Vacuole escape

Abstract

The present invention relates to a live attenuated Gram-negative bacterium modified to enable enhanced vacuole escape. In particular, the invention relates to a live attenuated Gram-negative bacterium comprising a heterologous polynucleotide encoding a prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein said heterologous polynucleotide encoding the prokaryotic disulfide bond isomerase is operably linked to a promoter, or a live attenuated Gram-negative bacterium comprising an endogenous prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein the endogenous prokaryotic disulfide bond isomerase is upregulated compared to its basal level expression.

Description

[0001] VACUOLE ESCAPE

[0002] FIELD OF THE INVENTION

[0003] The present invention relates to a live attenuated Gram-negative bacterium modified to enable enhanced vacuole escape.

[0004] BACKGROUND

[0005] Gram-negative bacteria are known to have a cell envelope consisting of two membranes, separated by the periplasm. Numerous proteins reside within the periplasm, undertaking numerous roles and functions. Many of these proteins require stabilisation via the formation of one or more disulfide bonds. The disulfide bond forming (Dsb) protein family is responsible for disulfide bond formation, rearrangement and protection against cysteine oxidation1. The Dsb proteins are involved in two pathways: an oxidation pathway involving the inner membrane protein DsbB and the periplasmic protein DsbA, and a reduction pathway involving the periplasmic proteins DsbC and DsbG1. DsbC (disulfide bond C) is a prokaryotic disulfide bond isomerase involved in the proper formation of disulfide bonds, resulting in proper folding of proteins and enhanced stabilisation of the tertiary structures of such proteins. Furthermore, if an incorrect disulfide bond is formed, the offending disulfide bond is broken and / or rearranged by DsbC1. DsbC has been shown to have a possible defensive role against oxidative stress2and in copper stress resistance3.

[0006] Due to their pivotal role in the proper stabilisation and formation of tertiary and quaternary proteins, mutations in dsb genes have been shown to influence the conformation and stability of many extracytoplasmic proteins, resulting in many pathogens becoming partially or fully attenuated due to improper folding of proteins that are intended as virulence factors4. Bacteria have also long been used as a way of producing recombinant proteins. Crucial to this process is the avoidance of unproductive interactions of newly expressed polypeptides, which can lead to aggregation of folding intermediates instead of the desired native protein. The Dsb family of proteins have therefore been identified as a mechanism by which correctly folded recombinant constructs can be achieved5.

[0007] In the biotechnology field, bacteria have emerged as a particularly useful tool in the context of a drug delivery system, i.e., the delivery of therapeutic molecules, for example, nucleic acids and / or proteins. A particularly relevant mode of delivery involves delivery of such molecules into the target cells cytosol, where they can interact with the host cellular machinery to trigger downstream therapeutic effects (e.g., delivery of therapeutic mRNA or intra-bodies). Crucial to this process is the process referred to as vacuole escape (VE), allowing bacteria to have access to the host cytosol, triggering hyper-replication or bacterial growth and potentially exponentially increasing the payload that can then be synthesized and delivered. However, reliable methods of vacuole escape are limited, often using large constructs which are complex to work with, and even then, have low levels of efficiency.

[0008] As such, there is a continued and evident need for new ways in which the level of vacuole escape in bacteria can be enhanced.

[0009] SUMMARY OF INVENTION

[0010] The inventors of the present invention have surprisingly demonstrated that a live attenuated Gram-negative bacterium, modified as described herein, results in an increased propensity for vacuole escape. As a result, the modified bacterium herein disclosed is particularly useful for the delivery of a therapeutic molecule to a subject in need thereof.

[0011] In a first aspect, a live attenuated Gram-negative bacterium comprising a heterologous polynucleotide encoding a prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein said heterologous polynucleotide encoding the prokaryotic disulfide bond isomerase is operably linked to a promoter, is disclosed.

[0012] In a second aspect, a live attenuated Gram-negative bacterium comprising an endogenous prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein the endogenous prokaryotic disulfide bond isomerase is upregulated compared to its basal level expression, is disclosed.

[0013] In a third aspect, there is provided the live attenuated Gram-negative bacterium of the first or second aspect of the invention, for therapeutic use. Preferably, the therapeutic use is the treatment, reduction, inhibition, prevention, or control of a neoplastic disease, an infectious disease, a cardiovascular disease, a neurodegenerative disease, a gastrointestinal disease, a respiratory disease, a renal disease, a liver disease, an autoimmune disease, an inflammatory disease or a genetic disorder, preferably the live attenuated Gram-negative bacterium is for use in the treatment, reduction, inhibition, prevention of recurrence, or control of a neoplastic disease or an infectious disease. More preferably, the therapeutic use is the treatment, reduction, inhibition, prevention, or control of a neoplastic disease, such as a solid cancer and / or a haematological malignancy.

[0014] In a fourth aspect, a vaccine composition comprising a live attenuated Gramnegative bacterium, wherein the live attenuated Gram-negative bacterium comprises a heterologous polynucleotide encoding a prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein said heterologous polynucleotide encoding the prokaryotic disulfide bond isomerase is operably linked to a promoter, is disclosed.

[0015] In a fifth aspect, a vaccine composition comprising a live attenuated Gramnegative bacterium comprising an endogenous prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein the endogenous prokaryotic disulfide bond is upregulated compared to its basal level expression, is disclosed.

[0016] In a sixth aspect, a method of treating, preventing, inhibiting, preventing recurrence or controlling a disease in a subject, wherein the method comprises administering to a subject a live attenuated Gram-negative bacterium, wherein the live attenuated Gram-negative bacterium comprises a heterologous polynucleotide encoding a prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein said heterologous polynucleotide encoding the prokaryotic disulfide bond isomerase is operably linked to a promoter, is disclosed.

[0017] In a seventh aspect, a method of treating, preventing, inhibiting, preventing recurrence or controlling a disease in a subject, wherein the method comprises administering to a subject a live attenuated Gram-negative bacterium, wherein the live attenuated Gram-negative bacterium comprises an endogenous prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein said endogenous prokaryotic disulfide bond is upregulated compared to its basal level expression, is disclosed.

[0018] In an eight aspect, a method of delivering a therapeutic molecule to the tumour microenvironment in a subject suffering from a tumour, said method comprising the steps of: i) modifying a live attenuated Gram-negative bacterium, said live attenuated Gram-negative comprising a heterologous polynucleotide encoding a prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein said heterologous polynucleotide encoding the prokaryotic disulfide bond isomerase is operably linked to a promoter, and ii) administering said modified Gram-negative bacterium to the subject in need thereof, is disclosed.

[0019] In a ninth aspect, a method of delivering a therapeutic molecule to the tumour microenvironment in a subject suffering from a tumour, said method comprising the steps of: i) modifying a live attenuated Gram-negative bacterium, said live attenuated Gram-negative comprising an endogenous prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein said endogenous prokaryotic disulfide bond isomerase is upregulated compared to its basal level expression, and ii) administering said modified Gram-negative bacterium to the subject in need thereof, is disclosed.

[0020] In a tenth aspect, the use of a live attenuated Gram-negative bacterium comprising a heterologous polynucleotide encoding a prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein said heterologous polynucleotide encoding the prokaryotic disulfide bond isomerase is operably linked to a promoter, in the manufacture of a medicament for use in a neoplastic disease, an infectious disease, a cardiovascular disease, a neurodegenerative disease, a gastrointestinal disease, a respiratory disease, a renal disease, a liver disease, an autoimmune disease, an inflammatory disease or a genetic disorder, is disclosed.

[0021] In an eleventh aspect, the use of a live attenuated Gram-negative bacterium comprising an endogenous prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein said endogenous prokaryotic disulfide bond isomerase is upregulated compared to its basal level expression, in the manufacture of a medicament for use in a neoplastic disease, an infection us disease, a cardiovascular disease, a neurodegenerative disease, a gastrointestinal disease, a respiratory disease, a renal disease, a liver disease, an autoimmune disease, an inflammatory disease or a genetic disorder, is disclosed.

[0022] BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 shows the level of vacuole escape in HeLa cells invaded with Salmonella Typhi (STy) ZH9 or Salmonella Typhimurium (STyM) CD12 with and without a plasmid bearing the beta-lactamase gene and treated with CCF4 at 24 h postinvasion.

[0024] Figure 2 shows a live attenuated Gram-negative bacterium (Salmonella strain) modified to express DsbC having an enhanced propensity for vacuole escape (see Figure 2A). At the same time, the modified live attenuated Gram-negative bacterium is shown to have enhanced levels of invasiveness (see Figure 2B).

[0025] Figure 3 shows an image of vacuole escape (indicated by the dots) in a positive control Salmonella Typhimurium sifA mutant strain (left panel) and a DsbC containing strain (right panel). DETAILED DESCRIPTION

[0026] In order that the present invention may be more readily understood, certain terms are first defined. Additional definitions are set forth throughout the detailed description.

[0027] As used herein, the term “attenuated” refers to a bacterium that has been genetically modified so as not to cause illness in a human or animal subject / model. It therefore refers to the alteration of a microorganism to reduce its pathogenicity, rendering it harmless to the host, whilst maintaining its viability. Attenuation of a bacterium may involve a number of methods, examples include, but are not limited to, passing the pathogens under in vitro conditions until virulence is lost, chemical mutagenesis and genetic engineering techniques. Such an attenuated microorganism is preferably a live attenuated microorganism, although non-live attenuated microorganisms are also disclosed.

[0028] As used herein, the term “prokaryotic disulfide bond isomerase” refers to a enzyme involved in the proper folding of proteins by catalyzing the formation and breaking of disulfide bonds.

[0029] As used herein, the term “upregulated” refers to an increase in the quantity of prokaryotic disulfide bond isomerase expression in a cell above basal level expression. This may result from an amplified level of gene expression. The skilled person will readily appreciate that upregulation can be measured via an increase in the gene transcript (i.e. , mRNA) or in the level of resulting protein. The methods by which the level of gene transcripts / proteins can be determined are well known to those in the art, and include, polymerase chain reaction, reverse transcriptase polymerase chain reaction, RNA-Seq, microarrays, northern blot analysis, western blot, ELISA assays, immunohistochemistry, immunofluorescence, and mass spectrometry.

[0030] In a preferred embodiment, the gene transcript encoding the prokaryotic disulfide bond isomerase is upregulated at least two-fold above basal level expression. In some embodiments, the gene transcript encoding the prokaryotic disulfide bond isomerase is upregulated at least three-fold, at least four-fold, at least five-fold, at least six-fold, at least seven-fold, at least eight-fold, at least nine-fold, at least tenfold, or more than ten-fold.

[0031] In another preferred embodiment, the prokaryotic disulfide bond isomerase (i.e. the protein itself) is upregulated 1.5-fold above basal level expression. In some embodiments, the prokaryotic disulfide bond isomerase is upregulated at least two-fold, at least three-fold, at least four-fold, at least five-fold, at least six-fold, at least seven-fold, at least eight-fold, at least nine-fold, at least ten-fold, or more than ten-fold.

[0032] Therefore, the bacteria are modified such that upregulation is achieved.

[0033] As used herein, the terms “basal level” and “basal level expression” are used interchangeably and refer to the level of prokaryotic disulfide bond isomerase expression that is present in a cell under “normal” conditions, i.e. without any external stimulation or stress. The basal level expression acts as a baseline to identify upregulation or downregulation of a cell component. The basal level expression may refer to the basal level gene expression or the basal level protein expression. The skilled person will be aware of basal expression levels.

[0034] As used herein, the term “non-natural bacterium or bacteria” refers to bacterial (prokaryotic) cells that have been genetically modified or “engineered” such that it is altered with respect to the naturally occurring cell. Such genetic modification may for example be the incorporation of additional genetic information into the cell, modification of existing genetic information or indeed deletion of existing genetic information. This may be achieved, for example, by way of transfection of a recombinant plasmid into the cell or modifications made directly to the bacterial genome. Additionally, a bacterial cell may be genetically modified by way of chemical mutagenesis, for example, to achieve attenuation, the methods of which will be well known to those skilled in the art. As such, the term “non-natural bacterium or bacteria” may refer to both recombinantly modified and non- recombinantly modified strains of bacteria. As used herein, the term “heterologous polynucleotide” refers to a polynucleotide that has been introduced into the live attenuated Gram-negative bacterium, i.e. , the introduction of a polynucleotide that was not previously present or naturally occurring in the Gram-negative bacterium. Accordingly, the live attenuated Gramnegative bacteria herein disclosed may be a recombinant strain of bacteria. The heterologous polynucleotide in the context of the present invention may be a DNA molecule or RNA molecule, and may be intended for delivery to a eukaryotic cell. The heterologous polynucleotide in the context of the present invention may encode a protein or peptide. In some embodiments, the heterologous polynucleotide encodes a prokaryotic disulfide bond isomerase, for example a Dsb family member isomerase, such as DsbC. In other words, where a non- endogenous prokaryotic disulfide bond isomerase is utilised, the isomerase may be introduced into the bacteria via a heterologous polynucleotide. In other embodiments, there may be a heterologous polynucleotide present which encodes a “cargo molecule”. The term “cargo” or “cargo molecule” is given its usual meaning in the art, and skilled person will be familiar with such term. In any case, the heterologous polynucleotide may be an DNA or RNA molecule or a protein. In a particularly preferred embodiment, the DNA or RNA molecule to be encoded is a mammalian DNA or RNA molecule. The RNA molecule may be an mRNA molecule. The mRNA molecule may encode a protein. The cargo (e.g., DNA, RNA, mRNA or protein) may be intended for delivery outside of the bacterial cell, for instance into a eukaryotic cell or within the interstitial space in between eukaryotic cells, such as within or proximal to the tumour microenvironment.

[0035] The term “prophylactic treatment”, as used herein, refers to a medical procedure whose purpose is to prevent, rather than treat or cure, an infection or disease. In the present invention, this applies particularly to the vaccine composition. The term “prevent” as used herein is not intended to be absolute and may also include the partial prevention of the infection or disease and / or one or more symptoms of said infection or disease. In contrast, the term “therapeutic treatment” refers to a medical procedure with the purpose of treating or curing an infection or disease or the associated symptoms thereof, as would be appreciated within the art. The terms "tumour," "cancer", “malignancy” and "neoplasia" are used interchangeably and refer to a cell or population of cells whose growth, proliferation or survival is greater than growth, proliferation or survival of a normal counterpart cell, e.g., a cell proliferative or differentiative disorder. Typically, the growth is uncontrolled. The term "malignancy" refers to invasion of nearby tissue. The term "metastasis" refers to spread or dissemination of a tumour, cancer or neoplasia to other sites, locations, or regions within the subject, in which the sites, locations or regions are distinct from the primary tumour or cancer. In one embodiment, the cancer is malignant. In an alternative embodiment, the cancer is non-malignant.

[0036] As used herein, the term “vaccine” or “vaccine composition” are used interchangeably and take their conventional meaning in the art. These terms may be taken to comprise a number of additional elements in addition to the attenuated live strain herein disclosed. The attenuated live strain may be present in a composition together with any other suitable or pharmaceutically acceptable adjuvant, diluent or excipient. Examples of adjuvants, diluents or excipients include, but are not limited to, disodium hydrogen phosphate, soya peptone, potassium dihydrogen phosphate, ammonium chloride, sodium chloride, magnesium sulphate, calcium chloride, sucrose, sterile saline and sterile water.

[0037] The terms "effective amount" or "pharmaceutically effective amount" refer to a sufficient amount of an agent to provide the desired biological or therapeutic result. That result can be reduction, amelioration, palliation, lessening, delaying, and / or alleviation of one or more of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system. In reference to cancer, an effective amount may comprise an amount sufficient to cause a tumour to shrink and / or to decrease the growth rate of the tumour (such as to suppress tumour growth) or to prevent or delay other unwanted cell proliferation. In some embodiments, an effective amount is an amount sufficient to delay development or prolong survival or induce stabilisation of the cancer or tumour.

[0038] In some embodiments, a therapeutically effective amount is an amount sufficient to prevent or delay recurrence. A therapeutically effective amount can be administered in one or more administrations. The therapeutically effective amount of the agent or combination may result in one or more of the following: (i) reduce the number of cancer cells; (ii) reduce tumour size; (iii) inhibit, retard, slow to some extent and preferably stop cancer cell infiltration into peripheral organs; (iv) inhibit (i.e., slow to some extent and preferably stop) tumour metastasis; (v) inhibit tumour growth; (vi) prevent or delay occurrence and / or recurrence of tumour; and / or (vii) relieve to some extent one or more of the symptoms associated with the cancer.

[0039] For example, for the treatment of tumours, a "therapeutically effective dosage" may induce tumour shrinkage by at least about 5 % relative to baseline measurement, such as at least about 10 %, or about 20 %, or about 60 % or more. The baseline measurement may be derived from untreated subjects.

[0040] A therapeutically effective amount of a therapeutic compound can decrease tumour size, or otherwise ameliorate symptoms in a subject. One of ordinary skill in the art would be able to determine such amounts based on such factors as the subject's size, the severity of the subject's symptoms, and the particular composition or route of administration selected.

[0041] The term "treatment" or "therapy" refers to administering an active agent with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, or affect a condition (e.g., a disease), the symptoms of the condition, or to prevent or delay the onset of the symptoms, complications, biochemical indicia of a disease, or otherwise arrest or inhibit further development of the disease, condition, or disorder in a statistically significant manner.

[0042] As used herein, the term "subject" is intended to include human and non-human animals. Preferred subjects are human subjects. In a particular embodiment, the methods are particularly suitable for treatment of neoplastic disease or infectious disease in vivo.

[0043] The use of the alternative (e.g., "or") should be understood to mean either one, both, or any combination thereof of the alternatives. As used herein, the indefinite articles "a" or "an" should be understood to refer to "one or more" of any recited or enumerated component.

[0044] As used herein, "about" means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" can mean within 1 or more than 1 standard deviation per the practice in the art. Alternatively, "about" can mean a range of up to 20%. When particular values are provided in the application and claims, unless otherwise stated, the meaning of "about" should be assumed to be within an acceptable error range for that particular value.

[0045] The inventors of the present invention have surprisingly found that the expression of a sequence encoding a prokaryotic disulfide bond isomerase significantly enhances the level of vacuole escape in Gram-negative bacteria. Thus, the inventors of the present invention have also found a novel and inventive way of enhancing delivery of therapeutic molecules to a subject in need thereof.

[0046] In a first aspect, a live attenuated Gram-negative bacterium comprising a heterologous polynucleotide encoding a prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein said heterologous polynucleotide encoding the prokaryotic disulfide bond isomerase is operably linked to a promoter is disclosed.

[0047] In a second aspect, a live attenuated Gram-negative bacterium comprising a live attenuated Gram-negative bacterium comprising an endogenous prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein the endogenous prokaryotic disulfide bond is upregulated compared to its basal level is disclosed.

[0048] As such, the present invention provides methods by which the level of a prokaryotic disulfide bond isomerase can be enhanced, resulting in the advantageous properties of the modified live attenuated Gram-negative bacterium herein disclosed. The inventors of the present invention have surprisingly found that the modification of a live attenuated Gram-negative bacterium, to either enhance levels of the endogenous prokaryotic disulfide bond isomerase or introduce a heterologous form of said prokaryotic disulphide bond isomerase, significantly enhance the level of vacuole escape observed. Without being bound by theory, it is envisaged that this increased propensity is as a result of enhanced invasiveness of the modified strains, both effects of which were completely unexpected. Ordinarily, prokaryotic disulfide bond isomerases are expressed on the bacterial periplasm. Irrespective of how the prokaryotic disulfide bond isomerase is expressed, its expression from a novel location - the bacterial cytosol - has been found to increase invasiveness and the propensity for vacuole escape of the bacteria. Therefore, the invention provides a live attenuated Gramnegative bacterium comprising a prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein the prokaryotic disulfide bond isomerase is expressed in the cytosol of the live attenuated Gram-negative bacterium. As is disclosed in the other aspects of the invention, the prokaryotic disulfide bond isomerase may be endogenous or heterologous, and / or the prokaryotic disulfide bond isomerase may be upregulated.

[0049] Where an endogenous prokaryotic disulfide bond isomerase is utilised (i.e., a prokaryotic disulfide bond isomerase native to a certain strain of bacteria), any means for (up)regulation of the isomerase may be employed. For instance, the endogenous promoter may be employed and regulated via any synthetic means. In some embodiments, synthetic regulation of a native promoter can be achieved by engineering the promoter, for example by mutating promoter elements and / or incorporating upstream activating sequences or transcription factor binding sites to strengthen transcription. Further, synthetic transcriptional activators may be recruited by incorporating activating domains to the promoter. Further, the bacterial cell may be stimulated via external cues such as nutrients, pH, or other conditions. An inducer of a native promoter may be supplied to the bacteria. Such inducer may be the natural inducer, threshold concentrations of the natural inducer, synthetic inducers, inducer analogues and so on. Alternatively, a heterologous promoter may be employed to achieve such regulation. In some embodiments, the heterologous promoter may be selected based on its strength (e.g., constitutive promoter, inducible promoter). The native promoter may be replaced with a strong promoter such as those described herein. To enhance cytosolic expression, signal peptides may be added, or native signal peptides may be removed.

[0050] The modified bacterium herein disclosed has wide reaching applications. Not only is it of particular use in the context of the bacterium acting as a delivery vehicle for a cargo molecule, for example, a therapeutic cargo molecule, but the modified bacterium may act as a “priming” agent, enhancing an immune response in a subject in need thereof. For example, the modified bacterium may induce a systemic immune response in a subject. The terms “systemic” and “systemically activated” are used interchangeably and in the context of the present invention refers to a widespread immune response throughout the body of a subject, as opposed to a local, spatially-restricted response. Direct contact with, or accumulation within, tumour cells, tumour-immune cells, or the tumour microenvironment (TME), is not necessarily required for the bacteria to elicit the desired effect. Preferably, the systemic immune response involves the activation and / or maturation of myeloid cells, for example, dendritic cells, monocytes and / or macrophages and in the context of the present invention is thought to help systemically “condition” the immune system of the subject, such that the subject may be more responsive to a subsequent immunotherapy, such as a checkpoint inhibitor, an adoptive cell therapy and / or a CAR T-cell therapy. Accordingly, the Gram-negative bacteria may act to “prime”, “boost”, “amplify”, “enhance”, “improve”, “augment”, “pre-activate” or “promote” the immune response of a subject. When acting as a “priming” agent, the modified bacterium may or may not also act as a carrier for a cargo molecule.

[0051] The modified live attenuated Gram-negative bacterium comprises a prokaryotic disulfide bond isomerase, either in a heterologous form, or the endogenous form which has been upregulated. The term “prokaryotic disulfide bond isomerase” is also intended to cover any protein mimetic that results in the same effect. Additionally, the term “prokaryotic disulfide bond isomerase” is not limited to a single prokaryotic disulfide bond isomerase. As such, the modified live attenuated Gram-negative bacterium can comprise one or more prokaryotic disulfide bond isomerases. In an embodiment, the prokaryotic disulfide bond isomerase is any one of DsbA, DsbB, DsbC, DsbD, DsbE, DsbG, or any combination thereof. In a preferred embodiment, the prokaryotic disulfide bond isomerase is DsbC or DsbG. In a more preferred embodiment, the prokaryotic disulfide bond isomerase is DsbC. The DsbC molecule may be mature DsbC (i.e. without the signal peptide that directs DsbC to the periplasm) or a DsbC molecule with the signal peptide that directs DsbC to the periplasm). DsbC has an amino acid sequence according to SEQ ID NO: 1. The prokaryotic disulfide bond isomerase may comprise 70% sequence identity with SEQ ID NO: 1 , 75% sequence identity with SEQ ID NO:1 , 80% sequence identity with SEQ ID NO: 1 , 85% sequence identity with SEQ ID NO: 1 , 90% sequence identity with SEQ ID NO: 1 , 91 % sequence identity with SEQ ID NO: 1 , 92% sequence identity with SEQ ID NO: 1 , 93% sequence identity with SEQ ID NO: 1 , 94% sequence identity with SEQ ID NO: 1 , 95% sequence identity with SEQ ID NO: 1 , 96% sequence identity with SEQ ID NO: 1 , 97% sequence identity with SEQ ID NO: 1 , 98% sequence identity with SEQ ID NO: 1 , or 99% sequence identity with SEQ ID NO: 1 .

[0052] As used herein, the terms “sequence homology” and “sequence identity” are used interchangeably and refer to the number of identical residues over a defined length in a given alignment of a DNA sequence, RNA sequence or amino acid sequence. To calculate % sequence identity of any of the sequences herein disclosed, sequence comparison software can be used, for example, using the default settings on the BLAST software package (V2.10.1).

[0053] The live attenuated Gram-negative bacterium of the first aspect comprises a heterologous polynucleotide encoding a prokaryotic disulfide bond isomerase, which may be operably linked to a promoter in order to drive expression of the heterologous polynucleotide encoding the prokaryotic disulfide bond isomerase. A “promoter” refers to a DNA regulatory region capable of binding RNA polymerase and initiating transcription of a downstream (3' direction) coding or non-coding sequence. A promoter may also be a regulatory DNA sequence that affects the binding of RNA polymerase at the transcription initiation site. For the purposes of defining the present invention, the promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence may be found a transcription initiation site, as well as protein binding domains responsible for the binding of RNA polymerase.

[0054] The promoter may be a constitutive promoter, a vacuole-induced promoter, a promoter which is inducible upon invasion, or a hybrid promoter. For example, the promoter may be selected from any one of the promoters provided in SEQ ID NOs: 8-45.

[0055] In one embodiment, the promoter may be a constitutive promoter, where the term “constitutive” refers to a promoter which is active under all environments, i.e. a certain stimulus is not required for the promoter to be activated. As such, the constitutive promoter results in a continuous transcription process of the heterologous polynucleotide. In a preferred embodiment, the constitutive promoter is a strong promoter. The term “strong promoter” refers to a promoter that leads to a high rate of transcription initiation, thus producing higher yields of the desired product. The skilled person in this field is well acquainted with the concept of strong or weak promoters and their intended meaning. In a most preferred embodiment, the promoter is a proC promoter or a J23119 promoter.

[0056] As such, in one embodiment, the live attenuated Gram-negative bacterium comprises a polynucleotide sequence according to SEQ ID NO: 2 or a polynucleotide sequence having at least 70% sequence identity thereof. In another embodiment, the live attenuated Gram-negative bacterium comprises a polynucleotide sequence according to SEQ ID NO: 3, or at least a polynucleotide sequence having 70% sequence identity thereof. For example, the live attenuated Gram-negative bacterium may have a polynucleotide sequence having 75% sequence identity to SEQ ID NO: 2 or 3, 80% sequence identity to SEQ ID NO: 2 or 3, 85% sequence identity to SEQ ID NO: 2 or 3, 90% sequence identity to SEQ ID NO: 2 or 3, 91 % sequence identity to SEQ ID NO: 2 or 3, 92% sequence identity to SEQ ID NO: 2 or 3,93% sequence identity to SEQ ID NO: 2 or 3, 94% sequence identity to SEQ ID NO: 2 or 3, 94% sequence identity to SEQ ID NO: 2 or 3, 95% sequence identity to SEQ ID NO: 2 or 3, 96% sequence identity to SEQ ID NO: 2 or 3, 97% sequence identity to SEQ ID NO: 2 or 3, 98% sequence identity to SEQ ID NO: 2 or 3 or 99% sequence identity to SEQ ID NO: 2 or 3.

[0057] As outlined above, the capability of the live attenuated Gram-negative bacterium to have enhanced vacuole escape is particularly useful in the context of the Gramnegative bacterium acting as a delivery mechanism for a therapeutic molecule. As such, the live attenuated Gram-negative bacterium may further comprise a heterologous polynucleotide encoding one or more cargo molecules. For example, the live attenuated Gram-negative bacterium may comprise one cargo molecule, two cargo molecules, three cargo molecules, four cargo molecules, five cargo molecules or six cargo molecules. As used herein, the terms “cargo” and “cargo molecule” may be used interchangeably and will be well known to those in the art, and refers to a specific molecule of interest which is intended to be translocated, delivered, transported, or exported from one place to another. In one preferred embodiment, a cargo molecule may be translocated from the bacterial cytoplasm to the extracellular environment surrounding eukaryotic cells.

[0058] The modified bacterium may comprise a heterologous polynucleotide encoding both a prokaryotic disulfide bond isomerase and a cargo molecule, wherein both heterologous polynucleotides are located within the same circuit. Alternatively, the heterologous polynucleotide encoding a prokaryotic disulfide bond isomerase and the heterologous polynucleotide encoding a cargo molecule may be on separate circuits. The skilled person will appreciate that as long as the prokaryotic disulfide bond isomerase level is upregulated and the cargo molecule can be expressed, the exact positions in the genome are of limited importance. In one embodiment, the heterologous polynucleotide encoding the cargo molecule is positioned upstream of the heterologous polynucleotide encoding the prokaryotic disulfide bond isomerase, wherein the heterologous polynucleotide encoding the cargo molecule is flanked by promoters. The promoters may be the same promoters or different promoters. Several Gram-negative bacteria use a Type 1 Secretion System (T1SS) to translocate proteins across their inner and outer membranes into the extracellular environment Of these T1SS, the Escherichia coli a-hemolysin (HlyA) secretion system is the most thoroughly characterised. Exploitation of the T1SS enables proteins and other cargo molecules to be actively presented to eukaryotic cells of a host immune system through export from the bacterial cytoplasm, rather than merely becoming accessible to the eukaryotic cells once the bacterium has been engulfed and disintegrated. HlyA is a bacterial toxin and virulence factor, and is therefore undesirable in a modified bacterium. The secretion and activation of HlyA is determined by the hlyCABD operon. Briefly, once HlyA has been transcribed and translated, there are three components that modulate the export of HlyA: HlyB, HlyD and TolC. HlyB and HlyD are inner membrane proteins (which may be found in a HlyB-HlyD complex anchored to the inner membrane of the Gram-negative bacterial cell), whereas TolC is located on the outer membrane of the Gram-negative bacterial cell. As would be readily appreciated by the skilled person, hlyB and hlyD are the genes involved in secretion. HlyA carries a translocation signal sequence, known as HlyAs, on its C-terminus. Recognition of HlyAs by the HlyB-HlyD complex induces contact with TolC which forms a trans- periplasmic export channel between the inner and outer membrane. HlyC plays a role in the activation of HlyA. Therefore, the replacement of the HlyA toxin with a heterologous nucleotide encoding a protein, or other cargo molecule, enables the export of specific heterologous proteins or other molecules of interest, via the C-terminal HlyAs sequence, from a carrier bacterium to the extracellular surroundings. HlyA can be replaced while maintaining the translocation peptide (HlyAs). As used herein, “maintaining” HlyAs refers to the HlyAs sequence being intact or undisrupted by any other molecule. “Maintaining” HlyAs may also refer to the entire, full length HlyAs sequence being present without disruption. In some embodiments, the full length HlyAs may be maintained at the C-terminus of the cargo molecule. The full translocation sequence includes three glycine- and aspartic-rich repeats known as repeats in toxins (RTX). RTX repeats play an important role in facilitating translocation and secretion by providing binding sites for calcium ions, which help to improve stabilisation of the protein to be translocated as it passes through the secretion machinery. Advantageously, use of the full length HlyAs may allow for increasingly efficient secretion as compared to other operons in the art which insert cargo within the translocation sequence or utilise truncated translocation sequences.

[0059] Therefore, in one embodiment, the live attenuated Gram-negative bacterium further comprises a modified hlyCABD operon, wherein the modified hlyCABD operon is split into a first segment and a second segment, each segment being operably linked to an independently controlled promoter, wherein the first segment comprises the heterologous polynucleotide encoding the one or more cargo molecules upstream of a hlyAs translocation sequence, wherein the heterologous polynucleotide encoding the one or more cargo molecule replaces a hlyA gene, and wherein the second segment comprises hly genes involved in secretion.

[0060] The live attenuated Gram-negative bacterium of the present invention can act as an efficient and reliable method of delivering or exporting cargo molecules from the bacterial cytoplasm into the extracellular surroundings, including the interstitial space between eukaryotic cells, whilst at the same time having an increased propensity for vacuole escape. Accordingly, the bacterial strains herein disclosed may be recombinant strains comprising a modified hlyCABD operon which comprises a heterologous polynucleotide encoding a cargo molecule and a heterologous polynucleotide encoding a prokaryotic disulfide bond isomerase, or functional fragment thereof. Alternatively, the bacterial strains herein disclosed may be recombinant strains comprising a modified hlyCABD operon which comprises a heterologous polynucleotide encoding a cargo molecule and an endogenous prokaryotic disulfide bond isomerase which is upregulated compared to its basal level of expression. The heterologous polynucleotide therefore has a nucleotide-encoding structure which allows for its transcription, and, in the case where the cargo molecule is a protein, its subsequent translation into the encoded cargo molecule.

[0061] The modified hlyCABD operon can be split into a first segment and a second segment, each segment being operably linked to an independently controlled promoter. In order to allow for transcription and translation of the heterologous polynucleotide and production of the cargo molecule in the live attenuated Gramnegative bacterium, the heterologous polynucleotide is operably linked to an independently controlled promoter. Further, in order to allow for transcription and translation of the hly genes involved in secretion, the hly genes involved in secretion is operably linked to an independently controlled promoter. As used herein, the term “independently controlled promoter” refers to a promoter which is controlled by regulatory elements which are distinct to that of another promoter in the system. In particular, the promoter controlling the expression of the first segment may be different, or have distinct regulatory mechanisms, to that of the promoter controlling the expression of the second segment.

[0062] The first segment (the ‘cargo region’) is envisaged to comprise the heterologous polynucleotide which encodes a cargo molecule, upstream of a hlyAs translocation sequence.

[0063] The heterologous polynucleotide encoding the cargo molecule can be fused to a hlyAs sequence encoding the translocation peptide, HlyAs. In one embodiment, where the cargo molecule is a protein or peptide, the HlyAs translocation peptide is positioned on the C-terminus of the cargo molecule. The HlyAs protein may be approximately 50 to 220 amino acids in length. In some embodiments, the HlyAs protein is 218 amino acids in length. Several structural and sequence motifs within HlyAs have been identified as being important for its signal function through site- directed mutagenesis, CD and NMR spectroscopy studies [Holland, I.B., et al., 1990; Koronakis, V., 1989; Jarchau, T., et al., 1994], As used herein, the terms “translocation sequence”, “signal sequence”, and “target sequence” may be used interchangeably, and refer to a gene encoding a translocation peptide or protein which is recognised by cellular export machinery and targeted for export or secretion from the cell. Translocation peptides are typically found on the N- or C- terminus of a peptide or protein which is intended to be translocated from one location to another. Translocation sequences generally encode peptides with a specific amino acid sequence or motif which can be recognised by cellular export machinery. In the case of the hlyCABD operon, HlyAs translocation peptide is recognised by the HlyB and HlyD structural proteins which engage with TolC to create a trans-periplasm channel, thus enabling the translocation of HlyAs (and any cargo to which it may be fused) through the inner and outer membrane of the live attenuated Gram-negative bacterium.

[0064] In a further embodiment, the hlyCABD operon may further comprise a hlyC gene. HlyC is relevant for the activation of HlyA. However, according to the literature, a region on the 3’ end of HlyC can influence secretion yields, and therefore in another embodiment, the hlyCABD operon may further comprise a functional fragment or portion of the hlyC gene. In one embodiment, the hlyC gene, or functional fragment thereof, is positioned upstream of the heterologous polynucleotide which encodes a cargo molecule upstream of a hlyAs translocation sequence. In another embodiment, the hlyC gene, or functional fragment thereof, is positioned downstream of the independently controlled promoter. In yet another embodiment, the hlyC gene, or functional fragment thereof, is positioned upstream of the heterologous polynucleotide which encodes the one or more cargo molecule upstream of a hlyAs translocation sequence and downstream of the independently controlled promoter.

[0065] The second segment (the ‘structural region’) is envisaged to comprise the hly genes involved in secretion.

[0066] In the context of the hlyCABD operon, the hly genes involved in secretion are hlyB and hlyD. Accordingly, in one embodiment, the second segment comprises a hlyB gene and a hlyD gene. The hlyB and hlyD genes are also referred to as the T 1 SS structural genes. In one embodiment, the hlyB gene is upstream of the hlyD gene. In another embodiment, the hlyB gene is downstream of the independently controlled promoter. In yet another embodiment, the hlyB gene is upstream of the hlyD gene and downstream of the independently controlled promoter.

[0067] Table 1. Sequences used to build expression plasmids involving the hly genes, including conserved regions for amplification of DNA blocks and Bsal-dependent cleavage sites for Golden Gate Assembly.

[0068] The inventors of the present invention have surprisingly found that splitting the operon into two segments resulted in functional translocation, which was increased upon increasing the transcription levels of both segments. The present inventors have also identified the optimal combination of promoters to be operably linked to each segment in order to maximise cargo export.

[0069] The independently controlled promoters may be a constitutive promoter, a vacuole inducible promoter, an inducible promoter during invasion and / or a hybrid promoter. For example, the promoter may be selected from any one of the promoters provided in SEQ ID NOs: 8-45. In a preferred embodiment, the independently controlled promoters controlling expression of the first and second segments are strong promoters. For example, the first independently controlled promoter may be a strong constitutive promoter, or a strong vacuole induced promoter. The skilled person will be familiar with the term “strong promoter” as a widely used term in the art. As used herein, the term “constitutive promoter” has its usual meaning in the art. For the avoidance of doubt, constitutive promoters are active in the cell under all circumstances, and allow for continual transcription of its associated gene. Constitutive promoters differ in strength, and may be weak, medium or strong constitutive promoters. For example, J23119 is a strong constitutive promoter, whereas proB is a medium to weak constitutive promoter. As used herein, the term “vacuole-induced promoter” has its usual meaning in the art. For the avoidance of doubt, vacuole-induced promoters are promoters which initiate the transcription of particular genes when the cell undergoes conditions that induce vacuole formation. Vacuole-induced promoters vary in strength. Examples of strong vacuole-induced promoters include ssaG, sseJ, pipB and sseA.

[0070] As such, in one embodiment, the first segment is operably linked to its own independently controlled promoter, wherein the first independently controlled promoter is any of J23119 or sseA, and the second segment is operably linked to a second independently controlled promoter, wherein the second independently controlled promoter is any of ssaG, sseJ or sseA, Preferably, the first independently controlled promoter is J23119 and the second independently controlled promoter is any of ssaG, sseJ or sseA. More preferably, the first independently controlled promoter is J23119, and the second independently controlled promoter is ssaG. In an alternative embodiment, the first independently controlled promoter is sseA and the second the independently controlled promoter is any of: J23119, ssaG, sseA or sseJ. More preferably, the first independently controlled promoter is sseA and the second independently controlled promoter is ssaG.

[0071] The preferred combination of promoters for the first independently controlled promoter (P1) and second independently controlled promoter (P2) is as follows:

[0072] Table 2. Combination of promoters within modified operon.

[0073] The bacterium of the present invention is a Gram-negative bacterium. Examples of Gram-negative bacteria for use in the present invention include, but are not limited to, Escherichia coli, Salmonella, Shigella, Pseudomonas, Moraxella, Helicobacter, Stenotrophomonas, Bdellovibrio, Legionella, Chlamydia and Yersinia. As the skilled person would be aware, Gram-negative bacteria can be identified by the colour they turn after a chemical process known as Gram staining. Gram-negative bacteria stain red when this process is used. In the context of Salmonella, only one viable strategy has been reported to enforce Salmonella release from the SCV (Sa / mone / / a-containing vacuole), which relies on the deletion of the gene sifA, involved in vacuole maturation and which requires a functional SPI-2. Therefore, there is a need to develop alternative strategies that warrant bacterial access into the cytosol and that are compatible with SPI-2-deficient mutants (attenuated strains). Furthermore, Salmonella are becoming increasingly more relevant from a therapeutic perspective and thus need to have further strategies to export bacteria from vacuole so that they can deliver therapeutic payload into host cells. As such, in one embodiment, the live attenuated Gram-negative bacterium is a Salmonella species. Examples of Salmonella species for use in the present invention are Salmonella enterica and Salmonella bongori. Salmonella enterica can be further sub-divided into different serotypes or serovars. Examples of said serotypes or serovars for use in the present invention are Salmonella enterica Typhi, Salmonella enterica Paratyphi A, Salmonella enterica Paratyphi B, Salmonella enterica Paratyphi C, Salmonella enterica Typhimurium and Salmonella enterica Enteritidis. In a preferred embodiment, the live attenuated Gram-negative bacterium is Salmonella enterica Typhi or Salmonella enterica Typhimurium.

[0074] The live attenuated Gram-negative bacterium may be a genetically engineered nonnatural bacterium.

[0075] As would be understood by a person of skill in the art, genes may be mutated by a number of well-known methods in the art, such as homologous recombination with recombinant plasmids targeted to the gene of interest, in which case an engineered gene with homology to the target gene is incorporated into an appropriate nucleic acid vector (such as a plasmid or a bacteriophage), which is transfected into the target cell. The homologous engineered gene is then recombined with the natural gene to either replace or mutate it to achieve the desired inactivating mutation. Such modification may be in the coding part of the gene or any regulatory portions, such as the promoter region. As would be understood by a person of skill in the art, any appropriate genetic modification technique may be used to mutate the genes of interest, such as the CRISPR / Cas system, e.g. CRISPR / Cas 9.

[0076] Thus, numerous methods and techniques for genetically engineering bacterial strains will be well known to the person skilled in the art. These techniques include those required for introducing heterologous genes into the bacteria either via chromosomal integration or via the introduction of a stable autosomal self-replicating genetic element. Exemplary methods for genetically modifying (also referred to as "transforming" or “engineering”) bacterial cells include bacteriophage infection, transduction, conjugation, lipofection or electroporation. A general discussion on these and other methods in molecular and cellular biochemistry can be found in such standard textbooks as Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., HaRBor Laboratory Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley & Sons 1999 ); Protein Methods (Bollag et al., John Wiley & Sons 1996); which are hereby incorporated by reference.

[0077] In one embodiment, the genetically engineered non-natural bacterium may be derived from a Salmonella species that may comprise an attenuating mutation in a Salmonella Pathogenicity Island 2 (SPI-2) gene and / or an attenuating mutation in a second gene. Suitable genes and details of such a live attenuated bacterium is as described in WO 2000 / 68261 , which is hereby incorporated by reference in its entirety.

[0078] In one embodiment, the SPI-2 gene is an ssa gene. For example, the invention includes an attenuating mutation in one or more of ssa / ssaJ, ssaU, ssaK, ssaL, ssaM, ssaO, ssaP, ssaQ, ssaR, ssaS, ssaT, ssaD, ssaE, ssaG, ssal, ssaC and ssaH. Preferably, the attenuating mutation is in the ssaV or ssa J gene. Even more preferably, the attenuating mutation is in the ssaV gene.

[0079] The genetically engineered non-natural bacterium may also comprise an attenuating mutation in a second gene, which may or may not be in the SPI-2 region. The mutation may be outside of the SPI-2 region and involved in the biosynthesis of aromatic compound. For examples, the invention includes an attenuating mutation in an aro gene. In a preferred embodiment, the aro gene is aroA or aroC. Even more preferably, the aro gene is aroC.

[0080] The genetically engineered non-natural bacterium may further comprise one or more gene cassettes. Such gene cassettes may be used to deliver additional prokaryotic molecules to support the function of the genetically engineered non-natural bacterium to condition the immune system, or to support the activity of the additional dementia therapy. The skilled person will recognise that the supporting molecule delivered in this manner may be dependent on the dementia therapy to be administered.

[0081] In yet another embodiment, the genetically engineered non-natural bacterium may be derived from a Salmonella species and may comprise inactivating mutations in one or more genes selected from pltA, pltB, cdtB and ttsA and further comprises attenuating mutations in one or more genes selected from aroA and / or aroC and / or ssaV. Details of said genes and mutations are as described in WO 2019 / 110819, which is hereby incorporated by reference in its entirety.

[0082] It is envisaged that inactivating mutations (e.g. deletions) in the genes pltA, pltB and cdtB will prevent the Salmonella species from producing the typhoid toxin and that inactivating mutations (e.g. deletions) in ttsA will prevent the Salmonella species from secreting the typhoid toxin.

[0083] In an embodiment, the genetically engineered non-natural bacterium may be derived from Salmonella enterica serovar Typhi and comprise a modification in which the lipopolysaccharide 02 O-antigens of Salmonella enterica serovar Paratyphi A are expressed. In yet another preferred embodiment, the genetically engineered nonnatural bacterium is derived from Salmonella enterica serovar Typhi, wherein said strain comprises a modification in which the flagella proteins of Salmonella enterica serovar Paratyphi A are expressed. In some instances, the genetically engineered non-natural bacterium may be derived from Salmonella enterica serovar Typhi and comprise a modification in which both the lipopolysaccharide 02 O-antigens and the flagella proteins of Salmonella enterica serovar Paratyphi A are expressed. Details of such modifications can be found in W02020 / 157203. Such strains are considered to be non-recombinant in the context of the present invention due to the term “nonrecombinant” referring to a bacteria that does not contain eukaryotic genes or gene fragments, or bacteria that acts as a “carrier” strain for the purpose of the delivery of a therapeutic molecules, or delivery of eukaryotic heterologous DNA that encodes for a therapeutic molecule.

[0084] Where the methods herein described involve the use of a plasmid, said plasmid will ideally have an origin of replication selected from pMB1 , ColEI, p15A, pSC101 and RK2. The plasmid may contain an antibiotic resistance gene selected from - lactamase (b / a), kanamycin phosphotransferase ( an), tetracycline efflux protein (tetA) or chloramphenicol acetyltransferase (cat). Ideally the antibiotic resistance gene will be excised prior to or shortly after transformation into the live bacterial vector strain, for example by a mechanism such as ‘X-mark’ (Cranenburgh & Leckenby 2012, WO2012 / 001352). A plasmid maintenance system may be required to prevent plasmid loss. These may include mechanisms to place a native chromosomal gene under a heterologous promoter such as the ‘Operator-Repressor Titration for Vaccines’ (ORT-VAC; Garmory et al. 2005, Infect. Immun. 73: 2005-2011) or ‘oriSELECT’ (Cranenburgh 2005, WO 2005 / 052167) systems, neither of which require an additional selectable marker gene to be present on the plasmid. Alternatively, a selectable marker gene will be used that is not an antibiotic resistance gene, such as a gene to complement a host cell mutation (Degryse 1991 , Mol. Gen. Genet. 227: 49- 51).

[0085] It is envisaged that the present invention may also include the genetically engineered non-natural bacterium, according to above, wherein said strain may have its native fliC gene replaced with the fliC gene of Salmonella enterica serovar Paratyphi A, such that the conferred serotype is altered from an Hd serotype to a Ha serotype, where ‘serotype’ refers to a distinct variation within the bacterial species. Details of such a modification can be found in W02020 / 157203.

[0086] An additional embodiment of the present invention is the genetically engineered nonnatural bacterium described above wherein the strain may be further modified to contain a functional fepE gene, such that long O-antigen chains are generated, preferably wherein the O-antigen chains are 100 repeated units of the trisaccharide backbone in length. Details of such a modification can be found in W02020 / 157203.

[0087] The fepE gene encodes the length regulator of very long O-antigen chains, wherein ‘very long’ is taken to mean more than 100 repeated units of the trisaccharide backbone. Salmonella enterica serovar Typhi does not possess these long O-antigen chains due to a mutation introducing a stop codon into the gene. Salmonella enterica serovar Typhi may be manipulated into expressing these long O-antigen chains via a number of methods; the natural promoter of fepE may be replaced with an alternative promoter, for example ParaBAD, the chromosomal mutation of fepE in Salmonella enterica serovar Typhi may be repaired or a functional copy of fepE may be inserted elsewhere in the Salmonella enterica serovar Typhi chromosome. An in v / vo-induced promoter or a constitutive promoter may be utilised, examples of such promoters include P page, P nirB, P ssaG, P sifA, P sifB, P sseA, P sseG P sseJ, Plac, Ptac, Ptrc and lambda PL / PR. Similar modified sequences may include having at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the wild-type sequence of any of Ppagc, PmrB, P ssaG, P sifA, P sifB, P sseA, P sseG, P sseJ and lambda PL / PR. Preferably, the introduction of these long O-antigen chains may be beneficial in inducing an LPS-specific immune response. There may be an additional benefit where the LPS is naturally very long such as from expression of fepE.

[0088] It is further envisaged that the genetically engineered non-natural bacterium described above may be modified to constitutively express gtrC or to express gtrC in trans. Details of such a modification can be found in W02020 / 157203.

[0089] It is further envisaged that the genetically engineered non-natural bacterium described above may be further modified to contain an additional copy of the tviA gene under the control of a phagosomally induced promoter. Details of such a modification can be found in W02020 / 157203.

[0090] The live attenuated Gram-negative bacterium of the present invention may be selected from the group comprising Ty21a, CVD 908-htrA, CVD 909, Ty800, M01ZH09 (ZH9), x9633, x9640, x8444, ZH9PA, x639, DTY88, MD58, WT05, ZH26, SL7838, SL7207, VNP20009, A1-R or any combinations thereof. Preferably, the bacteria herein disclosed is a non-recombinant strain, for example, Ty21a, CVD 908- htrA, CVD 909, Ty800, M01ZH09, x9633, x9640, x8444, DTY88, MD58, WT05, ZH26, SL7838, SL7207, VNP20009 or A1-R. These live attenuated strains are readily available and would be easily identifiable and commonly used by those in the art. For example, EP 2 801 364 A1 discloses Ty21a, CVD 908-htrA, CVD 909, Ty800, M01ZH09, X9633, X9640, and x8444. In addition, EP 3 917 565 discloses in detail ZH9 strains and derivatives thereof, including ZH9PA. Further references to these strains can be found in the literature, in particular in Petrovska 2004, Hindle 2002, Lehouritis 2017, and Kimura 2010. Also intended to be included are any derivatives or variants of the strains, including genetically engineered or genetically modified strains. In another embodiment, the bacteria herein disclosed is a strain that has been modified to contain prokaryotic heterologous DNA, for example, ZH9PA. In addition to the aforementioned strains, it is envisaged that any attenuated, non- pathogenic, Salmonella enterica serovar Typhi orTyphimurium strain may be used as herein disclosed, i.e. as a conditioning agent, resulting in a more effective immune response being mounted in a subject. The live attenuated Gram-negative bacterium herein disclosed may be used as a delivery vehicle for one or more cargo molecules. The cargo molecule may be an RNA molecule, peptide, protein or functional fragment thereof.

[0091] As used herein, the terms “RNA” and “ribonucleic acid” are used interchangeably, and refer to nucleic acids composed of uracil, adenine, guanine, and cytosine ribonucleic acid bases. These terms and concepts will be well known to those in the art. Types of RNA molecules include, for example, messenger RNA (mRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), transfer RNA (tRNA), self-amplifying RNA (saRNA) and ribosomal RNA (rRNA). Accordingly, the RNA cargo molecule may be an mRNA molecule. As used herein, the terms “mRNA” and “messenger RNA” are used interchangeably and refer to a single-stranded RNA molecule involved in protein synthesis. Eukaryotic mRNA molecules are transcribed from DNA in the nucleus of a eukaryotic cell, and subsequently exported from the nucleus into the cytoplasm of the eukaryotic cell, where translation of the mRNA molecule into proteins takes place. Bacterial mRNA molecules are transcribed from DNA that is non-compartmentalised and translated in the cytosol coupled to transcription. These terms and concepts will be well known to those in the art. RNA molecules are transcribed and translated within the bacterium itself. For example, the live attenuated Gram-negative bacterium may encode up to 10 different heterologous mRNA molecules, for example, 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 different heterologous mRNA molecules. A cargo mRNA molecule itself may encode a peptide and / or protein, whereby the peptide and / or protein may be a therapeutic peptide and / or therapeutic protein.

[0092] In a preferred embodiment, the RNA molecule, peptide, protein or functional fragment thereof is a therapeutic RNA molecule, a therapeutic peptide, a therapeutic protein, or therapeutic functional fragment thereof. The therapeutic peptide / protein / functional fragment thereof may be a cytokine, a chemokine, an antibody or a functional fragment thereof, a cytotoxic agent, a cancer agent or any combination thereof. The invention herein disclosed provides a live attenuated Gram-negative bacterium in which the cargo molecule is expressed within the bacterium itself prior to export. For example, the live attenuated Gram-negative bacterium may encode up to 10 different cargo (e.g. protein) molecules, for example, 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 different cargo (e.g. protein) molecules.

[0093] As such, the live attenuated Gram-negative bacterium disclosed herein may be for therapeutic use. For example, the live attenuated Gram-negative bacteria may be used in the treatment, reduction, inhibition, prevention, prevention of recurrence, or control of a disease. In a preferred embodiment the disease is a human disease. In a more preferred embodiment, the disease may be a neoplastic disease, an infectious disease, a cardiovascular disease, a neurodegenerative disease, a gastrointestinal disease, a respiratory disease, a renal disease, a liver disease, an autoimmune disease, an inflammatory disease or a genetic disorder. In a preferred embodiment, the live attenuated Gram-negative bacterium is for use in the treatment, reduction, inhibition, prevention, prevention of recurrence, or control of a neoplastic disease or an infectious disease.

[0094] Where the disease to be treated is a neoplastic disease, the neoplastic disease may be associated with a solid tumour or haematological tumour. In particular aspects, the neoplastic disease is associated with a cancer selected from prostate cancer, oesophageal cancer, liver cancer, renal cancer, lung cancer, breast cancer, colorectal cancer, bladder cancer, breast cancer, pancreatic cancer, brain cancer, mesothelioma, hepatocellular cancer, lymphoma, leukaemia, gastric cancer, endometrial cancer, vulvar cancer, vaginal cancer, cervical cancer, ovarian cancer, thyroid cancer, melanoma, carcinoma, head and neck cancer, skin cancer or sarcoma.

[0095] Neoplasia, tumours, and cancers include benign, malignant, metastatic and non- metastatic types, and include any stage (I, II, III, IV or V) or grade (G1 , G2, G3, etc.) of neoplasia, tumour, or cancer, or a neoplasia, tumour, cancer or metastasis that is progressing, worsening, stabilized or in remission. Cancers that may be treated according to the invention include but are not limited to cells or neoplasms of the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestines, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, testis, tongue, or uterus. In addition, the cancer may specifically be of the following histological type, though it is not limited to the following: neoplasm, malignant; carcinoma; undifferentiated; giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyp; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumour, malignant; bronchiolo-alveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; acidophil carcinoma; oxyphilic adenocarcinoma; basophil carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; nonencapsulating sclerosing carcinoma; adrenal cortical carcinoma; endometroid carcinoma; skin appendage carcinoma; apocrine adenocarcinoma; sebaceous adenocarcinoma; ceruminous adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; infiltrating duct carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; Paget's disease, mammary; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma with squamous metaplasia; thymoma, malignant; ovarian stromal tumour, malignant; thecoma, malignant; granulosa cell tumour, malignant; androblastoma, malignant; Sertoli cell carcinoma; Leydig cell tumour, malignant; lipid cell tumour, malignant; paraganglioma, malignant; extramammary paraganglioma, malignant; pheochromocytoma; glomangiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malignant melanoma in giant pigmented nevus; epithelioid cell melanoma; blue nevus, malignant; sarcoma; fibrosarcoma; fibrous histiocytoma, malignant; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; mixed tumour; Mullerian mixed tumour; nephroblastoma; hepatoblastoma; carcinosarcoma; mesenchymoma, malignant; Brenner tumour, malignant; phyllodes tumour, malignant; synovial sarcoma; mesothelioma, malignant; dysgerminoma; embryonal carcinoma; teratoma, malignant; struma ovarii, malignant; choriocarcinoma; mesonephroma, malignant; hemangiosarcoma; hemangioendothelioma, malignant; Kaposi's sarcoma; hemangiopericytoma, malignant; lymphangiosarcoma; osteosarcoma; juxtacortical osteosarcoma; chondrosarcoma; chondroblastoma, malignant; mesenchymal chondrosarcoma; giant cell tumour of bone; Ewing's sarcoma; odontogenic tumour, malignant; ameloblastic odontosarcoma; ameloblastoma, malignant; ameloblastic fibrosarcoma; pinealoma, malignant; chordoma; glioma, malignant; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroblastoma; primitive neuroectodermal; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumour; meningioma, malignant; neurofibrosarcoma; neurilemmoma, malignant; granular cell tumour, malignant; malignant lymphoma; Hodgkin's disease; Hodgkin's; paragranuloma; malignant lymphoma, small lymphocytic; malignant lymphoma, large cell, diffuse; malignant lymphoma, follicular; mycosis fungoides; other specified non-Hodgkin's lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid sarcoma; and hairy cell leukemia. Preferably, the neoplastic disease may be tumours associated with a cancer selected from prostate cancer, liver cancer, renal cancer, lung cancer, breast cancer, colorectal cancer, pancreatic cancer, brain cancer, hepatocellular cancer, lymphoma, leukaemia, gastric cancer, endometrial cancer, vulvar cancer, vaginal cancer, cervical cancer, ovarian cancer, thyroid cancer, melanoma, head and neck cancer, skin cancer and soft tissue sarcoma and / or other forms of carcinoma. The tumour may be metastatic or a malignant tumour.

[0096] Preferably, the neoplastic disease is associated with a cancer selected from bladder cancer, lung cancer, mesothelioma, hepatocellular cancer, melanoma, oesophageal cancer, gastric cancer, ovarian cancer, colorectal cancer, head and neck cancer, prostate cancer, endometrial cancer, cervical cancer or breast cancer.

[0097] The amount of the live attenuated Gram-negative bacterium administered to a subject in need thereof is sufficient to generate the desired result. For example, in the context of the live attenuated Gram-negative bacterium acting as a delivery vehicle, the amount of live attenuated Gram-negative bacterium administered will be sufficient to deliver the therapeutic molecule to the desired location in high enough concentrations to have an effect. Alternatively, in the context of the live attenuated Gram-negative bacterium acting as a “priming” agent, the amount administered will be sufficient to elicit an immune response in a subject. The skilled person will readily understand that the precise amount to be administered will be dependent on a number of factors, for example, the disease to be treated and the medical history of the subject to be treated.

[0098] The live attenuated Gram-negative bacterium may be administered at a dose of between 105and 1012CFU, where CFU is a colony-forming unit. For example, suitable doses may be between 105and 106CFU, 105and 107CFU, 105and 108CFU, 105and 109CFU, 105and 101° CFU, 105and 1011CFU, 106and 107CFU, 106and 108CFU, 106and 109CFU, 106, and 101° CFU, 106and 1011CFU, 106and 1012CFU, 107and 108CFU, 107and 109CFU, 107and 101° CFU, 107and 1011CFU, 107and 1012CFU, 108and 109CFU, 108and 101° CFU, 108and 1011CFU, 108and 1012CFU, 109and 101° CFU, 109and 1011CFU, 109and 1012CFU, 101° and 1011CFU, 101° and 1012CFU, or 1011and 1012CFU. The live attenuated Gram-negative bacterium may be administered in a single dose or in multiple doses. The specific number of doses to be administered are understood to be dependent on the specific cargo molecule to be delivered, as well as the specific indication to be treated.

[0099] The live attenuated Gram-negative bacteria may be administered intratumourally, peritoumorally, intravenously, intraperitoneally, subcutaneously, intradermally, or orally administered. In a preferred embodiment, the live attenuated Gram-negative bacterium is formulated for intratumourally administration. In another preferred embodiment, the live attenuated Gram-negative bacterium is formulated for oral administration. However, it is also contemplated that other methods of administration may be used in some cases. Therefore, in certain instances the live attenuated Gram-negative bacterium of the present invention may be administered by injection, infusion, continuous infusion, intradermally, intraarterially, intralesionally, intravaginally, intrarectally, intramuscularly, subcutaneously, subconjunctival, mucosally, intrapericardially, intraumbilically, intraocularally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intratracheally, intranasally, via a catheter, via a lavage, or by other method or any combination of the forgoing as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990).

[0100] In a fourth aspect, a vaccine composition comprising a live attenuated Gramnegative bacterium, wherein the live attenuated Gram-negative bacterium comprises a heterologous polynucleotide encoding a prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein said heterologous polynucleotide encoding the prokaryotic disulfide bond isomerase is operably linked to a promoter is disclosed.

[0101] In a fifth aspect, a vaccine composition comprising a live attenuated Gramnegative bacterium comprising an endogenous prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein the endogenous prokaryotic disulfide bond is upregulated compared to its basal level expression is disclosed.

[0102] In an embodiment, the vaccine composition of the present invention may be for therapeutic use. For example, the live attenuated Gram-negative bacterium may be for use in the treatment, reduction, inhibition, prevention, prevention of recurrence, or control of a disease.

[0103] It is particularly envisaged that the vaccine composition herein disclosed may be used in the treatment, reduction, inhibition, prevention of recurrence or control of an infectious disease, for example, a disease caused by a bacteria, a virus, a parasite or a fungi. In such instances, the heterologous polynucleotide of the present invention may encode for an antigen of the causative agent of the specific infectious disease in order to produce an immune response in the host. Alternatively, it is envisaged that the vaccine composition herein disclosed may be used as a cancer vaccine. In such instances the vaccine composition comprises Gram-negative bacteria comprising a heterologous polynucleotide encoding a cancer antigen that is capable of producing an immune response in the host. It is therefore appreciated that a wide-range of cancers and infectious diseases can be prevented / treated using the bacterium and methods herein disclosed. In other instances, the heterologous polynucleotide may encode an siRNA or shRNA molecule, which is designed to enhance immune anti-infectious function or tissue anti-infectious defences.

[0104] The vaccine composition of the present invention may further comprise a pharmaceutically acceptable adjuvant, carrier or excipient.

[0105] As used herein, "pharmaceutically acceptable camer / adjuvant / diluent / excipient" includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavouring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289- 1329). Examples include, but are not limited to disodium hydrogen phosphate, soya peptone, potassium dihydrogen phosphate, ammonium chloride, sodium chloride, magnesium sulphate, calcium chloride, sucrose, borate buffer, sterile saline solution (0.9 % NaCI) and sterile water.

[0106] Suitable aqueous and non-aqueous carriers that may be employed in the vaccine compositions of the invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.

[0107] The vaccine compositions herein disclosed may further contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of presence of unwanted microorganisms may be ensured both by sterilization procedures, supra, and by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents that delay absorption such as aluminium monostearate and gelatin. The vaccine composition may also optionally include additional therapeutic agents, known to be efficacious in, for example, infectious disease or neoplastic disease. Accordingly, the vaccine composition herein disclosed may also comprise antiretroviral drugs, antibiotics, antifungals, antiparasitics and anticancer agents.

[0108] The vaccine composition may also comprise additional components intended for enhancing an immune response in a subject following administration. Examples of such additional components include but are not limited to; aluminium salts such as aluminium hydroxide, aluminium oxide and aluminium phosphate, oil-based adjuvants such as Freund's Complete Adjuvant and Freund's Incomplete Adjuvant, mycolate-based adjuvants (e.g., trehalose dimycolate), bacterial lipopolysaccharide (LPS), peptidoglycans (e.g., mureins, mucopeptides, or glycoproteins such as N-Opaca, muramyl dipeptide [MDP], or MDP analogs), proteoglycans (e.g., extracted from Klebsiella pneumoniae), streptococcal preparations (e.g., OK432), muramyldipeptides, Immune Stimulating Complexes (the "Iscoms" as disclosed in EP 109942, EP 180564 and EP 231 039), saponins, DEAE-dextran, neutral oils (such as miglyol), vegetable oils (such as arachis oil), liposomes, polyols, the Ribi adjuvant system (see, for instance, GB-A-2 189 141 ), vitamin E, Carbopol, interferons (e.g., IFN-alpha, IFN-gamma, or IFN-beta) or interleukins, particularly those that stimulate cell mediated immunity (e.g., IL-2, IL- 3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-1 1 , IL-12, IL-13, IL-14, IL-15, IL-16 and IL-17).

[0109] The live attenuated Gram-negative bacterium of the vaccine composition herein disclosed may include any one of, or any combination of the features of the live attenuated Gram-negative bacterium herein disclosed.

[0110] In a sixth aspect, a method of treating, preventing, inhibiting, preventing recurrence or controlling a disease in a subject, wherein the method comprises administering to a subject a live attenuated Gram-negative bacterium, wherein the live attenuated Gram-negative bacterium comprises a heterologous polynucleotide encoding a prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein said heterologous polynucleotide encoding the prokaryotic disulfide bond isomerase is operably linked to a promoter is disclosed.

[0111] In a seventh aspect, a method of treating, preventing, inhibiting, preventing recurrence or controlling a disease in a subject, wherein the method comprises administering to a subject a live attenuated Gram-negative bacterium, wherein the live attenuated Gram-negative bacterium comprises an endogenous prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein said endogenous prokaryotic disulfide bond is upregulated compared to its basal level expression is disclosed.

[0112] The method of treating, preventing, inhibiting, preventing recurrence or controlling a disease in a subject of the sixth or seventh aspects may comprise one or more of the aforementioned embodiments in respect to any preceding aspect.

[0113] In an eighth aspect, a method of delivering a therapeutic molecule to the tumour microenvironment in a subject suffering from a tumour, said method comprising the steps of: i) modifying a live attenuated Gram-negative bacterium, said live attenuated Gram-negative comprising a heterologous polynucleotide encoding a prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein said heterologous polynucleotide encoding the prokaryotic disulfide bond isomerase is operably linked to a promoter, and ii) administering said modified Gram-negative bacterium to the subject in need thereof is disclosed.

[0114] In an ninth aspect, a method of delivering a therapeutic molecule to the tumour microenvironment in a subject suffering from a tumour, said method comprising the steps of: i) modifying a live attenuated Gram-negative bacterium, said live attenuated Gram-negative comprising an endogenous prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein said endogenous prokaryotic disulfide bond isomerase is upregulated compared to its basal level expression, and ii) administering said modified Gram-negative bacterium to the subject in need thereof is disclosed.

[0115] As such, in one embodiment, the live attenuated Gram-negative bacterium of the present invention is envisaged to allow for the delivery of a therapeutically relevant cargo molecule to the TME, including the interstitial space between eukaryotic cells, in a subject suffering from a tumour, whilst also benefiting from enhanced vacuole escape. The therapeutically relevant cargo molecule may be delivered inside cells or outside of cells, such as the interstitial space between eukaryotic cells. As used herein, the terms “interstitial compartment”, “interstitial environment”, “interstitial space”, “tissue space” or “interstitial surroundings” are used interchangeably and refer to the space surrounding tissue cells (i.e., the space outside blood and lymph vessels and parenchymal cells), also known as the tissue microenvironment. The interstitial space consists of two major phases: interstitial fluid which provides the immediate microenvironment between eukaryotic cells, and the structural molecules comprising the extracellular matrix. The eukaryotic cells may be mammalian cells. In a preferred embodiment, the eukaryotic cells are human cells. Where the eukaryotic cell is a human cell, the target cell may be a cancerous human cell or a non-cancerous human cell.

[0116] The tissue microenvironment is relevant to solid and haematological cancers. As used herein, the terms “tumour microenvironment” or “TME” are used interchangeably and refer to the local environment surrounding a tumour, tumour interstitial space and interstitial fluid. The TME is created by the tumour and is dominated by tumour-induced interactions but may also comprise immune effector cells which have been recruited to the tumour, fibroblasts, signalling molecules, and blood vessels. Therefore, it is envisaged that the live attenuated Gramnegative bacteria can be modified to deliver therapeutically relevant proteins in the interstitial space of the TME in a subject suffering from a tumour.

[0117] The method of delivering a therapeutic molecule to the tumour microenvironment in a subject suffering from a tumour of the eighth or ninth aspect may comprise one or more of the aforementioned embodiments in respect to any preceding aspect.

[0118] In a tenth aspect, the use of a live attenuated Gram-negative bacterium comprising a heterologous polynucleotide encoding a prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein said heterologous polynucleotide encoding the prokaryotic disulfide bond isomerase is operably linked to a promoter, in the manufacture of a medicament for use in a neoplastic disease, an infectious disease, a cardiovascular disease, a neurodegenerative disease, a gastrointestinal disease, a respiratory disease, a renal disease, a liver disease, an autoimmune disease, an inflammatory disease or a genetic disorder is disclosed.

[0119] In a eleventh aspect, the use of a live attenuated Gram-negative bacterium comprising an endogenous prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein said endogenous prokaryotic disulfide bond isomerase is upregulated compared to its basal level expression, in the manufacture of a medicament for use in a neoplastic disease, an infectious disease, a cardiovascular disease, a neurodegenerative disease, a gastrointestinal disease, a respiratory disease, a renal disease, a liver disease, an autoimmune disease, an inflammatory disease or a genetic disorder is disclosed.

[0120] The live attenuated Gram-negative bacterium of the uses of the tenth or eleventh aspect herein disclosed may include any one of, or any combination of the features of the live attenuated Gram-negative bacterium herein disclosed.

[0121] The inventors of the present invention have surprisingly found that the live attenuated Gram-negative bacterium herein disclosed results in a modified bacterium with superior vacuole escape properties, and as such is particularly useful in the context of a bacterial delivery system.

[0122] The inventors of the present invention have determined that Gram-negative bacteria modified to express a prokaryotic disulfide bond isomerase within the cytosol, as opposed to in the periplasm, results in the bacteria having increased invasiveness and thus increased propensity for vacuole escape. After constructing a plasmid encoding the isomerase, said plasmid was transformed into the desired bacterial cell for expression of the isomerase. The resulting bacteria were then tested for their invasiveness / capacity for vacuole escape.

[0123] Isomerases function based on redox reactions, such as thiol-disulfide exchange reactions. The principles of redox reactions will be highly familiar to those in the art and essentially depend on the transfer of electrons, where a loss of electrons results in oxidation of a species and gaining of electrons results in reduction of a species. The thiol-disulfide exchange reaction involves a transfer of electrons from sulphur atoms in cysteine residues in the substrate to thiols in cysteines residues in the isomerase. The electron transfer results in the reduction of the substrate cysteines and the oxidation of the isomerase cysteines. Therefore, it can be seen that the findings presented herein are applicable to various isomerases, in particular prokaryotic disulfide bond isomerases, such as those in the Dsb family. For example, the catalytic cysteine residues of isomerases are often highly conserved (Hatahet et al6).

[0124] Further, it is to be expected that the presently claimed invention is fully functional in any Gram-negative bacteria since expression of the isomerase is carried out in the cytosol, i.e., the cellular space encapsulated by the inner and outer membranes common to all Gram-negative bacteria.

[0125] The invention is further described with reference to the following non-limiting examples: EXAMPLES

[0126] Enhanced vacuole escape in Salmonella ZH9 strains comprising DsbC

[0127] Construction of a mdsbC expression plasmid

[0128] A gene block encoding mDsbC was designed to contain appropriate Bbsl- cleavable overhangs compatible with assembly strategy and ordered as a gBIock from IDT. The gene block (30 fmol) was assembled into the codebase vector CB16C6 (C6, J23119) or CB16C4 (C4, proC) (15 fmol, p15A ori, carbenicilin- resistant, bla) via Bbsl-dependent Golden Gate Assembly (reaction volume, 5 pL) with the mixture DNA volume brought to 3 pL and topped up with 2 pL of NEB Bridge + Bsal (1 .667 pL NEB Bridge and 0.333 pL of Bsal). To ensure a successful reaction, the mixture samples were mixed properly, centrifuged, and cycled at 37°C, 4 min and 16°C, 2 min for 30 cycles (~4h run). The resulting assemblies were transformed into DH10b (2 pL from the 5 pL reaction).

[0129] CCF4 vacuole escape assay

[0130] A cell-based assay based on the addition of the CCF4 reagent was developed to validate the vacuole escape nature of Salmonella ZH9 strains described immediately above (see Figure 1). CCF4 is a Forster Resonance Energy Transfer (FRET) substrate composed of a cephalosporin core linking 7-hydroxycummarine to fluorescein. After administration, the substrate accumulates within the cytosol of mammalian cells. Cleavage of the beta-lactam ring through a Beta-lactamase enzyme (provided by the bacterial strain) causes the split and release of fluorescein, shifting the emission wavelength from 520 nm to 447 nm after excitation with a 409 nm wavelength.

[0131] Bacterial invasion stocks were prepared by subculturing 1 :100 of a pre-culture of the desired Salmonella bacterial strain in 10 mL of Lysogeny Broth (Miller) supplemented with 100 pg / mL of Carbenicillin / Ampicillin, followed by growth at 37 °C and 250 rpm for approximately 3 h (OD6oo~0.8). Bacterial cells were spun down and resuspended in 1 mL of 10 % ice-cold glycerol. Stocks were aliquoted and flash-frozen, and stored at -80 °C until required.

[0132] In the CCF4 cell-based assay, 15,000 HeLa cells were seeded overnight in a black-walled 96 well plates. On day of invasion, bacterial invasion stocks were thawed and diluted in cell culture media to appropriate concentrations to give an MOI of 200. Bacterial dilutions were added to HeLa cells and incubated for 1 h at 37°C. Then, the HeLa cells were washed with PBS three times, and incubated overnight in cell culture media containing 50pg / mL Gentamicin. At 24 h post invasion, cell culture media was aspirated and replaced with 100pL fresh media. LiveBLAzer™ FRET-B / G Loading Kit with CCF4-AM (Thermofisher; K1095) was prepared with Solution D (Thermofisher; K1156) according to the manufacturer’s instructions. 20pL of CCF4 was then added to each well and incubated for 45 min at room temperature in the dark. The media was replaced with fresh media and imaged on a Leica DMi8 inverted microscope. Fluorescence images were captured using two filter set: Blue (excitation -405 nm; emission -450 nm) and Green (excitation -405 nm; emission -535). Image analysis was performed in CellProfiler. The number of blue cells (indicative of the presence of vacuole escape) and number of green cells (indicative of the absence of vacuole escape) were counted per well and the ratio of blue to green cells calculated to give a percentage of vacuole escape.

[0133] Invasiveness of the tested strains was evaluated in parallel with the CCF4 assay by performing replica invasion experiments on 15,000 HeLa cells previously seeded overnight, and as described above. At 24h post-invasion, cell culture media was aspirated from each well and the cells washed once with 200 pL / well of sterile DPBS. Cells were detached by removing the DPBS wash and replacing with 200 pL / well Trypsin EDTA, followed by incubation at 37 °C and 5% CO2 for 2-3 min. Medium was neutralised by adding 70|iL / well of 2%FBS / medium. Detached cells were transferred into a U-shaped 96-well plate and spun down at 300 xg for 5 min. Supernatant was removed and cells permeabilised and dyed for 30 min with CSA-I-FITC antibody. After wash, cells were resuspended in ice-cold FACS buffer and analysed by flow cytometry to detect FITC+. Non-invasive samples were discarded from further analysis by CCF4.

[0134] As can be seen from Figure 2A, Salmonella strains comprising DsbC are shown to have enhanced vacuole escape compared to CyDisCo (a mammalian-derived circuit that aims to allow formation of disulphide bonds in the cytosol). Without being bound by theory, it is believed that this enhanced vacuole escape is due to an increased invasiveness of the Salmonella strain (see Figure 2B).

[0135] The above finding is particularly surprising, with the Salmonella strains showing a significant enhanced propensity for vacuole escape even compared to the S. Typhimurium sifA mutant positive control (see Figure 3).

[0136] SEQUENCES FORMING PART OF THE DESCRIPTION

[0137] SEQ ID NO: 1 (DsbC) cagagtccccaggcattactagagtcacacttttatagcacagctaacaccacgtcgtc cctatctgctgccctaggtctatgagtggttgctggataactttacgggcatgcataag gctcgtatgatatattcaggcacagcacaacggtttccttttagctgtcaccggatgtg ctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaag gcacagcacaacggctcgtgagacgagctgtcaccggatgtgctttccggtctgatgag tccgtgaggacgaaacagcctctacaaataattttgtttaaattaaagaggagaaatag tccatggcgagatgacgcggcaattcaacaaacgttagccaaaatgggcatcaaaagca gcgatattcagcccgcgcctgtagctggcatgaaaacagttctgactaacagcggcgtg ttgtacatcaccgatgatggtaaacatatcattcaggggccaatgtatgacgttagtgg cacggctccggtcaatgtcaccaataagatgctgttaaagcagttgaatgcgcttgaaa aagagatgatcgtt tat aaagcgccgcaggaaaaacacgt cat caccgtgtt tact gat attacctgtggttactgccacaaactgcatgagcaaatggcagactacaacgcgctggg gatcaccgtgcgttatcttgctttcccgcgccaggggctggacagcgatgcagagaaag aaatgaaagctatctggtgtgcgaaagataaaaacaaagcgtttgatgatgtgatggca ggtaaaagcgtcgcaccagccagttgcgacgtggatattgccgaccattacgcacttgg cgtccagcttggcgttagcggtactccggcagttgtgctgagcaatggcacacttgttc cgggttaccagccgccgaaagagatgaaagaattcctcgacgaacaccaaaaaatgacc agcggtaaataagagc

[0138] SEQ ID NO: 2 (proC + DsbC) atgcctttaattaaggctccttagttatgcggtatatgccggtcagctagctactgggc cagagtccccaggcattactagagtcacacttttatagcacagctaacaccacgtcgtc cctatctgctgccctaggtctatgagtggttgctggataactttacgggcatgcataag gctcgtatgatatattcaggcacagcacaacggtttccttttagctgtcaccggatgtg ctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaag gcacagcacaacggctcgtgagacgagctgtcaccggatgtgctttccggtctgatgag tccgtgaggacgaaacagcctctacaaataattttgtttaaattaaagaggagaaatag tccatggcgagatgacgcggcaattcaacaaacgttagccaaaatgggcatcaaaagca gcgatattcagcccgcgcctgtagctggcatgaaaacagttctgactaacagcggcgtg ttgtacatcaccgatgatggtaaacatatcattcaggggccaatgtatgacgttagtgg cacggctccggtcaatgtcaccaataagatgctgttaaagcagttgaatgcgcttgaaa aagagatgatcgtt tat aaagcgccgcaggaaaaacacgt cat caccgtgtt tact gat attacctgtggttactgccacaaactgcatgagcaaatggcagactacaacgcgctggg gatcaccgtgcgttatcttgctttcccgcgccaggggctggacagcgatgcagagaaag aaatgaaagctatctggtgtgcgaaagataaaaacaaagcgtttgatgatgtgatggca ggtaaaagcgtcgcaccagccagttgcgacgtggatattgccgaccattacgcacttgg cgtccagcttggcgttagcggtactccggcagttgtgctgagcaatggcacacttgttc cgggttaccagccgccgaaagagatgaaagaattcctcgacgaacaccaaaaaatgacc agcggtaaataagagc

[0139] SEQ ID NO: 3 (J23119 (C6) + DsbC) atgcctttaattaaggctccttagttatgcggtatatgccggtcagctagctactgggc cagagtccccaggcattactagagtcacacttttatagcacagctaacaccacgtcgtc cctatctgctgccctaggtctatgagtggttgctggataacttgacagctagctcagtc ctaggtataatgctagcaggcacagcacaacggtttccttttagctgtcaccggatgtg ctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaag gcacagcacaacggctcgtgagacgagctgtcaccggatgtgctttccggtctgatgag tccgtgaggacgaaacagcctctacaaataattttgtttaaattaaagaggagaaatag tccatggcgagatgacgcggcaattcaacaaacgttagccaaaatgggcatcaaaagca gcgatattcagcccgcgcctgtagctggcatgaaaacagttctgactaacagcggcgtg ttgtacatcaccgatgatggtaaacatatcattcaggggccaatgtatgacgttagtgg cacggctccggtcaatgtcaccaataagatgctgttaaagcagttgaatgcgcttgaaa aagagatgatcgtt tat aaagcgccgcaggaaaaacacgt cat caccgtgtt tact gat attacctgtggttactgccacaaactgcatgagcaaatggcagactacaacgcgctggg gatcaccgtgcgttatcttgctttcccgcgccaggggctggacagcgatgcagagaaag aaatgaaagctatctggtgtgcgaaagataaaaacaaagcgtttgatgatgtgatggca ggtaaaagcgtcgcaccagccagttgcgacgtggatattgccgaccattacgcacttgg cgtccagcttggcgttagcggtactccggcagttgtgctgagcaatggcacacttgttc cgggttaccagccgccgaaagagatgaaagaattcctcgacgaacaccaaaaaatgacc agcggtaaataagagc

[0140] SEQ ID NO: 4 (hlyAs) gctaggagtcgtctggtgggtctctaaagacaacggtttccctctagaaataattttgt ttaactttaagaaggagatatattcatggctgtgagcggctggcgtctgttcaagaaaa ttagcgcgaccgtcttcggcggtggtggcagcgttagcaaaggcgaggcggttatcaag gagtttatgcgttttaaggttcacatggagggtagcatgaatggtcacgagttcgagat cgagggtgaaggcgagggtcgtccgtacgaaggcacccagaccgcgaagctgaaagtga ccaagggtggcccgctgccgttcagctgggacatcctgagcccgcagttcatgtatggc agccgtgcgtttaccaaacacccggcggacattccggattactataagcaaagcttccc ggaaggttttaaatgggagcgtgttatgaacttcgaagatggtggcgcggtgaccgtta cccaggacaccagcctggaggatggcaccctgatttacaaggtgaaactgcgtggcacc aactttccgccggatggtccggttatgcagaagaaaacgatgggttgggaagcgagcac cgagcgtctgtatccggaagatggcgtgctgaagggtgatatcaaaatggcgctgcgtc tgaaggacggtggccgttacctggcggattttaagaccacctataaagcgaagaaaccg gtgcaaatgccgggtgcgtacaacgttgaccgtaaactggatattaccagccacaacga ggattataccgtggttgagcaatatgagcgtagcgagggtcgccacagcaccggcggca tggacgaactgtataagggatccgaagacgcgagcacgcccgggggtgcgccggtgccg tatccggatccgctggaaccggccggggaaaattctcttgctaaaaatgtattatccgg tggaaaaggtaatgacaagttgtacggcagtgagggagcagacctgcttgatggcggag aagggaatgatcttctgaaaggtggatatggtaatgatatttatcgttatctttcagga tatggccatcatattattgacgatgaaggggggaaagacgataaactcagtttagctga tatagatttccgggacgttgcctttaagcgagaagggaatgacctcattatgtataaag ctgaaggtaatgttctttctattggccacaaaaatggtattacatttaaaaactggttt gaaaaagagtcagatgatctctctaatcatcagatagagcagatttttgataaagacgg cagggtaatcacaccagattctcttaaaaaagcatttgaatatcagcagagtaataaca aggtaagttatgtgtatggacatgatgcatcaacttatgggagccaggacaatcttaat ccattaattaatgaaatcagcaaaatcatttcagctgcaggtaacttcgatgttaagga ggaaagatctgccgcttctttattgcagttgtccggtaatgccagtgatttttcatatg gacggaactcaataactttgacagcatcagcataatatattagtaatgagacctatcgg gtggttgcgaag

[0141] SEQ ID NO: 5 (hlyCAs) gctaggagtcgtctggtgggtctctaaagatatttttgccacaatatttaatcatataa tttaagttgtagtgagtttattatgaatataaacaaaccattagagattcttgggcatg tatcctggctatgggccagttctccactacacagaaactggccagtatctttgtttgca ataaatgtattacccgcaatacaggctaaccaatatgttttattaacccgggatgatta ccctgtcgcgtattgtagttgggctaatttaagtttagaaaatgaaattaaatatctta atgatgttacctcattagttgcagaggactggacttcaggtgatcgtaaatggttcatt gactggattgctcctttcggggataacggtgccctgtacaaatatatgcgaaaaaaatt ccctgatgaactattcagagccatcagggtggatcccaaaactcatgttggtaaagtat cagaatttcatggaggtaaaattgataaacagttagcgaataaaatttttaaacaatat caccacgagttaataactgaagtaaaaagaaagtcagattttaatttttcattaactgg ttaaacaacggtttccctctagaaataattttgtttaactttaagaaggagatatattc atggctgtgagcggctggcgtctgttcaagaaaattagcgcgaccgtcttcggcggtgg tggcagcgttagcaaaggcgaggcggttatcaaggagtttatgcgttttaaggttcaca tggagggtagcatgaatggtcacgagttcgagatcgagggtgaaggcgagggtcgtccg tacgaaggcacccagaccgcgaagctgaaagtgaccaagggtggcccgctgccgttcag ctgggacatcctgagcccgcagttcatgtatggcagccgtgcgtttaccaaacacccgg cggacattccggattactataagcaaagcttcccggaaggttttaaatgggagcgtgtt atgaacttcgaagatggtggcgcggtgaccgttacccaggacaccagcctggaggatgg caccctgatttacaaggtgaaactgcgtggcaccaactttccgccggatggtccggtta tgcagaagaaaacgatgggttgggaagcgagcaccgagcgtctgtatccggaagatggc gtgctgaagggtgatatcaaaatggcgctgcgtctgaaggacggtggccgttacctggc ggattttaagaccacctataaagcgaagaaaccggtgcaaatgccgggtgcgtacaacg ttgaccgtaaactggatattaccagccacaacgaggattataccgtggttgagcaatat gagcgtagcgagggtcgccacagcaccggcggcatggacgaactgtataagggatccga agacgcgagcacgcccgggggtgcgccggtgccgtatccggatccgctggaaccggccg gggaaaattctcttgctaaaaatgtattatccggtggaaaaggtaatgacaagttgtac ggcagtgagggagcagacctgcttgatggcggagaagggaatgatcttctgaaaggtgg atatggtaatgatatttatcgttatctttcaggatatggccatcatattattgacgatg aaggggggaaagacgataaactcagtttagctgatatagatttccgggacgttgccttt aagcgagaagggaatgacctcattatgtataaagctgaaggtaatgttctttctattgg ccacaaaaatggtattacatttaaaaactggtttgaaaaagagtcagatgatctctcta atcatcagatagagcagatttttgataaagacggcagggtaatcacaccagattctctt aaaaaagcatttgaatatcagcagagtaataacaaggtaagttatgtgtatggacatga tgcatcaacttatgggagccaggacaatcttaatccattaattaatgaaatcagcaaaa tcatttcagctgcaggtaacttcgatgttaaggaggaaagatctgccgcttctttattg cagttgtccggtaatgccagtgatttttcatatggacggaactcaataactttgacagc atcagcataatatattagtaatgagacctatcgggtggttgcgaag

[0142] SEQ ID NO: 6 (hlyB) gctaggagtcgtctggtgggtctctcacagatatttttttggagtcataatggattctt gtcataaaattgattatgggttatacgccctggagattttagcccaataccataacgtg tctgttaacccggaagaaattaaacatagatttgacacagacgggactggtctgggatt aacgtcatggttgcttgctgcgaaatctttagaactaaaggtaaaacaggtaaaaaaaa caattgaccgattaaactttatttctctgcccgcattagtctggagagaggatggacgt cattttattctgactaaagtcagtaaagaagcaaacagatatcttatttttgatctgga gcagcgaaatccccgtgttctcgaacagtctgagtttgaggcgttatatcaggggcata ttattcttatcgcttcccgttcttctgtggcgggcaaactggcgaaatttgactttacc tggtttattcctgccattataaaatacaggagaatatttattgaaacccttgttgtgtc tgtttttttacaattatttgcattaataaccccccttttttttcaggtggttatggaca aagtattagtgcacaggggattttcaactcttaatgttattactgtcgcattatctgtt gtggtggtgtttgagattatactcagcggtttaagaacttacatttttgcacatagtac aagtcggattgatgttgagttgggtgccaaactcttccggcatttactggcgctaccga tctcttattttgagagtcgtcgtgttggtgatactgttgccagggtaagagaattagac cagatccgtaattttctgacaggacaggcattaacatctgttctggacttattattttc attcatattttttgcggtaatgtggtattacagtccaaagcttactctggtgatcttat tttcgctgccttgttatgctgcatggtctgtttttattagccccattttgcgacgtcgc cttgatgataagttttcacggaatgcggataatcaatctttcctggtggaatcagtcac ggcgattaacactataaaagctatggcagtctcacctcagatgacgaacatatgggaca aacaattggcaggatatgttgctgcaggcttcaaagtgacagtattagcaaccattggt caacaaggaatacagttaatacaaaagactgttatgatcatcaacctgtggttgggagc acacctggttatttccggggatttaagtattggtcagttaattgcttttaatatgcttg ctggtcagattgttgcaccggttattcgccttgcacaaatctggcaggatttccagcag gttggtatatcagttacccgccttggtgatgtgcttaactctccaactgaaagttatca tgggaaactggcattaccggaaattaatggtgatatcacttttcgtaatatccggtttc gctataagcctgactctccggttattttagataatatcaatctcagtattaagcagggg gaggttattggtattgtcggacgttctggttcaggaaaaagcacattaactaaattaat tcaacgtttttatattcctgaaaatggccaggtcttaattgatggacatgatcttgcgt tggccgatcctaactggttacgtcgtcaggtgggggttgtgttgcaggacaatgtgctg cttaatcgcagtattattgataatatctcactggctaatcctggtatgtccgtcgaaaa agttatttatgcagcgaaattagcaggcgctcatgattttatttctgaattgcgtgagg ggtataacaccattgtcggggaacagggggcaggattatccggaggtcaacgtcaacgc atcgcaattgcaagggcgctggtgaacaaccctaaaatacttatttttgatgaagcaac cagtgctctggattatgagtcggagcatatcatcatgcgcaatatgcacaaaatatgta agggcagaacggttataatcattgctcatcgtctgtctacagtaaaaaatgcagaccgc attattgtcatggaaaaagggaaaattgttgaacagggtaaacataaggaactgctttc tgaaccggaaagtttatacagttacttatatcagttacagtcagactaacagaaagaac agtgagacctatcgggtggttgcgaag

[0143] SEQ ID NO: 7 (hlyD) gctaggagtcgtctggtgggtctctacagaagaatatgaaaacatggttaatggggttc agcgagttcctgttgtgctataaacttgtctggagtgaaacatggaaaatccggaagca attagatactccggtacgtgaaaaggacgaaaatgaattcttacccgctcatctggaat taattgaaacgccggtatcccgcagaccgcgtctggttgcttattttattatggggttt ctggttattgctgtcattttatctgttttaggtcaggtggaaattgttgccactgcaaa tgggaaattaacactaagtgggcgtagcaaagaaattaaacctattgaaaactcaatag ttaaagaaattatcgtaaaagaaggagagtcagtccggaaaggggatgtgttattaaag cttacagcactgggagctgaagctgatacgttaaaaacacagtcatcactgttacagac caggctggaacaaactcggtatcaaattctgagcaggtcaattgaattaaataaactac ctgaactgaagcttcctgatgagccttattttcagaatgtatctgaagaggaagtactg cgtttaacttctttgataaaagaacagttttccacatggcaaaatcagaagtatcaaaa agaactgaatctggataagaaaagagcagagcgattaacaatacttgcccgtataaacc gttatgaaaatttatcgagagttgaaaaaagccgtctggatgatttcaggagtttattg cataaacaggcaattgcaaaacatgctgtacttgagcaggagaataaatatgtcgaggc agcaaatgaattacgggtttataaatcgcaactggagcaaattgagagtgagatattgt ctgcaaaagaagaatatcagcttgtcacgcagctttttaaaaatgaaattttagacaag ctaagacaaacaacagacagcattgagttattaactctggagttagagaaaaatgaaga gcgtcaacaggcttcagtaatcagggcccctgtttcgggaaaagttcagcaactgaagg t teat act gaaggtggggttgttacaacagcggaaacactgatggt cat cgttccggaa gatgacacgctggaggttactgctctggtacaaaataaagatattggttttattaacgt cgggcagaatgccatcattaaagtggaggcctttccttacacccgatatggttatctgg tgggtaaggtgaaaaatataaatttagatgcaatagaggaccagaaactgggactcgtt tttaatgtcattgtttctgttgaagagaatgatttgtcaaccgggaataagcacattcc attaagctcgggtatggctgtcactgcagaaataaagactggaatgcgaagcgtaatca gctatcttcttagtcctctggaagagtctgtaacagaaagtttacatgagcgttaagtc tcagagccgcggt at ccggct cat at cttctcctgtcgtcct gagacct at cgggtggt tgegaag

[0144] SEQ ID NO: 8 (J23119 (C6)) cagagtccccaggcattactagagtcacacttttatagcacagctaacaccacgtcgtc cctatctgctgccctaggtctatgagtggttgctggataacttgacagctagctcagtc ctaggtataatgctagcaggcacagcacaacggtttccttttagctgtcaccggatgtg ctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaag gca

[0145] SEQ ID NO: 9 (PRO1) cagagtccccaggcattactagagtcacacttttatagcacagctaacaccacgtcgtc cctatctgctgccctaggtctatgagtggttgctggataactttacgggcatgcataag gctcggtactatattcaggcacagcacaacggtttccttttagctgtcaccggatgtgc tttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaagg ca

[0146] SEQ ID NO: 10 (proA) cagagtccccaggcattactagagtcacacttttatagcacagctaacaccacgtcgtc cctatctgctgccctaggtctatgagtggttgctggataactttacgggcatgcataag gctcgtaggctatattcaggcacagcacaacggtttccttttagctgtcaccggatgtg ctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaag gca

[0147] SEQ ID NO: 11 (proB) cagagtccccaggcattactagagtcacacttttatagcacagctaacaccacgtcgtc cctatctgctgccctaggtctatgagtggttgctggataactttacgggcatgcataag gctcgtaatatatattcaggcacagcacaacggtttccttttagctgtcaccggatgtg ctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaag gca

[0148] SEQ ID NO: 12 (proC) cagagtccccaggcattactagagtcacacttttatagcacagctaacaccacgtcgtc cctatctgctgccctaggtctatgagtggttgctggataactttacgggcatgcataag gctcgtatgatatattcaggcacagcacaacggtttccttttagctgtcaccggatgtg ctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaag gca

[0149] SEQ ID NO: 13 (proD) cagagtccccaggcattactagagtcacacttttatagcacagctaacaccacgtcgtc cctatctgctgccctaggtctatgagtggttgctggataactttacgggcatgcataag gctcgtataatatattcaggcacagcacaacggtttccttttagctgtcaccggatgtg ctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaag gca

[0150] SEQ ID NO: 14 (rpsm) cagagaaaggctacggccgttaattggtcgcctgagaagttacggagagtaaaaatgaa agttcgtgcttccgtcaagaaattatgccgtaactgcaaaatcgttaagcgtgatggtg tcatccgtgtgatttgcagtgccgagccgaagcataaacagcgccaaggctgatttttt cgcatatttttcttgcaaagttgggttgagctggctagattagccagccaatcttttgt atgtctgtacgtttccatttgagtatcctgaaaacgggcttttcagcatggtacgtaca tattaaatagtaggagtgccaggca

[0151] SEQ ID NO: 15 (vac1_ssaG)

[0152] Cagatattgccatcgcggatgtcgcctgtcttatctaccatcataaacatcatttgcct atggctcacgacagtataggcaatgccgttttttatattgctaattgtttcgccaatca acgcaaaagtatggcgattgctaaagccgtctccctgggcggtagattagccttaaccg cgacggtaatgactcattcatactggagtggtagtttgggactacagcctcatttatta gagcgtcttaatgatatt acct at ggactaatgagttt tact cgcttcggtatggatgg gatggcaatgaccggtatgcaggtcagcagcccattatatcgtttgctggctcaggtaa cgccagaacaacgtgcgccggagtaatcgttttcaggtatataccggatgttcattgct ttctaaattttgctatgttgccagtatccttacgatgtatttattttaaggaaaagcgg ca

[0153] SEQ ID NO: 16 (vac2_sseJ)

[0154] Cagatcacataaaacactagcactttagcaataatagtcggatgataagtttgtctgtt tttcctgagtat caagccagc tea tact cacgccagcacactaaaatcaggagtggctt cttttttagatctttgccttagccaggcgcacactcaataatgatagcagtcagataat atgtaccaggcattaacctcacgttgttgatgatatatttacttcgttgaaaaacaata aacattgtatgtattttattggcgacgaaaaactgttaaagaagcgtaattccatatac accatttacctgattacttttcttgctaatatttgctaattaattatttgctaaagcgt gtttaataaagtaaggaggaggca

[0155] SEQ ID NO: 17 (vac3_ssrA)

[0156] Cagagatgctgtctacatataccttgtcacaggcgattctatcattcggattttccgat aaattcacaattacattttcagcattgacataaaaacttacaatttgaaaaattattta ttaaataaactgttacgatgtttttacatcgccatcttattaaaaagtaattgtagtca tcgactgggttatatatgaagaaatttatcttcctaatgataacaccatcgattaatct tctgatgaaactatatgtactgcgatagtgatcaagtgccaaagattttgcaacaggca

[0157] SEQ ID NO: 18 (vac4_pipB2) cagatttatacgtgtttggctgctattgtgtaagccagacagcaacgcgtcgtgatacg ttattatgtaaccagacgtaaagggggtattcaccttatctctaaatgcaaatctatat gataaattttatcatgcactgtgttgctgtctctgggagaaaatattagccggtttcct tttggca

[0158] SEQ ID NO: 19 (vac5_ssaB) cagattatcggaaaatccgaatgatagaatcgcctgtgacaaggtatatgtagacagca tcctgatattgtacaagaagagtatagtcgaaataaatgtgaatcaggctttttacgga tgtggttgtgagcgaatttgatagaaactcccatttatgtctgggca

[0159] SEQ ID NO: 20 (vac6_sifA)

[0160] Gctaggagtcgtctggtgggtctcacagaataagcgattaattgcgcaacgctaacaaa tccacacgcatccaggcatgaagtttattcaagggtaaacttcatgccttcggcataaa aaacgcatgaaagaagttgccgccagtattgcaaatctacaacatcatccgcggtagtc cttcttttatttttacctgtagcgacgctatcacagacagtaatgcgtttatacgcgaa gctctcaggttttatactgattgccagtctcttttaaaaattatattacatccgatgcg cccgcagttgagataaaaagggtcgatttaatcaattatgtagtcatttttactccagt ataagtgagattaaggcaggagacctatcgggtggttgcgaag

[0161] SEQ ID NO: 21: vac7_sifB

[0162] Cagactgccctaccgctaaacatctcattgttgttagcctaataatacttttagtttaa cttcttataagacaatttctacacggttgagcaactatttactttctctaaaaataata tagtgcgtaattaatcattactcatagtacatgatgatgtgagaattaagaaaaccgtt ttactttcattcgttttatctgacatatttcatggccaggaggcgtgggcatgactaaa gctacgggtcgatttgaacaattgaacaataatgttgacggttcaggacaaagcaaaaa tcaggtgtttcaccgataggcaaaccgatgggcaacatgggataatatttcgaatacca cctattccagtaatgaagtatcatataatcacttgtggggca

[0163] SEQ ID NO: 22 (vac8_pipB) cagaaaaaatattggtgcttattattttttctttaagtaaattttcgctcaacaaactt aattgtttattcaatgatgatgaagcgtaagctatgctggaaatgaaggaagtcaatag caaggataatcttattattcacgggtgatattacttctgcttcaggca

[0164] SEQ ID NO: 23 (vac9_pipB2_extended) gctaggagtcgtctggtgggtctcacagagtctgtacagacgatgttgttaaacagttt atcaatggcggtaataaaatgcctgaacacgctttttaataggttttctgctaatgagt gggatgagtccagaacgtagtattaaaacgaatgccgtgtttattattttaaatgatgt tatatactctaaataattcgagttgcaggaaggcggcaagcgagcgaatccccaggagc ttactaaagtaagtgactggggtgagggaacgcggccgcagcacatgcaacttgaagta tgacgagtataagccaatatatttatttggctgctattgtgtaagccagacagcaacgc gtcgtgatacgttattatgtaaccagacgtaaagggggtattcaccttatctctaaatg caaatctatatgataaattttatcatgcactgtgttgctggcaggagacctatcgggtg gttgcgaag

[0165] SEQ ID NO: 24 (vac10_zinT)

[0166] Cagaaagcgagtagtcacaaaaattatgccgcctgtgcgcggatatctgcaaagcctgt gccgaagagtgtgcaaggcacgatcacgaccattgccagaattgcgcgcgggcatgcag ccaatgcgcagacgcctgccttaaaatggccgcgtaatttttcttccgccatt agetea accggatagagcatagagcttctacctctaaggttcggggttcaattcctcgatggcgg accagttgatatcaaaaaaggccacctgcgcggtggccgctgagtttctgttgaaataa atgcaatgttataatataacaatcatctttctaagaaagatgagggtaacgttttggtg attcatttaaaaaaactgacaatgcttctgggaatgctgttggtaaatagtggca

[0167] SEQ ID NO: 25 (vac11_mgtC) cagacgtttagcatcccttttctggtggaacccattttttcctcgtcatgttgttttat ttttttacgtgcaggcatcataacagagctatcgccggcattaagcaggaatttattgt ttaatgatttcagacgagcctgttattgacataatattgtcatttttttgtcacgggaa atatcaaacaaacttaaacaaatcgtcactatccccgcctttgcactttacagaacata ttgactgactataataagcgcaaattcatgcaggagtaatatgttggacagtcactttt acgtaaatcatctggcaagttaacgcacgctattcctgcgctgcttgccgaaccggtgg gcagcaatctccccttgtgacgattgtcatcccaataatgttacaacacgcgcattgtc gcgaggtaatcgtcatgttcatgtttaaacacgctttatttcctccgccgttaacacga cgctaattgcctcagggcagaaatttgtcgtgtgctaaatatagcacgtacttattctt ccagaaaaaatggaggaacgtatgttaatgtttccttatattttaaatttactggccgc tatgetggea

[0168] SEQ ID NO: 26 (cyto1_entC) gctaggagtcgtctggtgggtctcacagatttgccggggccaaccggcgtcctgggcta aggatattcctgaaattgataaaccaaccactaaaagcagccaacgataaaaggcggag agtctcacaatagcgtcctgttattaataaagttaatgcttctcattttcatgtcagcg gcagcgagatgcaagccttagtgccatttaactcatgaccagagttgacagagcgacgt tttactcttaggttagcgcactaaaaatagaaataataatcattattatacacaaaatc attcaagaagcatcgcgacggcaagggaagaatccccgcgggcatagataactgtgtga ccggggtttctgatcgcagccaacaaagaggcagcttgaaagatgaagtgtatataagc ctttatcattggaggatgatatggatatgtcactggccgaggacgctcaggagacaatg gcaacgcttgctggcaggagacctatcgggtggttgcgaag SEQ ID NO: 27 (cyto2_fepA) gctaggagtcgtctggtgggtctcacagaaataaaacagtagctgccgcgccagttagc gctaagcgccgtgctccagcgccagacatccgttccggcaatacgcgccatcgtctgag gctgcgcgttttgatgatgatcggttacgccagtgatgtagacccagacacgccgtatc ggggagtgtgtttcgtttccctgcgggtcgcgccaccaaaaagtgacccgataatttcc gtctttttcccgtatccattccggcccggttttcgtcctccaccaggcctcacttcccg ttgccagcgcctctttcattataaccctgtgtttattatgaattttgtatataaaaggt gaaatatattgataatattattgataactatttgcatttgcaatagcgtattgtagcgc tatgggacgcgcgaacacaatttcaccacccggccaatgcctttgacgggcgctttggc ttatgtggctaaagaaaagcaggatatacaatgaacaagaagattcattcggcaggaga cctatcgggtggttgcgaag

[0169] SEQ ID NO: 28 (cyto3_fepB)

[0170] Gctaggagtcgtctggtgggtctcacagacaaactgctggcgcaatttctgctggaaag ggctatccggcgaatctccggcaaccgcaggctcggtataacgggcgaagcacccggaa gtggtaaaactgcgatacggcgacatgaagaaaaagcgatcgggagcaagcgttgccat tgtctcctgagcgtcctcggccagtgacatatccatatcatcctccaatgataaaggct tatatacacttcatctttcaagctgcctctttgttggctgcgatcagaaaccccggtca cacagttatctatgcccgcggggattcttcccttgccgtcgcgatgcttcttgaatgat tttgtgtataataatgattattatttctatttttagtgcgctaacctaagagtaaaacg tcgctctgtcaactctggtcatgagttaaatggcactaaggcttgcatctcgctgccgc tgacatgaaaatgagaagcattaactttattaataacaggacgctattgtgagactggc aggagacctatcgggtggttgcgaag

[0171] SEQ ID NO: 29 (cyto4_fhuA) gctaggagtcgtctggtgggtctcacagatacgctgtgccagcagggcgagatgatgca gcagcaacagcagccgtcaggcaatccgttcgatcagtcgtctcagccgcagcagcctg cgcagcaacagccgccgaaagaagagaagagcgacggcgttgccggctggattaaggag atgtttggcggcaattaatcacggtaatagtgccgggtggcgctgtgcttactcggtcc acaccgttacgaccccattatgtgcgacgtaggccgaataagacgcttacatcgccatc cggcaaatcctccataaataacatttcagtctaatttattaacccttccttttcatctg gttgtttcttaaccccttagttttcgtagggccgcgtatcgcttgccattgcgacgata tttcgcctatcatgctgcggttataataataattatcgtttacgttatcattcactttc atcagagatataccaatggcgcgtcttaaaattgctcagccaaactcctcactgcgtaa aatcgcagttgtagtagccacggcaggagacctatcgggtggttgcgaag

[0172] SEQ ID NO: 30 (cyto5_fhuE) gctaggagtcgtctggtgggtctcacagacattgacggttgggatcaggatattgggaa taatcaagatatgcgtcggcgcctgcggtgaaatatcacgaaaggcggtgaccagctca tcctgataaacgatatccgaagggatttcacgacgaataattttgctgaatatagtttc ttctgccacgacgttttcctttttcataatagcccttgcagcgcacatgctacgccgag ccatactgcgagtatagagtatgagcgagttaccgacgctctttcaactttaacccacg atttattaagcgaaaaatgactacatgctggacttaccgccatatccccctgccatgac gcctttgtacgcttaaaaaatatttctagtttccctggttataccgttttacacattta atacaaatgcgtatatttctcatttgcatttttatacgcattaactagcaaagaatgaa aaggttcaacgtcatacgtcctgaacttaccccaataacaagcaaggattttcagatgt ctttcattcaataggcaggagacctatcgggtggttgcgaag

[0173] SEQ ID NO: 31 (cyto6_iroN) gctaggagtcgtctggtgggtctcacagaaagcgcctgataaatattaccaggcgcttt gtatgttggtgccaacatcactttcatcatcaaatatcgaatggctacaatcgtatccg atcccgccattacccagacggaaagtcgctggcaaactgtaagaatggttcgccgtcgg cagggaagcggcggtgaaccctgaaccgtgctataccatcttacctgggtgtttcttgt gattaacgatctgaaaaatagttttattttatctatttctgttttgtaaaacctccgtt cagtaggcgcattctgccccccttcccggatttactggcaaagcggagcccggacagag agtcatattgcaaaatcccgtttccgtttttttattaccagatttttgtggtcgaaaga t t gcct tt t cct t aat t gaat gat aatt at tat cat tagcat at gataataat tact at atagacgtaacctggcaaggatgtgagcttgagggcaacagcgctactttagacattat ttagggaatgggtatgagagttaagaagttcggcaggagacctatcgggtggttgcgaa g

[0174] SEQ ID NO: 32 (cyto7_mntH) gctaggagtcgtctggtgggtctcacagatttgctccaaatatgaggcaggtttaattt tcgtgcacattctatgcaacagctgtaaagaaaacgagatccaacacacactataataa ggacctgtgacgagattcaaaattagtgatctgtaatacacttttactgtactgaatat gaaaatgaaaagttatatcagtgtgctaatcttgtaatgttaagccaaactgttctgat acaggtcgccatcgtatcggtctatcgtttcacactatcaaagtaatcacccgtaccca ttgaaatgcacttgataatcattatcaatgaacatagcatgaaacatagcaaaggctat gtttttgaggcaaaagatgactgacaatcgcgtagagaatagggcaggagacctatcgg gtggttgcgaag

[0175] SEQ ID NO: 33 (cyto8_sfbA) gctaggagtcgtctggtgggtctcacagaggatgttggcgttaagacgtcttatccggc atttccctttacgccattcccgcctgacacacgcctgagcgcctgcctcgtacatttaa cgacacaccaggaaacatcatgaaataatttcaaggacagcaggctgtgatctgtgtca tgttaagaaatagcctttcgtttgggccaaaacagacgatgccgcatgaacggcatccg gcacagcatcacactatttaaaatggagaaattatgggattgcgtcagagtttacgcat tggcaggagacctatcgggtggttgcgaag SEQ ID NO: 34 (cyto9_sitA) gctaggagtcgtctggtgggtctcacagacggctgatagcagtgcaccgggcactgctt acaggcgggtttttcctcgccaaatacgcatttatcaagacgtttttgcgcgtaggcga acagcgcgtcgtaatgcccctgcaccgctgacgcctgtggacactggctttcatacagc gcgatcatttttttgatcgtcagtttttcacgagcgatacgtttaccaggcatcgtgct ctctccgaacattaagatgcatttattttacaccttatccctctttagcactatcactg catatcgtcgccattacgcaaataagaattattttcatttattcatgccttgtgctata taacatagcaaaggctatattcgatgattaattaaccacattgttgcgagggatactat gacgaatctacatcgtctaaaaacactcctgattgccggtattgtcgcgatactggcag gagacctatcgggtggttgcgaag

[0176] SEQ ID NO: 35 (cyto10_sntc3080) gctaggagtcgtctggtgggtctcacagacgcccgccatcaccaccggtaattgacgaa acccttgcgcccggagcgtatccgctgcatccggcaccagatcgacgttcaccatctca aattcaaatccacggctttccatcgcccgctttgtggcgtggcactgaacacagttatt gcgagtgtaaatagtaatgctcatgattcgtatttccatttaaaatgagaaaggcagga gacctatcgggtggttgcgaagcgtaaaggagaagaacttttcactggagttgtcccaa tcttg

[0177] SEQ ID NO: 36 (cyto11_soxS) gctaggagtcgtctggtgggtctcacagatttcgcagcggacagtcgctacgcgataaa cagccgcagccgatacaaccgtccagctcatcgcgcaacgccaccagcgtatgaatacg tcggtctaactcttcgcgccactgcgaggagagctgcttccactctttcgcgcttaacg tatgcccttccggcaagataccaaacgcgtcgccgatagttgccagcgggatgccgata cgctgggcaatcttgataatcgcgacataacgcaacacgtcacgcttgtatcgccgttg gttaccgctattacggatactggtaattagccctttgctttcatagaagtgcagggcgg acacagcaacaccgctacgtttcgcaacttcccccggcgtcagtaaggcttttaaacgg ggagattttttttccataaatcgctttacctcaagttaacttgaggaattatactcgcc cgcagacaaaacgacgaatcgaatactgtttaagaggcaacaatatgtcgcatcagcag ataattcagacccttatggcaggagacctatcgggtggttgcgaag

[0178] SEQ IN NO: 37 (cyto12_sntc3250) gctaggagtcgtctggtgggtctcacagaagtcataggtattggaagcgccgcgactgc ttacagttacgcccggcgtgtaacccaacgcttcttttactgactggaattgatgcatc tgcatctcttcgttagtgaccaccgaaaccgactgtggcgttttttcgatagatgtatc agttttggtggtagtggcggaacgcttcgcggcgatggtcggagccggtccccaggcac tttcctgcggcgcaggcgctgcggttacggtaatggtttcttctttcggttgaaccgcc gcctgtgcatagacagacatgccgctaaccgctgtggctactacaactgcgattttacg cagtgaggagtttggctgagcaattttaagacgcgccattggtatatctctgatgaaag tgaatgataacgtaaacgataattattattataaccgcagcatgataggcaggagacct atcgggtggttgcgaag

[0179] SEQ ID NO: 38 (cyto13_sufA) gctaggagtcgtctggtgggtctcacagactcattcagcacctgaaatgccggaaagag tttacataaacctatagctcaaactgagttatagaaccgcagcggattataaagagcgc aacgccaggtatccatacaaaaaatggggttctgacctcgccgcccggcaatgtcgaca gcctattaattaaatagtcattttctatacatcttttcgtttttgacctgccagaacgg ttaatgtcttataaatcattacttatcaaaaagttaagtggttttttgtctgtcgtatg acctggcggacagggtctatgcttaataaaaggcgctcaatatgaccatttgttggaaa gcccctgcggttaaggggttgaagtgataatcattatcactaacatgctgttatatcct ggtgatttagaacgcgaggtaactctatggaattgcattcaggcacgtttaacccggag gacttcggcaggagacct atcgggtggttgcgaag

[0180] SEQ ID NO: 39 (cyto14_uhpT) gctaggagtcgtctggtgggtctcacagagcactggaccggtttttttgcggtcatcgc catcgcggcggggatctccgcgctattgctgttgccatttctgaacgctcaggccccac gcgaaacccacgaagcgtgatacacctcacctttttgcgctgaatggggcaaaactaag aaattttcccggttttgcctggacgctgtcgcaggccacttttcctgtggatttttaca atgcctgccattcgcaggtataaaaattagctcaggagtaatccggcaggagacctatc gggtggttgcgaag

[0181] SEQ ID NO: 40 (cyto15_yjjZ) gctaggagtcgtctggtgggtctcacagagccgacacggcgttgagaaacaagaaaaga cgtaaagaaaactgatacttcttaatacgaagcgaccgccaggatggggttgtcatggg taattgtcgttatttatcggtgatatacacggaatcgggcgccaacatgaaaataacgt atgagaaaaggtcgcctaaagcgaggtgttgttgtttttacgttaacagtcggacaatt tatcaccttactgaatacgtgtcatcaaccgttaagtaaaactcatctctttagctttc tccctggctgacaaatgagaaaatatatcatatgatattggttatcattatcaattcca gaggtgaaaccatgttgcagcggacgttaggcagcggggcaggagacctatcgggtggt tgcgaag

[0182] SEQ ID NO: 41 (sicAp) cagagtccccaggcattactagagtcacacttttatagcacagctaacaccacgtcgtc cctatctgctgccctaggtctatgagtggttgctggataacaataggcgtatcacgagg ccctttcgtgttcacctcgagccacaagaaaacgaggtacggcattgagccgcgtaagg cagtagcgatgtattcattgggcgttttttgaatgttcactaaccaccgtcggggttta ataactgcatcagataaacgcagtcgttaagttctacaaagtcggtgacagatggca SEQ ID NO: 42 (sigDp) cagagtccccaggcattactagagtcacacttttatagcacagctaacaccacgtcgtc cctatctgctgccctaggtctatgagtggttgctggataacttatgaacatttgatgta ccgatctcccccatgatcgccactacgtatggacgtcaggatgcctccccgcctgatca gaagcgtttcctcattaaaaaggacatttttttaaagttcctggtgcataaaagtcaca tccttttaaagagattgttaaccctgttgaatgttcccactcccctattcaggca

[0183] SEQ ID NO: 43 (sopEp) cagagtccccaggcattactagagtcacacttttatagcacagctaacaccacgtcgtc cctatctgctgccctaggtctatgagtggttgctggataacatcagctcacactccatt tcaatgccagaacggcaaggctcctcctgagcgaaaaggactttttttgaaagtttctg gaaaataaaaatagtactatttgtagcattaattgaatcagccgaatttttctaattca tcaatcagatgggca

[0184] SEQ ID NO: 44 (ssaG_sicAp) gctaggagtcgtctggtgggtctctcagatattgccatcgcggatgtcgcctgtcttat ctaccatcataaacatcatttgcctatggctcacgacagtataggcaatgccgtttttt atattgctaattgtttcgccaatcaacgcaaaagtatggcgattgctaaagccgtctgc ctgggcggtagattagccttaaccgcgacggtaatgactcattcatactggagtggtag tttgggactacagcctcatttattagagcgtcttaatgatattacctatggactaatga gttttactcgcttcggtatggatgggatggcaatgaccggtatgcaggtcagcagccca ttatatcgtttgctggctcaggtaacgccagaacaacgtgcgccggagtaatcgttttc aggtatataccggatgttcattgctttctaaattttgctatgttgccagtatccttacg atgtatttattttaaggaaaagcgtccccaggcattactagagtcacacttttatagca cagctaacaccacgtcgtccctatctgctgccctaggtctatgagtggttgctggataa caataggcgtatcacgaggccctttcgtgttcacctcgagccacaagaaaacgaggtac ggcattgagccgcgtaaggcagtagcgatgtattcattgggcgttttttgaatgttcac taaccaccgtcggggtttaataactgcatcagataaacgcagtcgttaagttctacaaa gtcggtgacagatggcat gagacct at cgggtggttgcgaag

[0185] SEQ ID NO: 45 (sseJ_sicAp) gctaggagtcgtctggtgggtctctcagagtccccaggcattatcacataaaacactag cactttagcaataatagtcggatgataagtttgtctgtttttcctgagtatcaagccag ctcatactcacgccagcacactaaaatcaggagtggcttcttttttagatctttgcctt agccaggcgcacactcaataatgatagcagtcagataatatgtaccaggcattaacctc acgttgttgatgatatatttacttcgttgaaaaacaataaacattgtatgtattttatt ggcgacgaaaaactgttaaagaagcgtaattccatatacaccattt acct gat t act tt tcttgctaatatttgctaattaattatttgctaaagcgtgtttaataaagtaaggagga ggcagctagagtcacacttttatagcacagctaacaccacgtcgtccctatctgctgcc ctaggtctatgagtggttgctggataacaataggcgtatcacgaggccctttcgtgttc acctcgagccacaagaaaacgaggtacggcattgagccgcgtaaggcagtagcgatgta ttcattgggcgttttttgaatgttcactaaccaccgtcggggtttaataactgcatcag at aaacgcagtcgttaagttctacaaagtcggtgacagatggcat gagacct at cgggt ggttgcgaag

[0186] SEQ ID NO: 46 (CyDisCo mammalian derived circuit) ctcggaaataattatcagcaggacgcactgaccaggaggtacatatgaaagccatcgat aaaatgaccgacaatccgcctcaagagggtctgagtggtcgtaaaatcatctatgatga ggacggcaaaccatgtcgcagctgcaataccctgctggacttccagtatgttaccggga aaatctcaaatggcctgaaaaacctgagcagcaatggtaaactggcgggtacaggtgct ctgactggggaagcatctgaactgatgccgggttctcgtacctatcgtaaagtcgatcc tccggatgttgaacagctgggacgttcttcatggacactgctgcatagcgtagcagcct cttatccagctcaaccaaccgatcagcaaaaaggcgaaatgaaacagttcctgaacatc ttcagccacatctatccgtgtaactggtgcgctaaagacttcgaaaaatatatccgtga gaatgcccctcaagttgaatcacgtgaggagctgggtcgctggatgtgtgaggcccata acaaagtgaacaaaaagctgcgcaaaccgaagttcgactgtaacttctgggaaaaacgc tggaaagatggttgggatgagtaataaggatccgaattcactagaaataattttgttta actttaagaaggagatacatatggatgccccagaggaggaagatcacgtcctggttctg cgtaaaagcaacttcgctgaagcactggcagctcacaaatatctgctggtcgagttcta tgctccgtggtgtggtcattgcaaagccctggctccggaatatgctaaagcagccggca aactgaaagctgagggcagtgaaattcgtctggccaaagtggacgctaccgaagaatca gatctggcacaacagtatggtgttcgtggttatccgactatcaaatttttccgtaacgg cgatacagcaagccctaaagagtataccgctggccgtgaagctgatgatatcgtgaact ggctgaaaaaacgtacaggtccggcggcaacgactctgcctgatggtgccgctgccgag tcactggtagaatcatccgaagtggccgtgattggcttctttaaagacgtggagagcga ttcagcaaaacagttcctgcaagcagctgaagcgattgatgacatcccgtttggtatta cgagcaatagcgacgtgttctccaaatatcaactggacaaagacggtgtggttctgttc aaaaaattcgacgaaggccgtaacaactttgaaggtgaggtgaccaaagaaaacctgct ggactttatcaaacacaatcaactgccgctggtgattgagttcaccgaacagacagctc cgaaaatctttggcggcgagatcaaaacccacattctgctgtttctgcctaaaagtgtg tccgactatgacggcaaactgagcaacttcaaaaccgccgctgagagctttaaaggcaa aatcctgttcatcttcatcgacagcgatcataccgacaaccagcgtattctggagtttt ttggcctgaaaaaagaggaatgtccggccgttcgcctgattacactggaagaggagatg acgaaatataaaccagaaagcgaggagctgacagctgaacgtattaccgagttctgcca ccgttttctggaaggcaaaatcaaacctcatctgatgtcccaagaactgccagaagatt gggataaacagcctgtgaaagtgctggtaggcaaaaacttcgaggatgtggcgttcgac gagaaaaaaaacgtgtttgtggagttttatgccccttggtgtggacactgcaaacagct ggcaccgatttgggataaactgggcgaaacctataaagatcatgaaaacattgttattg ccaaaatggacagcaccgccaatgaagtcgaagccgtgaaagttcattcgtttccgacc ctgaaattctttcctgccagcgccgatcgtactgtgatcgattataacggggagcgtac cctggatggttttaaaaaattcctggagagcggtggtcaagatggtgccggtgatgatg acgatctggaggatctggaagaggctgaagaaccggatatggaggaggatgacgatcag aaagcagtcaaagacgagctgtgataaggatccgaattcacgtcc

[0187] REFERENCES

[0188] 1. Li Jiao, Jin-Sik Kim, Woo-Seok Song, Bo-Young Yoon, Kangseok Lee, Nam- Chul Ha, Crystal structure of the periplasmic disulfide-bond isomerase DsbC from Salmonella enterica serovar Typhimurium and the mechanistic implications, Journal of Structural Biology, Volume 183, Issue 1 , 2013, Pages 1-10.

[0189] 2. Denoncin K, Vertommen D, Arts IS, Goemans CV, Rahuel-Clermont S, Messens J, Collet JF. A new role for Escherichia coli DsbC protein in protection against oxidative stress. J Biol Chem. 2014 May 2;289(18): 12356-64. doi: 10.1074 / jbc.M114.554055. Epub 2014 Mar 14. PMID: 24634211 ; PMCID: PMC4007432.

[0190] 3. Yoon BY, Kim JS, Um SH, Jo I, Yoo JW, Lee K, Kim YH, Ha NC. Periplasmic disulfide isomerase DsbC is involved in the reduction of copper binding protein CueP from Salmonella enterica serovar Typhimurium. Biochem Biophys Res Commun. 2014 Apr 18;446(4):971-6. doi: 10.1016 / j.bbrc.2O14.03.043. Epub 2014 Mar 20. PMID: 24657263.

[0191] 4. Lasica, A.M. and Jagusztyn-Krynicka, E.K. (2007), The role of Dsb proteins of Gram-negative bacteria in the process of pathogenesis. FEMS Microbiology Reviews, 31 : 626-636.

[0192] 5. de Marco A. Strategies for successful recombinant expression of disulfide bond-dependent proteins in Escherichia coli. Microb Cell Fact. 2009 May 14;8:26. doi: 10.1186 / 1475-2859-8-26. PMID: 19442264; PMCID: PMC2689190.

[0193] 6. Hatahet F, Boyd D, Beckwith J. Disulfide bond formation in prokaryotes: history, diversity and design. Biochim Biophys Acta. 2014 Aug; 1844(8): 1402-14. doi: 10.1016 / j.bbapap.2014.02.014. Epub 2014 Feb 25. PMID: 24576574; PMCID: PMC4048783.

Claims

CLAIMS1. A live attenuated Gram-negative bacterium comprising a heterologous polynucleotide encoding a prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein said heterologous polynucleotide encoding the prokaryotic disulfide bond isomerase is operably linked to a promoter.

2. A live attenuated Gram-negative bacterium comprising an endogenous prokaryotic disulfide bond isomerase, or functional fragment thereof, wherein the endogenous prokaryotic disulfide bond isomerase is upregulated compared to its basal level expression.

3. The live attenuated Gram-negative bacterium of claim 1 or 2, wherein the prokaryotic disulfide bond isomerase is expressed in the cytosol of the live attenuated Gram-negative bacterium.

4. The live attenuated Gram-negative bacterium of any one of claims 1 to 3, wherein the prokaryotic disulfide bond isomerase is DsbC.

5. The live attenuated Gram-negative bacterium of any one of claims 1 to 4, wherein the promoter is a constitutive promoter, a promoter induced upon bacterial invasion, or a vacuole inducible promoter, preferably wherein the promoter is a constitutive strong promoter.

6. The live attenuated Gram-negative bacterium of claim 5, wherein the promoter is a proC or a J23119 promoter.

7. The live attenuated Gram-negative bacterium of any one of claims 1 to 6, wherein the live attenuated Gram-negative bacterium further comprises a heterologous polynucleotide encoding one or more cargo molecules.

8. The live attenuated Gram-negative bacterium of any one of claims 1 to 7, wherein the live attenuated Gram-negative bacterium further comprises a modified hlyCABD operon, wherein the modified hlyCABD operon is split into a first segment and a second segment, each segment being operably linked to an independently controlled promoter, wherein the first segment comprises theheterologous polynucleotide encoding one or more cargo molecules upstream of a hlyAs translocation sequence, wherein the heterologous polynucleotide encoding the one or more cargo molecule replaces a hlyA gene, and wherein the second segment comprises hly genes involved in secretion, preferably wherein the hlyAs translocation sequence is maintained.

9. The live attenuated Gram-negative bacterium of claim 8, wherein the first segment further comprises a hlyC gene, or a fragment thereof, upstream of the heterologous polynucleotide encoding the one or more cargo molecules.

10. The live attenuated Gram-negative bacterium of claim 8 or 9, wherein the independently controlled promoter operably linked to the first segment is positioned upstream of the hlyC gene, or a fragment thereof.

11. The live attenuated Gram-negative bacterium of any one of claims 8 to 10, wherein the first independently controlled promoter is any of J23119 or sseA, and the second independently controlled promoter is any of ssaG, sseJ or sseA.

12. The live attenuated Gram-negative bacterium according to claim 11 , wherein the first independently controlled promoter is J23119 and the second independently controlled promoter is any of ssaG, sseJ or sseA.

13. The live attenuated Gram-negative bacterium according to claim 12, wherein the first independently controlled promoter is J23119 and the second the independently controlled promoter is ssaG.

14. The live attenuated Gram-negative bacterium any one of claims 11 to 13, wherein the first independently controlled promoter is sseA and the second independently controlled promoter is any of: J23119, ssaG, sseA or sseJ.

15. The live attenuated Gram-negative bacterium of claim 14, wherein the first independently controlled promoter is sseA and the second independently controlled promoter is ssaG.

16. The live attenuated Gram-negative bacterium of any one of claims 1 to 15, wherein the live attenuated Gram-negative bacterium is a Salmonella spp,preferably wherein the live attenuated Gram-negative bacterium is a Salmonella enterica serovar Typhi and / or Salmonella enterica serovar Typhimurium.

17. The live attenuated Gram-negative bacterium of any one of claims 1 to16, wherein the live attenuated Gram-negative bacterium is a genetically modified non-natural bacterium.

18. The live attenuated Gram-negative bacterium of any one of claims 1 to17, wherein the cargo molecule is a RNA molecule, peptide, protein or functional fragment thereof.

19. The live attenuated Gram-negative bacterium of claim 18, wherein the RNA molecule, peptide, protein, or functional fragment thereof is a therapeutic RNA molecule, therapeutic peptide, therapeutic protein, or therapeutic functional fragment thereof.

20. The live attenuated Gram-negative bacterium of any one of claims 1 to 19, for therapeutic use.21 . The live attenuated Gram-negative bacterium for use of claim 20, wherein the live attenuated Gram-negative bacterium is for use in the treatment, reduction, inhibition, prevention, or control of a neoplastic disease, an infectious disease, a cardiovascular disease, a neurodegenerative disease, a gastrointestinal disease, a respiratory disease, a renal disease, a liver disease, an autoimmune disease, an inflammatory disease or a genetic disorder, preferably the live attenuated Gram-negative bacterium is for use in the treatment, reduction, inhibition, prevention of recurrence, or control of a neoplastic disease or an infectious disease.

22. The live attenuated Gram-negative bacterium for use of claim 21 , wherein the neoplastic disease is a solid cancer and / or a haematological malignancy.

23. The live attenuated Gram-negative bacterium for use of claim 22, wherein the solid cancer and / or the haematological malignancy is a cancer selected from prostate cancer, oesophageal cancer, liver cancer, renal cancer, lung cancer, breast cancer, colorectal cancer, bladder cancer, breast cancer, pancreaticcancer, brain cancer, mesothelioma, hepatocellular cancer, lymphoma, leukaemia, gastric cancer, prostate cancer, endometrial cancer, endometrial cancer, vulvar / vaginal cancer, cervical cancer, ovarian cancer, thyroid cancer, melanoma, carcinoma, head and neck cancer, skin cancer or sarcoma, preferably wherein the neoplastic disease is associated with a cancer selected from bladder cancer, lung cancer, mesothelioma, hepatocellular cancer, melanoma, oesophageal cancer, gastric cancer, ovarian cancer, colorectal cancer, head and neck cancer, prostate cancer, endometrial cancer, cervical cancer or breast cancer.

24. A vaccine composition comprising the live attenuated Gram-negative bacterium according to any of claims 1 to 19.

25. The vaccine composition of claim 24, wherein the vaccine composition further comprises a pharmaceutically acceptable adjuvant, carrier or excipient.

26. A method of treating, preventing, inhibiting, preventing recurrence or controlling a disease in a subject, wherein the method comprises administering to a subject the live attenuated Gram-negative bacterium according to any one of claims 1 to 19.

27. A method of delivering a therapeutic molecule to the tumour microenvironment in a subject suffering from a tumour, said method comprising the steps of: i) modifying a live attenuated Gram-negative bacterium as defined in any one of claims 1 to 19, and ii) administering said modified Gram-negative bacterium to the subject in need thereof.

28. Use of the live attenuated Gram-negative bacterium according to any one of claims 1 to 19, in the manufacture of a medicament for a neoplastic disease, an infectious disease, a cardiovascular disease, a neurodegenerative disease, a gastrointestinal disease, a respiratory disease, a renal disease, a liver disease, an autoimmune disease, an inflammatory disease or a genetic disorder.

Images