QTL related to high-temperature tolerance trait of gossypium hirsutum l., molecular marker and use thereof

Abstract

The present invention belongs to the technical field of biological agriculture, and specifically relates to a QTL related to the high-temperature tolerance trait of Gossypium hirsutum L., and a molecular marker and the use thereof. Provided are a QTL related to the high-temperature tolerance trait of Gossypium hirsutum L. and a molecular marker thereof. The QTL comprises one or more of qPV-A01-1, qPV-D01-1, qPV-D05-1 and qPV-D12-1. The QTL is significantly related to the high-temperature tolerance trait of Gossypium hirsutum L. Moreover, on the basis of a molecular marker tightly linked to the QTL, a corresponding primer and detection kit are designed, and a method for identifying high-temperature-tolerant Gossypium hirsutum L. is further provided, thereby realizing the identification and screening of high-temperature-tolerant Gossypium hirsutum L.

Description

QTLs, molecular markers related to high temperature tolerance trait of gossypium hirsutum and application thereof

[0001] The present application claims priority to the Chinese patent application No. CN202410447186.9, filed on April 13, 2024, and entitled "A set of QTLs, molecular markers related to high temperature tolerance trait of gossypium hirsutum and application thereof", the content of which is incorporated herein by reference in its entirety. TECHNICAL FIELD

[0002] The present application belongs to the field of biological agricultural technology, and specifically relates to QTLs, molecular markers related to high temperature tolerance trait of gossypium hirsutum and application thereof. BACKGROUND

[0003] High temperature weather can cause male sterility of cotton and thus lead to yield reduction of cotton, which restricts the development of cotton industry. Cultivating high temperature tolerant cotton varieties and improving the high temperature resistance of existing cotton varieties are one of the needs of the current cotton industry system in China. However, the existing technical research found that the high temperature resistance phenotype of anther of cotton is a complex agronomic trait regulated by quantitative trait loci (QTLs), and the performance thereof is additive. At the same time, due to the instability of the high temperature resistance phenotype of anther of cotton and the non-standardized investigation technology, there is no report on cloning and identification of QTLs or major loci of high temperature resistance of cotton.

[0004] SUMMARY

[0005] The present application aims to provide QTLs, molecular markers related to high temperature tolerance trait of gossypium hirsutum and application thereof, which can not only accurately predict and screen high temperature tolerant gossypium hirsutum, but also realize breeding of ideal plant type of cotton.

[0006] In order to achieve the above-mentioned purpose, the present application provides the following technical solutions:

[0007] The present application provides QTLs related to high temperature tolerance trait of gossypium hirsutum, which include one or more of qPV-A01-1, qPV-D01-1, qPV-D05-1 and qPV-D12-1; the qPV-A01-1 is located between 8809583bp and 9369583bp of chromosome A01 of the gossypium hirsutum genome; the qPV-D01-1 is located between 8105035bp and 8665035bp of chromosome D01 of the gossypium hirsutum genome; the qPV-D05-1 is located between 23545179bp and 24105179bp of chromosome D05 of the gossypium hirsutum genome; the qPV-D12-1 is located between 42381640bp and 42941640bp of chromosome D12 of the gossypium hirsutum genome; the version of the gossypium hirsutum genome is TM-1_HZAU.v1.1.

[0008] The application provides a molecular marker closely linked to the QTL described in the above technical solution, and the molecular marker comprises one or more of qPV-A01-9089583-A / G, qPV-D01-8385035-T / G, qPV-D05-23825179-G / A and qPV-D12-42661640-A / T; the qPV-A01-9089583-A / G is located at the 9089583th base of the A01 chromosome of the Gossypium hirsutum genome, and the 9089583th base is A or G; the qPV-D01-8385035-T / G is located at the 8385035th base of the D01 chromosome of the Gossypium hirsutum genome, and the 8385035th base is T or G; the qPV-D05-23825179-G / A is located at the 23825179th base of the D05 chromosome of the Gossypium hirsutum genome, and the 23825179th base is G or A; and the qPV-D12-42661640-A / T is located at the 42661640th base of the D12 chromosome of the Gossypium hirsutum genome, and the 42661640th base is A or T.

[0009] Preferably, the nucleotide sequence containing the qPV-A01-9089583-A / G is as shown in SEQ ID NO. 1 or SEQ ID NO. 2; the nucleotide sequence containing the qPV-D01-8385035-T / G is as shown in SEQ ID NO. 3 or SEQ ID NO. 4; the nucleotide sequence containing the qPV-D05-23825179-G / A is as shown in SEQ ID NO. 5 or SEQ ID NO. 6; and the nucleotide sequence containing the qPV-D12-42661640-A / T is as shown in SEQ ID NO. 7 or SEQ ID NO. 8.

[0010] The application provides a primer set for amplifying the molecular marker in the technical solution, and the primer set comprises one or more of a primer set for amplifying qPV-A01-9089583-A / G, a primer set for amplifying qPV-D01-8385035-T / G, a primer set for amplifying qPV-D05-23825179-G / A and a primer set for amplifying qPV-D12-42661640-A / T; the nucleotide sequence of the upstream primer for amplifying the qPV-A01-9089583-A / G is shown in SEQ ID NO. 9; the nucleotide sequence of the downstream primer for amplifying the qPV-A01-9089583-A / G is shown in SEQ ID NO. 10; the nucleotide sequence of the upstream primer for amplifying the qPV-D01-8385035-T / G is shown in SEQ ID NO. 11; the nucleotide sequence of the downstream primer for amplifying the qPV-D01-8385035-T / G is shown in SEQ ID NO. 12; the nucleotide sequence of the upstream primer for amplifying the qPV-D05-23825179-G / A is shown in SEQ ID NO. 13; the nucleotide sequence of the downstream primer for amplifying the qPV-D05-23825179-G / A is shown in SEQ ID NO. 14; the nucleotide sequence of the upstream primer for amplifying the qPV-D12-42661640-A / T is shown in SEQ ID NO. 15; and the nucleotide sequence of the downstream primer for amplifying the qPV-D12-42661640-A / T is shown in SEQ ID NO. 16.

[0011] The application provides a detection kit containing the primer set in the technical solution.

[0012] The application provides application of the QTL, the molecular marker, the primer set or the detection kit in the technical solution in one or more of identification, screening and breeding of high-temperature-resistant upland cotton.

[0013] Preferably, the high temperature comprises a temperature ≥ 35℃.

[0014] The application provides a method for identifying high-temperature-resistant upland cotton, and the steps are as follows:

[0015] The genomic DNA of the to-be-tested upland cotton is subjected to PCR amplification by using the primer set described in the technical scheme to obtain a PCR amplification product; the genotype of the PCR amplification product is detected and analyzed; when the genotype of the molecular marker qPV-A01-9089583-A / G in the amplification product is the high-temperature-resistant homozygous type AA, the genotype of the molecular marker qPV-D01-8385035-T / G is the high-temperature-resistant homozygous type TT, the genotype of the molecular marker qPV-D05-23825179-G / A is the high-temperature-resistant homozygous type GG, and the genotype of the molecular marker qPV-D12-42661640-A / T is the high-temperature-resistant homozygous type AA, then the to-be-tested upland cotton is a high-temperature-resistant upland cotton; when at least one of the molecular markers qPV-A01-9089583-A / G, qPV-D01-8385035-T / G, qPV-D05-23825179-G / A and qPV-D12-42661640-A / T in the amplification product is a non-high-temperature-resistant homozygous type genotype, then the to-be-tested upland cotton is a non-high-temperature-resistant upland cotton.

[0016] Preferably, the reaction system of the PCR amplification is 20 μL, including: 2 μL of 10×Buffer, 75-100 ng / μL of genomic DNA template 1 μL, 10 μM of upstream primer 0.5 μL, 10 μM of downstream primer 0.5 μL, dNTP mix 0.3 μL, Taq enzyme 0.2 μL, and ddH2O to make up to 20 μL.

[0017] Preferably, the reaction program of the PCR amplification is: 95 ℃ pre-denaturation for 5 min; 95 ℃ denaturation for 30 s, 53-62 ℃ annealing for 30 s, 72 ℃ extension for 30 s, for 35 cycles; 72 ℃ extension for 30 s. Beneficial effects:

[0018] The application provides a QTL and a molecular marker related to the high-temperature-resistant trait of upland cotton, the QTL includes one or more of qPV-A01-1, qPV-D01-1, qPV-D05-1 and qPV-D12-1, and the QTL is significantly related to the high-temperature-resistant trait of upland cotton; in addition, according to the molecular marker closely linked to the QTL, the application designs corresponding primers and detection kits, so as to realize the prediction and screening of high-temperature-resistant upland cotton, and provides a scientific basis for breeding high-temperature-resistant upland cotton.

[0019] Based on the above technical advantages, the application further provides a method for identifying high-temperature-resistant upland cotton, comprising the following steps: performing PCR amplification on genomic DNA of the to-be-tested upland cotton by using the primer set in the above technical solution to obtain a PCR amplification product; detecting the genotype of the PCR amplification product and performing analysis. When the genotype of the molecular marker qPV-A01-9089583-A / G in the amplification fragment is homozygous AA, the genotype of the molecular marker qPV-D01-8385035-T / G is homozygous TT, the genotype of the molecular marker qPV-D05-23825179-G / A is homozygous GG, and the genotype of the molecular marker qPV-D12-42661640-A / T is homozygous AA, the to-be-tested upland cotton is high-temperature-resistant upland cotton. Experimental results prove that the technical solution provided in the application can accurately identify and screen the high-temperature-resistant trait of upland cotton and realize breeding of cotton ideal plant type. BRIEF DESCRIPTION OF DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced below.

[0021] FIG. 1 is a diagram of identification of drug high-temperature-resistant QTL of upland cotton by whole genome association analysis in Embodiment 1;

[0022] FIG. 2 is a diagram of genotype effect analysis of high-temperature-resistant QTL in Embodiment 2;

[0023] FIG. 3 is a diagram of utilization of high-temperature-resistant QTL in the natural population of upland cotton in Embodiment 2;

[0024] FIG. 4 is a diagram of development of molecular markers of SNP variation in the four QTL in Embodiment 3;

[0025] FIG. 5 is a diagram of feasibility verification of the four high-temperature-resistant molecular markers in commercial hybrid in Embodiment 4;

[0026] FIG. 6 is a diagram of breeding results of the upland cotton conventional variety assisted by the molecular markers in Embodiment 4;

[0027] FIG. 7 is a diagram of breeding results of the upland cotton hybrid assisted by the molecular markers in Embodiment 4. DETAILED DESCRIPTION

[0028] The application provides a QTL related to the high temperature tolerance trait of Gossypium hirsutum, wherein the QTL comprises one or more of qPV-A01-1, qPV-D01-1, qPV-D05-1 and qPV-D12-1, preferably comprises qPV-A01-1, qPV-D01-1, qPV-D05-1 and qPV-D12-1; the qPV-A01-1 is located between 8809583bp-9369583bp of the A01 chromosome of the Gossypium hirsutum genome; the qPV-D01-1 is located between 8105035bp-8665035bp of the D01 chromosome of the Gossypium hirsutum genome; the qPV-D05-1 is located between 23545179bp-24105179bp of the D05 chromosome of the Gossypium hirsutum genome; the qPV-D12-1 is located between 42381640bp-42941640bp of the D12 chromosome of the Gossypium hirsutum genome; the version of the Gossypium hirsutum genome is TM-1_HZAU.v1.1. The QTL provided in the application is significantly related to the high temperature tolerance trait of Gossypium hirsutum.

[0029] The application provides a molecular marker closely linked to the QTL described in the above technical solution, wherein the molecular marker comprises one or more of qPV-A01-9089583-A / G, qPV-D01-8385035-T / G, qPV-D05-23825179-G / A and qPV-D12-42661640-A / T, and more preferably comprises qPV-A01-9089583-A / G, qPV-D01-8385035-T / G, qPV-D05-23825179-G / A and qPV-D12-42661640-A / T.

[0030] The qPV-A01-9089583-A / G described in the present application is located at the 9089583th base of the A01 chromosome of the Gossypium hirsutum genome, and the 9089583th base is A or G; the nucleotide sequence containing the qPV-A01-9089583-A / G is preferably as shown in SEQ ID NO. 1 or SEQ ID NO. 2; the nucleotide sequence of SEQ ID NO. 1 is specifically: 5'-GTTTCATTTT GCAGGGTATGGAGGGCCAGACGCGTGCGTGGAGAGTGGTGGTGGTAGTGCGCAAGGTGGCCAATGGTTGGCCGTTGGTGGGAAGCGGCGGCTGACAAGATGGGAGCTAGGGTTTGCTGCTGAAATCTTTTAAGCAAATGGGCTATTAGGGTTTTAAAATTTGGGCTCAGGTAGTTTTAGGATTGGGCTAGATTGGTTTAGGGTATTGGGCTAGGTTGGTTTAGGCTTGGTTTA GGATGAGATGGGTATGGGATTTAAGTAGCTTTGGTTATTGGGTTTTTGGGGGTGGCCCAAAATTGGCCTGTACACCTGCTAAAAGAGGTGATATAACAAGCATAGTTTTAGTTGACATGGGTGTATTAAATACACCAAAATATTGGCATTCCGCTTT-3'; the nucleotide sequence of SEQ ID NO. 2 is specifically: 5'-GTTTCATTTT GCAGGGTATGGAGGGCCAGACGCGTGCGTGGAGAGTGGTGGTGGTAGTGCGCAAGGTGGCCAATGGTTGGCCGTTGGTGGGAAGCGGCGGCTGACAAGATGGGAGCTAGGGTTTGCTGCTGAAATCTTTTAAGCAAATGGGCTATTAGGGTTTTAAAATTTGGGCTCAGGTAGTTTTAGGATTGGGCTAGGTTGGTTTAGGGTATTGGGCTAGGTTGGTTTAGGCTTGGTTTAGGATGAGATGGGTATGGGATTTAAGTAGCTTTGGTTATTGGGTTTTTGGGGGTGGCCCAAAATTGGCCTGTACACCTGCTAAAAGAGGTGATATAACAAGCATAGTTTTAGTTGACATGGGTGTATTAAATACACCAAAATATTGGCATTCCGCTTT-3'.

[0031] The qPV-D01-8385035-T / G described in the present application is located at the 8385035th base of the D01 chromosome of the Gossypium hirsutum genome, and the 8385035th base is T or G; the nucleotide sequence containing the qPV-D01-8385035-T / G is preferably as shown in SEQ ID NO. 3 or SEQ ID NO. 4; the nucleotide of the SEQ ID NO. 3 is specifically: 5'-AAATTTTGTAACTCCAATATATTTTTAAACTTTGAATGAAAAAGTTAGTGTTGTTCAGTTACAATTTCTGAGTGTTCAAGATTGCTTTGCTGTTTTATTTTCTTTTACTTCAATTTCCATTGGTTAAGCTTTGCAAAATGTATCATGCTGCTGCCTTTGTTCCTACAGACTAAGATGAAGATTCTGTTGCAGGAGATGAATCACATCTGTTGAGTTTTTGAATCGAGTTAATCCAAAAAAGAATTGATTCAAATGTCTACTAAAGCTTCATGCTTAGACTACTCATTCACTTTACTTCATTTAAAAAGACATCACTTCTTAAAGTACTCAAGGAATAGAATGAGGCAACGCAACCTCACTAAGCACTCAACCTTCAAAAGCTTATTACGCGCCAACTACG-3'; and the nucleotide of the SEQ ID NO. 4 is specifically: 5'-AAATTTTGTAACTCCAATATATTTTTAAACTTTGAATGAAAAAGTTAGTGTTGTT CAGTTACAATTTCTGAGTGTTCAAGATTGCTTTGCTGTTTTATTTTCTTTTACTTCAATTTCCATTGGTTAAGCTTTGCAAAATGTATCATGCTGCTGCCTTTGTTCCTACAGACTAAGATGAAGATTCTGTTGCAGGAGATGAAGCACATCTGTTGAGTTTTTGAATCGAGTTAATCCAAAAAAGAATTGATTCAAATGTCTACTAAAGCTTCATGCTTAGACTACTCATTCACTTTACTTCATTTAAAAAGACATCACTTCTTAAAGTACTCAAGGAATAGAATGAGGCAACGCAACCTCACTAAGCACTCAACCTTCAAAAGCTTATTACGCGCCAACTACG-3'.

[0032] The qPV-D05-23825179-G / A described in the present application is located at the 23825179th base of the D05 chromosome of the Gossypium hirsutum genome, and the 23825179th base is G or A; the nucleotide sequence containing the qPV-D05-23825179-G / A preferably is as shown in SEQ ID NO. 5 or SEQ ID NO. 6; the nucleotide of the SEQ ID NO. 5 is specifically: 5'-GTAGAG GAGAACTATTGTTTAAAAGAAGAGAACCAAAAGGCAAAAGTTGATCAACAAGATGGAGGTAAAAGACTCTTTTAAATGATAAACCTACTAGTCTTGAGGCTATTCAAAAGGATCTTATAGCAACTCAATCGATACTTAAAAGTTCAATACAAGTAGTGGGAAAATGGGTGAAACCCTTACAATAGGAATAAGAAGCCTTAAGAAAGGTGGTCTAGGAATACGTTAAAAAGAAAGAAAAGGTTATGGTCGAGAGTCTAACAATATTTGTCAAAACCATAAACCGCATTGATCGTGGAGTAGTCGAGCACATTAGGCTAAGATACTTTAAGATGTTACATAATTTGAGATTGATACAAGCAGTGGTAGGACCAATGCCAACTGCTCCATGCACTAC-3'; the nucleotide of the SEQ ID NO. 6 is specifically: 5'-GTAGAGGAGAACTATTGTTTAAAAGAAGAGAACCAAAAGGCAAAAGTTGATCAACAAGATGGAGGTAAAAGACTCTTTTAAATGATAAACCTACTAGTCTTGAGGCTATTCAAAAGGATCTTATAGCAACTCAATCGATACTTAAAAGTTCAATACAAGTAGTGGGAAAATGGGTGAAACCCTTACAATAGGAATAAGAAACCTTAAGAAAGGTGGTCTAGGAATACGTTAAAAAGAAAGAAAAGGTTATGGTCGAGAGTCTAACAATATTTGTCAAAACCATAAACCGCATTGATCGTGGAGTAGTCGAGCACATTAGGCTAAGATACTTTAAGATGTTACATAATTTGAGATTGATACAAGCAGTGGTAGGACCAATGCCAACTGCTCCATGCACTAC-3'

[0033] The qPV-D12-42661640-A / T described in the present application is located at the 42661640th base of the D12 chromosome of the Gossypium hirsutum genome, and the 42661640th base is A or T; the nucleotide sequence containing the qPV-D12-42661640-A / T preferably is as shown in SEQ ID NO. 7 or SEQ ID NO. 8; the nucleotide of the SEQ ID NO. 7 is specifically: 5'-TTAGTAATA TGTTAGAAAATAAATGGTATTCTTCTCAATTCAAAATTTTTCCAAACTCGTGTTTTATATATATTATAGATTTATATAATTGATAAGTATTTTTTGTATACATATATTAAATATTTCTTAAAAATATCTATAAATCTAAAACGATATACTAAAACAAACCAATACTGATACATACAAATTTCAATCGAAAAAGAATATGTCTACTGGTACATTACTAACTATTTTTAACCCTTATCGTTACTTTGCTAATCTTCCTCCTCAAATTTCTCTTACATTCATTACATGTTCTAACTTAAACATCGAAAAACATCTTCACAACATAAACTTTGACACTATCATAAAATTATGTATATATATTCAAGGTTCATCCAAACGTGTAACCCAAACTCTC-3'; and the nucleotide of the SEQ ID NO. 8 is specifically: 5'-TTAGTAATATGTTAGAAAATAAATGGTATTCTTCTCAATTCAAAATTTTTCCAAA CTCGTGTTTTATATATATTATAGATTTATATAATTGATAAGTATTTTTTGTATACATATATTAAATATTTCTTAAAAATATCTATAAATCTAAAACGATATACTAAAACAAACCAATACTGATACATACAAATTTCAATCGAAAATGAATATGTCTACTGGTACATTACTAACTATTTTTAACCCTTATCGTTACTTTGCTAATCTTCCTCCTCAAATTTCTCTTACATTCATTACATGTTCTAACTTAAACATCGAAAAACATCTTCACAACATAAACTTTGACACTATCATAAAATTATGTATATATATTCAAGGTTCATCCAAACGTGTAACCCAAACTCTC-3'.The molecular markers qPV-A01-9089583-A / G, qPV-D01-8385035-T / G, qPV-D05-23825179-G / A and qPV-D12-42661640-A / T described in the present application can specifically mark the high temperature resistance trait of Gossypium hirsutum.

[0034] The present application provides a primer set for amplifying the molecular markers described in the above technical solutions, which comprises one or more of the primer set for amplifying qPV-A01-9089583-A / G, the primer set for amplifying qPV-D01-8385035-T / G, the primer set for amplifying qPV-D05-23825179-G / A and the primer set for amplifying qPV-D12-42661640-A / T, preferably comprises the primer set for amplifying qPV-A01-9089583-A / G, the primer set for amplifying qPV-D01-8385035-T / G, the primer set for amplifying qPV-D05-23825179-G / A and the primer set for amplifying qPV-D12-42661640-A / T.

[0035] The nucleotide sequence of the upstream primer of the qPV-A01-9089583-A / G is shown in SEQ ID NO. 9, specifically 5'-GTAGTTTTAGGATTGGGCTAGA-3'; the nucleotide sequence of the downstream primer of the qPV-A01-9089583-A / G is shown in SEQ ID NO. 10, specifically 5'-AAAGCGGAATGCCAATAT-3'; the nucleotide sequence of the upstream primer of the qPV-D01-8385035-T / G is shown in SEQ ID NO. 11, specifically 5'-ATTCTGTTGCAGGAGATGAAT-3'; the nucleotide sequence of the downstream primer of the qPV-D01-8385035-T / G is shown in SEQ ID NO. 12, specifically 5'-CGTAGTTGGCGCGTAATA-3'; the nucleotide sequence of the upstream primer of the qPV-D05-23825179-G / A is shown in SEQ ID NO. 13, specifically 5'-AACCCTTACAATAGGAATAAGAAG-3'; the nucleotide sequence of the downstream primer of the qPV-D05-23825179-G / A is shown in SEQ ID NO. 14, specifically 5'-TAGTGCATGGAGCAGTTGG-3'; the nucleotide sequence of the upstream primer of the qPV-D12-42661640-A / T is shown in SEQ ID NO. 15, specifically 5'-CATACAAATTTCAATCGAAAAA-3'; the nucleotide sequence of the downstream primer of the qPV-D12-42661640-A / T is shown in SEQ ID NO. 16, specifically 5'-GAGTTTGGGTTACACGTTTG-3'. The primer set described in the application can specifically detect molecular markers closely linked to QTL, thereby realizing the prediction and screening of high-temperature-tolerant upland cotton and providing a scientific basis for breeding different types of high-temperature-tolerant upland cotton.

[0036] The application provides a detection kit containing the primer set described in the above technical solution. In the application, the detection kit preferably further contains PCR amplification reagents; the PCR amplification reagents preferably include DNA polymerase, dNTPs and Mg 2+ ; the source, amount of the DNA polymerase, dNTPs and Mg 2+ are not particularly limited, and commercially available products in the art can be used.

[0037] The application also provides application of the QTL, the molecular marker, the primer set or the detection kit in one or more of identification, screening and breeding of high-temperature-resistant upland cotton; the high temperature preferably includes a temperature of ≥ 35℃, more preferably includes a temperature of ≥ 35℃ for 3 consecutive days.

[0038] The application provides a method for identifying high-temperature-resistant upland cotton, comprising the following steps: performing PCR amplification on genomic DNA of the to-be-tested upland cotton by using the primer set according to the above technical solution to obtain a PCR amplification product; detecting the genotype of the PCR amplification product and performing analysis; when the genotype of the molecular marker qPV-A01-9089583-A / G in the amplification product is homozygous AA, the genotype of the molecular marker qPV-D01-8385035-T / G is homozygous TT, the genotype of the molecular marker qPV-D05-23825179-G / A is homozygous GG, and the genotype of the molecular marker qPV-D12-42661640-A / T is homozygous AA, the to-be-tested upland cotton is high-temperature-resistant upland cotton; when at least one of the molecular markers qPV-A01-9089583-A / G, qPV-D01-8385035-T / G, qPV-D05-23825179-G / A and qPV-D12-42661640-A / T in the amplification product is a non-homozygous genotype, the to-be-tested upland cotton is non-high-temperature-resistant upland cotton.

[0039] Preferably, the application extracts genomic DNA of the to-be-tested upland cotton to obtain template DNA. In the application, the extraction method and source of the template DNA are not particularly required, and a technique well known in the art can be used.

[0040] After obtaining the template DNA, the primer set in the technical solution is used for PCR amplification to obtain a PCR amplification product. In the present application, the reaction system of the PCR amplification is 20 μL, preferably including: 2 μL of 10x Buffer, 75-100 ng / μL of genomic DNA template 1 μL, 10 μM of upstream primer 0.5 μL, 10 μM of downstream primer 0.5 μL, dNTP mix 0.3 μL, Taq enzyme 0.2 μL, and ddH2O to 20 μL; the reaction program of the PCR amplification is preferably: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 53-62°C annealing for 30 s, 72°C extension for 30 s, 35 cycles; and 72°C extension for 30 s. The annealing temperature in the present application is further preferably different according to different templates, specifically: when the qPV-A01-9089583-A / G is amplified, the annealing temperature is most preferably 62°C; when the qPV-D01-8385035-T / G is amplified, the annealing temperature is most preferably 61°C; when the qPV-D05-23825179-G / A is amplified, the annealing temperature is most preferably 61°C; and when the qPV-D12-42661640-A / T is amplified, the annealing temperature is most preferably 55°C.

[0041] After obtaining the PCR amplification product, the genotype of the PCR amplification product is detected and analyzed. In the present application, the method and reagent for detecting the genotype of the PCR amplification product have no special requirements, and the technology well known in the art can be used. When the genotype of the molecular marker qPV-A01-9089583-A / G in the amplification product is homozygous AA, the genotype of the molecular marker qPV-D01-8385035-T / G is homozygous TT, the genotype of the molecular marker qPV-D05-23825179-G / A is homozygous GG, and the genotype of the molecular marker qPV-D12-42661640-A / T is homozygous AA, then the land cotton to be tested is a high-temperature-resistant land cotton; when at least one of the molecular markers qPV-A01-9089583-A / G, qPV-D01-8385035-T / G, qPV-D05-23825179-G / A, and qPV-D12-42661640-A / T in the amplification product is a non-homozygous genotype, then the land cotton to be tested is a non-high-temperature-resistant land cotton.

[0042] Experiments prove that after the technical solution provided in the present application is used, the high-temperature-resistant trait of land cotton can be accurately identified and screened, and the breeding of cotton ideal plant type is realized.

[0043] In order to further illustrate the present application, the QTLs related to the high temperature tolerance trait of Gossypium hirsutum, molecular markers and their applications provided by the present application are described in detail below in combination with the accompanying drawings and examples, but they cannot be understood as limiting the scope of protection of the present application.

[0044] Example 1

[0045] Identification of anther high temperature tolerance related QTLs in Gossypium hirsutum by genome-wide association analysis

[0046] Using the 376 Gossypium hirsutum resequencing data in the published article (article DOI: 10.1038 / s41588-021-00844-9), a SNP natural variation map of Gossypium hirsutum was constructed (the variation map information has been disclosed in DOI: 10.1038 / s41588-023-01530-8, the genome version of Gossypium hirsutum is TM-1_HZAU.v1.1, which can be obtained at https: / / www.cottongen.org / organism / 1033), combined with the rapid pollen activity quantification system established by the previous laboratory (the pollen activity quantification system has been disclosed in ZL201910010240.2), the pollen high temperature resistance phenotype of the above 376 germplasms of the natural population of Gossypium hirsutum was obtained, and genome-wide association analysis was performed, and the specific analysis steps are as follows:

[0047] 1. Based on the natural variation map, the population genetics of 376 Gossypium hirsutum varieties was analyzed, including population genetic structure, principal component analysis, linkage disequilibrium and species tree construction, etc.

[0048] 2. The anther high temperature resistance phenotype of 376 Gossypium hirsutum varieties was investigated in multiple years and multiple sites in Turpan, Xinjiang, Aksu, Xinjiang, Korla, Xinjiang, Wuhan, Hubei and Ezhou, Hubei in 2016, 2018, 2019, 2021, 2022 and 2023; the mixed linear model was called by EMMAX software to perform genome-wide association analysis, and the equation of association analysis is as follows: y=Xb+Zu+e;

[0049] Wherein y is the observation value vector; b is the fixed factor effect value vector; X is the fixed factor relationship matrix; u is the random factor effect value vector; Z is the random factor relationship matrix; e is the residual error vector;

[0050] In the process of association analysis, the natural variation map was used to construct the kinship matrix to control the false association signals generated in the process of association analysis.

[0051] 3. According to the position of the most significant SNP associated with the anther high temperature resistance phenotype and the linkage disequilibrium information, the QTL interval was determined (as shown in Table 1).

[0052] 4. Two extremely sensitive high temperature materials and two extremely resistant high temperature materials were selected from 376 upland cotton materials, and two pairs of F2 separation generations were constructed using the four materials to verify the authenticity of QTL by association analysis. The results are shown in Figure 1 (in Figure 1, a, c, e are Manhattan plots for identifying four high temperature resistance related QTLs; b, d, f are the corresponding Q-Q plots of the association analysis results) and Table 1. Note: the extremely sensitive high temperature materials are Jimian 6 (Jimian 6 / S151) and Ekangmian 8 (Ekangmian 8 / S401), and the extremely resistant high temperature materials are Xinluzao 19 (Xinluzao 19 / S9) and Yuanmian 5 (Yuanmian 5 / S226).

[0053] Table 1. Genome information and favorable allele types of four high temperature resistance QTLs

[0054] As shown by the results in Figure 1, three QTLs significantly associated with anther high temperature resistance phenotype were identified in the genome based on association analysis of the upland cotton natural population, and were named qPV-A01-1, qPV-D01-1 and qPV-D12-1. Two QTLs were identified in the genome based on association analysis of two F2 separation generations, and were named qPV-A01-1 and qPV-D05-1. Through analysis of the three groups of materials, a total of four QTLs associated with anther high temperature resistance phenotype were identified in the upland cotton genome.

[0055] As can be seen from Table 1, there are four QTLs significantly associated with anther high temperature resistance phenotype in the upland cotton genome, which are located on A01, D01, D05 and D12 chromosomes, respectively. According to the QTL naming rules and linkage disequilibrium of the upland cotton genome, the above four QTL intervals are determined and are named qPV-A01-1, qPV-D01-1, qPV-D05-1 and qPV-D12-1, respectively.

[0056] Example 2

[0057] Analysis of effects and utilization of four high temperature resistance related QTLs in the upland cotton natural population

[0058] Based on the QTL interval determined in Embodiment 1, the SNP variation most relevant to the anther high-temperature resistance phenotype within qPV-A01-1, qPV-D01-1, qPV-D05-1 and qPV-D12-1 was used as the QTL genotype, and 376 Gossypium hirsutum materials with the corresponding QTL genotype were grouped according to the format of 'QTL-SNP physical position-genotype', and statistical test was performed, and the results are shown in FIG. 2 (in FIG. 2, a represents the genotype effect analysis of qPV-A01-9089583-A / G, b represents the genotype effect analysis of qPV-D01-8385035-T / G, c represents the genotype effect analysis of qPV-D05-23825179-G / A, and d represents the genotype effect analysis of qPV-D12-42661640-A / T).

[0059] As can be seen from FIG. 2, the genotypes of the above four anther high-temperature resistance QTLs are qPV-A01-9089583-A / G, qPV-D01-8385035-T / G, qPV-D05-23825179-G / A and qPV-D12-42661640-A / T. After classifying different materials according to the genotypes, it was found that the allele frequencies of qPV-A01-9089583-A, qPV-D01-8385035-T, qPV-D05-23825179-G and qPV-D12-42661640-T in the natural population were relatively high, and the corresponding homozygous genotype materials were 324, 333, 201 and 280, respectively. Among them, qPV-A01-9089583-A, qPV-D01-8385035-T, qPV-D05-23825179-G and qPV-D12-42661640-A are high-temperature resistant genotypes, and the anther high-temperature resistance phenotype of the corresponding materials is relatively high, and except for qPV-D05-23825179-G, there is a statistically significant difference.

[0060] In addition, the combination of the high-temperature resistance QTL genotypes in the 376 Gossypium hirsutum and the corresponding anther high-temperature resistance phenotype were analyzed, and the results are shown in FIG. 3 (in FIG. 3, a shows the number of materials corresponding to different QTL genotype combinations; b shows the number of different high-temperature resistance QTL genotypes in the natural population; c shows the anther high-temperature resistance phenotype value of Gossypium hirsutum under different QTL genotype combinations).

[0061] As can be seen from FIG. 3, the materials simultaneously integrating four high-temperature resistance QTLs have good pollen viability under high-temperature stress, but the number of such materials is small, only more than 50. At the same time, there are no materials with qPV-D12-42661640-A high-temperature resistance genotype in the natural population.

[0062] Example 3

[0063] Molecular marker development for four heat tolerance related QTLs

[0064] To determine the authenticity of heat tolerance QTLs, molecular markers were developed. The present application attempts to develop qPV-A01-9089583-A, qPV-D01-8385035-T, qPV-D05-23825179-G and qPV-D12-42661640-A four SNP variations into annealing sensitive KASP markers. According to the variation map in Example 1 and 376 materials and corresponding genotype information in Example 2, the corresponding primers were designed, and the principles and steps were as follows:

[0065] 1. Download the genomic sequence of 200 bp upstream and downstream of the corresponding SNP variation physical position (the specific nucleotides are shown in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5 and SEQ ID NO. 7, respectively), design primers at the target SNP position, and design the target SNP at the 3' end of the target primer, with an annealing temperature of 52-54°C. The specific primer information is as follows:

[0066] The nucleotide sequence of the upstream primer for amplifying qPV-A01-9089583-A / G is shown in SEQ ID NO. 9, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 10;

[0067] The nucleotide sequence of the upstream primer for amplifying qPV-D01-8385035-T / G is shown in SEQ ID NO. 11, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 12;

[0068] The nucleotide sequence of the upstream primer for amplifying qPV-D05-23825179-G / A is shown in SEQ ID NO. 13, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 14;

[0069] The nucleotide sequence of the upstream primer for amplifying qPV-D12-42661640-A / T is shown in SEQ ID NO. 15, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 16 (Note: the A base at the 3' end of each upstream primer can be used to detect the target SNP, and the design principle of the downstream primer is relatively loose, only needs to meet the annealing temperature of 52-54°C to react and the product fragment of 150-200 bp);

[0070] 2. After the primer design was completed, according to the variation map information in Example 1, five materials containing corresponding SNP variations were selected, and the specific information of the upland cotton variety materials is shown in Table 2:

[0071] Table 2 Information of Upland Cotton Materials

[0072] Note: In Table 2, the five materials integrating four high temperature resistance genotypes (qPV-A01-9089583-G, qPV-D01-8385035-G, qPV-D05-23825179-A and qPV-D12-42661640-T) are Emian19, Zhemian3, Xinluzhong7, Xinluzao11 and DeltapineSR-1; the five materials of qPV-A01-9089583-G genotype are Jimian15, ShaanMian1, Hongyejijiaomian, Xinluzao6 and Shaan2786; the five materials of qPV-D01-8385035-G genotype are Jimian15, ShaanMian1, Hongyejijiaomian, Xinluzao6 and Shaan2786; the five materials of qPV-D05-23825179-A genotype are Ganmian12, Ejing92, Jimian3, Ekangmian10 and Dunn18; and the five materials of qPV-D12-42661640-T genotype are Ganmian12, Zhongmiansuo32, AoCS50 / 2, KK1543 and Che61-72.

[0073] 3. The genomic DNA of each material in Table 2 was extracted by CTAB method. The steps were as follows: fresh leaves were taken and placed in 2 mL centrifuge tubes, clean steel beads and 200 μL extraction buffer (extraction buffer was prepared with water as solvent, containing 0.35 M glucose, 0.1 M Tris-HCl, 5 mM Na2EDTA, 2% PVP K-30 (20 g dissolved in 1 L buffer) and 0.1% DIECA (1 g dissolved in 1 L buffer) by mass concentration, pH = 7.5) were added, and the samples were ground on a sample grinder (Shanghai Jingxin Tissuelyser-192) for 60 s at a frequency of 60 Hz. After grinding, 800 μL lysis buffer (lysis buffer was prepared with water as solvent, containing 0.1 M Tris-HCl, 1.4 M NaCl, 0.02 M Na2EDTA, 2% CTAB by volume concentration, 2% PVP K-30 by volume concentration and 0.1% DIECA by volume concentration, pH = 8.0) was added to the centrifuge tube. The centrifuge tube was placed in a 65°C water bath for 30 min, then 800 μL chloroform 24:1 (a mixture of chloroform and isopropyl alcohol with a volume ratio of 24:1) was added and gently inverted, and then extracted for 20 min. After centrifugation at 12000 rpm for 8-10 min, the supernatant was transferred and mixed with an equal volume of -20°C pre-cooled isopropyl alcohol. After mixing, a flocculent DNA precipitate appeared. The DNA was washed twice with 75% ethanol by volume concentration, and then dried on a clean bench. The DNA was dissolved with ddH2O to obtain the genomic DNA.

[0074] The extracted genomic DNA was subjected to PCR amplification using the primers in step 1. The PCR amplification system was prepared according to the formula in Table 3, and the PCR amplification was performed according to the program in Table 4.

[0075] Table 3 PCR reaction system

[0076] Table 4 PCR reaction program

[0077] 4. The annealing temperature in the PCR amplification program was set to be different from 53 to 62°C to evaluate the optimal annealing temperature of the detection molecular marker. For example, for the qPV-A01-9089583-A marker, at a certain specific annealing temperature, the detection primer could still anneal normally with the reverse sequence of the target base A and extend, finally producing a positive result. In addition, the remaining bases could not be annealed normally, and Taq enzyme could not start the extension process, resulting in reduced or failed PCR amplification efficiency and negative results. The specific results are shown in Figure 4.

[0078] As can be seen from FIG. 4, the present application develops qPV-A01-9089583-A, qPV-D01-8385035-T, qPV-D05-23825179-G and qPV-D12-42661640-A into KASP markers, the optimal annealing temperatures of which are 62°C, 61°C, 61°C and 55°C respectively, and the qA01-Tolerant, qD01-Tolerant, qD05-Tolerant, qD12-Tolerant are used to represent the qPV-A01-9089583-AA, qPV-D01-8385035-TT, qPV-D05-23825179-GG and qPV-D12-42661640-AA dominant genotypes respectively.

[0079] Example 4

[0080] Molecular marker verification of high temperature resistance QTL and breeding of high temperature resistant cotton varieties

[0081] The commercial cotton varieties are verified by using the PCR reaction system, reaction procedure, primer sequence and annealing temperature in Example 3, and the specific process is as follows:

[0082] The high temperature resistant hybrid cotton variety 'Huazamian H318' (Huazamian H318 was approved in 2009, the approval number is Guoshaizamian 2009018, and the hybrid cotton variety is disclosed in DOI: 10.1186 / s12864-021-07580-8) and the corresponding hybrid cotton variety parent materials (female parent 'B0011' and male parent '4-5') are selected for marker verification; the phenotypes of 'Huazamian H318' hybrid F1 and the parents in the field are counted, and the results are shown in FIG. 5A; in FIG. 5A, the first row shows the anther morphology of Huazamian H318 female parent (♀ mark), male parent (♂ mark) and F1 hybrid (F1 mark) after high temperature stress; the second row shows the pollen microscopic staining of Huazamian H318 female parent, male parent and F1 hybrid; the third row shows the plant type characteristics of Huazamian H318 female parent, male parent and F1 hybrid at the harvest stage.

[0083] As can be seen from FIG. 5A, 'Huazamian H318' has obvious high temperature resistance phenotype in the field, which is obviously different from the high temperature resistance performance of the parents, and is a good object for marker verification.

[0084] Using the four KASP markers of qPV-A01-9089583-A, qPV-D01-8385035-T, qPV-D05-23825179-G and qPV-D12-42661640-A developed in Example 3, PCR amplification was performed with the optimal annealing temperatures of 62℃, 61℃, 61℃ and 55℃, and the results are shown in B of Fig. 5.

[0085] As shown in B of Fig. 5, the female parent 'B0011' strain of 'Huazacai H318' contains four high-temperature resistance QTLs, and the male parent '4-5' strain contains two high-temperature resistance QTLs. The genotypes of the four high-temperature resistance QTLs in the genomes of the female parent and the male parent of 'Huazacai H318' are different, but the hybrid F1 'Huazacai H318' aggregates the four high-temperature resistance QTLs, which is consistent with the high-temperature resistance phenotype in the field (A of Fig. 5). It can be seen that the high-temperature resistance QTL genotypes of different materials can be identified by PCR, indicating that the four high-temperature resistance QTLs identified in this application actually exist in the Gossypium hirsutum materials, and the KASP markers are real and usable.

[0086] Based on the genetic characteristics of the high-temperature resistance QTLs, combined with the breeding of conventional high-quality cotton varieties with high-temperature resistance, 'Huacun 2270', 'Huacun 5108', 'Huacun 1126', 'Huacun 1543', 'Huacun 3097', 'Huacun 5198', 'Huacun 8119' and 'Huacun 3109' were used as test samples, Jinmian 6, Qianmian 465, Zhongmiansuo 27 and Lumian 10 were used as negative controls for qA01-Tolerant, qD01-Tolerant, qD05-Tolerant and qD12-Tolerant markers respectively, and PCR verification was performed (the PCR reaction system was the same as Table 3, and the PCR reaction program was the same as Table 4), and the results are shown in Fig. 6 (in A of Fig. 6, the first row shows the anther pictures of the eight Huacun series conventional varieties after high-temperature stress, and the above materials can still normally dehisce and shed pollen after high-temperature stress; the second row shows the pollen microscopic examination pictures of the eight Huacun series conventional varieties after high-temperature stress, and corresponding to the anther phenotype, the above materials can normally produce high-vigor fertile pollen after high-temperature stress; the third row shows the typical single plant performance of the eight Huacun series conventional varieties, and the above materials are almost not affected by the boll setting after encountering high-temperature stress in the field, and can still normally set bolls at the fruit branch parts most seriously affected by high-temperature stress (red line upwards). As shown in B of Fig. 6, the approved high-temperature resistant conventional varieties Huacun 1126, 1543, 2270, 3097, 3109, 5108, 5198 and 8119 all contain four high-temperature resistance QTLs, and have obvious high-temperature resistance characteristics in the field single plant performance (the third row of pictures in A of Fig. 6), which corresponds to the genotype.

[0087] Heterosis utilization is one of the important goals of cotton variety breeding. The laboratory combined molecular markers and superior parents to breed 'Huazacain H116', 'Huazacain H834', and 'Huazacain H922' hybrids. The corresponding hybrid F1 was observed in the field for high temperature resistance, and the results are shown in Figure 7A. Jinmian6, Qianmian465, Zhongmiansuo27 and Lumian10 were used as negative controls for qA01-Tolerant, qD01-Tolerant, qD05-Tolerant and qD12-Tolerant markers, respectively, for PCR verification (the PCR reaction system was the same as Table 3, and the PCR reaction program was the same as Table 4), and the results are shown in Figure 7B.

[0088] As can be seen from Figure 7A, the hybrid F1 of 'Huazacain H116', 'Huazacain H834' and 'Huazacain H922' showed obvious high temperature resistance in the field. The first row of Figure 7A shows the anther and pollen single plant performance of 'Huazacain H116' and its two parents (the female parent is marked with ♀, the male parent is marked with ♂, and the hybrid is marked with F1) after encountering high temperature stress. The second row shows the anther and pollen single plant performance of 'Huazacain H834' and its two parents after encountering high temperature stress. The third row shows the anther and pollen single plant performance of 'Huazacain H922' and its two parents after encountering high temperature stress. The red line in Figure 7A indicates the most severely stressed parts of the fruit branches in the field.

[0089] As can be seen from Figure 7B, the female parent 'H82140' strain of 'Huazacain H116' contains four high temperature resistance QTLs, and the male parent 'H92047' strain contains two high temperature resistance QTLs. The female parent 'Jingyin511' strain of 'Huazacain H834' contains three high temperature resistance QTLs, and the male parent 'H92072' strain contains three high temperature resistance QTLs. The female parent '361-9' strain of 'Huazacain H922' contains one high temperature resistance QTL, and the male parent '4007-17' strain contains four high temperature resistance QTLs. Although not all parents contain all high temperature resistance QTLs, through hybridization, the hybrid F1 has all the high temperature resistance QTLs, and also has the heterosis of the parents and the high temperature resistance phenotype.

[0090] In summary, after using the technical solutions provided in the present application, the high temperature resistance of Gossypium hirsutum can be accurately identified and screened, and the breeding of ideal cotton plant type can be realized.

[0091] Although the above embodiments have been described in detail, it should be understood that the above embodiments are only some embodiments of the present application, but not all embodiments of the present application, and other embodiments can be obtained by those skilled in the art without creativity on the basis of the above embodiments, and these embodiments all belong to the protection scope of the present application.

Claims

1. A QTL associated with high temperature tolerance in upland cotton, characterized in that: The QTL includes one or more of qPV-A01-1, qPV-D01-1, qPV-D05-1, and qPV-D12-1; The qPV-A01-1 is located between 8809583 bp and 9369583 bp of chromosome A01 in the upland cotton genome; The qPV-D01-1 is located between 8105035bp and 8665035bp of chromosome D01 in the upland cotton genome; The qPV-D05-1 is located between 23545179bp and 24105179bp of chromosome D05 in the upland cotton genome; The qPV-D12-1 is located between 42381640bp and 42941640bp of chromosome D12 of the upland cotton genome; The version of the upland cotton genome is TM-1_HZAU.v1.

1.

2. A molecular marker tightly linked to the QTL according to claim 1, characterized in that: The molecular markers include: one or more of qPV-A01-9089583-A / G, qPV-D01-8385035-T / G, qPV-D05-23825179-G / A and qPV-D12-42661640-A / T; The qPV-A01-9089583-A / G is located at the 9089583rd base of chromosome A01 of the upland cotton genome, and the 9089583rd base is A or G; The qPV-D01-8385035-T / G is located at the 8385035th base of chromosome D01 of the upland cotton genome, and the 8385035th base is T or G; The qPV-D05-23825179-G / A is located at base 23825179 of chromosome D05 of the upland cotton genome, and the base 23825179 is G or A; The qPV-D12-42661640-A / T is located at the 42661640th base of chromosome D12 of the upland cotton genome, and the 42661640th base is A or T.

3. The molecular marker according to claim 2, characterized in that The nucleotide sequence containing the qPV-A01-9089583-A / G is shown in SEQ ID NO.1 or SEQ ID NO.2; The nucleotide sequence containing the qPV-D01-8385035-T / G is shown in SEQ ID NO. 3 or SEQ ID NO. 4; The nucleotide sequence containing the qPV-D05-23825179-G / A is shown in SEQ ID NO. 5 or SEQ ID NO. 6; The nucleotide sequence containing the qPV-D12-42661640-A / T is shown in SEQ ID NO.7 or SEQ ID NO.

8.

4. A primer set for amplifying the molecular marker according to claim 2 or 3, characterized in that: The primer set includes one or more of a primer set for amplifying qPV-A01-9089583-A / G, a primer set for amplifying qPV-D01-8385035-T / G, a primer set for amplifying qPV-D05-23825179-G / A, and a primer set for amplifying qPV-D12-42661640-A / T; The nucleotide sequence of the upstream primer in the primer set for amplifying qPV-A01-9089583-A / G is shown in SEQ ID NO.9, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.10; The nucleotide sequence of the upstream primer in the primer set for amplifying qPV-D01-8385035-T / G is shown in SEQ ID NO.11, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.12; The nucleotide sequence of the upstream primer in the primer set for amplifying qPV-D05-23825179-G / A is shown in SEQ ID NO. 13, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 14; The nucleotide sequence of the upstream primer in the primer set for amplifying qPV-D12-42661640-A / T is shown in SEQ ID NO.15, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

16.

5. A detection kit, characterized in that: Contains the primer set according to claim 4.

6. The detection kit according to claim 5, characterized in that The detection kit also contains a PCR amplification reagent.

7. The detection kit according to claim 6, characterized in that The PCR amplification reagent includes DNA polymerase, dNTPs and Mg 2+ .

8. Use of the QTL according to claim 1, the molecular marker according to claim 2 or 3, the primer set according to claim 4, or the detection kit according to any one of claims 5 to 7 in one or more of the identification, screening, and breeding of heat-resistant upland cotton.

9. The use according to claim 8, characterized in that The high temperature includes temperatures ≥ 35°C.

10. A method for identifying high temperature resistant upland cotton, characterized in that: Here are the steps: PCR amplification is performed on the genomic DNA of the upland cotton to be tested using the primer set of claim 4 to obtain PCR amplification products; the genotype of the PCR amplification products is detected and analyzed; When the genotype of the corresponding molecular marker qPV-A01-9089583-A / G in the amplified product is the heat-resistant homozygous type AA, the genotype of qPV-D01-8385035-T / G is the heat-resistant homozygous type TT, the genotype of qPV-D05-23825179-G / A is the heat-resistant homozygous type GG, and the genotype of qPV-D12-42661640-A / T is the heat-resistant homozygous type AA, then the tested upland cotton is heat-resistant upland cotton; When at least one of the corresponding molecular markers qPV-A01-9089583-A / G, qPV-D01-8385035-T / G, qPV-D05-23825179-G / A and qPV-D12-42661640-A / T in the amplification product is a non-high temperature resistant homozygous genotype, the upland cotton to be tested is non-high temperature resistant upland cotton.

11. The method according to claim 10, characterized in that The PCR amplification reaction system, based on 20 μL, includes: 2 μL 10× Buffer, 1 μL genomic DNA template (75-100 ng / μL), 0.5 μL 10 μM upstream primer, 0.5 μL 10 μM downstream primer, 0.3 μL dNTP mix, 0.2 μL Taq enzyme, and ddH2O to make up to 20 μL.

12. The method according to claim 10 or 11, characterized in that The reaction procedure of the PCR amplification was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 53-62°C for 30 s, extension at 72°C for 30 s, for 35 cycles; and extension at 72°C for 30 s.

13. The method according to claim 12, characterized in that When amplifying the qPV-A01-9089583-A / G, the annealing temperature was 62°C; when amplifying the qPV-D01-8385035-T / G, the annealing temperature was 61°C; when amplifying the qPV-D05-23825179-G / A, the annealing temperature was 61°C; when amplifying the qPV-D12-42661640-A / T, the annealing temperature was 55°C.

Images