Devices and methods for rapid nucleic acid amplification with facilitated detection of amplified products

Abstract

The present invention concerns a microfluidic device, configured for rapid amplification of target nucleic acids, the microfluidic device comprising (a) a microfluidic chip, comprising at least one flow channel configured to receive a sample and comprising a capture surface, and primers, that are grafted on the capture surface of the at least one flow channel, and (b) a heating plate, comprising two heating zones, including a first heating zone and a second heating zone, the heating plate being configured to heat the first heating zone (5) at a first temperature that is constant, and the second heating zone at a second temperature that is constant and different to the first temperature, wherein the capture surface is aligned with the second heating zone, and wherein the microfluidic chip is positioned on the heating plate. It also concerns methods using the same.

Description

[0001] DEVICES AND METHODS FOR RAPID NUCLEIC ACID AMPLIFICATION WITH FACILITATED DETECTION OF AMPLIFIED PRODUCTS

[0002] The present invention concerns a microfluidic device, configured for rapid amplification of target nucleic acids, the microfluidic device comprising (a) a microfluidic chip, comprising at least one flow channel configured to receive a sample and comprising a capture surface, and primers, that are grafted on the capture surface of the at least one flow channel, and (b) a heating plate, comprising two heating zones, including a first heating zone and a second heating zone, the heating plate being configured to heat the first heating zone at a first temperature that is constant, and the second heating zone at a second temperature that is constant and different to the first temperature, wherein the capture surface is aligned with the second heating zone, and wherein the microfluidic chip is positioned on the heating plate.

[0003] The polymerase chain reaction (PCR) is the most common technic for nucleic acid amplification in clinical practice and is widely used in many applications such as infectious disease detection, tumor screening, forensic identification, genomic programs, food safety testing, and environmental monitoring. However, most PCR devices have inefficient heating and cooling ramp rates for the solution, which significantly limits their application.

[0004] PCR may be divided into 3 reactions (denaturation, annealing, and extension) occurring at 3 temperatures over 3 time periods each cycle. The PCR reaction requires repeated thermal cycles at different temperatures to perform denaturation and amplification (annealing and extension) of desoxyribonucleic acids (DNAs) for the number of target DNA sequences to increase exponentially. Typically, the PCR reaction will execute 30-40 cycles and will take between 1 and 4 hours, making it increasingly difficult to meet the demand for rapid clinical testing. Conventional PCR is performed in a volume from 20 pL to 50pL and cannot achieve ultra-fast ramping rate because of both the big reaction size and the large thermal resistance between the heating block and the reaction tube (with high thermal capacity).

[0005] Since the invention of PCR, many efforts have been made to reduce the required amplification time. Microfluidics devices provide a potential solution to improve PCR speed as they can perform ultra-high ramping rates due to low system thermal capacity. However, the sensitivity of the method is directly affected by the size of a PCR reactor, or the available nucleic acid templates. It has been tried to shorten the amplification and detection time by achieving a realtime (RT) detection. This implies either that a second reaction is added during each cycle of the PCR (e.g. hybridization onto a DNA array, as in US 2016 / 211698 or US 2011 / 0086361), and / or that the amplicons can be discriminated from native reagents in the reaction mix and differentially labeled to be distinguished from each other. In the first case, the detection rate is affected by the slow hybridization kinetics (e.g. about 2 min for a 50% yield of hybridization, according to the sequences, as shown in Zhang et al. (2017). Predicting DNA hybridization kinetics from sequence. Nature Chemistry, 10(1), 91-98. doi:10.1038 / nchem.2877). In the second case, the differential labeling of amplicons requires not only expensive chemicals but also limits the multiplexing capability of testing, due to a limited number of fluorophores that can be efficiently discriminated (typically 5 with usual RT-PCR thermocyclers).

[0006] To date, various microfluidic techniques have been applied for PCR. Two design methods have been reported for microfluidic PCR: one is to make the sample position fixed, and the temperature changed in a single heating zone; the other is to move the sample between multiple heating zones, and the temperature of each heating zone is fixed.

[0007] The microfluidic PCR with a fixed sample position cannot achieve rapid PCR because temperature changes take a long time. The second method consists in moving the fluid to circulate in multiple heating zones each with a fixed temperature and can be divided into two main types: convective PCR and flow-channel PCR.

[0008] With convective PCR, the heating source is placed under the PCR sample, and fluid heat conduction and convection are used to create the temperature gradient and fluid cycle, respectively. The fluid will thermally circulate in the temperature gradient area in the capillary to achieve PCR. However, the amplification efficiency is low as the solution cannot maintain a stable and prolonged constant temperature, and the PCR speed is limited by the speed of fluid convection.

[0009] The flow-channel PCR is where the sample flows inside a long (often serpentine) microchannel that is directly placed on multiple heaters with fixed temperatures. Because of the high surface to volume ratio of long microchannels, PCR efficiency is deteriorated due to an increased number of biomolecules adsorbed on the channel surface, resulting in reduced detection sensitivity.

[0010] The current amplification methods have the following problems: (i) most devices have slow solution temperature ramp rates, resulting in long amplification times, (ii) microfluidic devices have a reduced sensitivity, which limits potential in clinical applications. Therefore, there is a current need for nucleic acid amplification techniques with both rapidity and a high sensitivity suitable for clinical tests.

[0011] The present invention meets these needs.

[0012] SUMMARY OF THE INVENTION

[0013] The present invention relates to a microfluidic device for rapid amplification of target nucleic acids comprising: a) a microfluidic chip comprising at least one flow channel comprising a sample compartment, optionally at least one washing compartment, optionally a reading compartment, and oligonucleotides grafted on a capture surface of the flow channel, b) a heating plate comprising two heating zones at constant temperature, wherein the capture surface is aligned with the second heating zone, and wherein the microfluidic chip is positioned on the heating plate.

[0014] The present invention more preferably relates to microfluidic device, configured for rapid amplification of target nucleic acids, the microfluidic device comprising: a) a microfluidic chip, comprising: at least one flow channel configured to receive a sample and comprising a capture surface, and primers, that are grafted on the capture surface of the at least one flow channel, and b) a heating plate, comprising two heating zones, including a first heating zone and a second heating zone, the heating plate being configured to heat: the first heating zone at a first temperature that is constant, and the second heating zone (6) at a second temperature that is constant and different to the first temperature, wherein the capture surface (7) is aligned with the second heating zone (6), and wherein the microfluidic chip is positioned on the heating plate.

[0015] In some embodiments, the first temperature is higher than the second temperature.

[0016] In some embodiments, the first heating zone is a denaturation zone and the second heating zone is an amplification zone. In some embodiments, the first heating zone is configurated to reach about 95°C and the second heating zone is configurated to reach about 45C° to 72°C, for example about 50°C to 65°C, for example 52, 55, 57 or 59°C, and preferably about 60°C.

[0017] In some embodiments, the microfluidic chip further comprises in the flow channel an interspacing fluid or liquid, for example mineral oil.

[0018] In some embodiments, the microfluidic chip further comprises in the flow channel an interspacing solid material or plug.

[0019] Interspacing fluid, liquid, solid material or plug are movable with the sample inside the flow channel, as this will be detailed herein.

[0020] In some embodiments, the microfluidic device according to the invention further comprises at least one pump to repeatedly translate the sample from one heating zone to the other.

[0021] In some embodiments, the microfluidic chip is configured to receive a sample having a volume smaller than about 20 pL, preferably smaller than about 10 pL.

[0022] In some embodiments, the at least one flow channel comprises a plurality of flow channels, wherein each flow channel is configured to receive a sample and comprises primers, that are grafted on the capture surface of the considered flow channel, the primers being specific to certain target nucleic acids.

[0023] The present invention further relates to a method of rapid amplification of target nucleic acids comprising the steps of: a) providing the microfluidic device according to the invention, b) introducing a sample into the sample compartment, c) aligning the sample compartment with the first heating zone to effect denaturation, d) aligning the sample compartment with the second heating zone and the capture surface to effect amplification of the target nucleic acids, and e) repeating step c and step d so that the sample compartment goes back and forth between the two heating zones to effect thermal cycling.

[0024] The present invention more particularly relates to a method of rapid amplification of target nucleic acids comprising the steps of: a) providing the microfluidic device according to the invention, b) introducing a sample into the flow channel, c) aligning the sample with the first heating zone to effect denaturation, d) aligning the sample with the second heating zone and the capture surface to effect amplification of the target nucleic acids, and e) repeating step c) and step d) so that the sample goes back and forth between the two heating zones to effect thermal cycling.

[0025] In some embodiments, the sample is introduced into the flow channel along with amplification reagents such as primers, deoxynucleotides (dNTPs), polymerase, buffers, and co-factors.

[0026] In some embodiments, all or part of dNTPs are fluorescent.

[0027] In some embodiments, the method according to the invention, further comprises a step of detection of amplified products on the second heating zone after each thermal cycle.

[0028] In some embodiments, said target nucleic acids are amplified simultaneously in a solid phase and a liquid phase.

[0029] In some embodiments, the amplification of target nucleic acids is multiplexed.

[0030] The present invention further relates to a kit for rapid amplification of target nucleic acids comprising: a) a microfluidic chip, wherein said microfluidic chip comprises at least one flow channel comprising a sample compartment, optionally at least one washing compartment, optionally a reading compartment, and oligonucleotides grafted on a capture surface of the at least one flow channel; b) a heating plate comprising at least two heating zones at constant temperature; and c) at least one vial.

[0031] The present invention more particularly relates to a kit for rapid amplification of target nucleic acids, the kit comprising: a) a microfluidic chip, wherein said microfluidic chip comprises: at least one flow channel configured to receive a sample and comprising a capture surface, and primers, that are grafted on the capture surface of the at least one flow channel; and b) a heating plate comprising two heating zones, including a first heating zone and a second heating zone, the heating plate being configured to heat: the first heating zone at a first temperature that is constant, and the second heating zone at a second temperature that is constant and different to the first temperature; and c) at least one vial.

[0032] DETAILED DESCRIPTION OF THE INVENTION

[0033] The inventors designed a microfluidic device for rapid amplification of nucleic acids in which the sample is moved back and forth between two constant-temperature zones, and further comprises primers grafted on a capture surface of the flow channel. Thus, the microfluidic device according to the invention combines the advantages of a solid-phase amplification and flow channel thermocyclers, and provides ultrafast, accurate, and stable temperature conditions for PCR. This is in sharp contrast with most microfluidic devices that enable liquid-phase amplification only, and comprise three to more temperature regions.

[0034] In particular, the microfluidic device according to the invention is configured for rapid one-step amplification and real-time detection of nucleic acids. The devices and methods presented herein facilitate the detection of amplified products by combining in a one-step process both the amplification and the detection of target nucleic acids (in real-time). Primers grafted on the capture surface of the flow channel allows for a solid-phase PCR to be performed at the same time as a liquid-phase PCR. The solid-phase amplified products are themselves detectable (in real time) as the liquid-phase is removed from this array at each cycle of polymerization, allowing the mix to contain detectable molecules (i.e. fluorescent primers, fluorescent dNTPs,...) without interfering with the reading of the array or the need of signals blockers, like quenchers of fluorochromes.

[0035] The heat transfer time of the sample on this device is very short. The sample size is also very small (preferably less than about 20 pL), which can reduce the reagent volume and reduce the cost per analysis. The microfluidic device described herein aims to achieve rapid nucleic acid amplification suitable for practical application, for example point-of-care tests.

[0036] Most rapid PCR methods have focused on shortening thermal cycle time. The methods described herein judiciously combine a solid phase and a liquid phase amplification resulting in an increased sensitivity. Moreover, the combination with labeled or fluorescent dNTPs leads to a rapid signal enhancement. Thus, a lower number of cycles are necessary for the detection of a target nucleic acid.

[0037] Definitions

[0038] Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art.

[0039] It is also understood that various implementations described herein can be utilized in combination with any other implementation described or disclosed, without departing from the scope of the present disclosure. Therefore, devices, elements, methods and / or processes according to certain implementations of the present disclosure can include, incorporate, or otherwise comprise properties, features, components, elements, steps, and / or the like described in other disclosed herein without departing from the scope of the present disclosure. Thus, reference to a specific feature in relation to one implementation should not be construed as being limited to applications only within that implementation.

[0040] The term “about” is used herein to mean approximately, in the region of, roughly, or around. When the term “about” is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term “about” is used herein to modify a numerical value above and below the stated value by a variance of 5%.

[0041] Microfluidic device

[0042] The present invention thus relates to a microfluidic device, configured for rapid amplification of target nucleic acids, the microfluidic device comprising: a) a microfluidic chip, comprising: at least one flow channel configured to receive a sample and comprising a capture surface, and primers, that are grafted on the capture surface of the at least one flow channel, and b) a heating plate, comprising two heating zones, including a first heating zone and a second heating zone, the heating plate being configured to heat: the first heating zone at a first temperature that is constant, and the second heating zone at a second temperature that is constant and different to the first temperature, wherein the capture surface is aligned with the second heating zone, and wherein the microfluidic chip is positioned on the heating plate. In particular, the microfluidic device according to the invention is for rapid one-step amplification and real-time detection of target nucleic acids. By “one step amplification and real-time detection”, it is meant that amplification and detection can be performed simultaneously in the same localisation or zone of the microfluidic device. This is in sharp contrast with other systems in which a first process of amplification such as a PCR reaction is performed before a second process of detection such as a microarray hybridization.

[0043] By “microfluidic device”, it is meant an instrument that uses very small amounts of fluid on a microchip with small channel(s), generally microscale channel(s), to do certain laboratory tests. According to the invention, the microfluidic device comprises a microfluidic chip positioned on a heating plate. By “positioned” it is meant mounted, fixed or inserted. In some embodiments, the microfluidic chip is positioned above the heating plate.

[0044] The microfluidic device according to the invention comprises at least one flow channel allowing for a continuous and cyclic flow of the sample back and forth between the two heating zones at constant temperature. This is in sharp contrast to conventional flowchannel microfluidic devices in which the sample flows in one direction inside a long and often serpentine channel, or to rotary (or circular) microfluidic devices in which the flow channel forms a loop.

[0045] According to the invention, the microfluidic chip is configured to receive a mobile phase comprising a sample, optionally at least one wash solution, and optionally a reading fluid, and a fixed phase comprising primers grafted on a capture surface of the flow channel.

[0046] By “flow channel”, it is meant a flow path through which a solution can flow. The at least one flow channel may be present in various sizes and forms, linear or not. In some embodiments, the flow channel is a serpentine channel. In some embodiments, the flow channel is circular. Preferably, the flow channel is linear. The diameter of said flow channel may vary or not. In some embodiments, the flow channel diameter or height is constant. In some embodiments, the flow channel diameter or height varies to form at least two reaction chambers separated by a thinner section of the flow channel. By “reaction chamber”, it is meant a widen zone of the flow channel, wherein a reaction can occur (e.g a denaturation reaction or amplification reaction). Preferably, the flow channel according to the invention is fixed, whereas the sample is mobile inside the flow channel. In some embodiments, the microfluidic device according to the invention comprises at least one flow channel. In some embodiments, the microfluidic device according to the invention comprises a plurality of flow channels, preferably in order to detect multiple targets. Said plurality of flow channels may be on the same plane and / or parallel. In some embodiments, two channels or two sets of channels each located in the same plane and in parallel, are superimposed with the heating plate interposed between the two channels or the two sets, the heating plate having at least two heating zones in regard with the corresponding mobile phases of the two channels or sets.

[0047] By “sample”, it is meant a nucleic acid extract of a cell(s), tissue, or organ taken directly from a biological specimen, human or animal subject, or cell(s) maintained in culture or from a cultured cell line, a cell lysate or cell extract, a solution containing one or more molecules derived from a cell, cellular material, or viral material (e.g. a polypeptide or nucleic acid). A sample may also be a nucleic acid extract of any body fluid or excretion (for example, but not limited to, blood, urine, stool, saliva, tears, bile, or cerebrospinal fluid) that may or may not contain host or pathogen cells, cell components, or nucleic acids. Samples may also include a nucleic acid extract of an environmental sample such as, but not limited to, soil, water (fresh water, wastewater, etc.), air monitoring system samples (e.g., material captured in an air filter medium), surface swabs, and vectors (e.g., mosquitos, ticks, fleas, etc.). In some embodiments, the microfluidic device according to the invention comprises an inlet in fluid communication with the flow channel via which the sample can be introduced. In some embodiments, the microfluidic device according to the invention comprises an outlet in fluid communication with the flow channel via which the sample may exit.

[0048] In some embodiments, the microfluidic chip is configured to receive at least one wash solution. Said wash solution (or wash buffer) may be any solution or buffer which are well known in the art to remove contaminants from the capture surface such as enzymes, deoxyribonucleosides triphosphate (dNTPs), nucleosides triphosphate (NTPs), and unbound nucleic acids. Accordingly, the wash solution may comprise water, wash buffer, detergent, salts, or any combination thereof. In some embodiments, the at least one wash solution according to the invention washes the capture surface before each reading. In some embodiments, the at least one wash solution according to the invention washes the capture surface at periodic intervals. In some embodiments, the at least one wash solution according to the invention is placed between the sample and the reading fluid. In some embodiments, the microfluidic chip according to the invention comprises more than one wash solution to improve the reading of an amplification signal.

[0049] By “nucleic acid”, it is meant a naturally occurring or synthetic polynucleotide, or polynucleotide chain comprising individual nucleic acid residues. Said nucleic acid may be DNA, ribonucleic acid (RNA) or DNA-RNA hybrid, and can include triple-, double-, and single-stranded molecules. In particular, nucleic acids can include, without limitation, DNA, RNA, messenger RNA (mRNA), ribosomal RNA (rRNA), complementary DNA (cDNA), genomic DNA (gDNA), single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), or any combination thereof. By “target nucleic acid”, it is meant the nucleic acid one wish to amplify.

[0050] In some embodiments, the microfluidic chip is configured to receive a reading fluid. Said reading fluid may be any gas or buffer known in the art to not interfere with the used detection mean. In some embodiments, the reading fluid is water. In some embodiments, the reading fluid is air. Preferably, the reading fluid is adapted to improve signal detection. In some embodiments, the reading fluid is a buffer identical to the wash buffer. In some embodiments, the reading fluid is also a wash solution.

[0051] The microfluidic device according to the invention comprises a heating plate comprising at least two heating zones at constant temperature spaced along the flow channel. In some embodiments, the microfluidic device according to the invention comprises at least one heating plate configured to heat a first heating zone at a first temperature that is constant and a second heating zone at a second temperature that is constant and different to the first temperature. In some embodiments, the microfluidic device according to the invention comprises a heating plate configured to heat a first heating zone at a first temperature that is constant and a second heating zone at a second temperature that is constant and different to the first temperature. In some embodiments, the microfluidic device according to the invention comprises two heating plates, a first heating plate configured to heat a first heating zone at a first temperature that is constant and a second heating plate configured to heat a second heating zone at a second temperature that is constant and different to the first temperature. Preferably, a temperature controller regulates the temperature of each one of the heating zones. Said heating zones may be of different length. In some embodiments, said heating plate comprises two heating zones. In some embodiments, said heating plate comprises three heating zones. In particular, the first heating zone is at a temperature that is constant for the amplification reaction, more particularly for the denaturation step of the amplification reaction. Still in particular, the first heating zone could be at a constant temperature for a reverse transcriptase reaction taking place before the amplification reaction, in particular before the denaturation step of the amplification reaction, this constant temperature used for the reverse transcriptase reaction being the same or being different from the constant temperature used for the amplification reaction and in particular for the denaturation step. By “heating plate”, it is meant any device or element that can regulate temperature of the heating zones. The temperature of the heating zones may be controlled by any temperature controller known in the art including, but not limited to, a Peltier device, a heat exchanger, a resistance heater, an induction heater, an electromagnetic heater, a thin film heater, and combinations thereof. By “temperature controller”, it is meant a device that adds heat to or removes heat from a sample.

[0052] By “primer”, it is meant a single-stranded oligonucleotide capable of acting as a point of initiation of template-directed DNA or RNA synthesis under appropriate conditions (i.e., in the presence of four different nucleosides triphosphates or deoxyribonucleosides triphosphate, and an agent for polymerization, such as, DNA or RNA polymerase or reverse transcriptase) in an appropriate buffer and at a suitable temperature. A primer according to the invention is designed to prime polymerization of nucleotides, for example by solid-phase PCR or by primer extension. Said primer can base-pair to a second nucleic acid molecule that contains a complementary sequence (herein described as the “target nucleic acid”). In some embodiments, said primer can base-pair to a second nucleic acid molecule that contains a complementary sequence (herein described as the “target nucleic acid”) by its 3’ part, and its 5’ part corresponds to a defined and unique sequence per target nucleic acid thereafter referred to as “unique tag”. By “complementary”, it is meant that one nucleic acid hybridizes selectively to, another nucleic acid molecule. Said primers may be forward or reverse primers. In some embodiments, the primers are solid-phase, they are grafted on the capture surface. In some embodiments, the primers are liquid-phase primers. In some embodiments both solid-phase and liquid-phase primers are present. In some embodiments, the primers grafted on the capture surface are reverse primers. In some embodiments, the primers grafted on the capture surface are forward primers. In some embodiments, the primers grafted on the capture surface are complementary to the unique tags. In some embodiments, the primers on the capture surface are complementary to internal parts of amplified targets in liquid-phase, allowing solid-phase / grafted extension and amplification with a second level of specificity. In some embodiments, the primers may comprise modified NTPs, or dNTPs. In some embodiments, the primers may comprise fluorescent NTPs, or dNTPs.

[0053] According to the invention, primers are grafted on a capture surface of the flow channel and aligned with the second heating zone to facilitate amplification and detection reactions. According to the invention, primers are grafted on the capture surface of the flow channel for priming polymerization of nucleotides and / or primer extension. Said primers may be grafted by any methods well-known in the art. In some embodiments, the primers are grafted covalently to the capture surface. In one embodiment, only reverse primers are grafted on the capture surface. In another embodiment, only forward primers are grafted on the capture surface. In one embodiment, only sensitivity defining primers are grafted on the capture surface. By “sensitivity defining primers”, it is meant oligonucleotides designed to increase the sensitivity of the PCR, i.e the probability of a positive detection of a nucleic acid target.

[0054] By “capture surface”, it is meant the flow channel surface on which primers are grafted allowing for solid phase amplification. According to the invention, the capture surface is aligned with the heating zone (e.g. the second heating zone), which is the amplification zone in which annealing and extension can occur. With such an approach, when the sample is aligned on the second heating zone, it is in the flow channel part comprising the capture surface that annealing and extension can occur in both a liquid phase and a solid phase. In some embodiments, negative control primers and / or location markers such as a fluorescent dyes (e.g. fluorescein (FAM)) are also grafted on the capture surface.

[0055] Said solid phase comprises the primers grafted in the capture surface. Said liquid phase may further be a sample solution comprising free oligonucleotides. The combination of a liquid phase and a solid phase amplification accelerates and facilitates the solid-phase reaction and fewer amplification cycles are necessary for detection. It further allows the use of detectable molecules (i.e. fluorescent primers, fluorescent dNTPs, etc.) without interfering with the reading of the array or the need of signals blockers, like quenchers of fluorochromes. The amplification products can also be detected in real-time.

[0056] The appropriate length of a primer depends on the intended use of the primer but typically is at least 7 nucleotides long and, more typically range from 10 to 30 nucleotides in length. Other primers can be somewhat longer such as 30 to 50 nucleotides long. Short primer molecules generally require cooler temperatures to form sufficiently stable hybrid complexes with the template. A primer needs not reflect the exact sequence of the template but must be sufficiently complementary to hybridize with a template. The term “primer site” or “primer binding site” refers to the segment of the target DNA to which a primer hybridizes. The term “primer pair” means a set of primers including a 5' upstream primer that hybridizes with the complement of the 5' end of the DNA sequence to be amplified and a 3’ downstream primer that hybridizes with the 3' end of the sequence to be amplified. In some embodiments, primers are detectably-labeled, either radioactively, fluorescently, or non- radioactively, by methods well-known to those skilled in the art. By “aligned”, it is meant that an element of the flow channel, e.g the sample or the wash solution, a capture surface or primers is / are placed inside the flow channel so that it is located in regard with a certain heating zone and can be heated or cooled to reach the temperature of said heating zone. Said flow channel can be placed above or under the heating plate, preferably above. By “aligned”, it is also meant that a capture surface or primers is / are placed inside the flow channel so that it is located in regard with the heating zone allowing annealing and / or elongation / extension, or amplification.

[0057] Traditional thermocycling devices comprise a heater that raises and lowers the temperature of a sample to perform a number of cycles of annealing, elongation (also described herein as extension), and denaturation. In contrast, the device according to the invention can achieve high speed thermal cycling because there is no need to ramp the temperature to the desired level as the temperature of the two heating zones is constant.

[0058] The temperature within the at least two heating zone is selected to promote the major processes involved in nucleic acids amplification, namely denaturation of the nucleic acids, annealing of primers to the target nucleic acid, and extension of the primers.

[0059] In some embodiments, the temperature of the first heating zone is higher than the temperature of the second heating zone. In some embodiments, the first heating zone is a denaturation zone and the second heating zone is an amplification zone. In some embodiments, the first heating zone is a denaturation zone and the second heating zone is an annealing and extension zone. By “the first heating zone is a denaturation zone”, it is meant that the first heating zone is set to a temperature that is optimal for denaturation of the nucleic acids. By “the second heating zone is an amplification zone” or “the second heating zone is an annealing and extension zone”, it is meant that the second heating zone is set to a temperature that is optimal for annealing (or hybridization) and extension processes associated with the amplification reaction. In some embodiments, the second heating zone has a limited range of temperature from about 45°C to about 72°C and can be set to an annealing temperature from about 45°C to 72°C, for example from about 55°C to 70°C, for example about 56, 58, 60, 62, 64, 66, 68 or 70°C, and preferably about 60°C before being raised, or not, to an extension temperature from about 60°C to 72°C, for example about 60, 65, 70 or 72°C, and preferably about 72°C. It is understood that the annealing temperature cannot be above the extension temperature. In some embodiments, the second heating zone is configured to reach about 45°C to about 72°C, for example from about 55°C to 72°C, for example about 56, 58, 60, 62, 64, 66, 68, 70°C, and preferably about 60°C. In some embodiments, the first heating zone is configured to reach about 94 to about 98°C, preferably about 95°C and the second heating zone is configured to reach about 45°C to 72°C, for example about 50°C to 65°C, for example 52, 55, 57 or 59°C, and preferably about 60°C.

[0060] In some embodiments, the microfluidic chip further comprises an intercalating fluid that is non-miscible with the content of the flow channel such as an interspacing liquid, for example mineral oil. In some embodiments, the microfluidic chip further comprises a solid such as a valve, a tap, a piston or plug that is movable inside the flow channel along with the sample, the wash solution or buffer, and / or the reading solution. Said solid separates the different elements of the mobile phase inside the flow channel. In some embodiments, said intercalating fluid according to the invention washes the capture surface, preferably before each reading.

[0061] In some embodiments, the microfluidic device according to the invention further comprises at least one pump to repeatedly translate the sample from one heating zone to another. By increasing or decreasing pressure inside the flow channel, said at least one pump allows the sample solution to flow horizontally back and forth between the at least two heating zones while the flow channel remains fixed. However, a wide variety of other techniques can be utilized to move the sample between the at least two heating zones. In some embodiments, the microfluidic device according to the invention further comprises at least one piston to repeatedly translate the sample from one heating zone to another. In some embodiments, the microfluidic device according to the invention comprises one reversible pump to push and pump the sample inside the flow channel. In some embodiments, the microfluidic device according to the invention comprises a unidirectional pump in one extremity of the flow channel, which pushes the mobile phase(s) inside the flow channel. In such embodiments, the mobile phase(s) come back automatically to their original position when the pump is stopped. In some embodiments, the microfluidic device according to the invention comprises two pumps at each extremity of the flow channel, one pump being used to push the sample in one direction, the other pump being used to push the sample in the opposite direction. In some embodiments, no pumps or pistons are needed to move the sample inside the flow channel. In some embodiments, the sample circulates by convection flow.

[0062] In some embodiments, when the sample is aligned with the first heating zone, the wash solution is aligned with the second heating zone. When the sample is translated to the second heating zone, the wash solution is moved away from the second heating zone allowing to wash the capture surface from any unbound molecules. It is possible to regulate how long the sample is exposed to each heating zones.

[0063] The device according to the invention allows reactions to be conducted with very small reaction volume. The flow channel according to the invention may vary in size and shape. In some embodiments, the flow channel is rectangular. In a preferred embodiment, the flow channel is cylindrical. In some embodiments, the diameter or height of the flow channel is constant. In some embodiments, the diameter or height of the flow channel is from about 0.1 pm to about 1 cm, or from about 1 pm to about 500pm, or from about 10 pm to about 100 pm, and is preferably about 100 pm. In some embodiments, the diameter or width is from about 0.1 pm to about 1 cm, or from about 1 pm to about 500pm, or from about 10 pm to about 200 pm, and is preferably about 200 pm. In some embodiments, some part of the flow channel is enlarged to form reaction chambers. The diameter or height of said reaction chambers may be from about 1 pm to about 1 cm, and is preferably from 10 pm to about 100 pm. In some embodiments, the two heating zones according to the invention have a length from about 0.1 cm to about 2 cm, preferably about 0.5 cm. In some embodiments, the microfluidic chip is configured to receive a sample having a volume smaller than 20 pL, preferably smaller than 10 pL. In some embodiments, the microfluidic chip is configured to receive a sample having a volume comprised from 10 nL to 20 pL, in particular from 10 nL to 10 pL, more particularly from 10 nL to 2.5 pL or from 10 nL to 1 pL.

[0064] In some embodiments, the device according to the invention is about the size of a credit card. In some embodiments, the device according to the invention has a thickness of less than 10 mm, less than 5 mm or less than 1 mm. Preferably, the device according to the invention has a thickness of less than 5 mm.

[0065] The device according to the invention may include a detection zone at which amplified products can be detected. By “detection zone”, it is meant the portion of the microfluidic device at which detection occurs. This detection zone may include detectors that are incorporated into the device. As a variant, detectors are not incorporated into the device. In some embodiments, the detection zone is aligned with the second heating zone. In some embodiments, the detection zone is aligned with the amplification zone. In some embodiments, the detector is positioned to detect fluorescence from the amplified nucleic acids. In some embodiments, the detector can detect several fluorescence channels. In some embodiments, the detector can detect only one fluorescence channel. In some embodiments, the microfluidic device according to the invention comprises a plurality of flow channels in order to amplify multiple target nucleic acids simultaneously in a multiplexing assay or serial of assays. In some embodiments, the at least one flow channel according to the invention comprises a plurality of flow channels, wherein each flow channel is configured to receive a sample and comprises primers, that are grafted on the capture surface of the considered flow channel, the primers being specific to a certain target. In some embodiments, the plurality of flow channels are on the same plane and / or parallel. Said primers may be complementary with different targets in separate flow channels. In some embodiments, each primer in each flow channel is detected by a different fluorescent dye. In some embodiments, each primer in each flow channel is detected by the same fluorescent dye. In some embodiments, each flow channel allows for the amplification of one specific target on the capture surface. Thus, as the location of each amplified target is known, only one fluorescent channel may be necessary to co-detect multiple targets. The number of targets is therefore limited to the multiplexing of primers in solution, therefore allowing a dozen to thousands targets to be discriminated. This is very different from actual techniques that are limited to the simultaneously detection of only 4 or 5 targets as they need several fluorescent channels.

[0066] Amplification reactions that can be performed with the microfluidic device according to the invention include, but are not limited to, polymerase chain reaction (PCR), and other nucleic acid-based sequence amplification.

[0067] Method of rapid amplification

[0068] The present invention further relates to a method of rapid amplification of target nucleic acids comprising the steps of: a) providing the microfluidic device according to the invention, b) introducing a sample into the flow channel, c) aligning the sample with a first heating zone to effect denaturation, d) aligning the sample with a second heating zone and the capture surface to effect amplification of the target nucleic acids, and e) repeating step c) and step d) so that the sample goes back and forth between the at least two heating zones to effect thermal cycling.

[0069] While PCR is the amplification method described herein, it is understood that any amplification method that uses a primer may be suitable, in particular thermocycling amplification methods. In some embodiments, the method according to the invention is a method of rapid real-time one-step amplification and detection of target nucleic acids.

[0070] In some embodiments, the sample is introduced into the flow channel along with one or more reactants. In some embodiments, the sample is introduced along with amplification reagents selected from, but not limited to, primers, dNTPs, NTPs, polymerase, buffers, dsDNA dye, and co-factors. In some embodiments, amplification reagents further comprise a dye specific for dsDNA. In some embodiments, said primers are only forward primers. In some embodiments, said primers are only reverse primers. There are four dNTP typically used for PCR reactions: dATP (deoxyadenosine triphosphate), dCTP (deoxycytidine triphosphate), dGTP (deoxyguanosine triphosphate), dTTP (deoxythymidine triphosphate). In some embodiments, when the sample comprises RNA, the amplification reagents comprise NTPs (ATP, CTP, GTP, and UTP). Said dNTPs (or NTPs) may be modified dNTPs (or NTPs). The term “modified dNTPs” or “modified NTPs” refer to modification with respect to the four dNTPs (dATP, dGTP, dCTP, and dTTP) or NTPs (ATP, GTP, CTP, and UTP). Said modifications can include, for example, backbone modifications, sugar modifications or base modifications. Modified nucleotides can be synthesized by any useful method known in the art, such as chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleotides.

[0071] In some embodiments, at least one, at least two, or at least three dNTPs are labeled, especially fluorescent. In some embodiments, all dNTPs are labeled, especially fluorescent. In some embodiments, all dNTPs are linked to the same fluorochrome. In some embodiments, forward primers are fluorescent. In some embodiments, reverse primers are fluorescent.

[0072] Once the sample is introduced into the flow channel of the microfluidic device, the sample is repeatedly move from one heating zone to the other at fixed temperature chosen to promote reaction between the sample and the one or more reactants leading to the formation of an amplified product. The sample is exposed to several thermal cycle until an amplified product is formed and can be detected. By “thermal cycle” or “thermal cycling”, it is meant the completion of the three phases involved in PCR reactions: denaturation, annealing and extension. Each thermal cycle may be completed by repeating step c and d of the method according to the invention.

[0073] The method according to the invention effects extension of primers and / or amplification of the target nucleic acids simultaneously from the primers grafted on the capture surface and from free primers in the liquid phase. In some embodiments, the amplified products can be detected after a lower number of thermal cycles than a conventional PCR. In some embodiments, the amplified products can be detected after less than 25 cycles. In some embodiments, the amplified products can be detected after only 10 to 20 thermal cycles. Reducing the number of thermal cycles to effectively detect a specific target significantly lowers the necessary amplification reaction time.

[0074] The sample is repeatedly exposed to the at least two heating zones in a cyclic fashion whereas the flow channel remains fixed. Thus, it allows for a high ramping rate as only the sample needs to be heated. This is very different from microfluidic devices in which the heater is translated between different reaction zones and which require the flow channel to heat up or cool down.

[0075] The method according to the invention further enables detection, and optionally quantification or semi-quantification, of target nucleic acids in a sample. In some embodiments, the method according to the invention further comprises a step of detection of amplified products on the second heating zone after each thermal cycle. In some embodiments, the method according to the invention further comprises a step of detection of amplified products on the second heating zone after a certain number of thermal cycles, for example from the first, from the second, from the third or more thermal cycle. The resulting amplified product can be detected according to the methods described herein. In some embodiments, the detection of amplified products is conducted in the second heating zone after the sample have been translated from the second heating zone to the first heating zone. In particular, the detection step occurs when the sample is not aligned with the second heating zone, allowing the detection to occur during the cycling process without affecting the duration of each step, and therefore accelerating the overall process compared to other traditional systems. Thus, the method according to the invention may allow for real-time amplification. By “real-time amplification”, it is meant that the accumulation of amplification product is measured as the reaction progresses, in real time, with product quantification after each thermal cycle.

[0076] A wide variety of detection means can be used to detect the amplified product depending on the nature of the reactant and / or product being detected. The detection of amplified products can be performed by any physical, chemical, electromagnetic and other analytical techniques described in the art. In some embodiments, the method according to the invention uses labels such as radioisotopes, fluorophores, chromophores, mass labels, electron dense particles, magnetic particles, or molecules that emit chemiluminescence. Preferably, amplified products are detected by fluorescence. The detection methods include, but are not limited to, light scattering, multichannel fluorescence detection, UV and visible wavelength absorption, luminescence, differential reflectivity, and confocal laser scanning. Applications can also utilize scintillation proximity assay techniques, radiochemical detection, fluorescence polarization, fluorescence correlation spectroscopy (FCS), time-resolved energy transfer (TRET), fluorescence resonance energy transfer (FRET) and variations such as bioluminescence resonance energy transfer (BRET), electrical resistance, resistivity, impedance, voltage sensing and surface plasmonic resonance (SPR).

[0077] One method for detecting the amplified product is the use of dsDNA binding dyes. By “dsDNA binding dyes”, it is meant dyes that fluoresce differentially when bound to doublestranded DNA than when bound to single-stranded DNA or free in solution, usually by fluorescing more strongly. Suitable dyes may be SYBR® Green. Thus, as the amplification reaction progresses, an increasing amount of dye becomes bound and is accompanied by a concomitant increase in signal. Fluorescence detection is therefore indicative of an amplification of one (or more) target(s). When the sample is aligned with the first heating zone, remaining fluorescence and its position(s) is indicative of the identity of the detected target(s)

[0078] In some embodiments, labeled primers and / or nucleotides are utilized. Hence, product formed as the result of primer extension is labeled because of the labeled primer and / or the labeled nucleotides that are incorporated into the extension products. A wide variety of labels can be utilized to label the primer and / or nucleotides. In some embodiments, the amplified product is detected using fluorescence-tagged dNTP for base extension.

[0079] In some embodiments, said target nucleic acids are amplified simultaneously in a solid phase and a liquid phase. When the sample is aligned with the second heating zone, in particular the amplification zone, and the capture surface, the steps of annealing and extension of the target nucleic acids can occur with the primers in the sample solution (liquid-phase amplification) as well as with the primers grafted on the capture surface (solid phase amplification). Thus, a positive signal can be more quickly detected.

[0080] In some embodiments, the signal enhancement acquired at each thermal cycle by the method according to the invention is significantly superior to the signal enhancement acquired by a PCR. In some embodiments, the signal enhancement acquired at each thermal cycle by the method according to the invention is superior by at least 3-fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 50-fold, or at least 200-fold than the signal enhancement acquired by a PCR, depending on the size of the extended targets. Thanks to the rapid signal enhancement, the method according to the invention allows for a faster detection of the presence of a target nucleic acid with a fewer number of thermal cycles.

[0081] In some embodiments, the method according to the invention is used to detect an amplified product and is completed in 25 minutes or less, 15 minutes or less, 5 minutes or less, or 1 minute or less. In some embodiments, each thermal cycle is completed in 10 seconds or less, or 5 seconds or less.

[0082] In some embodiments, the amplification of target nucleic acids is multiplexed. The method may be performed in a multiplexing format in which multiple target nucleic acids are simultaneously amplified. In some embodiments, each flow channel allows for the amplification of one specific target on the specific capture surface. In some embodiments, each primer, in each flow channel are detected by a different fluorescent dye. In some embodiments, each primer, in each flow channel are detected by the same fluorescent dye, which allows for the use of a single-channel detector.

[0083] In some embodiments, the kit according to the invention comprises: a) a microfluidic chip, wherein said microfluidic chip comprises: at least one flow channel configured to receive a sample and comprising a capture surface , and

[0084] Primers, that are grafted on the capture surface of the at least one flow channel; and b) a heating plate comprising two heating zones including a first heating zone and a second heating zone, the heating plate being configured to heat: the first heating zone at a first temperature that is constant, and the second heating zone at a second temperature that is constant and different to the first temperature; and c) at least one vial.

[0085] Said at least one vial may be chosen from a wash buffer, a reading buffer, amplification reagents, or an interspacing fluid or liquid. Said amplification reagents may be selected from, but not limited to, primers, dNTPs, NTPs, polymerase, buffers, co-factors, dsDNA dye, and any combinations thereof.

[0086] In some embodiments, the kit according to the invention comprises: a) a microfluidic chip, wherein said microfluidic chip comprises (i) at least one flow channel configured to receive a sample, and primers grafted on a capture surface of the at least one flow channel; b) a heating plate comprising two heating zones including a first heating zone and a second heating zone, the heating plate being configured to heat: the first heating zone at a first temperature that is constant, and the second heating zone at a second temperature that is constant and different to the first temperature; and c) a vial comprising a wash buffer; d) a vial comprising a reading buffer; e) a vial comprising amplification reagents; and f) a vial comprising an interspacing liquid.

[0087] In some embodiments, the reading buffer is identical to the wash buffer.

[0088] Applications

[0089] The microfluidic device according to the invention and methods using the same can be used as an analytical tool to amplify a target nucleic acid potentially present in a sample and then to detect the amplified product to determine whether the target nucleic acid is present or absent in the sample. Amplification serves to enhance the ability to detect target nucleic acids present at low levels. Thus, the microfluidic device can be used in various diagnostic applications that involve a determination of whether a particular nucleic acid is present in a sample.

[0090] The microfluidic device and the method according to the invention may be used to detect and determine a wide variety of nucleic acid sequences from a wide variety of samples, including, human, veterinary, industrial, and environmental. Hence, samples can be tested for the presence of a particular nucleic acid associated with particular pathogens (e.g., certain viruses, bacteria or fungi), for identification purposes, such as in paternity and forensic cases, or to detect specific nucleic acids that are correlated with infectious diseases, genetic disorders or cellular disorders (e.g., oncogenes associated with cancer).

[0091] FIGURES

[0092] Figure 1. Schematic representation of an exemplary microfluidic device with linear flow channel(s) for rapid amplification of target nucleic acids. Figure 2. Schematic representation of thermal cycling performed with the microfluidic device with linear flow channel(s).

[0093] Figure 3. Schematic representation of thermal cycling performed with the microfluidic device with reaction chambers separated by a flow channel built as a serpentine in order to save space on the microfluidic chip.

[0094] Figure 4. Example of one microfluidic device for rapid specific detection of nucleic acids.

[0095] Figure 5. Illustration of the back and forth move of the sample across the different areas of the flow channel: the denaturation zone and the amplification zone.

[0096] Figure 6. Schematic molecular description of the functioning of the invention in one of its embodiments. A, description of the principal molecular components used for rapid detection of a SARS-CoV 2 DNA target. B, illustration of results obtained on the capture surface.

[0097] Figure 7. Illustration of real-time results of the detection of the equivalent of 104copies of SARS-CoV2 RNA genome with a flow channel encompassing an array of grafted primers.

[0098] EXAMPLES

[0099] The figures and examples presented herein as only exemplary and demonstrative embodiments without limiting the scope of the present invention.

[0100] The microfluidic device shown in Figure 1 is useful for conducting real-time PCR reactions. It comprises at least one flow channel 1 comprising a sample 2, and optionally a reading fluid 3; and a heating plate 4 including a first heating zone 5 and a second heating zone 6. The sample and the reading fluid may be delimited by an interspacing liquid 8. Inbetween these two elements, a wash solution 11 mays also be added, also delimited at each border by an interspacing liquid 8. Primers are grafted on a capture surface 7 of the flow channel and aligned with the second heating zone. The device may comprise a detection device 9 aligned with the second heating zone and at least one pump 10 to repeatedly translate the sample from one heating zone to the other.

[0101] Figure 2 represents nucleic acid amplification by thermal cycling using the method described herein. The sample 2 is charged with all the reagents necessary for nucleic acid amplification such as nucleic acid target, forward and revers primers, polymerase, and fluorescent dNTPs. To improve the yield of solid-phase amplification, if reverse primers are grafted onto the capture surface 7 than a lower concentration of free / liquid-phase reverse primers are used compared to forward free / liquid-phase primers. During step N.1 of a thermal cycle N, the sample is aligned with a first heating zone 5 at a constant denaturation temperature (e.g 95°C) that allows denaturation of the nucleic acid target, and the reading fluid 3 is aligned with a second heating zone 6 at a constant amplification temperature (e.g 60°C). Reverse primers are grafted on the capture surface 7 of the flow channel that is aligned with the second heating zone. A light excitation is emitted by the fluorescence detector 9 on the second heating zone. During the first cycle, no signal is detected as nucleic acid amplification has not yet occurred. During step N.2 of a thermal cycle N, the sample is translated inside the flow channel 1 (e.g by the means of a pump 10) and aligned with the second heating zone 6 at a constant amplification temperature which allows for both liquidphase and solid-phase amplification of the nucleic acid target. During step 1 of the next cycle, (i) the sample is moved back to the first heating zone 5 to allow for denaturation of the nucleic acid target as well as the liquid-phase amplified products, (ii) the second heating zone is washed by the motion of the wash solution 11 to wash the capture surface from any unbound molecules, (iii) when the reading fluid is moved back to the second heating zone a light excitation is emitted by the fluorescence detector on the second heating zone to detect solid-phase amplified products. At each cycle, the signal is exponentially increased and thermal cycling is conducted until a significant signal is detected to determine the presence of a target nucleic acid.

[0102] The device shown in Figure 3 represents an alternative microfluidic chip according to the invention comprising at least one flow channel 1 comprising two reaction chambers separated by a serpentine.

[0103] During step N.1 of a thermal cycle N, the sample 2 is aligned with a first heating zone 5 at a constant denaturation temperature (e.g 95°C), and the reading fluid 3 is aligned with a second heating zone 6 at a constant amplification temperature (e.g 60°C). Primers are grafted on the capture surface 7 of the second reaction chamber of the flow channel that is aligned with the second heating zone 6. The sample and the reading fluid may be delimited by an interspacing liquid 8. In-between these two elements, a wash solution may also be added, also delimited at each border by an interspacing liquid.

[0104] During step N.2 of a thermal cycle N , the sample 2 is translated inside the serpentine part of the flow channel (e.g by the means of a pump 10) to the second reaction chamber and aligned with the second heating zone 6 at a constant amplification temperature which allows for both liquid-phase and solid-phase amplification of the nucleic acid target.

[0105] The device shown in Figures 4, 5 and 7 is one example dedicated to the rapid detection of SARS-CoV-2 virus, to illustrate some benefits of the present invention in a simple realization, here to rapidly detect SARS-CoV-2 virus with a NAAT (Nucleic Acid Amplification Testing). The microfluidic chip was made by two pieces in polydimethylsiloxane (PDMS) 15 and 16, using molds fabricated by 3-dimensional (3D) printing using biocompatible material (Biomed, Formlabs). Then polydimethylsiloxane (PDMS) materials are used to make the replica structure. The microfluidic flow channel has a first enlarged zone referred to as the upper chamber 17. The upper chamber 17 is placed on a first heater made from a nichrome wire (NI80-012, OMEGA Engineering inc.) configured to heat a first heating zone 5, the wire being wrapped around a 3D-printed substrate that is attached to a customized aluminum block. Another enlarged zone, referred to as the lower chamber 18, stands at the opposite of the microchannel: this part is placed on a second heater built similarly and configured to heat a second heating zone 6. The first heating zone 5 can be initially set at a temperature of 45°C to perform a reverse transcription reaction before beingraised and fixed at 95°C for the denaturation step of the PCR reaction. The second heating zone 6 has a fixed temperature of 60°C. In the lower chamber 18, an array of 3 x 3 spots (corresponding to the capture surface 7) has been designed with amino- 06 oligonucleotides attached to the surface via the amino linker. Attachment of the probes to the PDMS surface is performed via covalently binding. Briefly, the PDMS is subjected to oxygen plasma treatment and immersed in 5% (3-Aminopropyl) triethoxysilane solution. After washing, the surface is immersed in a 5% glutaraldehyde solution. Finally, the probes are spotted on their respective lanes. A first lane 12 of 3 control-signal probes of sequence SEQ ID NO: 1 : GTAATTGATTAGCTTGTCGTTGTGA, being labelled in 3’ with the fluorescent molecule FAM and with an amino linker in 5’, are spotted (total sequence: 5’ NH2-C6- GTAATTGATTAGCTTGTCGTTGTGA-FAM 3’) in order to use this fluorescence signal as a signal control and to determine the location of other fluorescent signals. Another lane 14 of 3 spots of 5’-amino oligonucleotides of sequence SEQ ID NO: 2: GCCCTGGTCAAGGTTAATATAGGCATTAAC, corresponding to the sequence of a SARS- CoV-2 reverse primer with an amino-linker at its 5’ end (NH2-C6-SC2-Rv: 5’ NH2-C6- GCCCTGGTCAAGGTTAATATAGGCATTAAC 3’) is spotted. At last, another lane 13 of 3 spots is spotted corresponding to a 5’-amino oligonucleotide (Negative control (NegCTRL) primer, of sequence SEQ ID NO: 3: TCCAGCCTCATCTGCCAGGTCTACT with an amino- linker at its 5’ end: 5’ NH2-C6-TCCAGCCTCATCTGCCAGGTCTACT 3’). These last oligonucleotides have no homology to SARS-CoV-2 genome so that they should not lead for an amplicon when used in a standard PCR reaction, either alone or with SARS-CoV-2 forward or reverse primers (SC2-Fw or SC2-Rv).

[0106] Figure 5 describes the functioning of the reaction with this device. The liquid reaction mix corresponds to a synthetic RNA control for SARS-CoV-2 (GenBank accession no. MN908947.3). The liquid reaction mix encompasses a RT-PCR mix (here the SensiFAST™ Probe No-ROX One-Step kit from Meridian Bioscience) and primers specific to a part of the SARS-CoV-2 genome. Reverse Transcription is performed in the upper chamber 17 at 45°C. Next, the temperature of the upper chamber 17 is increased to 95°C to allow polymerase activation for 1 min. Then, PCR amplification is performed at 95°C in the upper chamber 17 and then transferring the solution to the lower chamber 18 to perform annealing and extension at 60°C. This back and forth move of the reaction mix is performed by regular mechanical pressure and release of a piston 19 placed above the upper chamber 17 (Figure 5 at the upper left part). This piston is lowered and enters in contact with the flexible upper layer part 16 of the microfluidic device. This exerts a pressure which pushes the liquid (the denatured PCR reaction mix) into the lower chamber 18 where primers are engrafted on the capture surface 7 (Figure 5, right part). Due to the lowered temperature, DNA target (SARS-CoV-2 cDNA) hybridizes with complementary sequences of primers, those in the liquid reaction mix (SC2-Fw; SC2-Rv) as well with the ones which are complementary and spotted (NH2-C6-SC2-RV primers on lane 14). This primes the extension of primers, like in a standard PCR, as well in the liquid phase or on the support: one cycle of reaction has been performed. The piston 19 is raised, leading the liquid reaction mix to leave the lower chamber 18 and its return into the upper chamber 17 where one new cycle of denaturation begins. At this specific phase, only solid-phase amplicons generated in the lower chamber 18 are still present in this zone, while other components are back into the denaturation zone (liquid PCR reaction mix and liquid new generated amplicons). Another round of this cycle is performed, and so on, leading to an increase amount of solid-phase bound amplicons in specific locations of the capture surface 7 of the lower chamber 18. These specific amplicons can be detected at each cycle of the PCR reaction, when the liquid reaction mix is moved backward into the upper chamber 17 (i.e. when the piston 19 is raised), for example using fluorescence.

[0107] Figure 6 gives a schematic molecular description of the functioning of the invention in one of its embodiments. Part A of Figure 6 highlights the principal molecular components used for rapid detection of a SARS-CoV 2 DNA target (with omission of enzyme and other components for clarity). Part B illustrates the results of the reaction taking part in the lower chamber 18, and more specifically at the interface solid-liquid on the support, where SC2- Rv primers and NegCTRL primers are bound on the capture surface 7. When the reaction mix is present in the lower chamber 18 placed on the second heating zone 6, i.e. when the piston 19 of Figure 5 is pushed down the membrane above the upper chamber 17 placed on first heating zone 5, an extension of the corresponding primer bound to the support occurs taking targeted DNA also amplifying in the liquid reaction part. In this example, only spotted NH2-C6-SC2-Rv primers on lane 14 (SC2) are extended while the NegCTRL primers on lane 13 (NegCTRL) are not. The result of such a reaction can be determined in real-time using fluorescence as a mean, when the liquid reaction is back into the upper chamber 17, i.e. when piston 19 is raised, resulting in no time loss for signal acquisition at every cycle. This fluorescence gain on specific spots in the lower chamber 18 can be achieved for example using dsDNA binding dyes, or fluorescent dNTPs (upper right part of Figure 5B, resulting in much higher fluorescent gain at each new cycle) or, as illustrated lower part of Figure 5B and as shown on Figure 7, using a 5’ FAM- labelled SC2-Fw primer in the reaction mix, instead of a standard, non-fluorescent SC2-Fw primer.

[0108] Figure 7 is a concrete macro-illustration of the realization at various cycles during the reaction, instead of focusing solely on the 3 x 3 spots array corresponding to the capture surface 7. For a 20-pL RT-PCR test, the SensiFAST™ Probe No-ROX One-Step kit from Meridian Bioscience was used. 16pl of RT-PCR master mix, that includes 6pl of purified RNA (10,000 copies in total), is combined with 4pl of a solution of SC2-Fw primers of sequence SEQ ID NO: 4: GATCTCAATGGTAACTGGTATGATTTCGGTG labelled in 3’ with the fluorescent molecule FAM (FAM labelled SC2-FW: 5’ FAM- GATCTCAATGGTAACTGGTATGATTTCGGTG 3’) and of SC2-Rv primers of sequence SEQ ID NO: 2 (Seq: 5’ GCCCTGGTCAAGGTTAATATAGGCATTAAC 3’) mixed in equimolar concentrations (0.4pM). These primers are specific to the SARS-CoV-2 genome and should lead to a 119-bp amplicon of Orflab gene of SARS-CoV-2, in a standard RT- PCR assay. Reverse Transcription was performed in the upper chamber 17 at 45°C. Next, the temperature of the upper was increased to 95°C to allow polymerase activation for 1 min. Then, PCR amplification was performed 5 seconds at 95°C in the upper chamber 17 and then transferring the solution to the lower chamber 18 to perform annealing and extension for 12 seconds at 60°C, by pressure of the piston. Cycles (lasting 17 seconds) were performed by back and forth move of the reaction mix caused by regular mechanical pressure and release of the piston 19 placed above the upper chamber17. Before initiating the reaction, the 3 spots of control-signal probes are detected (corresponding to the lane 12 of three spots in Figures 4 and 5) using the FAM channel of a fluorescence microscope. Once the reaction is initiated, a picture is taken at cycles 5, 15, 25 and 35, when the piston 19 is raised. The fluorescence is therefore detected at any cycle for these spots of FAM- control-signal probes in lane 12, but also in the denaturation zone (corresponding to the upper chamber 17) and around, corresponding to the zones where the liquid reaction mix stands at the time of picture acquisition, due to the presence of free FAM-labelled SC2-Fw primers and liquid-phase amplicons resulting from a FAM-labelled SC2-Fw / SC2-Rv PCR. However, some fluorescence appears specifically at spots of the lane 14, with an increase of its intensity during time course, corresponding to a SARS-CoV-2 specific detection, while lane 13 of NegCTRL primers spots remains non-fluorescent. One cycle, corresponding to one descent and ascent event of the piston 19, lasts for 17 seconds (2 seconds for denaturation, 15 seconds for solid-phase extension) and leads to a 35-cycle reaction in less than 10 minutes, while the detection of a positive signal is already visible after 4 minutes.

Claims

CLAIMS1. A microfluidic device, configured for rapid amplification of target nucleic acids, the microfluidic device comprising: a) a microfluidic chip, comprising: at least one flow channel (1) configured to receive a sample (2) and comprising a capture surface (7), and primers, that are grafted on the capture surface (7) of the at least one flow channel, and b) a heating plate (4), comprising two heating zones, including a first heating zone (5) and a second heating zone (6), the heating plate being configured to heat: the first heating zone (5) at a first temperature that is constant, and the second heating zone (6) at a second temperature that is constant and different to the first temperature, wherein the capture surface (7) is aligned with the second heating zone (6), and wherein the microfluidic chip is positioned on the heating plate.

2. The microfluidic device according to claim 1 , wherein the first temperature is higher than the second temperature.

3. The microfluidic device according to claim 1 or 2, wherein the first heating zone (5) is a denaturation zone and the second heating zone (6) is an amplification zone.

4. The microfluidic device according to any one of the preceding claims, wherein the first heating zone (5) is configured to reach about 95°C and the second heating zone (6) is configured to reach about 45°C to 72°C, for example about 50°C to 65°C, for example 52, 55, 57 or 59°C, and preferably about 60°C.

5. The microfluidic device according to any one of the preceding claims, wherein the microfluidic chip further comprises in the flow channel (1) (i) an interspacing fluid or liquid (8), for example mineral oil, or (ii) an interspacing solid material or plug.

6. The microfluidic device according to any one of the preceding claims, further comprising at least one pump (10) to repeatedly translate the sample from one heating zone to the other.

7. The microfluidic device according to any one of the preceding claims, wherein the microfluidic chip is configured to receive a sample having a volume smaller than about 20 pL, preferably smaller than about 10 pL.

8. The microfluidic device according to any one of the preceding claims, wherein the at least one flow channel (1) comprises a plurality of flow channels, wherein each flow channel is configured to receive a sample (2) and comprises primers, that are grafted on the capture surface (7) of the considered flow channel, the primers being specific to certain target nucleic acids.

9. A method of rapid amplification of target nucleic acids comprising the steps of: a) providing the microfluidic device according to any one of claims 1-8, b) introducing a sample (2) into the flow channel (1), c) aligning the sample with the first heating zone (5) to effect denaturation, d) aligning the sample with the second heating zone (6) and the capture surface (7) to effect amplification of the target nucleic acids, and e) repeating step c) and step d) so that the sample goes back and forth between the two heating zones to effect thermal cycling.

10. The method according to claim 9, wherein the sample is introduced into the flow channel (1) along with amplification reagents such as primers, deoxynucleotides (dNTPs), polymerase, buffers, and co-factors.

11. The method according to claim 10, wherein all or part of dNTPs are fluorescent.

12. The method according to any one of claims 9 to 11 , further comprising a step of detection of amplified products on the second heating zone (6) after each thermal cycle.

13. The method according to any one of claims 9 to 12, wherein target nucleic acids are amplified simultaneously in a solid phase and a liquid phase.

14. The method according to any one of claims 9 to 13, wherein the amplification of target nucleic acids is multiplexed.

15. A kit for rapid amplification of target nucleic acids, the kit comprising: a) a microfluidic chip, wherein said microfluidic chip comprises:at least one flow channel (1) configured to receive a sample (2) and comprising a capture surface (7), and primers, that are grafted on the capture surface (7) of the at least one flow channel, and b) a heating plate (4) comprising two heating zones, including a first heating zone (5) and a second heating zone (6), the heating plate being configured to heat: the first heating zone (5) at a first temperature that is constant, and the second heating zone (6) at a second temperature that is constant and different to the first temperature; and c) at least one vial.

Images