of optimal DOX concentration) The optimal DOX concentration was investigated using OCL (OKAPxCAG-rtTA3xins-Luc) to observe the in vivo DR effect through long-term follow-up observation using IVIS analysis. The OtCtLt (OKAPxCAG-rtTA3xIns-Luc) heterozygotes, male, 8 weeks old, were used. Condition 1 (OCL001): DOX 1.6 mg / kg (48 μg / day) administered by pump, 4OHT 100 μg subcutaneous injection Condition 2 (OCL002): DOX 7 mg / kg (245 μg / day) administered by pump, 4OHT 100 μg subcutaneous injection Condition 3 (OCL003, OL004): 35 mg / kg (1 mg) DOX and 70 mg / kg (2 mg) TAM were simultaneously administered by subcutaneous injection.
[0068] Pumps similar to those used in Test Example 1 were implanted subcutaneously on the backs of mice. Mice receiving subcutaneous administration were also prepared. Figure 8 shows photographs of mice receiving subcutaneous administration and mice receiving pumps (OCL001, OCL002) and subcutaneous administration (OCL003, OL004), respectively.
[0069] Figure 9 is a photograph showing the induction of ectopic insulin-producing cells in OCL mice. Observations were performed 9 hours after 4OHT administration under conditions 1 and 2. The intensity of the luciferase signal (fluorescence intensity) was detected by in vivo imaging using IVIS analysis. OCL mice are a cross between OC and Luc mice, in which the luciferase gene has been inserted downstream of insulin, so ectopic insulin expression can be observed by Luc activity. OL mice are a comparative example in which the CAG-rtTa3 gene has not been introduced. In all OCL001-003 mice under conditions 1 to 3, ectopic insulin expression was confirmed at the sites of DOX, 4OHT, or TAM administration.
[0070] Next, the expression level of insulin in the OCL mice was examined. Muscle membranes were collected from OCL002 and OL004 mice. To measure insulin content, the muscle membranes were placed in 300 μl of PBS, minced with scissors, and sonicated (on ice) at output 3 for 10 seconds three times. A portion was collected for protein quantification, and the remaining sample was vortex-mixed with 600 μl of acid ethanol and incubated overnight at 4°C. The following day, the sample was vortexed and centrifuged at 3500 rpm for 10 minutes. The supernatant was collected and diluted 1 / 5 for ELISA. ELISA was performed using the LBIS ultra sensitive mouse insulin kit (Mouse insulin U type elisa LBIS, Cat: 633-03411, Lot MIU-22k1, Exp: Oct 2023, unit: pg / mL) according to the protocol. Protein quantification was performed using a BCA kit and corrected.
[0071] The OD450nm of the OCL-2 muscle membrane sample was 0.149, pg / mL was 153.6305, mg protein was 1.124227, and pg / mg protein was 683.2718. The OD450nm of the OL-4 muscle membrane sample was 0.119, pg / mL was 74.58384, mg protein was 1.168133, and pg / mg protein was 319.2437. Figure 10 is a graph of the pg / mg protein of insulin for each muscle membrane sample. These results demonstrate that insulin induction in this example was also demonstrated in terms of protein amount, demonstrating that insulin protein can be induced in ectopic tissues other than the endodermal system by in vivo direct reprogramming.
[0072] (Test Example 4) (Study of Sustained Insulin Supply) Rapid expression of all four OKAP factors may lead to a decrease in the insulin production ability of model animals. However, in this embodiment, expression can be achieved by administering DOX, while nuclear translocation of K factors can be controlled by TAM (or 4OHT). In this embodiment, the sustainability of insulin production was investigated. OCL mice (OCL-6) were administered DOX (1.0 mg / kg) from day 3, followed by 100 μg of 4OHT (3.5 mg / kg) one day later and 50 μg of 4OHT (1.7 mg / kg) seven days later. Each administration was performed using a pump in the same manner as in Test Example 1.
[0073] 11 is a photograph showing the persistence of ectopic insulin production in OCL mice. As in Test Example 3, insulin production was detected from the luciferase signal. In the figure, "Day" indicates the number of days after the start of DOX administration, and days 1 and 7 represent the first and second administrations of 4OHT. As shown in the figure, the insulin production signal became stronger on day 7 (7 days after the first 4OHT administration), and there was almost no decrease in the signal on day 12 (5 days after the second 4OHT administration). Although not shown, the signal was observed up to day 19. These results demonstrate that the model animal of this embodiment can maintain insulin production ability for a long period of time.
[0074] (Test Example 5) (Hypoglycemic Effect of OKAP-Introduced Mice) The hypoglycemic effect of insulin production was investigated in mice with insulin production capacity due to OKAP introduction. DOX and 4OHT were administered to OC (OKAP / CAG-rtTA3) mice and control O (Om, OKAP / -) mice in the same manner as in Test Example 1. On day 0 (the day of transplantation), 1.2 mg / kg of DOX and 50 μg of 4OHT were administered. One day later, 4 μg of TAM was administered. On day 3, 100 μg (3 mg / kg) of DOX and 1 mg of TAM were administered. On day 4, 50 μg of DOX and 0.5 mg of TAM were administered. Blood glucose levels were measured in these mice using a StatStrip Glucose System (Siemen Healthcare).
[0075] Figure 12 is a graph comparing the blood glucose lowering effects. As shown in the figure, a significant decrease in blood glucose levels was observed in OC mice, which express OKAP factors, compared to O mice, which do not express OKAP factors. This result confirmed that insulin production in OC mice also reduces blood glucose levels.
[0076] Figure 13 is a graph comparing the blood glucose lowering effects of multiple mouse models. The blood glucose levels after 1 to 5 days are shown for five O mice and seven OC mice. The OC mice tended to have lower blood glucose levels than the O mice. Administration of TAM after 1.2 mg / kg of DOX resulted in an improvement in blood glucose levels within 16 to 48 hours.
[0077] Next, plasma was collected from Om(O) mice and OmCt(OC) mice, and the insulin levels in the plasma were examined. Four days after the DOX administration, plasma was collected, and the insulin levels in each plasma were determined by ELISA in the same manner as in Test Example 3. Figure 14 is a graph showing the insulin levels in the plasma. A significant increase in plasma insulin was observed in OC mice compared to O mice.
[0078] Next, the insulin protein content was examined in each organ of the Om(O) mice and OmCt(OC) mice. Five days after the above-mentioned DOX administration, each organ was collected, and the insulin content in each organ was determined by ELISA in the same manner as in Test Example 3. Figure 15 is a graph showing the insulin content in each organ. (a) duodenum, (b) colon, (c) small intestine, (d) appendix, and (e) kidney are shown. The vertical axis indicates the pg / ml / mg protein content of insulin, respectively. In each organ, a significant increase in insulin was observed in the OC mice compared to the O mice.
[0079] Next, insulin RNA levels were examined in each organ of Om (O) mice and OmCt (OC) mice. Five days after the DOX administration, each organ was collected, and insulin RNA levels in each organ were determined in the same manner as in Test Example 1. Figure 16 is a graph showing insulin (mIns1) RNA levels in each organ. (a) and (b) show the RNA levels for each organ, and (c) shows the RNA level in the kidney. As in Figure 15, significant increases in mIns1 RNA levels were observed in the duodenum (Duo), small intestine (Int), colon (Col), appendix (App), kidney (Kidney), and fascia (MM) of OC mice compared to O mice.
[0080] (Test Example 6) (Hypoglycemic Effect of T1D-OKAP-Introduced Mice) OKAP factor was introduced into T1D model mice (non-obese diabetic mice), and the effect of insulin production on blood glucose levels was examined. Genetically modified mice were generated by introducing the OC (OKAP / CAG-rtTA3) gene and the O (Om, OKAP / -) gene as a control into T1D model mice using the same method as in Test Example 1 (OC-162, 170, 179, 211, 217, 187, 198, 199, 201). DOX and 4OHT were administered to these mice using the same method as in Test Example 1. On day 0 (the day of transplantation), 1.5 mg / kg of DOX and 50 μg (1.6 mg / kg) of 4OHT were administered. 1, 2, and 3 days later, 25 μg or 50 μg of TAM were administered. Blood glucose levels were measured for these mice using the same method as in Test Example 5. Additionally, for individuals whose blood glucose levels had dropped too low, TAM was not administered on the first, second, or third day.
[0081] FIG. 17 is a graph showing the blood glucose lowering effect of T1D-OKAP-introduced mice. (a) shows a comparison of blood glucose levels between OC mice of this test example and control O mice. The OC mice showed a significant decrease in blood glucose levels. In particular, after three days, the blood glucose levels were reduced to a normal casual blood glucose level (200 mg / dL) compared to the control (700 mg / dL). (b) shows a comparison of blood glucose levels for multiple OC mice. As an overall trend, blood glucose levels tended to decrease from immediately after administration of TAM to half a day later. (c) shows the weight change for the OC mice in (b). Overall, weight loss was observed in all mice. These results demonstrate that the present embodiment improved insulin production and blood glucose levels in diabetic model mice, demonstrating its high effectiveness in research into the improvement of diabetes.
[0082] (Test Example 7) (Immunostaining of insulin expression in each organ) Each organ tissue of OC mice was immunostained with an anti-insulin antibody to analyze expression. OC176 and OC202 mice (male, 12-18 weeks old) were administered 1.2 mg / kg of DOX and 1.6 mg / kg of TAM by the method of Test Example 1, and mice were used 4 days after TAM administration. OC176 was used as a control because no green signal of ZsGreen was observed in the organs used and it was assumed that the OKAP factor was not expressed.
[0083] The tissues were fixed with 4% PFA and then paraffin sections were prepared. After deparaffinization, the sections were permeabilized with 0.1% triton / PBS and then blocked with 4% goat serum / PBS for 30 minutes at room temperature. The primary antibody, anti-insulin, was diluted 400-fold to prepare Immunoshot Strong solution, which was then incubated overnight at 4°C. The following day, the sections were washed with PBS and then treated with the secondary antibody for 1 hour at room temperature. After a PBS wash, the sections were mounted with DAPI-containing mounting medium. Images were taken using a TCS-5 Leica confocal microscope.
[0084] Figure 18 is a photograph of immunostained duodenal tissue from an OC mouse. The magnification is approximately 40x. (a) is OC176, and (b) is OC202. OC202 exhibits a stronger signal than the control OC176.
[0085] Figure 19 is a photograph of immunostained small intestinal tissue from an OC mouse. The magnification is approximately 40x. OC202 tissue is shown, with signals present in the intestine. These results demonstrate that insulin is strongly expressed in the intestinal tract of OC202 mice.
[0086] Figure 20 is another photograph of immunostained small intestinal tissue from an OC mouse. OC202 tissue is shown, and the bar indicates 75 μm. Light colors indicate insulin antibody, and gray colors indicate DAPI staining.
[0087] Figure 21 is another photograph of immunostained small intestinal tissue from an OC mouse. Both (a) and (b) show OC202 tissue; the bar is 50 μm and the magnification is approximately 63x. Light color indicates the arrow (insulin antibody), and gray indicates DAPI staining. As shown in Figures 20 and 21, insulin signals are observed in areas different from those stained by DAPI, which primarily stains cell nuclei, indicating that insulin is expressed in the cytoplasm rather than the nucleus.
[0088] Although the embodiments of the present invention have been described above, these embodiments are presented as examples and are not intended to limit the scope of the invention. These embodiments can be embodied in various other forms, and various omissions, substitutions, and modifications can be made without departing from the spirit of the invention. These embodiments and their modifications are included within the scope and spirit of the invention, as well as within the scope of the invention and its equivalents as defined in the claims.
[0089] According to the present invention, insulin-producing cells can be produced directly in vivo in an animal, and animals having insulin-producing tissues can be produced by simple procedures. It is also possible to provide an expression vector useful for medical research, an insulin-producing model animal, a method for producing the same, and an insulin production method using the same.
Claims
1. An expression vector for enabling expression of an insulin-producing cell-inducing factor comprising the Glis1 gene or mutant Glis1 gene, the Neurogenin3 gene, the MafA gene, and the Pdx1 gene, which comprises a Tet-controlled expression regulatory vector having a region including the TRE3G promoter, and into which the MafA gene and the Pdx1 gene are inserted upstream of the TRE3G promoter, and the Neurogenin3 gene and the Glis1 gene or mutant Glis1 gene are inserted downstream of the TRE3G promoter.
2. The expression vector according to claim 1, wherein the mutated Glis1 gene is the ΔK2 gene set forth in SEQ ID NO:
1.
3. The expression vector according to claim 1 or 2, wherein at least a portion of the gene constituting the insulin-producing cell-inducing factor is a fusion gene with the Ert gene.
4. The expression vector according to claim 3, which is a pTRE-OKAP vector into which genes have been inserted in the following order from upstream: the Pdx1 gene, the MafA gene, the TRE3G promoter, the Neurogenin3 gene, and the Glis1 gene or a fusion gene of the mutant Glis1 gene and the Ert gene.
5. The expression vector of claim 1 or 2, further comprising an rtTA or tTS gene.
6. An insulin-producing model animal into which the expression vector according to claim 1 or 2 has been introduced.
7. The insulin-producing model animal according to claim 6, wherein the insulin-producing cell-inducing factor can be expressed by administering doxycycline to the insulin-producing model animal.
8. The insulin-producing model animal described in claim 6, wherein at least a portion of the gene constituting the insulin-producing cell-inducing factor is designed so that the gene product is transported into the cell nucleus of the insulin-producing model animal when tamoxifen is administered to the insulin-producing model animal.
9. The insulin-producing model animal according to claim 6, wherein the insulin-producing model animal is a mouse.
10. A method for producing an insulin-producing model animal, which comprises introducing the expression vector of claim 1 or 2 into an animal.
11. A method for producing insulin using the insulin-producing model animal described in claim 6, comprising introducing the insulin-producing cell-inducing factor into the insulin-producing model animal to cause the insulin-producing model animal to produce insulin.
12. The method for producing insulin according to claim 11, wherein doxycycline or tamoxifen is administered to the insulin-producing model animal in a tissue where insulin is to be induced.
13. The insulin production method according to claim 12, wherein the doxycycline or tamoxifen is administered by contacting it with the body surface of the insulin-producing model animal.
14. The method for producing insulin according to claim 11, wherein the insulin-producing cell-inducing factor is introduced into the insulin-producing model animal so that it can be expressed by a Tet on / off system, and doxycycline is administered to the insulin-producing model animal, and then tamoxifen is administered to the insulin-producing model animal.
Citation Information
Patent Citations
Pancreatic endocrine cells, method for producing same, and transdifferentiation agent
WO2016002937A1
Method for producing pancreatic endocrine cells, and transdifferentiation agent
WO2017073740A1