Composition for direct cell lysis which can be applied to various specimens and enables rapid nucleic acid pretreatment, and paper-based one-step all-in-one molecular diagnostic platform having improved user convenience, using same

Abstract

The present invention relates to a composition for cell lysis, which can be applied to a molecular diagnostic platform, and a paper-based molecular diagnostic platform using same. In a conventional specimen pretreatment method, a complex method is used wherein nucleic acid extracted from a specimen and other detection-inhibiting components are applied to a solution for dissolving, and the nucleic acid is again eluted. However, the present invention uses a simple and rapid method that results in increased inhibition of nucleic acid decomposition and an increased inactivation effect for amplification-inhibiting materials, and thus can be applied to an isothermal amplification reaction. In addition, by applying a specimen to the composition for cell lysis, separate pretreatment is not required, and by using the paper-based molecular diagnostic platform, the presence or absence of a target nucleic acid can be confirmed with the naked eye.

Description

A DIRECT cell lysis composition that can be applied to various samples and enables rapid nucleic acid preprocessing, and a paper-based one-step all-in-one molecular diagnostic platform that improves user convenience by applying the composition.

[0001] The present invention relates to a cell lysis composition applicable to a molecular diagnostic platform and a paper-based molecular diagnostic platform using the same.

[0002] As healthcare services improve and diagnostic devices advance, technologies are being developed to quickly and easily measure infectious microorganisms that threaten human health, such as new viruses, superbugs, tuberculosis, and food poisoning bacteria. Molecular diagnostics capable of measuring these pathogens offer excellent sensitivity and specificity, but often require specialized equipment and reagents or involve complex procedures. Immunodiagnostic methods, while easy to reproduce with kits and quick and simple, suffer from low measurement sensitivity.

[0003] Currently, real-time PCR is known as the fastest and most sensitive diagnostic method, and diagnosis can generally be made within 8 hours. Molecular diagnostic methods are rapidly developing along with the advancement of PCR and microchannel technologies, and products such as Alere's AlereTM I and Roche's Cobas Influenza, which can detect the virus within 60 minutes, are commercially available. However, rapid molecular diagnostic methods require expensive analytical equipment or high testing costs, and the entire molecular diagnostic process requires multiple steps, which still limits their use in point-of-care diagnosis.

[0004] The most widely used molecular diagnostic method today is real-time PCR. While this method is the most widespread due to its rapidity, it requires large and expensive equipment, making it difficult to implement in point-of-care settings or primary and secondary medical institutions. Molecular diagnostics requires three main steps: sample preparation, nucleic acid amplification reaction, and detection. While nucleic acid amplification and detection can be simultaneously reproduced using real-time PCR equipment, sample preprocessing remains a challenge.

[0005] Meanwhile, lab-on-paper technology is an integrated system that performs sample pretreatment, isothermal amplification, detection, and analysis steps on a single chip. With a small piece of paper and a chip structure embedded in the paper, all reactions can be automated and performed quickly, offering the advantage of being independent of location, such as the detection site.

[0006] The purpose of the present invention is to provide a cell lysis composition applicable to a molecular diagnostic platform and a paper-based molecular diagnostic platform using the composition.

[0007] Another object of the present invention is to provide a cell lysis composition that can be applied to an isothermal amplification reaction by applying a simple and rapid method to increase the inactivation effect of nucleic acid degradation inhibitory and amplification inhibitory substances, whereas conventional sample pretreatment methods use a complicated method of extracting nucleic acids from a sample and applying a solution to dissolve other detection inhibitory components, and then eluting the nucleic acids again.

[0008] Another object of the present invention is to provide a paper-based molecular diagnostic platform that can visually confirm the presence or absence of a target nucleic acid by applying a sample to the cell lysis composition and applying it to the paper-based molecular diagnostic platform without requiring separate pretreatment.

[0009] To achieve the above object, the present invention relates to a cell lysis composition comprising 5 mM to 80 mM Tris-HCl, 5 mM to 50 mM potassium chloride, 1 mM to 30 mM magnesium sulfate, 5 mM to 50 mM ammonium sulfate, 0.01 mg / ml to 0.1 mg / ml protease, 0.05 mM to 1.5 mM polyvinylsulfonic acid, and 0.01 w / w% to 0.2 w / w% TritonX-100 or Tween20 as a surfactant, wherein the acidity of the cell lysis composition is pH 8.0 to 9.0.

[0010] Additionally, the cell lysis composition may further comprise 4 mM to 10 mM vanadyl ribonucleoside complex.

[0011] Additionally, the cell lysis composition may be suitable for application to a lab-on-paper chip nucleic acid detection device.

[0012] Additionally, the cell lysis composition may be characterized in that it does not contain glycerol.

[0013] Additionally, the cell lysis composition may be characterized in that it does not contain a reducing agent.

[0014] A method for analyzing nucleic acids according to another embodiment of the present invention may include the steps of preparing a biological sample by mixing the cell lysis composition and a sample; applying the biological sample to a sample pad of a molecular diagnostic paper chip and amplifying a target nucleic acid; and detecting the nucleic acid amplification product on a detection pad.

[0015] According to another embodiment of the present invention, a paper-based molecular diagnostic platform comprises: a sample pad for accommodating a biological sample; an amplification pad disposed on the lower side of the sample pad, comprising a primer capable of specifically binding to a target nucleic acid and a reagent for an isothermal amplification reaction (LAMP), and in which an isothermal amplification reaction occurs; an initiator pad disposed on the upper side of the sample pad, comprising a heat-responsive hydrophobic valve for transporting an isothermal amplification reaction product to a detection pad when the isothermal amplification reaction is completed; a binding pad disposed on the lower side of the initiator pad, connecting the initiator pad and the detection pad and comprising gold nanoparticles; a detection pad disposed on the lower side of the binding pad for obtaining a target nucleic acid amplified from the isothermal amplification reaction product; and an absorption pad disposed on the side of the detection pad for absorbing a remaining sample, wherein a biological sample in which the cell lysis composition and the sample are mixed can be applied to the sample pad to detect a target nucleic acid.

[0016] The present invention relates to a conventional sample pretreatment method that uses a complicated method of applying a solution that extracts nucleic acids from a sample and dissolves other detection inhibitory components, and then eluting the nucleic acids again, but the cell lysis composition of the present invention uses a simple and rapid method to increase the inactivation effect of nucleic acid degradation inhibitory and amplification inhibitory substances, and can be applied to an isothermal amplification reaction.

[0017] In addition, by applying a sample to the cell lysis composition, the presence or absence of a target nucleic acid can be visually confirmed by applying it to the paper-based molecular diagnostic platform without requiring separate pretreatment.

[0018] FIG. 1 is a diagram of an all-in-one molecular diagnostic platform structure according to one embodiment of the present invention.

[0019] FIG. 2 is a drawing of a molecular diagnostic kit to which an all-in-one molecular diagnostic platform structure according to one embodiment of the present invention is applied.

[0020] Figure 3 is an example of sample flow according to the difference in pore diameter of a sample pad according to one embodiment of the present invention.

[0021] Figure 4 is a drawing for forming a wax barrier layer according to one embodiment of the present invention.

[0022] FIG. 5 is a drawing of a film layer disposed on the lower portion of a pad according to one embodiment of the present invention.

[0023] FIG. 6 is a drawing of a technique for improving the signal sensitivity of a detection pad according to one embodiment of the present invention.

[0024] Figure 7 is a test result confirming the inhibitory effect of an amplification inhibitor on a cell lysis composition according to one embodiment of the present invention.

[0025] Figure 8 shows the test results applied to a molecular diagnostic kit for COVID-19 using a cell lysis composition according to one embodiment of the present invention.

[0026] FIG. 9 shows the test results applied to a molecular diagnostic kit for INFLUENZA VIRUS A using a cell lysis composition according to one embodiment of the present invention.

[0027] The present invention relates to a cell lysis composition comprising 5 mM to 80 mM Tris-HCl, 5 mM to 50 mM potassium chloride, 1 mM to 30 mM magnesium sulfate, 5 mM to 50 mM ammonium sulfate, 0.01 mg / ml to 0.1 mg / ml protease, 0.05 mM to 1.5 mM polyvinylsulfonic acid, and 0.01 w / w% to 0.2 w / w% TritonX-100 or Tween20 as a surfactant, wherein the acidity of the cell lysis composition is pH 8.0 to 9.0.

[0028] Hereinafter, embodiments of the present invention will be described in detail so that those skilled in the art can easily implement them. However, the present invention may be implemented in various different forms and is not limited to the embodiments described herein.

[0029] Molecular diagnostic technology boasts superior sensitivity and specificity compared to other diagnostic methods, and is primarily used for confirmatory testing. However, molecular diagnostic technology requires expensive equipment, making it limited to laboratory-based diagnostics and difficult to apply in point-of-care diagnostics. In 2012, the development of paper-based nucleic acid amplification technology was initiated following the demonstration of the potential for isothermal nucleic acid amplification on inexpensive paper-based devices. As technology for isothermal nucleic acid amplification on paper advanced, sample pretreatment techniques for point-of-care molecular diagnostics became increasingly important.

[0030] Specimens for viruses and bacteria, including those causing infectious diseases and food poisoning, come in a variety of forms, including blood, plasma, saliva, nasal mucus, food, and culture media. A major challenge in molecular diagnostic testing of these specimens is the potential for false negatives or nucleic acid amplification inhibition due to the various PCR inhibitors present in the specimens. Furthermore, unpurified specimens are rich in components that can interfere with the polymerase's ability or suppress signal sensitivity from incorporated dyes, making specimen pretreatment crucial. In other words, specimen pretreatment techniques have been recognized as crucial in molecular diagnostics, as is nucleic acid amplification.

[0031] In molecular diagnostics, nucleic acid extraction and purification processes require expertise and a lot of time to remove contaminants from the sample. However, these existing methods are suitable for laboratory-based molecular diagnostics because they require various reagents and centrifuges, making them difficult to use for point-of-care and self-diagnosis. The existing sample pretreatment method is a complex method that applies a solution to extract nucleic acids from the sample and dissolve other inhibitory components, spins down the sample in a tube containing a nucleic acid-friendly substrate, binds the nucleic acids to the substrate, and completely removes the remaining unpurified substances through repeated washing before re-eluting the nucleic acids from the substrate.

[0032] Paper has advantages that can be applied to sample pretreatment techniques, such as high nucleic acid adsorption, microfluidic flow, ease of purification, ease of chemical reagent treatment, and reagent drying stability.

[0033] To leverage the advantages of these papers and apply them to molecular diagnostics, specimens must be prepared for use in molecular diagnostics. Specimen preparation is one of the most crucial and tedious steps in molecular diagnostics. Given the complexity and time-consuming nature of existing methods, a technology is needed to simplify and expedite sample preparation.

[0034] The cell lysis solution of the present invention is a lysis buffer (cell lysis solution) capable of extracting both DNA and RNA from viruses, bacteria, animal cells, etc. The above-described cell lysis solution can extract nucleic acids by destroying the outer membrane composed of virus proteins, the cell membrane composed of bacteria peptidoglycan and phospholipids, and the cell membrane composed of animal cells proteins, phospholipids, cholesterol, etc., and is a cell lysis solution (Inhibitor-Neutralizing Complex, INC) containing a component capable of inactivating a substance that inhibits isothermal amplification reaction and inhibiting the degradation of unstable nucleic acids.

[0035] Specifically, the cell lysis solution of the present invention may contain 5 mM to 80 mM Tris-HCl, 5 mM to 50 mM potassium chloride, 1 mM to 30 mM magnesium sulfate, 5 mM to 50 mM ammonium sulfate, 0.01 mg / ml to 0.1 mg / ml protease, 0.05 mM to 1.5 mM polyvinylsulfonic acid, and 0.01 w / w% to 0.2 w / w% TritonX-100 or Tween20 as a surfactant. The acidity of the cell lysis composition may be pH 8.0 to 9.0.

[0036] The cell lysis composition of the present invention enables nucleic acid detection in a lateral flow manner by applying a sample without including a separate step of purifying the sample, thereby improving problems that may arise from mixing with an isothermal amplification reaction buffer, etc. required in the process from sample application to nucleic acid detection.

[0037] The above cell lysis composition (lysis buffer) may contain Tris (tris(hydroxymethyl)aminomethane) at 5 mM to 80 mM, 5 mM to 50 mM, or 10 mM to 50 mM. The Tris may be specifically Tris-HCl, and may reduce rapid pH fluctuations as a buffer in the cell lysis composition.

[0038] The above cell lysis composition may have a pH of 8.0 to 9.0. If the pH is lower than 8.0, the stability of the nucleic acid material may be reduced or the migration speed may be reduced.

[0039] The cell lysis composition may contain potassium chloride (KCl) at a concentration of 5 mM to 50 mM, 5 mM to 40 mM, or 10 mM to 20 mM. High concentrations of potassium chloride, exceeding 50 mM, aid in cell lysis, but may reduce the water solubility of the eluted nucleic acid material, necessitating the addition of a large amount of additional buffer or increasing the time required for the material to migrate to the amplification pad. On the other hand, if the potassium chloride concentration is less than 5 mM, the cells may not be properly lysed.

[0040] The above cell lysis composition may contain magnesium sulfate (MgSO4) in an amount of 1 mM to 30 mM, 1 mM to 20 mM, or 2 mM to 16 mM. It has been confirmed that when an appropriate amount of magnesium sulfate is included, the stability and migration speed of the nucleic acid material increase, and since it does not affect viscosity, it does not interfere with the flow of fluid, making it advantageous for preprocessing samples for paper chip analysis.

[0041] The cell lysis composition may contain ammonium sulfate ((NH4)2SO4) at a concentration of 5 mM to 50 mM, 5 mM to 40 mM, or 10 mM to 20 mM. A high concentration of ammonium sulfate exceeding 50 mM may precipitate the cell lysate, and a concentration of ammonium sulfate less than 5 mM may cause pH instability.

[0042] The above cell lysis composition may contain a protease at 0.01 mg / ml to 0.1 mg / ml, or 0.03 mg / ml to 0.07 mg / ml. The protease decomposes high molecular weight proteins to prevent the high molecular weight proteins from blocking the pores of the substrate or paper, which are the migration path of the nucleic acid, and increases the stability of the nucleic acid material by inhibiting RNase and DNase activities. The above protease may be proteinase K.

[0043] The above cell lysis composition may contain polyvinylsulfonic acid in an amount of 0.05 mM to 1.5 mM, or 0.07 mM to 1.0 mM. When the polyvinylsulfonic acid is contained in an appropriate amount, the stability and migration speed of the nucleic acid material can be increased, and the cell lysate can be prevented from clumping together and moved, thereby blocking the cell lysate from moving to the amplification pad so that it can be filtered from the sample pad as described below, thereby further increasing the isothermal amplification efficiency.

[0044] The surfactant may be TritonX-100 or Tween20, and may be included in an amount of 0.01 w / w% to 0.2 w / w%, preferably 0.05 w / w% to 0.1 w / w%, based on the weight of the cell lysis composition.

[0045] The cell lysis composition may further comprise 4 mM to 10 mM vanadyl ribonucleoside complex. This may be included to prevent degradation of RNA by RNase.

[0046] The above cell lysis composition may not contain glycerol. Glycerol is sometimes added to prevent protein precipitation, but glycerol increases viscosity, reducing the fluidity of the cell lysate and hindering the movement of nucleic acid materials.

[0047] The above cell lysis composition may not contain a reducing agent. Reducing agents, such as dithiothreitol (DTT), mercaptoethanol, etc., help denature proteins and increase the water solubility of cell lysates. However, if present in the solution flowing into the paper chip, they may interfere with fluorescence emission or detection reactions.

[0048] By using the above cell lysis composition, nucleic acids can be more easily detected using lateral flow. The term “lateral flow” refers to a method in which a sample flows from the point of application to the target point by capillary action or diffusion in a horizontal direction without using gravity. Since cell lysate contains a large amount of hydrolytic enzymes that can degrade nucleic acid materials, if the nucleic acid material remains in the movement path for a long time, the yield of nucleic acid material may decrease. Therefore, in order to be applied to a lateral flow nucleic acid detection structure, the flow rate must be excellent, and the cell lysate must not precipitate during the movement of the sample and block the movement path. In addition, it must not form a salt with the nucleic acid material to cause precipitation or reduce the movement speed. The composition of the cell lysis composition of the present invention can move the nucleic acid material laterally to the amplification pad with a high yield without precipitating the cell lysate or nucleic acid material even without containing glycerol or a reducing agent.

[0049] The nucleic acid detection device to which the cell lysis composition of the present invention is applied is based on lab-on-paper chip technology, and the nucleic acid material is purified as it moves to the amplification pad without separate nucleic acid purification, and can be applied to the amplification reaction immediately, and a plurality of target nucleic acids can be detected simultaneously by applying a single sample and related diseases can be diagnosed.

[0050] To achieve this, the nucleic acid detection structure of the present invention includes a sample pad (110), an amplification pad (120), an initiator pad (130), a binding pad (140), a detection pad (150), and an absorption pad (160) as components.

[0051] Each component is described in detail below.

[0052] Sample pad (110)

[0053] The sample pad (110) accommodates a sample containing a nucleic acid material. The sample may be isolated from a human body or from food, etc. Specifically, the sample isolated from a human body includes, but is not limited to, blood, serum, plasma, saliva, sweat, urine, cell culture medium, tissue suspension, etc. In addition, the sample isolated from food, etc. may include, but is not limited to, the food itself, food preparation tools, food ingredients before cooking, etc. Specifically, if the food or food ingredient is in a solid state, the food may be ground and mixed with saline solution, etc. for use, and if it is in a liquid state, it may be used as is.

[0054] The above sample may be mixed with a cell lysis buffer, and if necessary, may be further purified by a commonly known method such as centrifugation, filtration, or precipitation after mixing with the cell lysis buffer. Preferably, the sample does not include a step of purifying the sample for application to the sample pad outside of the molecular diagnostic platform structure after mixing with the cell lysis buffer.

[0055] The above cell lysis buffer may contain Tris (tris(hydroxymethyl)aminomethane) at 5 mM to 80 mM, 5 mM to 50 mM, or 10 mM to 50 mM. The Tris may be specifically Tris-HCl, and may reduce rapid pH fluctuations as a buffer in the cell lysis buffer. The cell lysis buffer may have a pH of 8.0 to 9.0. When the pH is lower than 8.0, the stability of the nucleic acid material may be reduced or the migration speed may be reduced.

[0056] The above cell lysis buffer may contain potassium chloride (KCl) at a concentration of 5 mM to 50 mM, 5 mM to 40 mM, or 10 mM to 20 mM. High concentrations of potassium chloride, exceeding 50 mM, aid in cell lysis, but may reduce the water solubility of the eluted nucleic acid material, necessitating the addition of a large amount of additional buffer or increasing the time required for the material to migrate to the amplification pad. On the other hand, if the potassium chloride concentration is less than 5 mM, the cells may not be properly lysed.

[0057] The above cell lysis buffer may contain magnesium sulfate (MgSO4) at 1 mM to 30 mM, 1 mM to 20 mM, or 2 mM to 16 mM. It has been confirmed that when an appropriate amount of magnesium sulfate is included, the stability and migration speed of the nucleic acid material increase, and since it does not affect viscosity, it does not interfere with the flow of fluid, making it advantageous for pretreating samples for paper chip analysis.

[0058] The above cell lysis buffer may contain ammonium sulfate ((NH4)2SO4) at 5 mM to 50 mM, 5 mM to 40 mM, or 10 mM to 20 mM. A high concentration of ammonium sulfate exceeding 50 mM may precipitate the cell lysate, and a concentration of ammonium sulfate less than 5 mM may cause pH instability.

[0059] The above cell lysis buffer may contain a protease at 0.01 mg / ml to 0.1 mg / ml, or 0.03 mg / ml to 0.07 mg / ml. The protease decomposes high-molecular-weight proteins to prevent the high-molecular-weight proteins from blocking the pores of the substrate or paper, which are the migration paths of the nucleic acids, and inhibits RNase and DNase activities to increase the stability of the nucleic acid material. The protease may be proteinase K.

[0060] The surfactant may be TritonX-100 or Tween20 (polysorbate 20), and may be included in an amount of 0.01 w / w% to 0.2 w / w%, preferably 0.05 w / w% to 0.1 w / w%, based on the weight of the cell lysis buffer.

[0061] Additionally, it may include 0.05 mg / mL to 1.5 mg / mL polyvinylsulfonic acid, 4 mM to 10 mM vanadyl ribonucleoside complex, etc.

[0062] The above cell lysis buffer may be used at a ratio of 1:1 to the volume of the sample.

[0063] The above cell lysis buffer may not contain glycerol. While glycerol is sometimes added to prevent protein precipitation, glycerol increases viscosity, reducing the fluidity of the cell lysate and hindering the movement of nucleic acid materials.

[0064] The above cell lysis buffer may not contain a reducing agent. Reducing agents, such as dithiothreitol (DTT) and mercaptoethanol, help denature proteins and increase the water solubility of cell lysates. However, if present in the solution flowing into the paper chip, they may interfere with fluorescence emission or detection reactions.

[0065] The above sample pad (110) may be selected from the group consisting of polyester paper, cellulose paper, cotton paper, and polysulfone paper, and preferably may be polysulfone paper.

[0066] The above polysulfone paper includes a structure in which two or more layers are laminated, may be asymmetrical, and may be a porous material having pores of 0.5 μm to 1 μm. Specifically, the asymmetric paper may include an upper layer and a lower layer, and the pores included in the upper layer may have an average diameter of 15 μm to 25 μm, and may include pores having various diameters. The plurality of pores included in the upper layer may have a diameter of approximately 7 μm to 29 μm. In addition, the pores included in the lower layer arranged to be in contact with the upper layer may have an average diameter of 1 μm to 5 μm, 1 μm to 4 μm, or 1 μm to 3 μm, and may include pores having various diameters. The plurality of pores included in the upper layer may have a diameter of approximately 1 μm to 9 μm. As described above, it is advantageous for the paper constituting the sample pad to have a relatively large pore diameter in the upper layer. However, many biological samples have viscosity, and in particular, when a cell lysis composition is treated on the sample, the viscosity may significantly increase as nucleic acid substances and proteins are eluted out of the cells. Therefore, it is preferable that the pore size of the sample pad (110) be appropriate for rapid absorption of the sample.

[0067] When a paper including asymmetric pores as shown in Fig. 3 is used as a sample pad, a sample passing through the sample pad can evenly move to the amplification pad while passing through the entire pores of the sample pad.

[0068] As described above, when moving to the amplification pad through the entire surface of the sample pad, it can react with all the isothermal amplification reaction reagents contained in the amplification pad, so that an efficient isothermal amplification reaction can proceed.

[0069] On the other hand, unlike the present invention, when a symmetrical paper is used as a sample pad and there is no difference compared to the pores of the amplification pad, the sample passing through the sample pad does not flow across the entire area of ​​the sample pad, but a narrow flow occurs within the portion where the sample is introduced, and the sample moves to the amplification pad along this narrow flow. At this time, the isothermal amplification reaction reagent fixed within the amplification pad moves to both ends due to the flow of the initial sample. Therefore, even if the sample is completely absorbed into the amplification pad, a problem may arise in which the isothermal amplification reaction does not occur because the isothermal amplification reaction reagent is not contained within the area where the initial sample was absorbed.

[0070] Amplification pad (120)

[0071] The amplification pad (120) is a component corresponding to a paper chip in the lab-on-paper, and isothermal amplification reaction reagents including dNTP, DNA polymerase, reverse transcriptase, fluorescent marker, isothermal amplification reaction buffer, etc. for amplification reaction are fixed thereon. Therefore, a solution containing a nucleic acid material is permeated and wetted into the amplification pad by an additional buffer solution applied to the sample pad, and when the contact material of the isothermal amplification reaction reagent and the sample moves to the amplification pad and is heated to 60 to 70°C by a heating unit at the bottom of the amplification pad, an isothermal amplification reaction or reverse transcription isothermal amplification reaction occurs.

[0072] The above isothermal amplification reaction reagent may specifically include dNTP (0.7 mM to 1.4 mM, dATP, dCTP, dGTP, and dTTP), isothermal amplification buffer (10 mM to 50 mM Tris-HCl, 5 mM to 20 mM (NH4)2SO4, 20 mM to 150 mM KCl, 2 mM to 8 mM MgSO4, and 0.1% Tween-20, pH 8.8), and Bst 3.0 DNA polymerase (0.1 U / uL to 1 U / uL), which may be mixed in an amplification pad and then dried under conditions such as refrigeration, freezing, or room temperature, or may be applied to the surface of the amplification pad in powder form and fixed by heating in an oven at about 35 to 40°C for about 30 minutes, for example.

[0073] A heating unit may be placed under the amplification pad to heat to a temperature at which the above isothermal amplification reaction can occur. The heating unit may include a heating wire or a heating plate for heating. The heating may be performed under conditions of 60 to 70°C, 60 to 65°C, for 10 to 60 minutes, 20 to 40 minutes, or 30 minutes.

[0074] The amplification pad has a plurality of wells, and each well can be immobilized with a primer set for an isothermal amplification reaction, including forward and reverse inner primers (inner primers: FIP and BIP, 0.8 μM to 3.2 μM), loop primers (loop primers: FL and BL, 0.2 μM to 0.8 μM), and outer primers (outer primers: F3 and B3, 0.1 μM to 0.2 μM). The concentration of the primers is a concentration relative to the well volume, and the concentration of the primer set in the well can be changed while maintaining the concentration ratio between each primer. The presence of the well in the amplification pad allows the isothermal amplification reaction to occur more intensively. Specifically, the well may have a hydrogel layer formed on the bottom, and the primer set may be immobilized on the hydrogel layer. For intensive amplification of a specific target nucleic acid, a primer set that specifically binds to a different target nucleic acid may be immobilized in each well.

[0075] The hydrogel layer containing the above primer can be formed, for example, by the following method. Based on the total volume of the hydrogel solution, 20% v / v of UV-photocrosslinkable poly(ethylene glycol) diacrylate (PEGDA, Sigma-Aldrich, MW700), 40% v / v of poly(ethylene glycol) (PEG, Sigma-Aldrich, MW600), 5% v / v of the photoinitiator 2-hydroxy-2-methylpropiophenone (Sigma-Aldrich), and 35% of a buffer (PBS buffer, pH 7.5) are mixed, and the primer set is mixed therein to prepare a hydrogel solution. The poly(ethylene glycol) is preferably included to increase the porosity of the hydrogel microparticles. Then, the hydrogel solution is applied to the inner surface of each well of the amplification pad, and exposed to UV (360 nm wavelength, 35 mJ / cm2) for 1 minute to form a hydrogel coating layer. Since the hydrogel layer has pores, the primer within the hydrogel layer can bind and an amplification reaction can occur intensively within the pores.

[0076] In the above primer set, any one of the forward and reverse primers may be labeled with one or more fluorescent markers selected from the group consisting of Cy3, Cy5, TAMRA, TEX, TYE, HEX, FAM, TET, JOE, MAX, ROX, VIC, Cy3.5, Texas Red, Cy5.5, TYE, BHQ, Iowa Black RQ, and IRDye. The fluorescent markers may be labeled differently for each target nucleic acid in order to independently detect the target nucleic acids.

[0077] In the above primer set, either the forward or reverse primer may be biotin-conjugated. Since biotin can bind to streptavidin, it exists in a bound form on the amplified target nucleic acid, and when it passes through the second connection pad, it binds to streptavidin on the surface of the gold particle and is captured by the detection pad, thereby visualizing the detection result. The biotin may be designed to be located opposite the detector on the amplified target nucleic acid. For example, if the detector is conjugated to the 5' end of the forward primer, biotin may be conjugated to the 5' end of the reverse primer.

[0078] The amplification pad may contain 10 mM to 100 mM trehalose, 40 mM to 50 mM sucrose, 0.001 to 0.01% Triton X-100, and 0.1 w / w% to 0.3 w / w% glycerol. This may increase the storage stability of isothermal amplification reaction reagents and primer sets when exposed to moisture or oxygen. The storage stability may mean that the amplification pad can be stored for more than 6 months at 25°C to 30°C without decomposition products or byproducts.

[0079] The amplification pad may use paper having a pore size of 0.001 μm to 0.005 μm, preferably 0.005 μm, so that the nucleic acids can remain and sufficiently undergo an isothermal amplification reaction while allowing the free flow of the sample and additional buffer. Specifically, the amplification pad may be selected from the group consisting of polyester paper, cellulose paper, cotton paper, and polysulfone paper, and preferably polyester paper.

[0080] The above polyester paper has a highly porous structure, which can increase the reactivity of reagents, and the chemical components processed during paper manufacturing do not inhibit the LAMP amplification reaction.

[0081] As described above, the amplification pad of the present invention is placed below the sample pad, so that a sample passing through the sample pad moves vertically to the amplification pad, thereby allowing an isothermal amplification reaction to proceed.

[0082] In conventional molecular diagnostic kits, the sample pad and the amplification pad are arranged in series for lateral movement, so that the sample injected into the sample pad moves laterally to the amplification pad, and an isothermal amplification reaction is performed on the amplification pad. If the sample pad and the amplification pad are connected to each other to form a molecular diagnostic structure, the problem of sample evaporation may occur when the isothermal amplification reaction is performed on the amplification pad. That is, since the isothermal amplification reaction is performed by providing heat by a heating unit located at the bottom of the amplification pad and the reaction is performed by continuously supplying such heat, the problem of sample evaporation in a liquid state may occur according to the isothermal amplification reaction, and to prevent this, a separate blocking pad is required to prevent evaporation of the sample.

[0083] On the other hand, the present invention positions the amplification pad below the sample pad, so that the amplification pad is positioned perpendicular to the sample pad, and thus the sample pad is positioned during the isothermal amplification reaction, thereby preventing evaporation of the sample, thereby increasing the efficiency of the reaction without a separate structure.

[0084] In addition, due to the vertical structural characteristics of the sample pad and amplification pad described above, since the sample pad is a paper with an asymmetric structure as described above, impurities in the sample can be first removed by the sample pad and then moved to the amplification pad.

[0085] A film layer (121) may be placed under the amplifying pad. The film layer (121) is positioned under the amplifying pad and may be placed symmetrically in the length direction with respect to the center of the amplifying pad. More specifically, it may be placed with respect to the center of the amplifying pad and may be placed so as to have a length of 25% to 75% of the total length of the amplifying pad.

[0086] As the film layer (121) is arranged as described above, a gap is formed between the amplification pad and the film layer, and the gap acts as a path, so that when the isothermal amplification reaction product moves by the initiator pad described later after the isothermal amplification reaction is completed at the amplification pad, it can move at a faster speed.

[0087] However, when the film layer (121) is placed on the amplification pad, it is preferable to place it so as to have a constant interval. For this purpose, a product in which the film layer is adhered to the amplification pad can be purchased and used, or, when placing the film layer on the amplification pad as shown in FIG. 5, a film layer can be additionally laminated on both ends of the film layer so that the interval between the amplification pad and the film layer is constant. At this time, the interval between the amplification pad and the film layer may be 100 µm to 750 µm, 150 µm to 500 µm, or 200 µm to 400 µm in height. If the height of the flow path is too low or too high, a problem may occur in which the flow rate of the isothermal amplification reactant slows down. When a flow path of an appropriate height, such as the above range, is formed by laminating the amplification pad and the film layer, a fast flow rate can be exhibited, thereby facilitating movement through the initiator pad.

[0088] The above film layer (121) can be made of any non-porous film material without limitation. For example, a polyacrylic film can be used, but is not limited to the above material.

[0089] Initiator Pad (130)

[0090] The above initiator pad (130) is placed on top of the sample pad and includes a thermally responsive hydrophobic valve to maintain fluid flow during an isothermal amplification reaction and to transport the isothermal amplification reaction product to the detection pad when the isothermal amplification reaction is completed.

[0091] The initiator pad may include an additional buffer to prevent nonspecific binding of antibodies in the detection signal. For example, the initiator pad may be an isothermal buffer or phosphate buffer (50 mM Na2HPO4, pH 7.2) containing 5 mM to 80 mM Tris-HCl, 20 mM to 70 mM potassium chloride, 0.5 mM to 5 mM magnesium sulfate, 1 mM to 30 mM ammonium sulfate, and 0.01 w / w% to 0.2 w / w% Tween® 20 to TritonX-100 and having an acidity of pH 8.0 to 9.0. The isothermal buffer may more specifically contain 20 mM Tris-HCl, 10 mM (NH4)2SO4, 50 mM KCl, 2 mM MgSO4, and 0.1% Tween® 20 and have an acidity of pH 8.8. The above additional buffer may not contain a proteolytic enzyme, glycerol, or reducing agent.

[0092] The above initiator pad may include a thermally responsive hydrophobic valve (131) and a blocking film layer (132) at one end.

[0093] The above initiator pad includes a thermally responsive hydrophobic valve (131) at one end, and the thermally responsive hydrophobic valve can prevent movement of the sample while the isothermal amplification reaction is in progress in the amplification pad. The above initiator pad may be made of a material composed of a cellulose membrane and may have pores of 0.005 μm to 0.015 μm. The portion of the initiator pad that comes into contact with the amplification pad may be coated with low-melting-point agarose or wax.

[0094] Conventional thermally responsive hydrophobic valves have formed wax barriers, and in order to completely block the flow of fluid, multiple wax barriers are formed so that the first wax barrier and the second wax barrier can block the flow. When multiple wax barriers are formed as described above, the fluid flow blocking effect by the wax barriers is excellent, but there is a problem that the inconvenience of forming multiple wax barriers and controlling them to an appropriate width must be resolved in the manufacturing process.

[0095] Accordingly, in the present invention, instead of forming a plurality of thermally responsive hydrophobic valves, a wax barrier is formed with a single thermally responsive hydrophobic valve, and at this time, the fluid blocking effect by the wax barrier is increased, and when the isothermal amplification reaction is completely completed in the amplification pad, the wax barrier is opened by heat, and an optimal width is set to enable smooth movement of the fluid.

[0096] FIG. 4 is a diagram illustrating a process for forming a thermally responsive hydrophobic valve according to one embodiment of the present invention, wherein wax film layers are disposed on the upper and lower portions of an initiator pad, and the wax is absorbed into the initiator pad through a lamination process. At this time, the wax is completely absorbed into the initiator pad, so that the wax of the wax film layers disposed on the upper and lower portions of the initiator pad can come into contact with and be bonded to the interior of the initiator pad.

[0097] At this time, the width of the thermally responsive hydrophobic valve is 1.0 mm to 4.0 mm, 2.0 mm to 4.0 mm, and may be 3.0 mm. Within the above width range, the movement of the sample can be prevented by the thermally responsive hydrophobic valve while the isothermal amplification reaction is carried out for 30 minutes under the condition of 60° C. on the amplification pad, and after the isothermal amplification reaction is completely completed, the thermally responsive hydrophobic valve is heated for 2 minutes under the condition of 90° C., and when the thermally responsive hydrophobic valve melts and opens, the isothermal amplification reactant moves through the initiator pad to the binding pad and the detection pad.

[0098] The above initiator pad can be divided into a portion connected to the sample pad (110) and a portion connected to the bonding pad (140) based on the thermal reaction hydrophobic valve (131). In the portion connected to the bonding pad, a blocking film layer (132) may be additionally included to prevent evaporation of the isothermal amplification reactant when it moves.

[0099] The above-mentioned blocking film layer (132) may utilize a polyacrylic film to prevent evaporation of the sample. However, the present invention is not limited to the above example, and any material capable of preventing evaporation of the sample may be used without limitation.

[0100] Additionally, the portion connected to the sample pad may have a film layer (133) placed underneath. It may be placed like the film layer (121) placed underneath the amplification pad (120) described above.

[0101] The above initiator pad is a porous material having pores of 0.5 μm to 1 μm, and may be cotton, fluff, paper, nitrocellulose, cellulose acetate, glass fiber, polysulfone, polyacrylic, polynitrile, polypiperazine, polyamide, polyethersulfone, polyvinylidene fluoride, polyethyleneimine, polydimethylsiloxane, or a mixture thereof.

[0102] Bonding pad (140)

[0103] The binding pad may be positioned above and to the side of the amplification pad, partially in contact with the amplification pad. The binding pad comprises gold nanoparticles, and the gold nanoparticles bind to the nucleic acids amplified in the amplification pad and are transferred to the detection pad. The gold nanoparticles may preferably have streptavidin or a specific antibody immobilized on their surface, but are not limited thereto.

[0104] The above binding pad may be a porous material such as cotton, fluff, paper, nitrocellulose, glass fiber, polysulfone, polyacrylic, polynitrile, polypiperazine, polyamide, polyethersulfone, polyvinylidenefluoride, polyethyleneimine, polydimethylsiloxane or a mixture thereof, having a pore size of 0.01 μm to 0.05 μm, preferably 0.05 μm, so that the amplified nucleic acid can easily move to the detection pad.

[0105] The above binding pad is arranged perpendicular to the initiator pad, and serves to help the isothermal amplification reactant moved from the initiator pad to move to the detection pad, thereby allowing the gold nanoparticles to bind well to the nucleic acid to be detected. However, when the binding pad is laterally bound to the initiator pad and the detection pad, as in the conventional molecular diagnostic kit, the problem of evaporation of the fluid may occur. To prevent this problem, a separate blocking pad had to be included, but in the present invention, by positioning the binding pad perpendicular to the initiator pad, not only does it facilitate the movement of the isothermal amplification reactant from the initiator pad to the binding pad, but it also prevents the problem of the liquid sample evaporating and reducing the detection sensitivity.

[0106] Detection pad (150)

[0107] The detection pad may be positioned on the lower and side of the binding pad, in contact with a portion of the binding pad. A receptor (151) capable of binding to a detector (152) is fixed to the detection pad. The receptor may be an antibody, protein, or a fragment thereof capable of specifically binding to the detector.

[0108] The above detection pad includes a plurality of detection zones, and the detection zones can be divided into lines or wells. Each receptor is independently fixed to each detection zone, and after forming a detection zone by stamping with ink containing, for example, polyethylene phthalate, the detection zone is then stamped again with ink containing the receptor, or in the case of a well, a solution containing the receptor is applied, and EDC (1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide) or NHS (N-hydroxysulfosuccinimide) can be applied. Dozens to hundreds or more detection zones are formed on one amplification pad, and target nucleic acids can be detected as many as the number of detection zones formed by applying a single sample.

[0109] The above detection pad may be selected from the group consisting of polyester paper, cellulose paper, cotton paper, and polysulfone paper, and may have a pore size of 0.001 μm to 0.005 μm, preferably 0.005 μm, so that the sample can move laterally to the absorption pad.

[0110] The above detection pad is specially patterned for micro-channel control. Specifically, based on the cross-section of the detection pad, the detection signal can be divided into a visible region and an invisible region as the detector binds to the receptor. In the case of detector-receptor binding in the invisible region, there is a problem of causing signal loss because the color of gold is not visible. Therefore, in the present invention, as shown in Fig. 6, the invisible region of the detection pad is blocked by wax patterning, thereby allowing the detector to bind to the receptor (151) in the visible region, thereby exhibiting a higher detection signal.

[0111] Specifically, the detection pad of the present invention is characterized by including a hydrophobic blocking layer in a non-visible area using a transfer film. Specifically, the hydrophobic blocking layer may include wax. In order to form the hydrophobic blocking layer as described above, a transfer film including wax is positioned on a surface of the detection pad that comes into contact with the non-visible area, and the wax of the transfer film is moved to the detection pad by lamination to form a hydrophobic blocking layer. The hydrophobic blocking layer may be formed using a method using a transfer film including the above-described wax, but is not limited to the above examples, and any method for including a hydrophobic substance in the non-visible area may be used without limitation.

[0112] When a hydrophobic blocking layer is formed on the cross-section of the detection pad as described above, a liquid sample moves to a porous region where a hydrophobic blocking layer is not formed, and a detector included in the sample binds to a receptor fixed to the detection pad. The thickness of the porous region may be 100 µm to 10 µm, 80 µm to 10 µm, 60 µm to 10 µm, 40 µm to 10 µm, 20 µm to 10 µm, or 20 µm. When a hydrophobic blocking layer is formed on the detection pad so as to have a thickness of the path within the above range, a colorimetric detection enhancement effect can be exhibited without a change in signal intensity.

[0113] Absorbent pad (160)

[0114] The absorbent pad (160) absorbs samples, buffers, etc. to block reverse flow and contribute to inducing lateral flow. The absorbent pad is a porous material and may be cotton, fluff, paper, nitrocellulose, cellulose acetate, glass fiber, polysulfone, polyacrylic, polynitrile, polypiperazine, polyamide, polyethersulfone, polyvinylidene fluoride, polyethyleneimine, polydimethylsiloxane, or a mixture thereof. The absorbent pad may preferably be glass fiber and have a pore size of 0.1 to 0.5 μm.

[0115] The above sample pad (110), amplification pad (120), initiator pad (130), bonding pad (140), detection pad (150), and absorption pad (160) are arranged to be connected to each other, and are in a coupled state so that a sample can move to the absorption pad (160) through the sample pad (110). Specifically, the amplification pad (120) is positioned vertically below the sample pad (110), the initiator pad (130) is arranged on one upper side of the sample pad (110) and is connected laterally, and the bonding pad (140) is arranged on the lower side of the other side of the initiator pad (130) so that they can be vertically coupled, the detection pad (150) can be arranged on one side of the bonding pad (140) below, and the absorption pad (160) can be arranged on one side of the detection pad (150).

[0116] A molecular diagnostic kit according to another embodiment of the present invention may have a shape as shown in FIG. 2. According to FIG. 2, the molecular diagnostic kit of the present invention may include a housing (200, 200'), an internal bracket (300), a molecular diagnostic strap (100), and a PCB substrate (400).

[0117] The above housing is divided into an upper housing (200) and a lower housing (200'), and the upper housing includes a sample receiving portion for receiving a biological sample and a detection area for confirming a search line.

[0118] The above-described internal bracket (300) includes a plurality of push pins for fixing a molecular diagnostic strap (100) located inside the housing and preventing heat from leaking out. Specifically, the push pins are located at the front and rear ends of the thermally responsive hydrophobic valve within the molecular diagnostic strap (100). The above-described push pins surround the thermally responsive hydrophobic valve and press the initiator pad, thereby preventing heat transferred by a heating unit within a PCB substrate (400) described below from leaking out to the outside, thereby melting the thermally responsive hydrophobic valve with minimal heat and heating time, or preventing heat from being released for an amplification reaction within the amplification pad.

[0119] The above molecular diagnostic strap (100) includes the sample pad (110), amplification pad (120), initiator pad (130), binding pad (140), detection pad (150), and absorption pad (160) described above, and is replaced with the above description.

[0120] In addition, the average pore diameter for the sample pad (110) is as described above, and the average diameter of the pores of the amplification pad (120), the initiator pad (130), the binding pad (140), the detection pad (150), and the absorption pad (160) is 7 µm to 29 µm, and more specifically, the pores of the amplification pad (120) may have a diameter of 15 µm to 37 µm, and the average diameter may be 20 µm to 29 µm. In addition, the pores of the initiator pad (130) may have a diameter of 5 µm to 26 µm, and the average diameter may be 15 µm to 19 µm. The binding pad may use paper having the same pore diameter as the amplification pad described above.

[0121] In addition, as described below, the amplification pad (120) may be immobilized with a primer set for amplifying a target nucleic acid. Specifically, a primer set for detecting COVID-19, Influenza A, or Influenza B may be immobilized, and each primer set capable of detecting COVID-19, Influenza A, and Influenza B may be immobilized on one amplification pad (120). Using one molecular diagnostic kit, HIV-1 and HIV-2 may be detected separately, or HIV-1 and HIV-2 may be diagnosed simultaneously with one molecular diagnostic kit.

[0122] The PCB substrate (400) is connected to an external power source and includes a power button, two heating elements, a temperature sensor, and a control element. The power button can be operated when the power button in the upper housing (200) is pressed, and the temperature sensor is located on the other side of each heating element to precisely control the degree of temperature increase by the heating elements. The heating elements are respectively located in an area corresponding to the amplification pad and an area corresponding to the thermally responsive hydrophobic valve. When the molecular diagnostic kit of the present invention is operated, the heating elements located in the area corresponding to the amplification pad provide heat over time so that an isothermal amplification reaction proceeds in the amplification pad, and when the isothermal amplification reaction is completed, the heating elements stop supplying heat, and the heating elements located in the area corresponding to the thermally responsive hydrophobic valve provide heat so that the wax barrier melts and the isothermal amplification reactants can move. The heating temperature of each heating element may be to satisfy the temperature conditions for the above-described isothermal amplification reaction and the temperature conditions for melting the thermally responsive hydrophobic valve FMF.

[0123] A quantitative analysis method for COVID-19, Influenza A, or Influenza B according to another embodiment of the present invention may include the steps of applying a biological sample to a sample pad of the all-in-one molecular diagnostic platform structure, amplifying a target nucleic acid; and detecting the nucleic acid amplification product in a detection pad.

[0124] In order to amplify the above target nucleic acid, the present invention uses an isothermal amplification reaction, and in order to proceed with this isothermal amplification reaction, design and securing of primers are required.

[0125] Specifically, while conventional nucleic acid amplification technology uses a pair of primers, nucleic acid isothermal amplification is a technology that amplifies nucleic acids at a constant temperature using two or three pairs of primers. Compared to general nucleic acid amplification technology, it can produce a large number of amplification products in a short period of time. However, due to the large number of primers, there is a high possibility of non-specific amplification, so a technology that can control this and enable rapid amplification is needed. In the present invention, a primer design program developed by applying artificial intelligence technology was used to suppress non-specific amplification and improve amplification reaction efficiency and colorimetric signal in nucleic acid isothermal amplification using four or six primers.

[0126] To classify the quality of LAMP primer sets for amplification activity and nonspecific amplification inhibition, models for primer set prediction and primer set quality classification are needed. To develop the first primer set prediction model, data were selected from online resources provided by existing LAMP primer design tools. The collected data included entire genome sequences and corresponding LAMP primer sets. The data structure included features such as tm, GC content, length, and ΔG values ​​for mono- and heterodimers for each primer. The target structure for the data was defined by two key elements: the start position of each primer and the distance between the end and start of adjacent primers. These allow for a clear representation of the spatial sequence at which the primers are intended to bind to the target DNA.

[0127] By structuring the data in this way, we trained multi-layer perceptron (MLP) and convolutional neural network (CNN) machine learning models to not only identify potential primers but also preserve the order and spacing required for the LAMP process to function correctly.

[0128] To develop a quality classification model for LAMP primer sets, we quantified the characteristics of primer sets for various indications and the amplification patterns of each primer set. The dataset consisted of various primer attributes along with labels indicating amplification success. For data clustering and classification, a large-scale unlabeled dataset derived from the primer set prediction model was clustered using a multi-model approach. To improve the accuracy of the classification model, class labels were assigned and the clusters were integrated with the labeled data.

[0129] LAMP primer design AI technology uses multi-layer perceptron (MLP) and convolutional neural network (CNN) machine learning models to select data from online resources provided by existing LAMP primer design tools. The AI ​​model learns characteristics such as Tm, GC content, length, ΔG values ​​for mono- and hetero-dimers, and the starting position and inter-primer distances of each primer in the target structure. Furthermore, the AI ​​program was completed by combining a primer-based amplification product size prediction model, which predicts the size of the amplification product based on the LAMP amplification reaction principle. Furthermore, this program developed an algorithm to predict the optimal LAMP master mix for various infectious diseases and emerging infectious diseases, thereby completing a technology for reconstituting LAMP amplification reagents for new pathogens. Through this method, we confirmed rapid amplification (within 15 cycles) without nonspecific amplification in single or simultaneous multiplex LAMP amplification for 16 infectious diseases. Furthermore, we confirmed that the colorimetric signal was improved by approximately 1.5 times through primer design that allows for size adjustment of the amplification product.

[0130] Specifically, the isothermal amplification reaction uses 4 to 6 primers to generate amplified products of various structures and sizes through a complex amplification reaction as the nucleic acid isothermal amplification reaction occurs, and amplified products of various sizes ranging from 100 bp to 10,000 bp are created. In a LOP system such as the present invention, the size of the nucleic acid, which is the amplified product, is one of the main factors affecting the sensitivity of the colorimetric signal in order for the antibody of the detection pad and the nucleic acid, which is the amplified product, to bind according to the microfluidic flow.

[0131] Accordingly, as a result of confirming through electrophoresis the amplification product bound to the test line of the detection pad to which the molecular diagnostic platform technology of the present invention is applied and the pure amplification product not bound to the detection pad, the size of the amplification product bound to the detection line was 500 bp or less, and it tended not to bind well at sizes greater than that.

[0132] Taking advantage of this trend, a technology capable of maximizing the production of amplicons smaller than 500 bp is needed to improve detection signal, as amplicons larger than 500 bp do not affect the detection signal. To this end, a primer-based mathematical model was developed that predicts the size of amplicons based on the principle of isothermal amplification:

[0133] [Formula 1]

[0134] LAMP structure size (bp) = (B2+B space ) + (B1)(x) + T(x) + (F1)(x +1) + (F2+ F space )

[0135] Here,

[0136] B2: B2 base sequence size (bp)

[0137] B space : Base sequence size (bp) between B1 and B2

[0138] B1: B1 base sequence size (bp)

[0139] T: Base sequence size (bp) between B1 and F1

[0140] F1: F1 base sequence size (bp)

[0141] F2: F2 base sequence size (bp)

[0142] F space : Base sequence size (bp) between F1 and F2

[0143] x: Value for each component according to the number of loops formed in the amplified product

[0144] Based on this technology, the time required to design and secure primers for various new diseases can be significantly shortened.

[0145] The sequence information of the primers designed and secured through the technology of the present invention is as shown in Table 1 below:

[0146] Indication genePrimerSequence Sequence number HIV-1 Gagpol F3 GCCAAAGTGATCCCA Sequence number 1 B3 ATCTGCCTGGTCAATA Sequence number 2 FIPCCACTTGTTAGCATGGTGTTGTTTTCACATTATCAGAAGA Sequence number 3 BIPGACATCAAGCGCCATGCAAGGATGCATCTATCCATTC Sequence number 4 LBAGAACCTCATGAGGAGCTGC Sequence number 5 HIV-2 Gagpol F3 CTCCTCTTGAAAG AGGAASEQ ID NO: 6B3CCCTGTGGTATCTGAATGGATSEQ ID NO: 7FIPGCCCACACAATTGTTTTAACCTTGCAGACGAATTAGGAAAGTTAGGSEQ ID NO: 8BIPAGCGAATGAAGAAGGATAAATTGGACTAAAACTCGAGATCTTTGGCSEQ ID NO: 9LFTTTCCGAAGGATCGTAASEQ ID NO: 10LBTTGGCAGGGAGGCTGGTGGASEQ ID NO: 11COVID-19ORFF3GGCCAAGTCTGCGG TCAASEQ ID NO: 12B3TCTTTGGTTAATCTAGCCCASEQ ID NO: 13FIPTCAGTGCTGCATGTTTGTAGCTTAGTTCCTGTCACTACGSEQ ID NO: 14BIPAATGCGTTAGCTTACTACACATTTTCAAATCCTGTATAATCGGATATSEQ ID NO: 15LFTACTCGGCAGTCACATAGACSEQ ID NO: 16LBCAATAGGGAGGTAGGATTTAGTACTTSEQ ID NO: 17ZIKANS5F3GCAGAAGCAATGA GATGGGATASEQ ID NO: 18B3CCCAATCCATTGAGGATACAGCTSEQ ID NO: 19FIPACCTAGAGGGCAATGTGCAAACCGACGGTCAAGTGGAGATGACTSEQ ID NO: 20BIPACACACAAGGAGATGGAACCCTCGGAGCAAGAACGGGACTTCTSEQ ID NO: 21LFTCATCGAATTGGCTTACACAAACGCSEQ ID NO: 22LBGACTGAGATGGAGGCTAATTGGGASEQ ID NO: 23SalmonellatyphimuriumProtease2F3ACCCTGGTTTAACCGTACTGGTTSEQ ID NO: 24B3GTAATCTGGCGGTCGTTCATTGASEQ ID NO: 25FIPGGCGATGCCAATATCACTTCACGTTTGGTCGAAGAGCGTCAACSEQ ID NO: 26BIPGACGATCCGGAATACGTGACCAGAATAGCCGTAACGCAGCSEQ ID NO: 27LFTTTTACGGAATTTGCCATAGGSEQ ID NO: 28LBGCTTGCTATAGTCTTGAACCTGSEQ ID NO: 29Salmonella EnteritidissefAF3GGCTTCTGGTGGATGAGTSeq. 30B3GGCTTAGGGATTTGACCCCAAASEQ ID NO: 31FIPCTCAACTGAATACGCCCGTTAGATAGCCAGTTCGTTCGSEQ ID NO: 32BIPCTGGAATTGAGGGCTTTGCAGGTGGGGACAGAGACATTTAGCGSEQ ID NO: 33LFCAGGCTTCCTTGATCAATCAASEQ ID NO: 34LBGCTTTGCCAGCTCTCAAGAAASEQ ID NO: 35Escherichia coliO157:H7stx1AF3GTAACTGGAGCCCTTTGTAGSeq. 36B3CTACGTTGCTTCTCATCTTGSEq. 37FIPTCCCAGAAAATTGCATCCTAATCGTCCTTTGCCTGAATTATCATGTGSEq. 38BIPGCGTGTAGGGCATTAATACTGATAGAAGGAATGAAACCCTCATCAGATSEq. 39LFCTTTTCCTACACTAGACGTACTTGTSeq. 40LBATGCAATCTTGATGTTGCCGSEq. 41Vibrio choleraehlyAF3GGGATCATTCTGTATTCACASEQ ID NO: 42B3ACCATTTCAAGAGCAATTAGSEQ ID NO: 43FIPGGATCCGGGTCATCGATGCCTGCCCGAAACCTACATSEQ ID NO: 44BIPAGCCAATATGGCGGCCCATACCTTCGCACTCACATACGACASEQ ID NO: 45LFTACATCGAAGTTTAAATGCTGTTCSEQ ID NO: 46LBAGCAAAGTCAGGCGCAATGATTTCATCSEQ ID NO: 47VibrioparahaemolyticustoxRF3GAACTTGTACGGCTAGGAAGCSEQ ID NO: 48B3GGATTAGTTTTAACCGCTCTGSEQ ID NO: 49FIPGCTCGTTTAAGGTTAAAACTTCGAGGGAAAGGGCATACTCCSEQ ID NO: 50BIPTTGTTTGGTTAAGCAAGGTCTTCGGGATCTTACGCAGAGSEQ ID NO: 51LFTTGGGCCCTCTCCGCTTACATCSEQ ID NO: 52LBTGACAAAGCCTGAAGCAAGSEQ ID NO: 53Vibrio vulnificuspilFF3GACTTCCGGTCACGGAGTSeq. 54B3AGTTTAGCCATGGAAGGAGCTGseq. 55FIPAGGAAGCAATGCGATGAGATTCTGCCATCAATAAGGCCAATCACAGseq. 56BIPTGGCTATCTCGGGAATGGCGCGTCAATAGCGTCAGTCAGGSeq. 57LFGCCACCATGGGTCGCGGAATCTseq. 58LBATCAGGCCCATCCGACACACTTACCAACseq. 59Dengue virus_type 1NS5F3CACCATTGCATCAATTTGAAGSEQ ID NO: 60B3AACGTAGCTGGAACAGATATGTAGCSEQ ID NO: 61FIPCACCTTGTGATAACTCTAGCCTACGGAGTAGGAGATAGTGTAGTGCTASEQ ID NO: 62BIPAGTGAGAGAACATGCGTCTCTGGCATCTCTCAACACTTGGSEQ ID NO: 63LFCAAGTTCAAATCTTTTGGTTACCGSeq ID NO: 64LBCACAGATGGTGCAGCTGAAGTSeq ID NO: 65Dengue virus_type 2C, PrMF3TGACCACACGACGCCAGACASEQ ID NO: 66B3GGACATCACGTACGTGCTTGSEQ ID NO: 67FIPCGATCATAAGTGGTTCTCCGTTCGGTATGCTGATAACACAGTGASEQ ID NO: 68BIPTGTTCGCCACAGGGGATGACGTCACACACGCCACCAAGGTCSEQ ID NO: 69LFCGTGCCGTTAAATGCCTCGCCASEQ ID NO: 70LBGACTATGTGTACAATCATGGCCSEQ ID NO: 71Dengue virus_type3UTRF3CCTTAAGCCATAGGTTTGAGSEQ ID NO: 72B3GGAACTCTCCTGGCAACTCSEQ ID NO: 73FIPTCCAATATTTGCAGCCTGATAAACCGTTTACCCTGTASEQ ID NO: 74BIPACATCGGTTAGACCAGTCCCCCACAGCAACCCGCAGTGCTSEQ ID NO: 75LFTTACCGTCCCGCACGAGCGGGAGSEQ ID NO: 76LBCCCAGTGAGCACAGACGCAGGCAGSEQ ID NO: 77Dengue virus_type 4UTRF3GGGCATGATTGGACGTAGCGGGTTSEQ ID NO: 78B3TGCGCTGGATTGGATGTGTGGCASEQ ID NO: 79FIPGGAGGTACAGGCTTCCTCGCTAGACCGCCTCCGCATCAGCTGSEQ ID NO: 80BIPAGAGGAAAGAGGAGACCCTCACAGGATCTCTGGTCAAGTCCCASEQ ID NO: 81LFGCGGAACTTTGGCTGAGTSeq NO: 82LBCAACACTTGGAAACAGCATATGACGCSEQ ID NO: 83Influenza APAF3GGAACGGAGCCGTCGCGGSEQ ID NO: 84B3GCCTACAGAATGTACGTCATGCSEQ ID NO: 85FIPCAGGTGGGCTGAGGATCGGGTCAAGCTTATCGAAATGTCASEQ ID NO: 86BIPGGACCTATTGCCATCAGCGTATTCCTTGGCCTTCGTGASEQ ID NO: 87LFGTCGAATTCAAGAATGCATGCAASEQ ID NO: 88LBGTATTCTGCTGACAGTATGCTCSEQ ID NO: 89Influenza BPAF3GACACTTGATGTTGAAGTGGGSEQ ID NO: 90B3CTTGTACAAGAGGATAATGATCSEQ ID NO: 91FIPCCACAACAAATAGGGAACCAATTTTAGAGTACAGAACCAGASEQ ID NO: 92BIPATTAAAGAGTGAATGACACAATGTTGCACTGATTGCAGCAGACSEQ ID NO: 93LFATTTCTTCACCACTGGACTGAGTCSEQ ID NO: 94LBTGGCCAATGGAAGCTCCAAGASEQ ID NO: 95

[0147] ※ F3, forward primer; B3, backward primer; FIP, forward inner primer; BIP, backward inner primer; FL, forward loop primer; BL, backward loop primer

[0148] Manufacturing Example 1. Preparation of cell lysis composition (lysis buffer)

[0149] Cell lysis compositions were prepared by mixing components, pH, and ratios of each component as shown in Table 2 below. Proteinase K was purchased from Thermofisher (EO0491), and 0.02 mg / ml of lysozyme (Thermofisher, 90082) was added depending on the type of bacteria to be detected. The pH was adjusted with 0.1 M HCl or 0.1 M NaOH.

[0150] CompositionProtease pHINC 120mM Tris·HCl15mM MgSO415mM KCl15mM (NH4)2SO40.1 w / w% Tween200.05 mg / ml8.8INC 220mM Tris·HCl15mM MgSO415mM KCl15mM (NH4)2SO41mM Polyvinylsulfonic acid5mM Vanadyl ribonucleoside complex0.1 w / w% Tween200.05 mg / m8.8INC 320mM Tris·HCl15mM MgSO415mM KCl15mM (NH4)2SO41mM Polyvinylsulfonic acid0.1 w / w% Tween200.05 mg / ml8.8Comparative example 150mM Tris-HCl100mM NaCl 1 mM DTT 5% Glycerol 0.05 mg / ml 7.0 Comparative Example 250 mM Tris-HCl 150 mM NaCl 5 mM EDTA 1% NP-40 0.05 mg / ml 8.5 Comparative Example 350 mM Tris-HCl 10 mM Na2HPO 4 5 mM MgCl 2 1% TritonX-100 0.05 mg / ml 8.5 Comparative Example 450 mM Tris-HCl 10 mM Na2HPO 4 10 mM NaCl 0.5% SDS 1% TritonX-100-9.0 Comparative Example 550 mM Tris-HCl 10 mM Na2HPO 4 10 mM NaCl 0.5% SDS 1% TritonX-100-7.0

[0151] Verification of whether effective control is possible against test amplification interference substances

[0152] An experiment was conducted to determine whether effective control of amplification inhibitors in nasopharyngeal swab specimens was possible using the cell lysis composition of Table 2 described above.

[0153] We purchased LAMP PCR reagents and conducted a performance evaluation. Testing was performed on COVID-19. Nasopharyngeal swab specimens from patients who tested positive for COVID-19 were used.

[0154] The positive control group was composed of a general LAMP PCR reagent composition with COVID-19 RNA added, and the negative control group was composed of a general LAMP PCR reagent composition without COVID-19 RNA. The non-INC group was composed of a general LAMP PCR reagent composition with the nasopharyngeal swab specimen of a patient who tested positive for COVID-19 added as is. The INC application group was composed of a general LAMP PCR reagent composition with the nasopharyngeal swab specimen of a patient who tested positive for COVID-19 and INC 1 to 3 applied respectively.

[0155] Using the test composition described above, a real-time PCR amplification reaction was performed at an isothermal temperature of 65°C for 1 hour. The test results are shown in Figure 7.

[0156] The positive control group confirmed that amplification occurred when COVID-19 RNA was directly added to the PCR reagent. However, in the non-INC group, the nasopharyngeal swab specimen was used as is, which inhibited PCR amplification efficiency. These test results confirm that amplification is hindered when other amplification-interfering components other than RNA are included during PCT amplification.

[0157] In addition, when the INC 1 composition was included, it was confirmed that the cell membrane was not destroyed well, resulting in poor nucleic acid extraction performance. On the other hand, in the test groups including the INC 2 and INC 3 compositions, it was confirmed that the amplification reaction occurred smoothly, but compared to INC 2, in the test group including the INC 3 composition, it was confirmed that the cell lysis component slightly inhibited the amplification reaction, confirming that the INC 2 composition showed the amplification pattern most similar to the positive control.

[0158] Manufacturing of an all-in-one molecular diagnostic platform architecture

[0159] The sample pad was prepared from polysulfone paper with an asymmetrical structure, the amplification pad was prepared from polyester paper, the initiator pad was prepared from cellulose paper, the binding pad was prepared from polyester paper, the detection pad was prepared from nitrocellulose paper, and the absorption pad was prepared from cellulose paper.

[0160] The above amplification pad was prepared by soaking polyester paper in a solution containing 45 mM sucrose, 0.005 w / w% TritonX-100, and 0.2 w / w% glycerol, and then drying.

[0161] Then, dNTP (0.7 to 1.4 mM, dATP, dCTP, dGTP, and dTTP), isothermal amplification buffer (10 to 50 mM Tris-HCl, 5 to 20 mM (NH4)2SO4, 20 to 150 mM KCl, 2 to 8 mM MgSO4, and 0.1% Tween-20, pH 8.8), and Bst 3.0 polymerase (0.1 to 1 U / uL) were applied to the surface of the amplification pad (140), and dried for 2 hours in a frozen or refrigerated state.

[0162] 89.3 wt% of 40 nm AuNPs solution (OD 1) and 8.9 wt% of 100 mM borate buffer solution were mixed and reacted at room temperature (20-25°C). 0.9 wt% of streptavidin solution (STP-AP) with a concentration of 17 U / mL was additionally mixed and reacted at room temperature. 0.9 wt% of 10% BSA solution was added and reacted at room temperature for more than 30 minutes to block the gold reaction sites. Afterwards, the supernatant was removed by centrifugation and washed three times with 10 mM borate buffer solution (centrifugation). The final pellet was dissolved in 10 mM borate buffer solution to an OD450 value of 10 and stored, which was then used as gold nanoparticles for immobilizing on the binding pad.

[0163] The above bonding pad was prepared by cutting polyester paper, immersing it in a solution prepared by mixing 0.4 M Tris (pH 6.5), 0.2% Tween-20, 1% sodium caseinate, 0.1% sodium azide, and 0.05% Proclin 300, and then drying to perform a first pretreatment. Thereafter, the prepared gold nanoparticles were applied to the polyester paper and dried to prepare a bonding pad.

[0164] The detection pad formed a hydrophobic layer by wax transfer on the non-visible area below the detection zone, and was then re-dispensed with a solution containing antibodies that can bind to fluorescent markers such as FAM, HEX, and Cy5 to immobilize the antibodies.

[0165] The sample pad, amplification pad, initiator pad, binding pad, detection pad, and absorption pad manufactured as described above were arranged as shown in FIGS. 1 and 2, and a PCB substrate including a heating unit, a housing, and an internal bracket were applied to manufacture a molecular diagnostic kit.

[0166] Analytical Performance Evaluation for COVID-19

[0167] The molecular diagnostic kit manufactured by the above manufacturing example was evaluated for its analytical ability against COVID-19.

[0168] The analytical performance for COVID-19 was evaluated using the above molecular diagnostic kit, and the primer set for confirming COVID-19 used the base sequence set in Table 1 described above. Specifically, a hydrogel solution was prepared by mixing dNTPs (1.4 mM, dATP, dCTP, dGTP, and dTTP), isothermal amplification buffer (1X, 20 mM Tris-HCl, 10 mM (NH4)2SO4, 50 mM KCl, 2 mM MgSO4, and 0.1% Tween-20, pH 8.8), and Bst 3.0 DNA polymerase (1 U / uL) on the surface of the amplification pad, and then mixing 1 μl each of the forward and backward outer primers (Outer primer: F3 and B3, 0.2 μM), 1 μl each of the inner primers (Inner primer: FIP and BIP, 1.6 μM), and 1 μl each of the loop primers (Loop primer: LF and LB, 0.4 μM) of the primer set for COVID-19 in Table 1 above, and then The hydrogel solution was applied to the surface of the amplification pad and dried for 2 hours in a frozen or refrigerated state.

[0169] A nasopharyngeal swab specimen from a patient who tested positive for COVID-19 was added to the INC 2 composition described above and introduced into the molecular diagnostic kit to confirm the diagnosis of COVID-19.

[0170] The test results are shown in Figure 8. According to Figure 8, when confirming whether a nasopharyngeal swab specimen from an actual COVID-19 positive patient was tested positive, the Positive group, which used nasopharyngeal swab specimens from an actual COVID-19 positive patient, was confirmed to be positive compared to the Negative group, which did not process the specimen. Through this, it can be said that when using the cell lysate of the present invention, rapid confirmation is possible without the need for separate preprocessing even when using nasopharyngeal swabs.

[0171] Analytical performance evaluation for Influenza A

[0172] The molecular diagnostic kit manufactured by the above manufacturing example was evaluated for its analytical ability against Influenza A.

[0173] The analytical ability for Influenza A was evaluated using the above molecular diagnostic kit, and the primer set for confirming Influenza A used the base sequence set of Table 1 described above. Specifically, a hydrogel solution was prepared by mixing dNTPs (1.4 mM, dATP, dCTP, dGTP, and dTTP), isothermal amplification buffer (1X, 20 mM Tris-HCl, 10 mM (NH4)2SO4, 50 mM KCl, 2 mM MgSO4, and 0.1% Tween-20, pH 8.8), and Bst 3.0 DNA polymerase (1 U / uL) on the surface of the amplification pad, and the primer set for Influenza A in Table 1 above, 1 μL each of the forward and backward outer primers (Outer primer: F3 and B3, 0.2 μM), 1 μL each of the inner primers (Inner primer: FIP and BIP, 1.6 μM), and 1 μL each of the loop primers (Loop primer: LF and LB, 0.4 μM), and then the The hydrogel solution was applied to the surface of the amplification pad and dried for 2 hours in a frozen or refrigerated state.

[0174] A nasopharyngeal swab specimen from a patient who tested positive for Influenza A was added to the above-described INC 2 composition and introduced into the above-described molecular diagnostic kit to confirm the diagnosis of Influenza A.

[0175] The test results are as shown in Fig. 9. According to Fig. 9, when confirming whether a nasopharyngeal swab specimen of a patient who actually tested positive for Influenza A was used, the positive result was confirmed in the Positive group using the nasopharyngeal swab specimen of a patient who actually tested positive for Influenza A, compared to the Negative group in which the specimen was not processed. Through this, it can be said that when the cell lysate of the present invention is used, rapid confirmation is possible without the need for separate preprocessing even when using a nasopharyngeal swab.

[0176] Although the preferred embodiments of the present invention have been described in detail above, the scope of the present invention is not limited thereto, and various modifications and improvements made by those skilled in the art using the basic concept of the present invention defined in the following claims also fall within the scope of the present invention.

[0177] The present invention relates to a cell lysis composition applicable to a molecular diagnostic platform and a paper-based molecular diagnostic platform using the same.

Claims

Containing 1.5 mM to 80 mM Tris-HCl, 5 mM to 50 mM potassium chloride, 1 mM to 30 mM magnesium sulfate, 5 mM to 50 mM ammonium sulfate, 0.01 mg / ml to 0.1 mg / ml protease, 0.05 mM to 1.5 mM polyvinylsulfonic acid, and 0.01 w / w% to 0.2 w / w% TritonX-100 or Tween20 as a surfactant. The acidity of the above cell lysis composition is pH 8.0 to 9.

0. Composition for cell lysis.

2. In paragraph 1, The above cell lysis composition further comprises 4 mM to 10 mM vanadyl ribonucleoside complex. Composition for cell lysis.

3. In paragraph 1, The above cell lysis composition is suitable for application to a lab-on-paper chip nucleic acid detection device. Composition for cell lysis.

4. In paragraph 1, The above cell lysis composition is characterized in that it does not contain glycerol. Composition for cell lysis.

5. In paragraph 1, The above cell lysis composition is characterized in that it does not contain a reducing agent. Composition for cell lysis.

6. A step of preparing a biological sample by mixing a cell lysis composition according to Article 1 and a sample; A step of applying the biological sample to the sample pad of a molecular diagnostic paper chip and amplifying the target nucleic acid; and A step of detecting the nucleic acid amplification product on a detection pad is included. Analytical methods for nucleic acids.

7. Sample pad for receiving biological samples; An amplification pad, which is placed at the bottom of the sample pad and includes a primer that can specifically bind to a target nucleic acid and a reagent for an isothermal amplification reaction (LAMP), and in which an isothermal amplification reaction occurs; An initiator pad, which is placed on top of the sample pad and includes a thermally responsive hydrophobic valve, for transporting the isothermal amplification reaction product to the detection pad when the isothermal amplification reaction is completed; A bonding pad disposed below the initiator pad, connecting the initiator pad and the detection pad, and including gold nanoparticles; A detection pad positioned at the bottom of the above-mentioned binding pad and obtaining a target nucleic acid amplified from the above-mentioned isothermal amplification reaction product; and An absorbent pad is disposed on the side of the above detection pad and absorbs the remaining sample, A biological sample containing a cell lysis composition and a sample according to Article 1 can be applied to the sample pad to detect target nucleic acids. Paper-based molecular diagnostic platform.

Images