Mitochondrial-localized small peptide (MLSP) and use thereof in improving plant yield and / or stress resistance
By overexpressing the mitochondrial small peptide MLSP in plants, the mitochondrial respiratory chain was optimized, solving the problems of improving plant yield and stress resistance, especially in crop improvement under drought and saline-alkali stress conditions, achieving efficient energy metabolism and enhanced stress resistance.
Patent Information
- Application Number
- PCT/CN2025/090660
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-04-23
- Filing Date
- 2025-04-23
- Publication Date
- 2025-10-30
AI Technical Summary
Existing technologies are insufficient to effectively improve plant yield and stress resistance, especially when facing extreme environmental conditions such as drought and salinity stress. Traditional breeding methods are unable to achieve high yields and improved stress resistance in crops.
By overexpressing the mitochondrial small peptide MLSP in plants, the stability and activity of the mitochondrial respiratory chain were optimized. The mitochondrial small peptide MLSP gene was introduced into crops such as soybean and rice using Agrobacterium-mediated transformation technology to improve mitochondrial function and energy metabolism efficiency.
It significantly improved plant yield and resistance to drought and salinity stress, reduced the need for chemical pesticides and fertilizers, and provided the possibility of utilizing saline-alkali land.
Smart Images

Figure CN2025090660_30102025_PF_FP_ABST
Abstract
Description
A mitochondrial small peptide MLSP and its application in improving plant yield and / or stress resistance. (I) Technical Field
[0001] This invention belongs to the field of plant genetic engineering and molecular breeding technology, specifically relating to a method for regulating the activity and stability of the plant mitochondrial respiratory chain through mitochondrial small peptides MLSP, thereby enhancing mitochondrial function, improving plant stress resistance and yield. (II) Background Technology
[0002] Improving crop yields and stress resistance is crucial for addressing global food security challenges, adapting to climate change, and ensuring sustainable agricultural development. With the global population continuing to grow—projected by the Food and Agriculture Organization of the United Nations (FAO) to reach approximately 9.7 billion by 2050—food demand will surge by more than 60%. Simultaneously, global arable land resources are decreasing due to urbanization and soil degradation, necessitating increased crop yields to meet future food demands. Frequent extreme weather events caused by climate change, such as droughts, floods, and extreme heat, further threaten crop production, resulting in substantial yield losses annually. Improving crop stress resistance is therefore a key approach to ensuring a stable food supply. Thus, developing high-yielding, stress-resistant new varieties can achieve significant yield increases without increasing arable land, while simultaneously endowing crops with the ability to cope with stresses such as drought, high temperatures, and pests and diseases, effectively reducing the risk of yield reductions caused by climate change. This is a key strategy for sustainable agricultural development.
[0003] Gene and molecular breeding technologies are driving revolutionary improvements in crop yield and stress resistance with unprecedented precision and efficiency. By deeply analyzing the functional elements of the crop genome, scientists can directly manipulate key genes that control yield and stress resistance, achieving trait improvements that are difficult to achieve with traditional breeding methods. Regarding high-yield traits, molecular breeding can specifically optimize photosynthesis-related genes (such as the Rubisco activator gene RCA), modify plant architecture regulatory networks (such as ideal plant architecture genes like IPA1 and DEP1), or enhance grain development signaling pathways (such as grain type genes like GS3 and GW8), systematically improving crop photosynthetic efficiency, nutrient allocation, and harvest index. In terms of stress resistance improvement, molecular technologies can precisely introduce or edit stress-resistance functional genes (such as drought-resistant DREB transcription factors, salt-tolerant SOS pathway genes, and disease-resistant NBS-LRR-like genes), endowing crops with a strong ability to cope with stresses such as drought, salinity, and pests and diseases.
[0004] Mitochondria, as the cellular energy factories of plants, play multiple crucial roles in high crop yields and stress resistance. From an energy metabolism perspective, mitochondria efficiently produce ATP through oxidative phosphorylation, providing energy for rapid crop growth and high yield. Optimization of their electron transport chain activity (such as the regulation of the alternating oxidase AOX) can reduce the accumulation of reactive oxygen species (ROS) and maintain cellular homeostasis under high metabolic rates. In terms of stress regulation, mitochondria are the core node in environmental stress perception and response. When plants encounter adversity, mitochondria activate the alternating respiratory pathway to divert excess reducing power, mitigating oxidative damage. The ROS they produce, as signaling molecules, can trigger the upregulation of antioxidant defense systems (such as SOD, APX, and other enzyme systems), enhancing crop tolerance. Therefore, optimizing mitochondrial respiratory chain activity can provide a new breakthrough for breeding high-yield and stress-resistant crops. (III) Summary of the Invention
[0005] The purpose of this invention is to provide a mitochondrial-localized small peptide (MLSP) and its application in improving plant yield and / or stress resistance. This invention improves the stability and activity of the plant mitochondrial respiratory chain and the activity of the plant mitochondrial complex by overexpressing the MLSP in plants, thereby increasing plant yield and generating resistance to drought and salt stress.
[0006] The technical solution adopted in this invention is:
[0007] In a first aspect, the present invention provides a mitochondrial small peptide MLSP, wherein the amino acid sequence of the mitochondrial small peptide MLSP is shown in one of SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 or SEQ ID NO.8.
[0008] The mitochondrial small peptide MLSP of this invention has highly conserved orthologous gene functions in crops. Mitochondrial small peptide MLSPs from soybean and rice were preferentially selected, as well as mitochondrial small peptide MLSPs from the model plant Arabidopsis thaliana and other higher plant sources.
[0009] Furthermore, the mitochondrial small peptide MLSP is preferably derived from soybean, with an amino acid sequence as shown in SEQ ID NO.4 or SEQ ID NO.5; derived from rice, with an amino acid sequence as shown in SEQ ID NO.6; or derived from Arabidopsis thaliana, with an amino acid sequence as shown in SEQ ID NO.8.
[0010] Secondly, the present invention provides a gene encoding the mitochondrial small peptide MLSP.
[0011] The gene encoding the mitochondrial small peptide MLSP is shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.7.
[0012] The CDS sequence of the mitochondrial small peptide MLSP in soybean is shown in SEQ ID NO.1 or SEQ ID NO.2 without the terminator, the CDS sequence in rice is shown in SEQ ID NO.3 without the terminator, and the CDS sequence in Arabidopsis thaliana is shown in SEQ ID NO.7 without the terminator.
[0013] Thirdly, the present invention provides an expression vector for the mitochondrial small peptide MLSP encoding gene.
[0014] Furthermore, the promoter of the expression vector includes a constitutive promoter or an inducible promoter, and the constitutive promoter includes the cauliflower mosaic virus 35S promoter, the Ubiquitin promoter, etc.
[0015] Furthermore, the vector backbone of the expression vector is pTF101 or pCAMBIA1302, and the insertion sites are Sac I and Sma I.
[0016] Fourthly, the present invention provides an Agrobacterium that expresses the mitochondrial small peptide MLSP.
[0017] Furthermore, the Agrobacterium is preferably Agrobacterium LBA4404 or EHA105.
[0018] Furthermore, Agrobacterium was used to screen the vector backbone pTF101 expressing the mitochondrial small peptide MLSP with 50 mg / L rifampicin and 50 mg / L spectinomycin, and Agrobacterium was used to screen the vector backbone pCAMBIA1302 with 50 mg / L rifampicin and 50 mg / L kanamycin.
[0019] Fifthly, the present invention provides an application of mitochondrial small peptide MLSP in improving the activity and stability of plant mitochondria.
[0020] Furthermore, the application involves using Agrobacterium-mediated overexpression of the mitochondrial small peptide MLSP in plants to enhance mitochondrial activity and stability.
[0021] Sixthly, the present invention provides an application of mitochondrial small peptide MLSP in improving plant yield.
[0022] Furthermore, the application involves using Agrobacterium-mediated overexpression of mitochondrial small peptide MLSP in plants to screen for lines with increased yields; the plants include soybeans and rice.
[0023] In a seventh aspect, the present invention provides an application of mitochondrial small peptide MLSP in improving plant stress resistance.
[0024] Furthermore, the application involves using Agrobacterium-mediated overexpression of mitochondrial small peptide MLSP in plants to screen for strains with enhanced stress resistance; the plants include soybean and rice.
[0025] Furthermore, the stress resistance includes drought resistance and salt-alkali stress resistance.
[0026] Eighthly, the present invention provides a method for cultivating plants with improved yield and / or stress resistance using mitochondrial small peptide MLSP, the method comprising: introducing an expression vector containing the mitochondrial small peptide MLSP gene into Agrobacterium, and using Agrobacterium-mediated cotyledon node transformation to screen for transgenic plants with improved mitochondrial activity, yield and / or stress resistance.
[0027] The method of this invention can be extended to other means, such as screening for haplotypes with high expression of the MLSP gene in genetic resources like soybeans and rice, which can also achieve relevant gains, and therefore are also covered by this invention.
[0028] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in the following aspects: The present invention overexpresses the mitochondrial small peptide MLSP gene in plants to improve plant mitochondrial activity, optimizes the energy metabolism efficiency of plants, and enables plants to have higher yields and stronger resistance to drought and salt-alkali stress. This helps to reduce the demand for chemical pesticides, fertilizers and water resources and provides the possibility for the utilization of saline-alkali land.
[0029] This invention constructs transgenic soybean and rice lines by overexpressing the mitochondrial small peptide MLSP gene in soybeans and rice, and obtains corresponding Arabidopsis overexpression lines, which have higher mitochondrial activity, yield, and resistance to drought and salt stress compared to the corresponding wild-type plants. (iv) Description of the attached drawings
[0030] Figure 1 shows a schematic diagram of the vector; Note: (a) Schematic diagram of pTF101-35S-GmMLSP1-eGFP vector; (b) Schematic diagram of pTF101-35S-GmMLSP2-eGFP vector; (c) Schematic diagram of pCAMBIA1302-35S-OsMLSP1-eGFP vector; (d) Map of the T-DNA region in CRISPR plasmid BGK032.
[0031] Figure 2 shows the results of qRT-PCR detection of MLSP transcriptional expression levels in homozygous T3 generation transgenic soybean and T2 generation rice plants; Note: (a) Identification of the expression level of GmMLSP1 / 2 gene in leaves of overexpressing soybean plants (the number after # represents the line number); (b) Identification of the expression level of OsMLSP1 gene in leaves of overexpressing rice plants (the number after # represents the line number).
[0032] Figure 3 shows the results of non-denaturing polyacrylamide gel electrophoresis (Blue Native PAGE) of the mitochondrial respiratory chain enzyme activities of Arabidopsis thaliana in wild-type (Col0), overexpression line (AtMLSP1-OE, the number after # represents the line number), and knockout line (atmlsp1, the number after - represents the line number); Note: (a) Coomassie brilliant blue staining results for complex abundance detection; (b) staining results from the mitochondrial respiratory chain complex I activity assay kit.
[0033] Figure 4 shows the plant phenotype and yield data at harvest; Note: (a) Arabidopsis thaliana phenotype and dry weight of seeds per plant at harvest; (b) Soybean phenotype and seeds at harvest (the number after # represents the line number); (c) Rice phenotype at harvest (the number after # represents the line number); Scale bar is 20cm.
[0034] Figure 5 shows the phenotypes of drought resistance; scale bar is 1 cm; note: (a) phenotypes of Arabidopsis thaliana before drought and after 10 days of drought treatment; (b) phenotypes after 13 days of drought treatment and 1 day after re-watering.
[0035] Figure 6 shows the phenotype of salt and alkali resistance; Note: (a) Phenotype of Arabidopsis thaliana after 8 days of growth on B5 medium containing different concentrations of sodium chloride; Scale bar is 3 cm; (b) Germination rate of Arabidopsis thaliana seeds on B5 medium containing different concentrations of sodium chloride on days 3, 5 and 8. The total number of seeds for each line in each biological replicate was 48. (V) Detailed Implementation
[0036] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:
[0037] The culture medium formula used in the embodiments of the present invention is as follows:
[0038] LB medium composition: 5 g / L yeast extract, 10 g / L tryptone, 10 g / L sodium chloride, pH adjusted to 7.0, solvent is deionized water, if it is a solid medium, add 12 g agar powder per liter.
[0039] YEP medium composition: 5 g / L yeast extract, 10 g / L tryptone, 5 g / L sodium chloride, pH adjusted to 7.0, solvent is deionized water, if it is a solid medium, add 12 g agar powder per liter.
[0040] MS macroelements: NH4NO3 1650mg / L, KNO3 1900mg / L, MgSO4·7H2O 370mg / L, CaCl2·2H2O4 40mg / L, KH2PO4·H2O 170mg / L, solvent: water.
[0041] MS trace elements: KI 0.83 mg / L, H3BO3 6.2 mg / L, MnSO4·4H2O 22.3 mg / L, ZnSO4·7H2O 8.6 mg / L, Na2MoO4·2H2O 0.25 mg / L, CoCl2·6H2O 0.025 mg / L, CuSO4·5H2O 0.025 mg / L, solvent: water.
[0042] MS medium: Its formula is based on the classic MS medium (Murashige and Skoog, 1962), containing the above-mentioned MS macro- and micro-elements, as well as MS vitamins (inositol 100 mg / L, nicotinic acid 0.5 mg / L, pyridoxine hydrochloride 0.5 mg / L, thiamine hydrochloride 0.1 mg / L), iron salts (Na2-EDTA 37.3 mg / L, FeSO4·7H2O 27.8 mg / L) and sucrose (30 g / L).
[0043] 1 / 2MS medium: The medium in which macroelements are reduced by half in MS medium.
[0044] B5 Macroelements: KNO3 2500mg / L, MgSO4·7H2O 50mg / L, CaCl2·2H2O 150mg / L, (NH4)2SO4 134mg / L, NaH2PO4·H2O 150mg / L, solvent is water.
[0045] B5 Trace Elements: KI 0.75 mg / L, H3BO3 3.0 mg / L, MnSO4·4H2O 10 mg / L, ZnSO4·7H2O 2.0 mg / L, Na2MoO4·2H2O 0.25 mg / L, CoCl2·6H2O 0.025 mg / L, CuSO4·5H2O 0.025 mg / L, solvent: water.
[0046] Vitamin B5 mixture: inositol 100mg / L, niacin 1.0mg / L, pyridoxine hydrochloride 1.0mg / L, thiamine hydrochloride 10mg / L, solvent is water.
[0047] B5 iron salt: disodium Na-ethylenediaminetetraacetate (Na2-EDTA) 37.3 mg / L, FeSO4·7H2O 27.8 mg / L, solvent is water.
[0048] Liquid co-culture medium (LCCM): 1 / 10 B5 salt powder (0.321 g / L, PhytoTech, G768), sucrose (Sigma) 30 g / L, MES (2-(N-morpholine)ethanesulfonic acid) 3.9 g / L, pH 5.4, sterilized at 121℃ for 20 min. After cooling, under aseptic conditions, filter-sterile gibberellin (GA3), 6-benzyladenine (BAP), cysteine (Cys), dithiothreitol (DTT), and acetylsylsyringone (As) were added to the LCCM culture medium to final concentrations of 0.25 mg / L, 1.67 mg / L, 400 mg / L, 154.2 mg / L, and 200 μmol / L, respectively.
[0049] Germination medium (GM): 20 g / L sucrose, 3 g / L agar and Milli-Q water, pH adjusted to 5.8, sterilized by high temperature and high pressure (121℃, 20 min) and then poured into plates.
[0050] Co-culture medium (CCM): Add 1×B5 vitamin mixture to LCCM medium and add 5 g / L agar before sterilization. All other components are the same.
[0051] Shoot induction selection medium (SI): 1×B5 macroelements, 1×B5 microelements, 1×B5 vitamin mixture, 1×B5 iron salt, 30 g / L sucrose, 0.59 g / L MES, 7 g / L agar, pH 5.7. After autoclaving and cooling, the above components were added with filtration-sterilized BAP (2,2-bis(4-hydroxy-3-aminophenyl)propane) 1.11 mg / L, cefotaxime 100 mg / L, and glufosinate 5 mg / L.
[0052] Stem elongation medium (SE): 1×MS macro-elements, 1×MS micro-elements, 1×B5 vitamin mixture, 30 g / L sucrose, 0.59 g / L MES, 7 g / L agar, pH 5.7. After autoclaving and cooling, add filtration-sterilized asparagine 50 mg / L, glutamine 50 mg / L, auxin (IAA) 100 μg / L, gibberellin (GA3) 500 μg / L, zeatin 1 mg / L, cefotaxime 100 mg / L, and glufosinate 5 mg / L.
[0053] Rooting medium (RM): 1×MS macro-elements, 1×MS micro-elements, 1×B5 vitamin mixture, 1×B5 iron salt, 30 g / L sucrose, 0.59 g / L MES, 7 g / L agar, pH 5.4. After autoclaving and cooling, add 50 mg / L asparagine and 50 mg / L glutamine.
[0054] Screening medium: MS medium, 2.0 mg / L 2,4-D, 0.5 g / L L-glutamic acid, 0.5 g / L L-proline, 0.3 g / L hydrolyzed casein, 4 g / L phytagel, 500 mg / L cephalosporin, 50 mg / L hygromycin, pH 5.8.
[0055] Predifferentiation medium: MS medium, 0.5 g / L L-glutamic acid, 0.5 g / L L-proline, 0.3 g / L hydrolyzed casein, 2.0 mg / L 6-BA, 0.1 mg / L NAA (1-naphthylacetic acid), 4 g / L plant gel, 500 mg / L cephalosporin, 50 mg / L hygromycin, pH=5.8.
[0056] Differentiation medium: MS medium, 0.5 g / L L-glutamic acid, 0.5 g / L L-proline, 0.3 g / L hydrolyzed casein, 3.0 mg / L 6-BA, 0.5 mg / L NAA, 4 g / L plant gel, pH 5.8.
[0057] The room temperature is 25-30℃.
[0058] The pTF101-eGFP vector was constructed by inserting an eGFP gene fragment (derived from the Clontech vector pEGFP-N3, Genbank accession#:U57609.1, http: / / www.synthesisgene.com / vector / pEGFP-N3.pdf) into the HindIII site of the binary vector pTF101.1 (Paz MM, Shou H, Guo Z, Zhang Z, Banerjee AK & Wang K. 2004. Assessment of conditions affecting Agrobacterium-mediated soybean transformation using the cotyledonary node explant. Euthytica 136:167-179). It was kindly provided by Professor Kan Wang of Iowa State University (Paz et al., 2004). This vector was used to insert the coding sequence of the GmMLSP1 / 2 gene for soybean transformation. The vector exhibits green fluorescence under laser confocal microscopy.
[0059] The pCAMBIA1302-eGFP vector is derived by replacing the mGFP5 fragment (GenBank AF234298) in pCAMBIA1302 with the aforementioned eGFP fragment. This vector is used to insert the OsMLSP1 gene coding sequence for transformation of rice. The vector emits green fluorescence under laser confocal microscopy.
[0060] Example 1: Cloning of the MLSP-encoding gene from soybean and rice mitochondria
[0061] 1. The sequences of Glyma.05G067900.1 and Glyma.17G150000.1 in the soybean reference genome G.max Wm82.a2.v1, and LOC_Os06g50090.1 in the rice (Nipponbare) reference genome O.sativa MSU v7.0 were analyzed using the Phytozome database. The results showed that the CDS coding sequence lengths of the three were 180bp, 174bp, and 213bp, respectively, denoted as GmMLSP1, GmMLSP2, and OsMLSP1, and the corresponding nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3. The encoded proteins contained 59, 57, and 71 amino acids, respectively, and the corresponding amino acid sequences are shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6.
[0062] GmMLSP1 CDS sequence, SEQ ID NO.1:
[0063] >G.max Wm82.a2.v1|Glyma.05G067900.1
[0064] GmMLSP2 CDS sequence, SEQ ID NO.2:
[0065] >G.max Wm82.a2.v1|Glyma.17G150000.1
[0066] OsMLSP1 CDS sequence, SEQ ID NO.3:
[0067] >O.sativa v7.0|LOC_Os06g50090.1
[0068] GmMLSP1 amino acid sequence, SEQ ID NO.4:
[0069] >G.max Wm82.a2.v1|Glyma.05G067900.1.p
[0070] GmMLSP2 amino acid sequence, SEQ ID NO.5:
[0071] >G.max Wm82.a2.v1|Glyma.17G150000.1.p
[0072] OsMLSP1 amino acid sequence, SEQ ID NO.6:
[0073] >O.sativa v7.0|LOC_Os06g50090.1
[0074] 2. Leaf tissues of wild-type soybean Williams 82 or wild-type rice Nipponbare were collected, and RNA was extracted using the novel RNA-easy Isolation Reagen kit from Novizan Biotechnology; reverse transcription was performed using the PrimeScript reverse transcription kit from Takara Biotechnology. TM cDNA was obtained by reverse transcription using the RT reagent kit; all experimental procedures were performed in accordance with the corresponding instruction manuals; using cDNA as a template, a high-fidelity PCR enzyme (RT-PCR) from Takara Bio Inc. was selected. HS DNA Polymerase was used to perform PCR reactions using GmMLSP1-CDS-F / R, GmMLSP2-CDS-F / R, and OsMLSP1-CDS-F / R primers. The PCR program was 98℃ for 5 min; 98℃ for 30 s, 56℃ for 5 s, 72℃ for 30 s, for 34 cycles; 72℃ for 5 min.
[0075] Primers:
[0076] GmMLSP1-CDS-F: 5'-ATGGAGAAGAAGATCACTTT-3'
[0077] GmMLSP1-CDS-R: 5'-AGAATGGGAAGGAAGGAAGA-3'
[0078] GmMLSP2-CDS-F: 5'-ATGGAGAAGAAGATGACTTTGGT-3'
[0079] GmMLSP2-CDS-R: 5'-AGAATGGGAGGGAGGTGGAGT-3'
[0080] OsMLSP1-CDS-F: 5'-ATGCCGCCGGCGAAGAAGAT-3'
[0081] OsMLSP1-CDS-R: 5'-GGGTTTGGAATGAGCGTCAGA-3'
[0082] 3. The PCR amplification products were recovered and purified using agarose gel electrophoresis and a gel extraction kit (Tiangen Biotech). Following the manufacturer's instructions, the obtained target fragment was a CDS sequence without any adapters or stop codons, corresponding to the sequences of SEQ ID NO.1-SEQ ID NO.3 after removing the last three bases of the stop codon. Specifically, SEQ ID NO.1 is TAA after removing the last three bases, SEQ ID NO.2 is TGA after removing the last three bases, and SEQ ID NO.3 is TAG after removing the last three bases.
[0083] Example 2: Construction of an overexpression vector for the mitochondrial small peptide MLSP (see Figure 1 for a schematic diagram of the vector).
[0084] 1. Enzyme digestion of backbone vectors
[0085] The pTF101-eGFP and pCAMBIA1302-eGFP backbone vectors were double-digested using the conventional restriction endonucleases Sac I and Sma I from Thermo Scientific. Electrophoresis was used to detect whether the vectors were cleaved and the linearized backbone vectors were recovered.
[0086] 2. Adding a linker to the target gene fragment
[0087] Using the CDS fragment recovered in Example 1 as a template, the selected high-fidelity enzyme was... HSDNA Polymerase (Takara), primers: GmMLSP1-pTF101-F / R, GmMLSP2-pTF101-F / R, OsMLSP1-p1302-F / R, the PCR program used was 98℃ for 5 min; 98℃ for 30 s, 60℃ for 5 s, 72℃ for 30 s, 34 cycles; 72℃ for 5 min.
[0088] Primers:
[0089] GmMLSP1-pTF101-F: 5'-gaTCAgCCCACGAGCTCATGGAGAAGAAGATCACTTTGGT-3'
[0090] GmMLSP1-pTF101-R: 5'-GACTCTAGAGGATCCCCGGGTAGAATGGGAGGAAGAGGAA-3'
[0091] GmMLSP2-pTF101-F: 5'-gaTCAgCCCACGAGCTCATGGAGAAGAAGATGACTTTGGT-3'
[0092] GmMLSP2-pTF101-R: 5'-GACTCTAGAGGATCCCCGGGTAGAATGGGAGGGAGGTGGA-3'
[0093] OsMLSP1-p1302-F: 5'-AGAACACGGGGGACGAGCTCATGCCCGCGGCGAAGAA-3'
[0094] OsMLSP1-p1302-R: 5'-ACTCTAGAGGATCCCCGGGtGGGTTTGGAATGAGCGTCAG-3'.
[0095] 3. Glue recovery from the target fragment
[0096] The PCR amplification product from step 2 above was recovered and purified by agarose gel electrophoresis and gel recovery kit (Tiangen Biotech). The target fragment obtained was a CDS sequence containing the corresponding adapter of the enzyme-digested backbone vector.
[0097] 4. Ligation of linearized backbone vector to target fragment and product transformation in E. coli
[0098] use II. The One Step Cloning Kit (Novizan) was used to ligate the target gene fragment with adapter and the linearized backbone vector. The ligation product was transformed into competent E. coli DH5α cells (100 μL, Vidi Biotechnology). The cells were incubated on ice for 30 min, then incubated in a 42°C water bath for 45 s. 500 μL of LB liquid medium was added, and the cells were incubated at 37°C and 200 rpm for 1 h. 100 μL of the bacterial culture was evenly spread on LB solid medium containing 50 mg / L spectinomycin (pTF101 backbone) or 50 mg / L kanamycin (pCAMBIA1302 backbone) and cultured in the dark at 37°C for 12 h. After single colonies grew, 2-3 single colonies were picked, activated, and sequenced by the company. After verification, the overexpression vectors pTF101-35S-GmMLSP1-eGFP, pTF101-35S-GmMLSP2-eGFP, and pCAMBIA1302-35S-OsMLSP1-eGFP were obtained. The schematic diagram is shown in Figure 1.
[0099] Example 3: Construction of a knockout vector for the mitochondrial small peptide MLSP
[0100] Using the rice-derived mitochondrial peptide OsMLSP1 from Example 1 as the target site, the target site sequence (OsMLSP1-KO in Table 1) was selected, sgRNA was designed, and after being constructed into the U6 promoter of the CRISPR / Cas9 vector BGK032, the mitochondrial peptide OsMLSP1 knockout vector CRISPR / Cas9-OsMLSP1 was obtained. It was constructed by Baige Gene Technology Co., Ltd., and the schematic diagram is shown in Figure 1d.
[0101] Using the soybean-derived mitochondrial peptides GmMLSP1 and GmMLSP2 from Example 2 as target sites, and referring to the gene editing target site design tool developed by Liu Yaoguang's laboratory (https: / / www.genome.arizona.edu / crispr / more.html), target site sequences that can simultaneously target GmMLSP1 and GmMLSP2 were selected (GmMLSP1 / 2-KO in Table 1). sgRNA was designed, and BbsI restriction sites were added before and after the sgRNA. The vector was constructed into the EcoRI site of the CRISPR / Cas9 vector MDC123 (Addgene) to obtain the knockout vector CRISPR / Cas9-GmMLSP1 / 2 for the mitochondrial peptide GmMLSP1 / 2, which was constructed by Baige Gene Technology Co., Ltd.
[0102] Table 1 Target Site Design Information
[0103] Example 4: Transformation of Agrobacterium tumefaciens with overexpression and knockout vectors of mitochondrial small peptides
[0104] 1. Overexpression of Agrobacterium
[0105] Add 500 ng of the overexpression vectors pTF101-35S-GmMLSP1-eGFP and pTF101-35S-GmMLSP2-eGFP constructed in Example 2 to a centrifuge tube containing 100 μL of Agrobacterium LBA4404 competent cells (Weidi Bio). Place on ice for 5 minutes, then perform liquid nitrogen shock for 10 seconds. After freezing, place in a 37°C water bath for 5 minutes, then on ice for 2 minutes. Add 0.5 mL of antibiotic-free YEP liquid medium and incubate at 28°C with shaking at 250 rpm for 3 hours. Centrifuge at 4000 rpm for 2 minutes, and spread the bacterial pellet evenly on YEP solid medium containing 50 mg / L rifampicin and 50 mg / L spectinomycin. Incubate at 28°C for 2 days to obtain Agrobacterium carrying the corresponding overexpression vectors. Inoculate this pellet into 0.5 mL of antibiotic-free YEP liquid medium and incubate at 250 rpm. After shaking culture at 28℃ for 3 hours, the obtained Agrobacterium bacterial solution was mixed with glycerol at a volume ratio of 1:1 and stored in an ultra-low temperature freezer at -80℃.
[0106] Under the same conditions, 500 ng of the overexpression vector pCAMBIA1302-35S-OsMLSP1-eGFP constructed in Example 2 was added to a centrifuge tube containing Agrobacterium EHA105 competent cells (100 μL, Weidi Bio). The antibiotic spectinomycin was replaced with 50 mg / L kanamycin. Other operations were the same to obtain Agrobacterium culture carrying the corresponding overexpression vector. The Agrobacterium culture was mixed with glycerol at a volume ratio of 1:1 and stored in an ultra-low temperature freezer at -80℃.
[0107] 2. Knockout of Agrobacterium
[0108] Add 500 ng of the soybean GmMLSP1 / 2 gene knockout vector CRISPR / Cas9-GmMLSP1 / 2 constructed in Example 3 to a centrifuge tube containing 100 μL of Agrobacterium LBA4404 competent cells (Weidi Bio). Place on ice for 5 minutes, then perform liquid nitrogen shock for 10 seconds. After freezing, place in a 37°C water bath for 5 minutes, then on ice for 2 minutes. Add 0.5 mL of YEP liquid medium without antibiotics, and culture at 250 rpm and 28°C for 3 hours with shaking. Centrifuge at 4000 rpm / 2 min to evenly spread the bacterial pellet onto YEP solid medium containing 50 mg / L rifampin and 50 mg / L spectinomycin. Culture at 28°C for 2 days to obtain Agrobacterium corresponding to the knockout vector. Inoculate into 0.5 mL of YEP liquid medium without antibiotics, and culture at 250 rpm and 28°C for 3 hours with shaking. Mix the obtained Agrobacterium bacterial culture with glycerol at a volume ratio of 1:1 and store at -80°C.
[0109] Under the same conditions, 500 ng of the rice OsMLSP1 gene knockout vector CRISPR / Cas9-OsMLSP1 constructed in Example 3 was added to a centrifuge tube containing Agrobacterium EHA105 competent cells (100 μL, Weidi Bio). The antibiotic 50 mg / L spectinomycin was replaced with 50 mg / L kanamycin. Other operations were the same to obtain Agrobacterium culture with the corresponding knockout vector. The Agrobacterium culture was mixed with glycerol at a volume ratio of 1:1 and stored in an ultra-low temperature freezer at -80℃.
[0110] Example 5: Agrobacterium-mediated genetic transformation of soybean cotyledonary nodes
[0111] 1. Seed surface disinfection and germination
[0112] Soybean seeds were sterilized using chlorine dry sterilization. Plump, disease-free wild-type Williams 82 soybean seeds were selected and arranged in a single layer in a 90*15mm disposable petri dish. The dish was then placed in a desiccator with the lid off. A 500mL glass beaker was placed in the center of the desiccator, and 100mL of Libai multi-purpose bleach was added to the beaker. 5mL of 12mol / L hydrochloric acid (Shanghai Test, GR) was slowly added along the beaker wall. The desiccator lid was quickly closed to ensure the dish was sealed, and the generated chlorine gas was used for overnight sterilization for 10–12 hours. After sterilization, the petri dishes were covered and transferred to a sterile laminar flow hood. The lids of the disposable petri dishes were then opened, and the dish was blown with a strong fan for 1–2 hours to remove residual chlorine.
[0113] Sow the sterilized seeds with the hilum facing down on the germination medium (GM). Stack the petri dishes, wrap them with plastic wrap, and place them in a plant incubator (temperature: 28.0℃, light: 10000Lx, humidity: 60% RH, time: 16h; temperature: 24.0℃, light: 0Lx, humidity: 40% RH, time: 8h) for 16-24 hours.
[0114] 2. Preparation of Agrobacterium bacterial suspension
[0115] (1) Preparation of Agrobacterium tumefaciens culture carrying overexpression vector
[0116] Take 50 μL of the glycerol bacteria carrying the overexpression vectors pTF101-35S-GmMLSP1-eGFP and pTF101-35S-GmMLSP2-eGFP from Example 4 into YEP liquid medium supplemented with a final concentration of 50 mg / L rifampin and 50 mg / L spectinomycin. Incubate at 28°C with shaking at 250 rpm for 24–36 hours to obtain a saturated bacterial culture. Take 0.2–1 mL of the saturated bacterial culture into 250 mL of medium supplemented with a final concentration of 25 mg / L rifampin and 25 mg / L spectinomycin. In YEP liquid medium, the bacterial culture was expanded to OD650nm = 0.8–1.0 in a shaker at 28°C and 250 rpm. The bacterial culture was then aliquoted into six 50 mL sterile centrifuge tubes and centrifuged (4000 rpm, 10 min, 25°C). The bacterial pellet was collected and resuspended in an equal volume of liquid co-culture medium to OD650nm = 0.6–0.8 to obtain Agrobacterium tumefaciens bacterial culture for cultivating transgenic soybeans overexpressing the target gene, for later use.
[0117] (2) Preparation of Agrobacterium tumefaciens bacterial culture carrying the target gene knockout vector
[0118] The above overexpression vector was replaced with the glycerol bacteria carrying the knockout vector CRISPR / Cas9-GmMLSP1 / 2 prepared in Example 4, and the other operations were the same to obtain Agrobacterium tumefaciens bacterial solution for cultivating transgenic soybeans with the target gene knocked out.
[0119] 3. Preparation, infection, and co-culture of explants
[0120] Pour the Agrobacterium-mediated bacterial solution prepared in step 2 into a sterile petri dish. Select germinated and uncontaminated soybean seeds from step 1 and place them in a sterile petri dish. Use a scalpel to longitudinally cut the seeds along the hilum, evenly separating the cotyledons and hypocotyl into two halves. Gently make three incisions at the cotyledon node to remove the seed coat, thus obtaining the explants. Place them in the Agrobacterium-mediated bacterial solution, with approximately 80 explants per petri dish. The incubation time is 0.5–1 hour, during which the bacterial solution is frequently stirred to ensure the explants have sufficient contact with the fresh bacterial solution. Add 30 mL of liquid co-culture medium to a sterile stainless steel square box (24*16*5 cm) lined with two layers of filter paper. Remove the incubated explants and shake off the Agrobacterium-mediated bacterial solution. Arrange them neatly on sterile filter paper and incubate in the dark at 28°C for 3–5 days.
[0121] 4. Induction of clustered buds
[0122] After the dark culture in step 3, retain only the 0.5 cm hypocotyl and remove the rest. Insert the explants at a 30–45° angle into the shoot induction medium (SI) and seal with 3M breathable tape. Place in a light culture room (daytime temperature 28°C, nighttime temperature 24°C; light cycle 12h light / 12h dark; light intensity 216 μmol·m⁻¹). -2 ·s -1 After culturing for 14 days, some hypocotyls were cut off and replaced with new bud induction medium, and then cultured for another 14 days.
[0123] 5. Elongation of young stems
[0124] Step 4: After 4 weeks of inducing shoot clusters, remove the cotyledons and transfer the shoots to a shoot elongation medium. Place the medium in a light-controlled culture room for 14 days (daytime temperature 28℃, nighttime temperature 24℃. Photoperiod is 12h light / 12h dark, light intensity 216μmol·m⁻¹). -2 ·s -1 Replace the bud elongation medium every 14 days and screen 4-5 times.
[0125] 6. Rooting and cultivation
[0126] Young stems that have grown to 3-4 cm in the shoot elongation medium were cut off, dipped in a 1 mg / L indolebutyric acid (IBA) aqueous solution for 30 seconds to 1 minute, and then inserted into the rooting medium. The plants were placed in a light-cured culture room and cultured under the conditions of step 5. After 7-14 days, roots were grown. The rooted seedlings were removed from the medium, the residual medium on the roots was washed off, and the plants were transferred to soil and then to a greenhouse for further culture. Soybean T0 generation genetic transformants were obtained.
[0127] Example 6: Agrobacterium tumefaciens-mediated stable genetic transformation in rice
[0128] The OsMLSP1 gene overexpression vector and knockout vector were introduced into Agrobacterium tumefaciens EHA105 for stable genetic transformation in rice. The specific steps are as follows:
[0129] 1. Callus tissue
[0130] Select whole, plump, and uniformly sized rice grains (variety: Nipponbare). Disinfect with 70% alcohol for 2 minutes, rinse with sterile water, disinfect with 30% sodium hypochlorite for 10 minutes, rinse thoroughly with sterile water, and place in 1 / 2 MS medium in a rice growth chamber (30℃ (light) / 24℃ (dark), photoperiod: 14h (light) / 12h (dark), light intensity: 800 μmol·m⁻¹). -2 ·s -1 After 14 to 21 days of light cultivation (at a relative humidity of around 50%), fresh callus tissue can gradually form at the scutellum position of rice seeds.
[0131] 2. Agrobacterium bacterial solution
[0132] (1) Preparation of Agrobacterium tumefaciens bacterial culture carrying target gene overexpression vector
[0133] Take 50 μL of the glycerol bacteria carrying the overexpression vector pCAMBIA1302-35S-OsMLSP1-eGFP from Example 4 into YEP liquid medium supplemented with a final concentration of 50 mg / L rifampin and 50 mg / L kanamycin. Incubate at 28°C with shaking at 250 rpm for 24–36 hours to obtain a saturated bacterial culture. Take 0.2–1 mL of the saturated bacterial culture into 250 mL of YEP liquid medium supplemented with a final concentration of 25 mg / L rifampin and 25 mg / L kanamycin. Expand the culture to OD at 28°C with shaking at 250 rpm. 650nm =0.8~1.0; Dispense the bacterial culture into six 50mL sterile centrifuge tubes, centrifuge (4000rpm, 10min, 25℃), collect the bacterial pellet, and resuspend it with an equal volume of liquid co-culture medium to OD. 650nm =0.6~0.8, to obtain the overexpressed Agrobacterium bacterial suspension, for later use.
[0134] (2) Preparation of Agrobacterium tumefaciens culture carrying the target gene knockout
[0135] Replace the glycerol bacteria carrying the overexpression vector prepared in Example 4 of step (1) with the glycerol bacteria carrying the knockout vector CRISPR / Cas9-OsMLSP1 prepared in Example 4, and perform the same other operations to obtain the knockout Agrobacterium tumefaciens bacterial solution.
[0136] 3. Genetic transformation
[0137] The callus tissue grown in step 1 was placed in the Agrobacterium overexpression and Agrobacterium knockout bacterial solutions from step 2 for 25 min of infection, then air-dried on sterile filter paper, spread evenly on co-culture medium, and co-cultured in the dark at 25°C for 2.5–3 days. The callus tissue was then evenly placed on selection medium and cultured in the dark at 25°C for 2–3 weeks. It was then transferred to pre-differentiation medium and cultured in alternating light and dark conditions at room temperature for 14 h / 10 h for two weeks before being transferred to differentiation medium. Rice callus tissue that had grown to the 2-leaf or 2-leaf-one-heart stage was transferred to rooting medium. When the rice seedlings reached approximately 10 cm in length, they were hardened off in water for 3–4 days and then transplanted into soil pots to obtain the T0 generation genetic transformants.
[0138] Example 7: Identification of overexpression and knockout plants in soybeans and rice, and detection of expression levels.
[0139] The expression or knockout of mitochondrial small peptides in the T3 or T2 generation plants cultivated in Examples 5 and 6 were identified and detected by qRT-PCR.
[0140] (1) Identification of positive plants of soybean transgenic lines
[0141] The primers for identifying soybean overexpression positive plants were GmMLSP1 / 2-ID-F, GmMLSP1-ID-R, and GmMLSP2-ID-R (the first primer was the same). Positive plants were screened and the overexpression lines were denoted as GmMLSP1-OE or GmMLSP2-OE. After stabilization through propagation, homozygous overexpression transgenic lines of the T3 generation were collected, with genotypes GmMLSP1 / GmMLSP1 and GmMLSP2 / GmMLSP2.
[0142] The primers for identifying the transgenic lines with GmMLSP1 and GmMLSP2 gene knockout in soybean were GmMLSP1-KO-F / R and GmMLSP2-KO-F / R. After identification, transgenic lines with single gene knockout of GmMLSP1 and double gene knockout of GmMLSP1 / GmMLSP2 were obtained, which were denoted as gmmlsp1 and gmmlsp1 / 2, respectively. After stabilization through breeding, the T3 generation transgenic lines were collected.
[0143] (2) Detection of expression level in soybean overexpression-positive plants
[0144] Select homozygous overexpression transgenic lines of generation (1) T3, and use the non-transgenic recipient soybean variety Williams 82 as a control. Use primers GmMLSP1-qPCR-F / R and GmMLSP2-qPCR-F / R to detect the relative expression level of mitochondrial small peptide encoding genes. The internal reference gene is GmCYP2, and the primer is GmCYP22-qPCR-F / R. The relative expression levels of the mitochondrial peptide-encoding genes in the overexpression lines GmMLSP1-OE or GmMLSP2-OE are shown in Figure 2a. The relative expression levels of the target gene in the GmMLSP1 transgenic overexpression lines GmMLSP1-OE#2, GmMLSP1-OE#7, and GmMLSP1-OE#8 listed in the figure are 47.7, 130.6, and 224.4 times that of the control plants, respectively. The relative expression levels of the target gene in the GmMLSP2 transgenic overexpression lines GmMLSP2-OE#2, GmMLSP2-OE#4, and GmMLSP2-OE#5 are 25.6, 121.5, and 378.5 times that of the control plants, respectively.
[0145] (3) Identification of positive plants of transgenic rice lines
[0146] The primers for identifying positive rice overexpression plants were OsMLSP1-ID-F / R, and the primers for the internal reference gene OsACTIN were OsACTIN-qPCR-F / R. Positive plants were screened and the overexpression line was designated OsMLSP1-OE. After self-pollination, homozygous T2 generation plants overexpressing OsMLSP1 (genotype OsMLSP1 / OsMLSP1) were obtained for subsequent experiments.
[0147] The primers for identifying OsMLSP1 knockout plants in rice were OsMLSP1-KO-F / R. The knockout plants obtained were cultured to obtain T2 generation homozygous knockout plants (genotype osmlsp1 / osmlsp1), denoted as osmlsp1.
[0148] (4) Detection of expression level in rice overexpression positive plants
[0149] In step (3), the T2 generation homozygous OsMLSP1 overexpressing plants were screened. Using rice (variety: Nipponbare) as a control, the relative expression level of the mitochondrial small peptide encoding gene was detected by primer OsMLSP1-qPCR-F / R. The internal reference gene was OsACTIN. The results are shown in Figure 2b. The relative expression levels of the target gene in the OsMLSP1 transgenic overexpressing lines OsMLSP1-OE#1, OsMLSP1-OE#2 and OsMLSP1-OE#3 were 33.5, 94.8 and 79.3 times that of the control plants, respectively.
[0150] Primers:
[0151] GmMLSP1 / 2-ID-F:5'-ttcatttggagagaacacgt-3'
[0152] GmMLSP1-ID-R:5'-AGAATGGGAGGAAGAGGAAGAGGGA-3'
[0153] GmMLSP2-ID-R:5'-AGAATGGGAGGGAGGTGGAGTGTTT-3'
[0154] GmMLSP1-qPCR-F: 5'-ATGGAGAAGAAGATCACTTT-3'
[0155] GmMLSP1-qPCR-R: 5'-GATCTTGGATTAGGTCAGA-3'
[0156] GmMLSP2-qPCR-F: 5'-GAGAAGAAGATGACTTTGG-3'
[0157] GmMLSP2-qPCR-R:5’-GATGACTCTCTACCAAACAT-3’
[0158] GmCYP2-qPCR-F:5’-CGGGACCAGTGTGCTTCTTCA-3’
[0159] GmCYP2-qPCR-R:5’-CCCCTCCACTACAAAGGCTCG-3’
[0160] GmMLSP1-KO-F:5’-TACACCGTACACTGCATTAT-3’
[0161] GmMLSP1-KO-R:5’-TGGGGTTTGGAAGAGACATA-3’
[0162] GmMLSP2-KO-F:5’-AAAAATTGAAGTTGGGCCT-3’
[0163] GmMLSP2-KO-R:5’-TGTGTTGTTTGGTGCACTTA-3’
[0164] OsMLSP1-ID-F:5’-ATTTGGAGAGAACACGGGGGACGA-3’
[0165] OsMLSP1-ID-R:5’-TTTGGAATGAGCGTCAGAATCGGG-3’
[0166] OsMLSP1-qPCR-F:5’-ATCACGCTCCTGCAGACGGT-3’
[0167] OsMLSP1-qPCR-R:5’-TGCTGCGGAGGTCTTCAATGA-3’
[0168] OsACTIN-qPCR-F:5’-CAACACCCCTGCTATGTACG-3’
[0169] OsACTIN-qPCR-R:5’-CATCACCAGAGTCCAACACAA-3’
[0170] OsMLSP1-KO-F:5’-ATCCCAATCCTGTGGAGAGGTTGGG-3’
[0171] OsMLSP1-KO-R:5’-TGCGTGGTTTTCTGCGACTTGA-3’。
[0172] Example 8: Cloning, overexpression, or knockout vector construction and transformation of Arabidopsis thaliana-derived mitochondrial small peptide MLSP
[0173] 1. Cloning of the MLSP protein-coding gene
[0174] Using the method described in Example 1, the AtMLSP1 gene (At4G17085) of the Arabidopsis thaliana genome was analyzed using the Phytozome database. The CDS coding sequence is 174 bp in length, and the corresponding nucleotide sequence is shown in SEQ ID NO.7. The encoded protein contains 57 amino acids, and the corresponding amino acid sequence is shown in SEQ ID NO.8.
[0175] >A.thaliana TAIR10|AT4G17085 CDS,SEQ ID NO.7:
[0176] >A.thaliana TAIR10|AT4G17085.1,SEQ ID NO.8:
[0177] 2. Construction of overexpression vectors
[0178] Using the method in Example 2, the AtMLSP1 gene was inserted into its NcoI site using the pCAMBIAsuper1300-GFP vector (catalog number V013425) from HonorGene as the backbone vector, ensuring that there was no frameshift between the AtMLSP1 gene and the eGFP reading frame in the vector, thus constructing the overexpression vector.
[0179] 3. Construction of the knockout vector
[0180] Using the method described in Example 3, the target site sequences CCAAACAGTGGCAATCTCCGGCGT and GCCGTCTCATGCTGGTGAGTG were introduced into the backbone vector pHSE401 (purchased from Addgene) to construct a knockout vector.
[0181] 4. Transformation of Agrobacterium with overexpression and knockout vectors
[0182] Using the method described in Example 4, the above-mentioned overexpression vector and knockout vector were transformed into Agrobacterium strain GV3101.
[0183] 5. Cultivation of wild-type Arabidopsis thaliana
[0184] Wild-type Arabidopsis thaliana seeds (Columbia CL0) were sown in a mixture of potting soil, vermiculite, and perlite in a 3:1:1 (mass ratio) and cultured in an Arabidopsis thaliana growth chamber (23℃ (light) / 19℃ (dark), photoperiod: 16h (light) / 8h (dark), light intensity: 120 μmol·m⁻¹). -2 ·s -1 (Relative humidity around 50%), until the inflorescence grows.
[0185] 6. Preparation of Agrobacterium tumefaciens bacterial culture
[0186] Using the method of Example 5, the Agrobacterium bacteria from step 4 were cultured in large batches at 28°C with liquid YEP medium containing a final concentration of 50 mg / L kanamycin and 25 mg / L rifampin until OD600nm = 0.8. The bacterial suspension was centrifuged at 2000 rpm for 10 min, and the bacterial cells were collected. The Agrobacterium bacteria were resuspended in an aqueous solution containing 0.5 g / L sucrose and 0.03% (v / v) of the surfactant polysiloxane polyether (Silwet) until OD600nm = 0.8 to obtain the Agrobacterium bacterial suspension.
[0187] 7. Genetic transformation
[0188] Gently immerse the inflorescences of wild-type Arabidopsis thaliana at the initial flowering stage (step 5) in the Agrobacterium tumefaciens solution prepared in step 6, infecting at 25°C for 30 seconds. Cover the infected Arabidopsis plants with plastic bags overnight to maintain high humidity (65%). Remove the plastic bags and culture normally in an Arabidopsis thaliana growth chamber. To improve transformation efficiency, the plants can be re-infected with fresh Agrobacterium tumefaciens solution after 6–7 days. Continue culturing until seeds are produced. The overexpression line is designated AtMLSP1-OE, and the knockout line is designated atmlsp1.
[0189] 8. Isolation and purification of mitochondria
[0190] Mitochondrial respiratory chain enzymes, also known as mitochondrial respiratory chain complexes or mitochondrial respiratory chain compound enzymes, are located on the inner mitochondrial membrane and consist of five complexes: NADH-Q oxidoreductase (also known as complex I), succinate-Q oxidoreductase (also known as complex II), UQ-cytochrome C oxidoreductase (complex III), cytochrome C oxidase (also known as complex IV), and ATPase (ATP synthase, complex V).
[0191] Wild-type (Col0-1, Col0-2), knockout lines (amlsp1-1, amlsp1-2), and overexpression lines (AtMLSP1-OE#1, AtMLSP1-OE#2) Arabidopsis seeds were sown on B5 medium and grown for 12 days under the conditions of step 5. Mitochondria were extracted from seedlings and analyzed according to NativePAGE. TMThe extracted mitochondria were processed according to the sample preparation kit (Invitrogen) instructions. The Invitrogen NativePAGE Bis-Tris gel system was used. After electrophoresis, the gel was taken and the abundance of the complex was detected by Coomassie Brilliant Blue staining (Figure 3a). The activity of the mitochondrial respiratory chain complex I was detected by the mitochondrial respiratory chain complex I activity assay kit (Figure 3b).
[0192] The results showed that, with the same total number of mitochondria, the activity of the mitochondrial supercomplex I+III2 in the AtMLSP1-OE#1 / 2 line was higher than that in the wild type, while the activities of other complexes were not significantly different from those in the wild type. However, the activities of the supercomplexes I+III2 and III2 in the knockout line were significantly lower than those in the wild type, demonstrating that overexpression of the mitochondrial peptide MLSP can improve the activity of plant mitochondria.
[0193] Example 9: Statistical analysis of growth and yield traits in plants overexpressing mitochondrial small peptides
[0194] Wild-type (Col0), knockout lines (amlsp1-1, amlsp1-2), and overexpression lines (AtMLSP1-OE#1, AtMLSP1-OE#2) Arabidopsis seeds were planted using the method described in step 5 of Example 8, with the light intensity changed to 350 μmol·m⁻¹. -2 ·s -1 Seeds were collected from fully dried mature plants, and their volume and dry weight were recorded (Figure 4a). The results showed that the seed yield of the wild type was higher than that of the knockout line atmlsp1-1 / 2 but lower than that of the overexpression line AtMLSP1-OE#1 / 2.
[0195] In Example 7, homozygous transgenic soybean plants (GmMLSP1-OE#2, GmMLSP1-OE#7 and GmMLSP1-OE#8; GmMLSP2-OE#2, GmMLSP2-OE#4 and GmMLSP2-OE#5), knockout plants (gmmlsp1, gmmlsp1 / 2), and wild-type soybean Williams 82 (W82) overexpressing GmMLSP were planted at the Changxing Experimental Farm of Zhejiang University (June 2024 - October 2024). The results are shown in Figure 4b. The GmMLSP1 / 2 overexpressing lines had higher plant height, more pods, and larger seeds than the wild type, while the wild type was superior to the knockout plant gmmlsp1 / 2 in these aspects.
[0196] In Example 7, the T2 generation homozygous transgenic rice plants (OsMLSP1-OE#1, OsMLSP1-OE#2, and OsMLSP1-OE#3) overexpressing OsMLSP, knockout plants (osmlsp1#1 and osmlsp1#2), and rice (Nipponbare Nip) were all grown in a rice growing chamber (30℃ (light) / 24℃ (dark), photoperiod: 14h (light) / 12h (dark), light intensity: 800 μmol·m⁻¹). -2 ·s -1 When planted in a relative humidity of around 50%, the results showed that the overexpressing plants grew better than the wild type (Figure 4c), while the knockout lines did not.
[0197] In summary, while the amino acid sequence of mitochondrial small peptide MLSP is highly conserved in different plants, its function is also conserved. Overexpression of mitochondrial small peptide MLSP can promote plant growth and increase yield, demonstrating certain development and utilization value in agricultural production.
[0198] Example 10: Identification of drought resistance phenotype in Arabidopsis thaliana overexpressing mitochondrial small peptide MLSP
[0199] Wild-type Arabidopsis seeds (Col-0), knockout lines (atmlsp1-1, atmlsp1-2) constructed in Example 8, and overexpression lines (AtMLSP1-OE#1, AtMLSP1-OE#2) were vernalized at 4°C for 2 days. Seeds were sown on a substrate of nutrient soil:vermiculite:perlite = 3:1:1 (mass ratio), pre-moistened with the substrate and kept to a similar weight in each pot. Transparent lids were placed over the substrate, with 20 pots per tray. The lids were removed after 3 days, and the plants continued to grow for 7 days. Thinning was then carried out, and pots from different lines with consistent growth were randomly placed to allow the plants to continue growing until they had at least 14 rosette leaves before initiating drought treatment.
[0200] Drought treatment: Specific traits of each strain before drought treatment are shown in Figure 5 (Before drought). Then, the strains were treated at 23℃ (light) / 19℃ (dark), with a photoperiod of 16h (light) / 8h (dark) and a light intensity of 350 μmol·m⁻¹. -2 ·s -1 After being drought-cultured at a relative humidity of around 50% for 10 days, as shown in Figure 5, the wild type was the first to be significantly drought-stressed. After another 3 days of drying, significant drying occurred in all different strains, as shown in Figure 5. After that, water was added to completely moisten the soil, and the photos after one day of recovery are shown in Figure 5.
[0201] The results showed that after 13 days of drought, wild-type Arabidopsis plants wilted earlier than the overexpression line AtMLSP1-OE#1 / 2. After one day of watering, the overexpression line AtMLSP1-OE#1 / 2 recovered to a state closer to that before wilting, proving that plants overexpressing the mitochondrial peptide MLSP have drought resistance.
[0202] Example 11: Identification of salt-alkali resistance phenotype in Arabidopsis thaliana overexpressing mitochondrial small peptide MLSP
[0203] Wild-type Arabidopsis seeds (Col-0), overexpression lines constructed in Example 8 (AtMLSP1-OE#1, AtMLSP1-OE#2), and knockout lines (atmlsp1-1, atmlsp1-2) were disinfected and sown on B5 medium containing different sodium chloride concentrations (0mM, 100mM, and 150mM). The seeds were vernalized at 4°C for 2 days. After vernalization, the seeds were sown and cultured according to the method in Example 10. The germination rate and growth characteristics of Arabidopsis seeds were recorded at 3, 5, and 8 days after sowing, as shown in Figure 6.
[0204] The results showed that Arabidopsis seeds overexpressing the mitochondrial peptide MLSP had better germination rate and growth under high sodium chloride stress than wild-type seeds, while knockout line seeds were more sensitive to sodium chloride stress than wild-type seeds.
Claims
1. A mitochondrial small peptide MLSP, characterized in that, The amino acid sequence of the mitochondrial small peptide MLSP is shown in one of SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 or SEQ ID NO.
8.
2. A gene encoding the mitochondrial small peptide MLSP as described in claim 1.
3. An expression vector for the gene encoding the mitochondrial small peptide MLSP as described in claim 2.
4. The expression vector as described in claim 3, characterized in that, The vector backbone of the expression vector is pTF101 or pCAMBIA1302.
5. An Agrobacterium expressing the mitochondrial small peptide MLSP of claim 1.
6. The application of the mitochondrial small peptide MLSP as described in claim 1 in improving the activity and stability of plant mitochondria.
7. The application of the mitochondrial small peptide MLSP as described in claim 1 in improving plant yield.
8. The application as described in claim 7, characterized in that, The application involves using Agrobacterium-mediated overexpression of the mitochondrial small peptide MLSP in plants to screen for lines with increased yields.
9. The application of the mitochondrial small peptide MLSP as described in claim 1 in improving plant stress resistance.
10. A method for cultivating plants with improved yield and / or stress resistance using the mitochondrial small peptide MLSP as described in claim 1, characterized in that, The method involves introducing an expression vector containing the mitochondrial peptide MLSP gene into Agrobacterium, and then using Agrobacterium-mediated cotyledonary node transformation to screen for transgenic plants with improved mitochondrial activity, yield, and / or stress resistance.
Citation Information
Patent Citations
Application of GmZSP gene in increasing yield of protein-rich soybeans
CN118272392A