Method for killing target cells

Abstract

The present specification discloses a method for killing target cells. The method for killing target cells uses the principle that cells die when a plurality of double strand breaks occur in the cell genome. Specifically, the method comprises a step for delivering a composition for killing target cells to target cells. The composition for killing target cells comprises a CRISPR complex or CRISPR RNA. Here, the CRISPR RNA collectively refers to mRNA and guide RNA that encode Cas proteins. The method has the following characteristics: 1) a CRISPR complex or CRISPR RNA is used to kill target cells; 2) one type of CRISPR complex capable of target-specifically cleaving the same target sequence or CRISPR RNA expressing same is used; and 3) the method exhibits a cell-killing effect even when only three or four target sites including the same target sequence are included in a target cell.

Description

Targeted cell killing method

[0001] The technology disclosed in this specification relates to a technology for killing cells by cutting multiple sites in the cellular genome using the CRISPR / Cas system. Specifically, it relates to a target-specific cutting technology using the CRISPR / Cas system.

[0002]

[0003] It is well known that the CRISPR / Cas system can generate double-stranded breaks in nucleic acids in a target-specific manner.

[0004] Meanwhile, some prior literature has shown that the CRISPR / Cas system can cause multiple double-stranded nucleic acid breaks in the cell genome, leading to cell death.

[0005] For example, Korean Patent No. 2023577 demonstrated that cells can be killed by targeting multiple targets known to be contained within the cellular genome using the CRISPR / Cas system.

[0006] In addition, Korean Patent No. 2021-0116324 discovered a number of cancer cell-specific SNPs and demonstrated that multiple CRISPR / Cas systems capable of targeting each SNP can be introduced into cells to kill the cells.

[0007] However, previous studies have not comprehensively verified how efficiently the CRISPR / Cas system should be delivered to cells, or at what exact locations double-stranded nucleic acid cleavage should occur to kill cells.

[0008] In particular, in almost all cases, only the vector system was used in the method of delivering the CRISPR / Cas system to cells.

[0009] Moreover, upon closer examination of the experimental results, there are many cases where it is questionable whether the cells should be considered dead.

[0010] [Prior Art Literature]

[0011] [Patent Document]

[0012] Prior patent 1: Korean registered patent no. 2023577

[0013] Prior patent 2: Korean Patent No. 2021-0116324

[0014]

[0015] Limitations of prior art

[0016] Some prior literature suggests that multiple double-stranded nucleic acid breaks within the cellular genome using the CRISPR / Cas system can lead to cell death. For example, Korean Patent No. 2023577 demonstrated that targeting multiple targets known to be present in the cellular genome with the CRISPR / Cas system can induce cell death. Furthermore, Korean Patent No. 2021-0116324 demonstrated that multiple cancer-specific single nucleotide polymorphisms (SNPs) can be identified and multiple CRISPR / Cas systems capable of targeting each SNP can be introduced into cells to induce cell death. However, previous studies have not comprehensively verified how to efficiently deliver the CRISPR / Cas system to cells or the precise number of double-stranded nucleic acid breaks required to induce cell death. In particular, in almost all cases, vector systems were exclusively used for delivering the CRISPR / Cas system to cells. Furthermore, a close examination of the experimental results often raises questions about whether cell death can be truly attributed to the system. Therefore, the method, composition, and conditions that can effectively kill cells using the CRISPR / Cas system have not yet been properly elucidated, and the lower limit of how many double-stranded nucleic acid breaks must occur within the cellular genome before cell death has been elucidated.

[0017] The task to be solved

[0018] The technical challenge of this specification is to elucidate methods, compositions, and conditions that can effectively induce cell death using the CRISPR / Cas system. The technical challenge of this specification is to verify the number of double-stranded nucleic acid breaks required for cell death to occur. Furthermore, by utilizing the results of the verification, the technical challenge is to provide a method for killing cells that contain fewer sites (e.g., three or four) where double-stranded nucleic acid breaks (DSBs) can occur in the cell genome.

[0019]

[0020] To address the above technical challenges, this specification provides a method for inducing multiple double-stranded nucleic acid cleavages by (i) introducing a CRISPR / Cas system into a cell in the form of a ribonucleoprotein (RNP) or (ii) delivering mRNA encoding a Cas protein and guide RNA to the cell. The inventors of this application have discovered that when the CRISPR / Cas system is introduced into a target cell in the form of (i) an RNP or (ii) an mRNA encoding a Cas protein and guide RNA, a superior cell killing effect is observed compared to when the CRISPR / Cas system is introduced into a target cell in the form of a vector. Furthermore, when the CRISPR / Cas system is delivered in the form described above, it was discovered that even if only three or four double-stranded nucleic acid cleavages are simultaneously formed in the cell genome, the cell is killed. On the other hand, when the CRISPR / Cas system is introduced into a cell in the form of a vector under the same conditions, it was discovered that the cell is not easily killed.

[0021] The above inventors provide essential components for performing the above target cell killing method, and additional components that can be added according to the embodiment.

[0022]

[0023] The targeted cell killing method provided in this specification can kill target cells. Since the targeted cell killing method does not affect non-target cells, it can be applied to various therapeutic methods.

[0024]

[0025] Figure 1 shows the experimental results for each example including guide RNAs (MT-3-1 to MT-3-5) targeting three target sites in HCT-116 cells during the cell death experiment according to Experimental Example 2. The graph shows cases where 1) a CRISPR complex was delivered to the target cells (Complex, left group), 2) a CRISPR RNA was delivered (RNA, middle group), and 3) a CRISPR vector was delivered (Vector, right group). For each group, Mock represents a control group without guide RNA, NT represents Non-Target guide RNA, MT50 represents MT-50 guide RNA, and MT-3-1 to MT-3-5 represent examples comprising the respective guide RNAs shown in the table of Experimental Example 2.1. The vertical axis represents the cell viability observed on the 4th day after delivery of each example.

[0026] Figure 2 shows the experimental results for each example including guide RNAs (MT-3-1 to MT-3-5) targeting three target sites in HeLa cells during the cell death experiment according to Experimental Example 2. The graph shows cases where 1) a CRISPR complex was delivered to the target cells (Complex, left group), 2) CRISPR RNA was delivered (RNA, middle group), and 3) CRISPR vector was delivered (Vector, right group). For each group, Mock represents a control group without guide RNA, NT represents Non-Target guide RNA, MT50 represents MT-50 guide RNA, and MT-3-1 to MT-3-5 represent examples having the respective guide RNAs shown in the table of Experimental Example 2.1 as a composition. The vertical axis represents the cell viability observed on the 4th day after delivery of each example.

[0027] Figure 3 shows the experimental results for each example including guide RNAs (MT-4-1 to MT-4-5) targeting four target sites in HCT-116 cells during the cell death experiment according to Experimental Example 2. The graph shows cases where 1) a CRISPR complex was delivered to the target cells (Complex, left group), 2) a CRISPR RNA was delivered (RNA, middle group), and 3) a CRISPR vector was delivered (Vector, right group). For each group, Mock represents a control group without guide RNA, NT represents Non-Target guide RNA, MT50 represents MT-50 guide RNA, and MT-4-1 to MT-4-5 represent examples comprising the respective guide RNAs shown in the table of Experimental Example 2.1. The vertical axis represents the cell viability observed on the 4th day after delivery of each example.

[0028] Figure 4 shows the experimental results for each example including guide RNAs (MT-4-1 to MT-4-5) targeting four target sites in HeLa cells during the cell death experiment according to Experimental Example 2. The graph shows cases where 1) a CRISPR complex was delivered to the target cells (Complex, left group), 2) CRISPR RNA was delivered (RNA, middle group), and 3) CRISPR vector was delivered (Vector, right group). For each group, Mock represents a control group without guide RNA, NT represents Non-Target guide RNA, MT50 represents MT-50 guide RNA, and MT-4-1 to MT-4-5 represent examples comprising the respective guide RNAs shown in the table of Experimental Example 2.1. The vertical axis represents the cell viability observed on the fourth day after delivery of each example.

[0029] Figure 5 shows the experimental results for each example including guide RNAs (MT-5-1 to MT-5-5) targeting five target sites in HCT-116 cells during the cell death experiment according to Experimental Example 2. The graph shows cases where 1) a CRISPR complex was delivered to the target cells (Complex, left group), 2) a CRISPR RNA was delivered (RNA, middle group), and 3) a CRISPR vector was delivered (Vector, right group). For each group, Mock represents a control group without guide RNA, NT represents Non-Target guide RNA, MT50 represents MT-50 guide RNA, and MT-5-1 to MT-5-5 represent examples comprising each guide RNA shown in the table of Experimental Example 2.1. The vertical axis represents the cell viability observed on the 4th day after delivery of each example.

[0030] Figure 6 shows the experimental results for each example including guide RNAs (MT-5-1 to MT-5-5) targeting five target sites in HeLa cells during the cell death experiment according to Experimental Example 2. The graph shows cases where 1) a CRISPR complex was delivered to the target cells (Complex, left group), 2) a CRISPR RNA was delivered (RNA, middle group), and 3) a CRISPR vector was delivered (Vector, right group). For each group, Mock represents a control group without guide RNA, NT represents Non-Target guide RNA, MT50 represents MT-50 guide RNA, and MT-5-1 to MT-5-5 represent examples comprising the respective guide RNAs shown in the table of Experimental Example 2.1. The vertical axis represents the cell viability observed on the 4th day after delivery of each example.

[0031] Figure 7 shows a cell micrograph taken on the 4th day after delivering a CRISPR complex containing each guide RNA to HCT-116 cells during a cell death experiment according to Experimental Example 2. Mock represents a control group without guide RNA, NT represents a non-target guide RNA, MT50 represents an MT-50 guide RNA, MT-3-1 to MT-3-5, and MT-5-1 to MT-5-5 represent examples of CRISPR complexes comprising each guide RNA shown in the table of Experimental Example 2.1. The vertical axis represents the cell viability observed on the 4th day after delivery of each example.

[0032] Figure 8 shows a cell micrograph taken on the 4th day after delivering a CRISPR complex containing each guide RNA to HeLa cells during a cell death experiment according to Experimental Example 2. Mock represents a control group without guide RNA, NT represents a non-target guide RNA, MT50 represents an MT-50 guide RNA, MT-3-1 to MT-3-5, and MT-5-1 to MT-5-5 represent examples of CRISPR complexes comprising each guide RNA shown in the table of Experimental Example 2.1. The vertical axis represents the cell viability observed on the 4th day after delivery of each example.

[0033] Figure 9 shows a cell micrograph taken on the 4th day after delivering CRISPR vectors containing each guide RNA to HCT-116 cells during a cell death experiment according to Experimental Example 2. Mock represents a control group without guide RNA, NT represents a non-target guide RNA, MT50 represents an MT-50 guide RNA, and MT-3-1 to MT-3-5 and MT-5-1 to MT-5-5 represent examples of CRISPR complexes comprising the respective guide RNAs shown in the table of Experimental Example 2.1.

[0034] Figure 10 shows a cell micrograph taken on the fourth day after delivering CRISPR vectors containing each guide RNA to HeLa cells during a cell death experiment according to Experimental Example 2. Mock represents a control group without guide RNA, NT represents a non-target guide RNA, and MT-3-1 to MT-3-5 and MT-5-1 to MT-5-5 represent examples of CRISPR complexes comprising each guide RNA shown in the table of Experimental Example 2.1.

[0035] Figure 11 shows the results of an experiment using a CRISPR complex containing each guide RNA in each clone transfected with lentivirus during a cell death experiment according to Experimental Example 3. Each experimental result is grouped by the clone number of HCT-116 cells transfected with lentivirus. WT represents wild-type HCT-116 cells, and 10_6, 10_13, 30_10, 100_2, 100_3, 100_12, 100_13, and 100_15 represent clone numbers derived from a single cell, respectively. NT represents a Non-Target guide RNA, MT50 represents a guide RNA of MT-50, and LTR3(3) and LTR(5) represent CRISPR complexes comprising the respective guide RNAs shown in the table of Experimental Example 3.1.

[0036] Figure 12 shows the results of an experiment using CRISPR RNA containing each guide RNA in each clone transfected with lentivirus during a cell death experiment according to Experimental Example 3. Each experimental result is grouped by the clone number of HCT-116 cells transfected with lentivirus. WT represents wild-type HCT-116 cells, and 10_6, 10_13, 30_10, 100_2, 100_3, 100_12, 100_13, and 100_15 represent clone numbers derived from a single cell, respectively. NT represents Non-Target guide RNA, MT50 represents the guide RNA of MT-50, and LTR3(3) and LTR(5) represent CRISPR RNAs comprising the respective guide RNAs shown in the table of Experimental Example 3.1.

[0037] Figure 13 shows the results of an experiment using a CRISPR vector containing each guide RNA in each clone transfected with lentivirus during a cell death experiment according to Experimental Example 3. Each experimental result is grouped by the clone number of HCT-116 cells transfected with lentivirus. WT represents wild-type HCT-116 cells, and 10_6, 10_13, 30_10, 100_2, 100_3, 100_12, 100_13, and 100_15 represent clone numbers derived from a single cell, respectively. NT represents a Non-Target guide RNA, MT50 represents a guide RNA of MT-50, and LTR3(3) and LTR5(4) represent CRISPR vectors comprising the respective guide RNAs shown in the table of Experimental Example 3.1.

[0038] Figure 14 shows a cell micrograph taken 4 days after delivery of each cell death composition to wild-type HCT-116 cells during a cell death experiment according to Experimental Example 3. CRISPR Complex refers to a CRISPR complex, CRISPR RNA refers to CRISPR RNA, and CRISPR Vector refers to cells delivered with a CRISPR vector. MT-50 refers to a guide RNA of MT-50, NT refers to a non-target guide RNA, and LTR3(3) and LTR5(4) refer to a cell death composition comprising the respective guide RNAs shown in the table of Experimental Example 3.1.

[0039] Figure 15 shows a cell micrograph taken on the 4th day after delivery of each cell death composition for clone number 10_6jw cells during a cell death experiment according to Experimental Example 3. CRISPR Complex refers to a CRISPR complex, CRISPR RNA refers to CRISPR RNA, and CRISPR Vector refers to cells delivered with a CRISPR vector. MT-50 refers to a guide RNA of MT-50, NT refers to a non-target guide RNA, and LTR3(3) and LTR5(4) refer to a cell death composition comprising the respective guide RNAs shown in the table of Experimental Example 3.1.

[0040] Figure 16 shows a cell micrograph taken 4 days after delivery of each cell death composition to cells of clone number 10_13 during a cell death experiment according to Experimental Example 3. CRISPR Complex refers to a CRISPR complex, CRISPR RNA refers to CRISPR RNA, and CRISPR Vector refers to cells delivered with a CRISPR vector. MT-50 refers to a guide RNA of MT-50, NT refers to a non-target guide RNA, and LTR3(3) and LTR5(4) refer to a cell death composition comprising the respective guide RNAs shown in the table of Experimental Example 3.1.

[0041] Figure 17 shows a cell micrograph taken 4 days after delivery of each cell death composition to cells of clone number 30_10 during a cell death experiment according to Experimental Example 3. CRISPR Complex refers to a CRISPR complex, CRISPR RNA refers to CRISPR RNA, and CRISPR Vector refers to cells delivered with a CRISPR vector. MT-50 refers to a guide RNA of MT-50, NT refers to a non-target guide RNA, and LTR3(3) and LTR5(4) refer to a cell death composition comprising the respective guide RNAs shown in the table of Experimental Example 3.1.

[0042] Figure 18 shows a cell micrograph taken on the 4th day after delivery of each cell death composition to cells of clone number 100_2 during a cell death experiment according to Experimental Example 3. CRISPR Complex refers to a CRISPR complex, CRISPR RNA refers to CRISPR RNA, and CRISPR Vector refers to cells delivered with a CRISPR vector. MT-50 refers to a guide RNA of MT-50, NT refers to a non-target guide RNA, and LTR3(3) and LTR5(4) refer to a cell death composition comprising the respective guide RNAs shown in the table of Experimental Example 3.1.

[0043] Figure 19 shows a cell micrograph taken on the 4th day after delivery of each cell death composition to cells of clone number 100_3 during a cell death experiment according to Experimental Example 3. CRISPR Complex refers to a CRISPR complex, CRISPR RNA refers to CRISPR RNA, and CRISPR Vector refers to cells delivered with a CRISPR vector. MT-50 refers to a guide RNA of MT-50, NT refers to a non-target guide RNA, and LTR3(3) and LTR5(4) refer to a cell death composition comprising the respective guide RNAs shown in the table of Experimental Example 3.1.

[0044] Figure 20 shows a cell micrograph taken on the 4th day after delivery of each cell death composition to cells of clone number 100_12 during a cell death experiment according to Experimental Example 3. CRISPR Complex refers to a CRISPR complex, CRISPR RNA refers to CRISPR RNA, and CRISPR Vector refers to cells delivered with a CRISPR vector. MT-50 refers to a guide RNA of MT-50, NT refers to a non-target guide RNA, and LTR3(3) and LTR5(4) refer to a cell death composition comprising the respective guide RNAs shown in the table of Experimental Example 3.1.

[0045] Figure 21 shows a cell micrograph taken 4 days after delivery of each cell death composition to cells of clone number 100_13 during a cell death experiment according to Experimental Example 3. CRISPR Complex refers to a CRISPR complex, CRISPR RNA refers to CRISPR RNA, and CRISPR Vector refers to cells delivered with a CRISPR vector. MT-50 refers to a guide RNA of MT-50, NT refers to a non-target guide RNA, and LTR3(3) and LTR5(4) refer to a cell death composition comprising the respective guide RNAs shown in the table of Experimental Example 3.1.

[0046] Figure 22 shows a cell micrograph taken on the 4th day after delivery of each cell death composition to cells of clone number 100_15 during a cell death experiment according to Experimental Example 3. CRISPR Complex refers to a CRISPR complex, CRISPR RNA refers to CRISPR RNA, and CRISPR Vector refers to cells delivered with a CRISPR vector. MT-50 refers to a guide RNA of MT-50, NT refers to a non-target guide RNA, and LTR3(3) and LTR5(4) refer to a cell death composition comprising the respective guide RNAs shown in the table of Experimental Example 3.1.

[0047] Figure 23 shows the results of a cell death experiment according to Experimental Example 3, in which cells were stained with methylene blue and observed on day 4 after CRISPR RNA containing each guide RNA was delivered to cells of each clone number. The labels on each vertical axis represent each clone number, and the labels on each horizontal axis represent each guide RNA. For reference, "Mock" refers to a control group that did not contain guide RNA.

[0048] Figure 24 shows the results of microscopic observation of cells on day 4 after delivering CRISPR RNA containing each guide RNA to cells of each clone number during a cell death experiment according to Experimental Example 3. The labels on each vertical axis represent each clone number, and the labels on each horizontal axis represent each guide RNA. For reference, "Mock" refers to the control group without guide RNA.

[0049] Figure 25 schematically shows the structure of a lentivirus containing a luciferase sequence according to Experimental Example 1.5.

[0050] Figure 26 schematically illustrates examples of the formation of populations of target cells. Case A represents a case where target cells exist independently. Case B represents a case where one or more populations of target cells are identified within a larger cell population. Case C represents a case where target cells and non-target cells are mixed.

[0051]

[0052] Hereinafter, the best mode for carrying out the invention is disclosed by way of example. This includes some, but not all, implementations of the invention disclosed in this specification. The embodiments described in this paragraph are merely exemplary, and the implementations described in this paragraph should not be construed as the "best mode for carrying out the invention." Those skilled in the art will likely envision numerous variations and more desirable implementations of the examples described in this paragraph, and such variations should also be considered to be included within the best mode for carrying out the invention.

[0053] This specification describes a method for killing target cells.

[0054] The target cell comprises at least three target sites,

[0055] All of the above target sites contain the same target sequence,

[0056] Provides a method that includes:

[0057] (a) Process for preparing multiple CRISPR RNAs;

[0058] Here, each of the CRISPR RNAs comprises multiple mRNAs and multiple guide RNAs,

[0059] Each of the above mRNAs is configured to express the same Cas protein,

[0060] Each of the above guide RNAs targets the target sequence,

[0061] The Cas protein and the guide RNA combine to form a CRISPR complex; and

[0062] (b) a process of delivering the plurality of CRISPR RNAs to the target cell;

[0063] As a result of performing the above method, multiple CRISPR complexes are formed within the target cell,

[0064] By the above multiple CRISPR complexes, double strand nucleic acid breaks (Double Strand Breaks; DSBs) occur at least three target sites in the genome of the target cell,

[0065] This causes the target cells to die.

[0066] As an example,

[0067] The target cell may be a cancer cell or a virus-infected cell.

[0068] As an example,

[0069] The above target sequence may be a sequence derived from a virus.

[0070] As an example,

[0071] The above process (b) may be a process of loading the plurality of CRISPR RNAs onto a lipid nanoparticle (LNP) and delivering them to the target cell.

[0072] This specification describes a method for killing a population of target cells,

[0073] Each of the above target cells comprises at least three target sites,

[0074] All of the above target sites contain the same target sequence,

[0075] Provides a method that includes:

[0076] (a) Process for preparing multiple CRISPR RNAs;

[0077] Here, each of the CRISPR RNAs comprises multiple mRNAs and multiple guide RNAs,

[0078] Each of the above mRNAs is configured to express the same Cas protein,

[0079] Each of the above guide RNAs targets the target sequence,

[0080] The Cas protein and the guide RNA combine to form a CRISPR complex; and

[0081] (b) a process of introducing the plurality of CRISPR RNAs into the population;

[0082] As a result of performing the above method, some of the plurality of CRISPR RNAs are delivered to each of the target cells,

[0083] Multiple CRISPR complexes are formed within each of the above target cells,

[0084] By the above multiple CRISPR complexes, double strand nucleic acid breaks (Double Strand Breaks; DSBs) occur at least three target sites in the genome of each target cell,

[0085] This causes the population of target cells to die.

[0086] As an example,

[0087] The population of target cells may be a benign tumor or a malignant tumor.

[0088] As an example,

[0089] The above target sequence may be a sequence derived from a virus.

[0090] As an example,

[0091] The above process (b) may be a process of introducing the plurality of CRISPR RNAs into a population of target cells by loading them into a lipid nanoparticle (LNP).

[0092] This specification describes a method for targeting cell death,

[0093] The above target cells include a first target cell and a second target cell,

[0094] The first target cell comprises three or four target sites,

[0095] The second target cell comprises five or more target sites,

[0096] The target sites included in the first target cell and the second target cell all contain the same target sequence,

[0097] Provides a method that includes:

[0098] (a) a process for preparing multiple CRISPR complexes;

[0099] Here, each of the above CRISPR complexes comprises a Cas protein and a guide RNA,

[0100] The above guide RNA targets the target sequence;

[0101] (b) a process of delivering some of the plurality of CRISPR complexes to the first target cell; and

[0102] (c) a process of delivering some of the plurality of CRISPR complexes to the second target cell;

[0103] As a result of performing the above method, the plurality of CRISPR complexes cause double-stranded nucleic acid cleavage at at least three target sites included in the first target cell and the second target cell,

[0104] This causes the first target cell and the second target cell to die.

[0105] As an example,

[0106] The above target sequence may be a sequence derived from a virus.

[0107] As an example,

[0108] The target cell may be a cancer cell or a virus-infected cell.

[0109] As an example,

[0110] The above process (a) is a process for preparing a plurality of lipid nanoparticles (Lipid Nanoparticles; LNPs) loaded with one or more of the CRISPR complexes,

[0111] The above process (b) is a process of delivering some of the plurality of lipid nanoparticles to the first target cell,

[0112] The above process (c) may be a process of delivering some of the plurality of lipid nanoparticles to the second target cell.

[0113]

[0114] Hereinafter, the present invention will be described in more detail through specific implementation examples and examples with reference to the attached drawings. It should be noted that the attached drawings include some, but not all, implementation examples of the invention. The invention disclosed by this specification may be implemented in various ways and is not limited to the specific implementation examples described herein. These implementation examples should be considered as provided to satisfy the legal requirements applicable to this specification. Those skilled in the art will be able to think of many modifications and other implementations of the invention disclosed in this specification. Therefore, the invention disclosed in this specification is not limited to the specific implementation examples described herein, and it should be understood that modifications and other implementations thereof are included within the scope of the claims.

[0115] Definition of Terms

[0116] approximately

[0117] The term "about" as used in this specification means an amount, level, value, number, frequency, percentage, dimension, size, amount, weight, or length that varies by about 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1%, or 0% with respect to a reference amount, level, value, number, frequency, percentage, dimension, size, amount, weight, or length.

[0118] Amino acid sequence notation

[0119] Unless otherwise stated, amino acid sequences in this specification are written in the N-terminal to C-terminal direction using the amino acid single-letter notation or the three-letter notation. For example, MDK means a peptide in which methionine, aspartic acid, and lysine are sequentially linked from the N-terminal to the C-terminal. Another example, Lys-Tyr-Ser means a peptide in which lysine, tyrosine, and serine are sequentially linked from the N-terminal to the C-terminal. In the case of amino acids that cannot be expressed in the above single-letter notation, other letters are used and additional explanations are provided.

[0120] The notation for each amino acid is as follows: Alanine (Ala, A); Arginine (Arg, R); Asparagine (Asn, N); Aspartic acid (Asp, D); Cysteine ​​(Cys, C); Glutamic acid (Glu, E); Glutamine (Gln, Q); Glycine (Gly, G); Histidine (His, H); Isoleucine (Ile, I); Leucine (Leu, L); Lysine (Lys, K); Methionine (Met, M); Phenylalanine (Phe, F); Proline (Pro, P); Serine (Ser, S); Threonine (Thr, T); Tryptophan (Trp, W); Tyrosine (Ty, Y); and Valine (Val, V).

[0121] Nucleic acid sequence notation

[0122] The symbols A, T, C, G, and U used in this specification are to be interpreted as having the meanings understood by a person of ordinary skill in the art. They may be appropriately interpreted as bases, nucleosides, or nucleotides in DNA or RNA, depending on the context and technology. For example, when referring to a base, it may be interpreted as adenine (A), thymine (T), cytosine (C), guanine (G), or uracil (U) itself, respectively; when referring to a nucleoside, it may be interpreted as adenosine (A), thymidine (T), cytidine (C), guanosine (G), or uridine (U), respectively; and when referring to a nucleotide in a sequence, it should be interpreted to mean a nucleotide containing each of the above nucleosides. Unless otherwise defined, when referring to or indicating a nucleic acid sequence, it is described from the 5' end to the 3' end of the nucleic acid.

[0123] the same time

[0124] The term "simultaneous" as used in this specification is used to describe two or more phenomena occurring independently from each other in terms of time. In this specification, "two or more phenomena occurring simultaneously" not only means that the time difference between the occurrences of the phenomena is zero, but also that the phenomena all occur within a "reasonable time span" recognizable to a person skilled in the art. Here, a "reasonable time span" is not uniformly defined and may vary depending on the phenomenon being observed.

[0125] For example, when it is described that "three or more double-strand breaks occurred simultaneously within the cellular genome," 1) the time difference between the occurrence of the three double-strand breaks may have been 0, 2) the double-strand breaks occurred at three locations within the cellular genome "before the repair machinery of the cellular genome was activated to completely repair each double-strand break," or 3) the three double-strand breaks may have occurred within a reasonable time range that a person skilled in the art would recognize as "occurring simultaneously."

[0126] The term "simultaneous" above includes all other meanings recognized by a person of ordinary skill in the art.

[0127] Background - CRISPR / Cas System

[0128] Overview of the CRISPR / Cas System

[0129] The CRISPR / Cas system is a type of immune system found in prokaryotic organisms, comprising a Cas protein and a guide RNA. The detailed structure of the Cas protein and guide RNA is described in detail in the public document WO2018 / 231018 (International Publication No. 2018 / 231018). The term "Cas protein" as used in this specification is a general term for nucleases that can be interpreted as being utilized in the CRISPR / Cas system. Below, we briefly describe the DNA cleavage process of the most commonly used CRISPR / Cas9 system.

[0130] Cas9 protein

[0131] In the CRISPR / Cas9 complex, the protein with nuclease activity that cleaves nucleic acids is called the Cas9 protein. The above Cas9 protein corresponds to Class 2, Type II in the CRISPR / Cas system classification, and includes Cas9 proteins derived from Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, and Streptosporangium roseum.

[0132] guide RNA

[0133] In the CRISPR / Cas9 complex, the RNA that has the function of guiding the CRISPR / Cas9 complex (hereinafter referred to as the CRISPR complex) to recognize a specific sequence contained in the target nucleic acid is called a guide RNA. The structure of the guide RNA can be broadly divided into a scaffold and a guide domain. The scaffold is a part that interacts with the Cas9 protein and enables it to bind to the Cas9 protein and form a complex. Typically, the scaffold includes a tracrRNA and a crRNA repeat sequence. The specific nucleic acid sequence varies depending on the type of Cas9 protein used together. The guide domain is a part that can complementarily bind to all or part of the target nucleic acid. The guide domain is artificially designed depending on the target nucleic acid to be targeted.

[0134] The process by which the CRISPR / Cas9 complex cuts the target nucleic acid

[0135] When the CRISPR / Cas9 complex comes into contact with the target nucleic acid, the Cas9 protein recognizes a nucleotide sequence of a certain length, and the guide domain of the guide RNA complementarily binds to a nucleic acid adjacent to the sequence recognized by the Cas9 protein, the target nucleic acid is cleaved by the CRISPR / Cas9 complex. At this time, the nucleotide sequence of a certain length recognized by the Cas9 protein is called a protospacer-adjacent motif (PAM). This is a sequence determined according to the type or origin of the Cas9 protein. For example, the Cas9 protein derived from Streptococcus pyogenes can recognize the 5'-NGG-3' sequence in the target nucleic acid. Here, N is one of A, T, C, or G. In order for the CRISPR / Cas9 complex to cleave the target nucleic acid, the guide domain of the guide RNA must complementarily bind to the sequence portion adjacent to the PAM. Here, if the target nucleic acid is double-stranded DNA, the guide RNA complementarily binds to the strand that does not contain a PAM. This is further described in the "Target Strand, Non-Target Strand" section below. Therefore, the guide sequence portion is designed to match the sequence of the target nucleic acid, specifically, the sequence portion adjacent to the PAM sequence. When the CRISPR / Cas9 complex cleaves the target nucleic acid, any position within the PAM sequence portion of the target nucleic acid and / or the sequence portion complementarily binding to the guide domain is cleaved.

[0136] Target strand, non-target strand

[0137] The CRISPR / Cas9 complex has cleavage activity against double-stranded DNA. In double-stranded DNA, the strand that binds to the guide domain is called the target strand (TS). The strand complementary to the target strand, which does not bind to the guide domain, and which contains the PAM and protospacer recognized by the Cas9 protein is called the non-target strand (NTS). The guide domain has a nucleic acid sequence equivalent to the protospacer of the non-target strand. The guide domain has a nucleic acid sequence complementary to a certain portion of the target strand.

[0138] Targeted cell killing method

[0139] Overview of Targeted Cell Killing Methods

[0140] This specification discloses a method for killing a target cell. The method utilizes the principle that multiple double-strand breaks occur in the cell genome, causing cell death. Specifically, the method comprises delivering a composition for killing a target cell to a target cell. The composition for killing a target cell comprises a CRISPR complex or CRISPR RNA. Here, CRISPR RNA collectively refers to an mRNA encoding a Cas protein and a guide RNA. When the CRISPR RNA is delivered to a cell, a CRISPR complex is formed within the cell. Each component of the CRISPR complex, whether delivered directly to the target cell or formed from the CRISPR RNA, is designed to kill the target cell. Specifically, the CRISPR complex is designed to cause double-strand breaks at multiple predetermined target sites within the target cell genome. The method has the following characteristics: 1) using a CRISPR complex or CRISPR RNA for killing the target cell; 2) A type of CRISPR complex or CRISPR RNA expressing the same capable of target-specifically cleaving the same target sequence is used; and 3) the above method exhibits a cell killing effect even if the target cell contains only three or four target sites containing the same target sequence.

[0141] The following describes the above target cell killing method in more detail.

[0142] target cells

[0143] In this specification, the cell that the above cell killing method is intended to kill is referred to as a "target cell." The target cell is not limited to any cell in which the above CRISPR complex can exhibit double-strand cleavage activity. The target cell comprises multiple target sites within the genome, and each of the multiple target sites comprises the same target sequence. Here, the terms "target site", "target sequence", etc. are arbitrarily given to describe the fact that the above CRISPR complex causes multiple double-stranded nucleic acid cleavages within the genome of the target cell when the above cell killing method is performed, and have meaning only within the context in which the above cell killing method is performed.

[0144] A more detailed description of the above target cells is described in the “Target Cells” section.

[0145] Target Site

[0146] The above target site refers to a nucleic acid region at a specific location with a specific sequence. In this specification, the above target site encompasses both the nucleic acid sequence and its location. For example, a target site within a specific target can be defined as 1) a specific target, e.g., a genome, 2) a nucleic acid region starting at a specific location, and 3) ending at a specific location. The above target can be any nucleic acid that can specify that region. For example, it can be a genome of a specific cell, a specific chromosome, a specific gene, or a specific genetic region. The continuous sequence of bases from the starting base to the ending base is called the target sequence. The base refers to a nucleobase and can also be expressed as a nucleoside or nucleotide. The above target site can refer to a double-stranded nucleic acid or a single-stranded nucleic acid. This definition varies depending on the context in which the target nucleic acid is defined. Even if the target site refers to a double-stranded nucleic acid, for convenience, it is described based on one strand. However, it should be understood that other complementary strands are also included.

[0147] Composition for Targeted Cell Death #1 - CRISPR Complex

[0148] The target cell killing method of this specification uses a composition for target cell killing. The target cell killing composition may include a CRISPR complex. The CRISPR complex refers to a ribonucleoprotein (RNP) in which a Cas protein and a guide RNA are bound. The CRISPR complex functions in the target cell genome to cause double-stranded nucleic acid cleavage at the target site. The nucleic acid cleavage principle of the CRISPR complex is as described above, and the CRISPR complex used in the method is configured to cleave the intended target site. The CRISPR complex acts to cause multiple double-stranded nucleic acid cleavages in the target cell genome, resulting in cell death.

[0149] Composition for Targeted Cell Death #2 - CRISPR RNA

[0150] The above target cell killing composition may include CRISPR RNA. The CRISPR RNA comprises mRNA and guide RNA configured to express the Cas protein. The mRNA and guide RNA contained in the CRISPR RNA do not necessarily need to be paired or included in a specific ratio. That is, the CRISPR RNA may include multiple mRNAs and multiple guide RNAs, and any number of each mRNA and guide RNA may be included. When the CRISPR RNA is delivered to a target cell, the Cas protein is expressed from the mRNA within the cell, and the expressed Cas protein binds to the guide RNA to form a CRISPR complex. The CRISPR complex thus formed causes multiple double-stranded nucleic acid cleavages within the cell, resulting in cell death. The mRNA is characterized by its ability to function in the cytoplasm and express the Cas protein. This contrasts with vectors configured to express the Cas protein, which must be transcribed within the cell nucleus.

[0151] Delivering a composition for target cell death to target cells

[0152] The above-described targeted cell killing method involves delivering a target cell killing composition to the target cell. As long as the CRISPR complex or CRISPR RNA can be delivered to the target cell to function as intended, the delivery method or means is not limited. Furthermore, since the above-described targeted cell killing composition is designed to kill only target cells, it does not kill non-target cells (hereinafter, "non-target cells") even when delivered to them. Therefore, when performing the above-described targeted cell killing method, even if target and non-target cells are mixed, no special delivery means or method is required. Known technologies can be utilized for the above-described delivery method or means. For example, the above-described delivery process may involve loading the CRISPR complex or CRISPR RNA onto a lipid nanoparticle (LNP) and delivering it to the target cell. More specific examples are described in the "Possible Embodiments of the Invention" section.

[0153] The delivered CRISPR complex or CRISPR RNA acts to kill the cell.

[0154] As described above, the composition for killing a target cell comprises a CRISPR complex or CRISPR RNA. When the CRISPR complex is delivered to a target cell, the CRISPR complex directly acts on the target site of the cell genome to cause multiple double-stranded nucleic acid cleavages. When the CRISPR RNA is delivered to the target cell, 1) the Cas protein is expressed from mRNA encoding the Cas protein contained in the CRISPR RNA within the cell, 2) the expressed Cas protein binds to the guide RNA to form a CRISPR complex, and 3) the CRISPR complex acts on the target site of the cell genome to cause multiple double-stranded nucleic acid cleavages. Consequently, the target cell is induced to experience multiple double-stranded nucleic acid cleavages in its genome, resulting in the death of the target cell.

[0155] Can selectively kill only target cells

[0156] The above-described targeted cell killing method can selectively kill only target cells. This is because the CRISPR / Cas system operates target-specifically, and thus cannot kill cells that do not contain target sites or contain fewer than two target sites. Even if the above-described cell killing composition is delivered to non-target cells, it is expected to have no significant effect on them. Therefore, even in situations where target and non-target cells are mixed, the above-described method can be used to selectively kill only target cells.

[0157] Feature #1 of Targeted Cell Death Methods - Using CRISPR complexes or CRISPR RNA as CRISPR / Cas system vectors

[0158] The method for target cell death disclosed in this specification is characterized by delivering the CRISPR / Cas system as a CRISPR complex or CRISPR RNA. According to what is known in the art, methods for delivering the CRISPR / Cas system to cells can be divided into 1) a method for delivering an expression vector (hereinafter, “CRISPR vector”) configured to express the Cas protein and guide RNA, 2) a method for delivering the CRISPR complex, and 3) a method for delivering the CRISPR RNA. The inventors of this application have revealed that the method for delivering the CRISPR complex or CRISPR RNA exhibits a superior cell killing effect than the method for delivering the CRISPR vector.

[0159] The fact that CRISPR complexes or CRISPR RNA are more effective when delivered than when delivered with the above CRISPR vectors is counterintuitive to the intuition of ordinary technicians. In general, CRISPR vectors are considered suitable vehicles for delivering CRISPR / Cas systems to achieve the intended effect because 1) they are easier to deliver to cells than CRISPR complexes or CRISPR RNA due to developments in vector technology, 2) they are more stable than CRISPR complexes and CRISPR RNA, and 3) once delivered to cells, Cas proteins and guide RNAs are continuously expressed, allowing a large number of CRISPR / Cas systems to continuously operate. On the other hand, CRISPR complexes are not generally thought to be more effective than CRISPR vectors because 1) they are less efficient at delivering to cells, 2) they can only function as many times as the number delivered, and 2) when the delivered CRISPR complexes are degraded, they lose that opportunity to function. Similarly, it is difficult to expect that CRISPR RNA will be more effective than CRISPR vectors because it is less stable, is not easily delivered to cells, and is easily degraded after delivery, making it difficult for it to continue to function.

[0160] However, the inventors of this application have experimentally shown that the CRISPR complex or CRISPR RNA exhibits a more superior cell killing effect in target cell death. This is because 1) the CRISPR vector must first be delivered to the cell nucleus and go through transcription, translation, and CRISPR complex assembly processes before it can function, whereas 2) the CRISPR complex can function immediately after being delivered to the cell, and 3) CRISPR RNA can perform Cas protein translation and CRISPR complex assembly directly in the cytoplasm, so it can be assumed that it may work more immediately and efficiently than the CRISPR vector.

[0161] Feature #2 of Targeted Cell Killing Methods - Uses Only One Type of CRISPR / Cas System

[0162] The targeted cell killing method disclosed in this specification is characterized by using only one type of CRISPR / Cas system, i.e., only one type of CRISPR complex or one type of CRISPR RNA. Here, the single type of CRISPR / Cas system refers to a CRISPR / Cas system capable of recognizing and target-specifically cleaving a single target sequence. The targeted cell killing method induces cell death by causing double-stranded nucleic acid cleavage at multiple target sites containing the same target sequence in a target cell. Since the goal is to target target sites containing the same target sequence, only one type of CRISPR / Cas system can be used. Using a single type of CRISPR / Cas system has the following advantages: 1) the effort required to identify multiple target sequences can be reduced; 2) the preparation process is simplified, as all CRISPR / Cas systems with the same configuration need to be manufactured and delivered; and 2) the cell killing efficiency is further enhanced, as only one type of CRISPR / Cas system needs to be delivered to the target cell for operation.

[0163] Feature #3 of Targeted Cell Killing Methods - Works even with only 3 or 4 target sites

[0164] The targeted cell death method disclosed in this specification is characterized by its ability to induce cell death even when target sites are present in only three or four locations within the target cell's genome. Therefore, this targeted cell death method can be applied to a wide range of cells under a wide range of conditions, making it highly versatile.

[0165] Feature #4 of Targeted Cell Killing Methods - Pre-manufactured CRISPR complexes or CRISPR RNA can be used.

[0166] The target cell killing method disclosed in this specification uses only one type of CRISPR / Cas system as described above, and can kill target cells even if they contain only a small number of target sites, so it is very easy to use a pre-manufactured CRISPR complex or pre-manufactured CRIPSR RNA.

[0167] For example, when applying the above target cell death method as a cancer treatment method, a cell death composition can be prepared in advance by selecting a target sequence known to be specifically found in the cancer tumor to be treated (e.g., a sequence included in a virus-derived exogenous gene), and after simply confirming whether the patient's cancer tumor includes the target sequence, the cancer can be treated by administering the prepared cell death composition in advance.

[0168] Feature #5 of Targeted Cell Death Methods - Kills Cells Very Quickly

[0169] The targeted cell death method disclosed in this specification is characterized by rapid cell death. This characteristic is highly useful when applying this targeted cell death method as a therapeutic method. For example, if the method is applied to cancer cells as targets, it can rapidly kill them, making it highly effective in dealing with rapidly proliferating cancer tumors and preventing additional risks such as metastasis.

[0170] target cells

[0171] Target Cell Overview

[0172] In the targeted cell killing method disclosed in this specification, the cell to be killed is referred to as a target cell. Any cell can be a target cell, as long as it is killed by multiple double-strand breaks in its genome. The target cell comprises three or more target sites within the genome targeted by the targeted cell killing composition. Here, all target sites have the same target sequence. The type of target cell is appropriately selected depending on the intended use and purpose of the targeted cell killing method. For example, the target cell may be a cancer cell. The target cell encompasses not only a single target cell but also multiple target cells or a population of target cells. Target cells are described in more detail below.

[0173] target area

[0174] A target site refers to a nucleic acid region at a specific location within a specific subject, containing a specific sequence. For example, a target site within a specific subject can be specified as i) a specific subject, e.g., a genome, ii) a contiguous nucleic acid region starting at a specific location, and iii) ending at a specific location. The specific subject can be any nucleic acid that can specify the region. For example, it can be the genome of a specific cell, a specific chromosome, a specific gene, or a specific genetic region. The target site can refer to a double-stranded nucleic acid or a single-stranded nucleic acid. This depends on the context in which the target nucleic acid is defined. Even when the target site refers to a double-stranded nucleic acid, for convenience, the description will be based on one strand. However, it should be understood that the complementary strand is also included.

[0175] Target sequence

[0176] The above target sequence refers to all or part of the nucleic acid sequence of the target site. That is, when defining the target site above, all or part of the continuous nucleobase sequence from the starting nucleobase to the ending nucleobase is referred to as the target sequence. Here, the nucleobase may be used interchangeably with nucleosides or nucleotides. In this specification, the term "target sequence" refers only to the sequence itself and is therefore used in a somewhat different context from the target site. For example, multiple target sites may all contain the same target sequence. In this case, although each target site is located at a different location within the genome, when analyzed, they all contain the same nucleic acid sequence. If the target site is a double-stranded nucleic acid, the target sequence may be expressed by only one strand of the target site.

[0177] Type of target cell

[0178] The target cell type is not limited, as long as it is a cell that can be killed by the above target cell killing composition. The target cell is appropriately selected as a cell that can be killed by the target cell killing method. For example, the target cell may be a cancer cell or a virus-infected cell.

[0179] population of target cells

[0180] In the method for killing targeted cells disclosed in this specification, the cells to be killed may be a plurality of target cells or a population of target cells. In particular, the population of target cells is used to describe the following situations: 1) all or some of the target cells when only the target cells exist independently; 2) all or some of the target cell population when one or more populations of target cells are identified within a larger cell population; 3) all or some of the target cells when target cells and non-target cells are mixed; or 4) all or some of the target cells when any of the above 1) to 3) is combined. The above situations are schematically illustrated in FIG. 26. The plurality of cells or the population of target cells may include homogeneous or heterogeneous target cells.

[0181] Composition for target cell killing

[0182] Overview of Compositions for Target Cell Killing

[0183] The method disclosed in this specification uses a composition for killing target cells. Specifically, the method comprises delivering the composition for killing target cells to a target cell. The composition for killing target cells comprises a type of CRISPR / Cas system. In this specification, the CRISPR / Cas system refers to a CRISPR complex or CRISPR RNA. The CRISPR complex comprises a Cas protein and a guide RNA, and the CRISPR RNA comprises an mRNA configured to express the Cas protein and a guide RNA. The composition of the Cas protein and the guide RNA is described in detail below.

[0184] A type of CRISPR / Cas system

[0185] A type of CRISPR / Cas system is a general term for a CRISPR / Cas system that can recognize the same target sequence and cause double-strand breaks. The above CRISPR / Cas system specifically refers to a CRISPR complex or CRISPR RNA. Even if a composition for killing a target cell includes multiple CRISPR complexes or multiple CRISPR RNAs, as long as the individual CRISPR complexes (or individual CRISPR complexes derived from CRISPR RNAs) all target the same target sequence, it is referred to as one type of CRISPR / Cas system. More specifically, depending on the form of the CRISPR / Cas system, it is also referred to as one type of CRISPR complex or one type of CRISPR RNA.

[0186] Cas protein

[0187] The composition disclosed herein for killing a target cell comprises a CRISPR complex or CRISPR RNA. The CRISPR complex comprises a Cas protein, and the CRISPR RNA comprises an mRNA configured to express the Cas protein within a cell. The Cas protein recognizes a PAM and can target-specifically cleave a double-stranded nucleic acid under the guidance of a guide RNA. Specifically, the Cas protein can cleave at a specific location of a target site comprising a target sequence to which a guide RNA can complementarily bind near the PAM. The Cas protein may comprise various additional domains. For example, the Cas protein may comprise a nuclear localization signal (NLS). Specific examples of the Cas protein are described in the "Cas Protein" section of "Possible Embodiments of the Invention."

[0188] Guide RNA #1 - Overview

[0189] The composition disclosed herein for target cell killing comprises a CRISPR complex or CRISPR RNA. Both the CRISPR complex and the CRISPR RNA comprise a guide RNA. The guide RNA interacts with a Cas protein to form a complex, guides the CRISPR complex to a target sequence, and hybridizes with the target sequence, enabling the Cas protein to cleave the corresponding nucleic acid. The guide RNA comprises a scaffold and a guide domain. The scaffold allows the guide RNA to interact with the Cas protein to form a complex. The guide domain is designed to recognize a specific nucleic acid sequence. Each component of the guide RNA is described in more detail below.

[0190] Guide RNA #1 - Scaffold

[0191] The above guide RNA includes a scaffold. The scaffold allows the guide RNA to interact with the Cas protein to form a complex. Depending on the type of Cas protein, the nucleic acid sequence of the scaffold of the guide RNA that interacts with it varies. Since the guide RNA of the CRISPR / Cas system is well known, those skilled in the art will easily understand which part is referred to as the scaffold in this specification. For example, if the Cas protein is the Cas9 protein or a variant of the Cas9 protein, the scaffold includes the tracrRNA and the direct repeat portion of the crRNA. For another example, if the Cas protein is the Cas12a protein or a variant of the Cas12a protein, the scaffold includes the direct repeat portion of the crRNA. In some cases, the scaffold may be composed of a single molecule or may encompass two or more molecules.

[0192] Guide RNA #2 - Guide domain

[0193] The above guide RNA comprises a guide domain. The above guide domain is designed to target—or recognize—a target sequence. Specifically, the above guide domain can complementarily bind to a target nucleic acid comprising the target sequence. When the above Cas protein recognizes the PAM sequence, and the guide domain of the above guide RNA recognizes a nucleic acid sequence near the PAM sequence, the CRISPR / Cas system functions to cleave double-stranded nucleic acids. Various embodiments of the above guide domain are described in the "Guide Domain" section of "Possible Embodiments of the Invention."

[0194] Guide RNA #3 - Other domains

[0195] The above guide RNA may contain one or more other domains in addition to the scaffold and guide domain. These other domains are selected for specific purposes and positioned at appropriate locations. For example, the other domain may be a guide RNA stabilization motif.

[0196] CRISPR complex

[0197] The above target cell killing composition may include a CRISPR complex. The CRISPR complex is a protein-RNA complex comprising the Cas protein and the guide RNA, also referred to as a ribonucleoprotein (RNP). The CRISPR complex can act on the cellular genome to cause the intended double-stranded nucleic acid cleavage.

[0198] CRISPR RNA

[0199] The above target cell killing composition may comprise CRISPR RNA. The CRISPR RNA comprises mRNA and guide RNA configured to express a Cas protein within a cell. When the CRISPR RNA is delivered to a cell, the Cas protein is expressed from the mRNA and binds to the guide RNA to form a CRISPR complex. The CRISPR complex acts on the cellular genome to cause the intended double-stranded nucleic acid cleavage. The CRISPR RNA may comprise multiple mRNAs and multiple guide RNAs. The ratio of mRNA and guide RNA contained in the CRISPR RNA may be determined arbitrarily and is not particularly limited.

[0200] The process of identifying a target cell or a population of target cells

[0201] The targeted cell killing method disclosed in this specification may further include a step of identifying a target cell or a target cell population. The step of identifying the target cell or target cell population is a step for determining, when applying the cell killing method to any cell or cell population, whether the cell or cell population is a target cell that can be killed by the method, or a target cell population that includes such a target cell. The identification step is performed on any cell or cell population itself, or on a sample obtained from any cell or cell population. Through the identification step, information is obtained about the target sequence of the cell or cell population and the target site containing the target sequence. Here, the target sequence refers to a sequence that can be targeted by the CRISPR / Cas system used in the cell killing method. If the cell or cell population is determined to be a suitable target cell or cell population based on the information identified above, the cell killing method described above can be applied to kill the cell or cell population. However, the identification step is not necessarily a step that must be included in the cell killing method disclosed in this specification.

[0202] Utilization of targeted cell killing methods

[0203] As described above, any cell capable of identifying three or more target sites containing the same target sequence can be killed using the above-described targeted cell killing method. Furthermore, since the targeted cell killing composition is designed to selectively kill only target cells, it can be utilized even in environments where target and non-target cells are mixed. Accordingly, the above-described targeted cell killing method can be utilized to kill a variety of cells. For example, the above-described targeted cell killing method can be utilized to kill cancer cells. Furthermore, the above-described targeted cell killing method can be used as a cancer treatment method. As another example, the above-described targeted cell killing method can be utilized to kill virus-infected cells.

[0204]

[0205] Possible embodiments of the invention

[0206] Cas protein

[0207] Example 1, Cas protein

[0208] Cas protein having target-specific double-stranded nucleic acid cleavage function guided by guide RNA

[0209] Example 2, Cas protein example

[0210] In Example 1, the Cas protein is selected from the following:

[0211] Cas1; Cas1B; Cas2; Cas3; Cas4; Cas5; Cas6; Cas7; Cas8; Cas9; Cas10; Cas12a; Cas12b; Cas12c; Cas12d; Cas12e; Cas12g; Cas12h; Cas12i; Cas12j; Cas13a; Cas13b; Cas13c; Cas13d; Cas14; Csy1; Csy2; Csy3; Cse1; Cse2; Csc1; Csc2; Csa5; Csn2; CsMT2; Csm3; Csm4; Csm5; Csm6; Cmr1; Cmr3; Cmr4; Cmr5; Cmr6; Csb1; Csb2; Csb3; Csx17; Csx14; Csx10; Csx16; CsaX; Csx3; Csx1; Csx15; Csf1; Csf2; Csf3; and Csf4.

[0212] Example 3, Cas protein ortholog limitation

[0213] In Example 2, the Cas protein is selected from the following:

[0214] Cas9 protein from Streptococcus-pyogenes; and Cas12a protein from Lachnospiraceae bacterium.

[0215] Example 4, including NLS

[0216] In any one of Examples 1 to 3, the Cas protein additionally comprises one or more nuclear localization signals (NLS).

[0217] Example 5, NLS structure limitation

[0218] In Example 4, the Cas protein has a nuclear localization signal linked to the N-terminus, the C-terminus, or the N-terminus and the C-terminus.

[0219] guide RNA

[0220] Example 6, Guide RNA

[0221] Guide RNA comprising a guide domain and a scaffold.

[0222] Example 7, Scaffold Function

[0223] In Example 6, the scaffold can interact with any one of the Cas proteins of Examples 1 to 5 to form a protein-RNA complex (also referred to as ribonucleoprotein, or RNP, hereinafter the same).

[0224] Example 8, Guide Domain Function

[0225] In any one of Examples 6 to 7, the guide domain is capable of targeting a target sequence.

[0226] Example 9, Target Sequence Meaning of Target

[0227] In Example 8,

[0228] The above target sequence is a double-stranded nucleic acid,

[0229] When one strand of the above double-stranded nucleic acid is called the first strand and the other strand is called the second strand,

[0230] That the above guide domain can target the above target sequence means one or more selected from the following:

[0231] The above guide domain can complementarily bind to one of the two strands of the above target sequence;

[0232] wherein the guide domain comprises a sequence that is identical, equivalent, homologous, and / or corresponding to all or part of the nucleic acid sequence of the first strand of the target sequence; and

[0233] The above guide domain comprises a sequence complementary to all or part of the nucleic acid sequence of the second strand of the target sequence.

[0234] Example 10, Cas9 guide RNA structure

[0235] In any one selected from Examples 6 to 9,

[0236] If the above guide RNA can interact with the Cas9 protein to form RNP,

[0237] The above guide RNA has a structure in which a guide domain and a scaffold are sequentially connected in the direction from the 5' end to the 3' end.

[0238] Example 11, Cas12a guide RNA structure

[0239] In any one selected from Examples 6 to 10,

[0240] If the above guide RNA can interact with the Cas12a protein to form RNP,

[0241] The above guide RNA has a structure in which a scaffold and a guide domain are sequentially connected in the direction from the 5' end to the 3' end.

[0242] CRISPR complex

[0243] Example 12, CRISPR complex

[0244] CRISPR complexes (also called ribonucleoproteins or RNPs) containing:

[0245] The Cas protein of any one of Examples 1 to 5; and

[0246] The guide RNA of any one of Examples 6 to 11;

[0247] Here, the scaffold of the guide RNA can interact with the Cas protein to form a protein-RNA complex.

[0248] Example 13, cell death possible

[0249] In Example 12, the CRISPR complex has one or more functions selected from the following:

[0250] When introduced, administered, or delivered to a cell containing three target sites including the target sequence of the guide RNA, it causes double-stranded nucleic acid cleavage at the target sequence site of the cell, thereby killing the cell;

[0251] When introduced, administered, or delivered to a cell containing four target sites including the target sequence of the guide RNA, it causes double-stranded nucleic acid cleavage at the target sequence site of the cell, thereby killing the cell;

[0252] When introduced, administered, or delivered to a cell containing five target sites including the target sequence of the guide RNA, it causes double-stranded nucleic acid cleavage at the target sequence site of the cell, thereby killing the cell;

[0253] When introduced, administered, or delivered to a cell containing six or more target sites including the target sequence of the guide RNA, it causes double-stranded nucleic acid cleavage at the target sequence site of the cell, thereby killing the cell; or

[0254] Any combination of the above features.

[0255] CRISPR RNA

[0256] Example 14, CRISPR RNA

[0257] CRISPR RNA containing:

[0258] An mRNA encoding any one of the Cas proteins of Examples 1 to 5; and

[0259] The guide RNA of any one of Examples 6 to 11;

[0260] Here, the mRNA is configured to express the Cas protein within the cell,

[0261] The CRISPR RNA comprises one or more of the mRNAs and one or more of the guide RNAs,

[0262] The above guide RNA can interact with the Cas protein to form a protein-RNA complex.

[0263] Example 15, CRISPR RNA function

[0264] In Example 14,

[0265] When the above CRISPR RNA is delivered to a cell, the expression of the Cas protein is induced by the mRNA within the cell,

[0266] The above Cas protein and the above guide RNA interact to form a CRISPR complex,

[0267] The CRISPR complex has one or more functions selected from the following:

[0268] Causing double-stranded nucleic acid cleavage at each of the target sites of a cell containing three target sites containing the target sequence of the guide RNA in the genome, thereby killing the cell;

[0269] Inducing double-stranded nucleic acid cleavage at each of the target sites of a cell containing four target sites containing the target sequence of the guide RNA in the genome, thereby killing the cell;

[0270] Inducing double-stranded nucleic acid cleavage at each of the target sites of a cell containing five target sites containing the target sequence of the guide RNA in the genome, thereby killing the cell;

[0271] causing double-stranded nucleic acid cleavage at each target site of a cell containing six or more target sites including the target sequence of the guide RNA in the genome, thereby killing the cell; or

[0272] Any combination of the above features.

[0273] Example 16, mRNA and guide RNA ratio

[0274] In any one selected from Examples 14 to 15,

[0275] The ratio of the number of the mRNA contained in the CRISPR RNA to the number of the guide RNA is selected from the following:

[0276] (i) The number of the above mRNA is 1.0 times, 1.1 times, 1.2 times, 1.3 times, 1.4 times, 1.5 times, 1.6 times, 1.7 times, 1.8 times, 1.9 times, 2.0 times, 2.1 times, 2.2 times, 2.3 times, 2.4 times, 2.5 times, 2.6 times, 2.7 times, 2.8 times, 2.9 times, 3.0 times, 3.1 times, 3.2 times, 3.3 times, 3.4 times, 3.5 times, 3.6 times, 3.7 times, 3.8 times, 3.9 times, 4.0 times, 4.1 times, 4.2 times, 4.3 times, 4.4 times, 4.5 times, 4.6 times, 4.7 times, 4.8x, 4.9x, or 5.0x;

[0277] (ii) the number of said mRNA is set within a range consisting of any two values ​​described in (i) with respect to the number of said guide RNA, for example, 1.0 times to 3.0 times;

[0278] (iii) The number of the above guide RNA is 1.0 times, 1.1 times, 1.2 times, 1.3 times, 1.4 times, 1.5 times, 1.6 times, 1.7 times, 1.8 times, 1.9 times, 2.0 times, 2.1 times, 2.2 times, 2.3 times, 2.4 times, 2.5 times, 2.6 times, 2.7 times, 2.8 times, 2.9 times, 3.0 times, 3.1 times, 3.2 times, 3.3 times, 3.4 times, 3.5 times, 3.6 times, 3.7 times, 3.8 times, 3.9 times, 4.0 times, 4.1 times, 4.2 times, 4.3 times, 4.4 times, 4.5 times, 4.6 times, 4.7 times, 4.8x, 4.9x, or 5.0x; or

[0279] (iv) The number of the guide RNA is set within a range consisting of any two values ​​described in (iii) with respect to the number of the mRNA, for example, 1.0 times to 3.0 times.

[0280] target cells

[0281] Example 17, target cells

[0282] A target cell into which a double strand break (DSB) may occur in the cell genome when a CRISPR complex or CRISPR RNA is introduced.

[0283] Example 18, including target sites and target sequences

[0284] In Example 17, the target cell comprises three or more target sites in the genome, each of the target sites comprising the same target sequence.

[0285] Example 19, limiting the number of target sites

[0286] In Example 18, the target cell comprises a selected number of target sites from among:

[0287] 3, 4, 5, 6, or 7;

[0288] 3 or more, 4 or more, 5 or more, 6 or more, or 7 or more;

[0289] 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, or 3 or fewer; and

[0290] a or more and b or less, where a and b are integers, b is greater than a, and a and b are each selected from an integer greater than or equal to 2, for example, 3 or more and 4 or less;

[0291] Example 20, limited to eukaryotic cells

[0292] In any one of Examples 17 to 19, the target cell is a eukaryotic cell.

[0293] Example 21, animal cell limitation

[0294] In Example 20, the target cell is a human cell or a non-human animal cell.

[0295] Example 22, Cell Type Restriction

[0296] In Example 21, the cell is selected from among a senescent cell, a benign tumor, a malignant tumor, and a cancer cell.

[0297] Example 23, target sequence type limitation

[0298] In any one of Examples 17 to 22, the target sequence is selected from the following:

[0299] a sequence contained in an exogenous gene within the target cell genome; and

[0300] A sequence contained in a gene that has undergone copy-number variation compared to a standard reference genome within the target cell genome.

[0301] Example 24, Exogenous Gene Origin Limitation

[0302] In Example 23, the target sequence is a sequence included in an exogenous gene in the target cell genome, and the exogenous gene is a virus-derived exogenous gene.

[0303] Example 25, Relationship with Oncogenes

[0304] In any one of Examples 17 to 24, the target sequence is in a relationship selected from the following with an oncogene:

[0305] 1) The above target sequence is a sequence not included in an oncogene;

[0306] 2) The above target sequence is a sequence determined independently of the oncogene;

[0307] 3) The target sequence is a sequence included in an oncogene; or

[0308] 4) The above target sequence is a sequence determined to target an oncogene.

[0309] Cell population targeted for apoptosis

[0310] Example 26, Cell population containing target cells

[0311] A cell population comprising a plurality of target cells, wherein each target cell is independently selected from Examples 17 to 25.

[0312] Example 27, homologous or heterologous cells

[0313] In Example 26, the plurality of target cells included in the cell population are homogeneous cells or heterogeneous cells.

[0314] Example 28, including two types of target cells

[0315] In Example 26, the cell population comprises the following target cells:

[0316] (i) first cell,

[0317] Here, the first cell may cause double-stranded nucleic acid cleavage in the cell genome when a CRISPR complex or CRISPR RNA is introduced,

[0318] The first cell comprises three or four target sites in the genome,

[0319] Each of the above target sites comprises the same target sequence; and

[0320] (ii) second cell,

[0321] Here, the second cell may cause double-stranded nucleic acid cleavage in the cell genome when a CRISPR complex or CRISPR RNA is introduced.

[0322] The second cell comprises five or more target sites in the genome,

[0323] Each of the above target sites contains the same target sequence;

[0324] Here, the target sequences contained in the first cell and the second cell are identical.

[0325] Example 29, including two types of target cells

[0326] In Example 26, the cell population comprises the following target cells:

[0327] (i) first cell,

[0328] Here, the first cell may cause double-stranded nucleic acid cleavage in the cell genome when a CRISPR complex or CRISPR RNA is introduced,

[0329] The first cell comprises three or more and five or fewer target sites in the genome,

[0330] Each of the above target sites comprises the same target sequence; and

[0331] (ii) second cell,

[0332] Here, the second cell may cause double-stranded nucleic acid cleavage in the cell genome when a CRISPR complex or CRISPR RNA is introduced.

[0333] The second cell comprises six or more target sites in the genome,

[0334] Each of the above target sites contains the same target sequence;

[0335] Here, the target sequences contained in the first cell and the second cell are identical.

[0336] Cell death method

[0337] Example 30: Method for killing two types of cells

[0338] A method of killing a first cell and a second cell using a CRISPR complex or CRISPR RNA,

[0339] The first cell and the second cell are each independently selected from Examples 17 to 25,

[0340] The target sites of the first cell and the second cell both contain the same target sequence,

[0341] The above method includes:

[0342] (a) a process for preparing CRISPR complexes or CRISPR RNAs;

[0343] Here, each of the above CRISPR complexes is a CRISPR complex selected from any one of Examples 12 to 13,

[0344] Each of the above CRISPR RNAs is any one of the CRISPR RNAs selected from Examples 14 to 16,

[0345] The guide domain of the guide RNA of each of the CRISPR complexes, or the guide domain of the guide RNA of each of the CRISPR RNAs, targets a target sequence included in the genome of the first cell and the genome of the second cell;

[0346] (b) a process of introducing, administering, treating, and / or delivering some of the CRSIPR complexes or the CRISPR RNAs to the first cell; and

[0347] (c) introducing, administering, treating, and / or delivering to the second cell another portion of the CRISPR complexes or the CRISPR RNAs;

[0348] Here, as a result of the above process (b), double-stranded nucleic acid breaks may occur at three or more target sites included in the genome of the first cell, thereby causing the first cell to die.

[0349] As a result of the above process (c), double-stranded nucleic acid breaks may occur at three or more target sites included in the genome of the second cell, resulting in the death of the second cell.

[0350] Example 31, Use of identical or homologous CRISPR complexes

[0351] In Example 30, each of the CRISPR complexes or each of the CRISPR RNAs is identical (identical / same) or homologous CRISPR complex or CRISPR RNA.

[0352] Example 32, First and Second Cell Limitations #1

[0353] In any one of Examples 30 to 31, the first cell and the second cell are a combination selected from the following:

[0354] (i) the first cell comprises 3 to 4 target sites, selected from any one of Examples 17 to 25;

[0355] The second cell comprises at least five target sites, wherein the second cell is any one selected from Examples 17 to 25; and

[0356] (ii) the first cell comprises 3 to 5 target sites, selected from any one of Examples 17 to 25;

[0357] The second cell is any one selected from Examples 17 to 25, and comprises six or more target sites.

[0358] Example 33: Method for killing two types of cells

[0359] A method of killing cells using a CRISPR complex or CRISPR RNA,

[0360] By performing the above method, at least two types of cells can be killed,

[0361] Here, one type of cell is any one selected from Examples 17 to 25,

[0362] Another type of cell is any one selected from Examples 17 to 25,

[0363] The number of target sites contained in the two types of cells above is different,

[0364] The target sequences of the target sites contained in the above two types of cells are identical,

[0365] The above method includes:

[0366] (a) Process for preparing CRISPR complexes or CRISPR RNAs

[0367] Here, each of the above CRISPR complexes is a CRISPR complex selected from any one of Examples 12 to 13,

[0368] Each of the above CRISPR RNAs is any one of the CRISPR RNAs selected from Examples 14 to 16,

[0369] The guide domain of the guide RNA of each of the above CRISPR complexes, or the guide domain of the guide RNA of each of the above CRISPR RNAs, targets a target sequence contained in the cell; and

[0370] (b) a process of introducing, administering, treating, and / or delivering the CRISPR complexes or the CRISPR RNAs into the cell;

[0371] Here, as a result of the above process (b), double-stranded nucleic acid cleavage may occur at three or more target sites included in the genome of the cell, resulting in the death of the cell.

[0372] Example 34, Use of identical or homologous CRISPR complexes

[0373] In Example 33, each of the CRISPR complexes or each of the CRISPR RNAs is identical / same or homologous CRISPR complex or CRISPR RNA.

[0374] Example 35, Cell Type Restriction

[0375] In any one of Examples 33 to 34, the two types of cells that can be killed as a result of performing the method are selected from the following combinations:

[0376] A cell comprising three to four target sites selected from any one of Examples 17 to 25, and a cell comprising five or more target sites selected from any one of Examples 17 to 25; and

[0377] A cell comprising three to five target sites selected from any one of Examples 17 to 25, and a cell comprising six or more target sites selected from any one of Examples 17 to 25.

[0378] Example 36, Method for Killing a Population of Cells

[0379] A method of killing a population of cells using a CRISPR complex or CRISPR RNA,

[0380] The above cell populations each independently comprise cells selected from Examples 17 to 25,

[0381] The above method includes:

[0382] (a) a process for preparing CRISPR complexes or CRISPR RNAs;

[0383] Here, each of the CRISPR complexes is one selected from Examples 12 to 13,

[0384] Each of the above CRISPR RNAs is any one selected from Examples 14 to 16,

[0385] The guide domain of the guide RNA of each of the above CRISPR / Cas complexes targets a target sequence contained in the cell; and

[0386] (b) a process of introducing, administering, treating, and / or delivering CRISPR / Cas complexes to the cell population;

[0387] Here, as a result of the above process (b), double-stranded nucleic acid cleavage may occur at three or more target sites included in the genome of each cell included in the cell population, resulting in the death of the cell.

[0388] Example 37, including cell identification process

[0389] A method of killing a population of cells using CRISPR complexes or CRISPR RNAs,

[0390] Each of the above CRISPR complexes is any one selected from Examples 12 to 13,

[0391] Each of the above CRISPR RNAs is any one selected from Examples 14 to 16,

[0392] Here, the guide domain of the guide RNA of each of the above CRISPR complexes, or the guide domain of the guide RNA of each of the above CRISPR RNAs, all target the first sequence (also referred to as the target sequence, hereinafter the same),

[0393] The above method includes:

[0394] (a) a process of identifying, measuring, calculating, and / or determining information about a first sequence in the genome of each cell of the cell population using a sample of the cell population;

[0395] (b) a process of identifying, measuring, calculating, and / or determining whether the cell population comprises a first type cell population by evaluating information about a first sequence in the genome of each cell of the cell population identified, measured, calculated, and / or determined in (a);

[0396] wherein each cell belonging to the first type of cell population comprises the first sequence in its genome; and

[0397] (c) when the cell population comprises a first type cell population, a process of introducing, administering, treating and / or delivering the CRISPR complexes or the CRISPR RNAs to the cell population;

[0398] Here, as a result of performing the above process (c), the CRISPR complexes or the CRISPR complexes whose expression is induced from the CRISPR RNA cause multiple double-stranded nucleic acid cleavages in the genome of one or more cells in the cell population, thereby selectively killing the first type cell population in the cell population.

[0399] Example 38, Use of identical or homologous CRISPR / Cas

[0400] In Example 37, each of the CRISPR complexes or each of the CRISPR RNAs is identical (identical / same) or homologous CRISPR complex or CRISPR RNA.

[0401] Example 39, limited to the first type of cell population

[0402] In any one of Examples 37 to 38, the first cell population is one selected from the following, or a combination of two or more selected from the following.

[0403] A population of cells comprising three copies of the first sequence within the cell genome;

[0404] A population of cells comprising four copies of the first sequence within the cell genome;

[0405] A population of cells comprising five copies of the first sequence within the cell genome;

[0406] A population of cells comprising six or more of the first sequences within the cell genome;

[0407] A population in which the mean, median, mode and / or other representative value of the number of times the first sequence is included in the genome of each cell belonging to the population of cells is at least two per cell;

[0408] A population of cells in which the mean, median, mode and / or other representative value of the number of times the first sequence is included in the genome of each cell in the population of cells is at least 3 per cell;

[0409] A population of cells in which the mean, median, mode and / or other representative value of the number of times the first sequence is included in the genome of each cell in the population of cells is at least 4 per cell;

[0410] A population in which the mean, median, mode and / or other representative value of the number of copies of the first sequence contained in the genome of each cell belonging to the population of cells is at least 5 per cell; and

[0411] A population of cells in which the mean, median, mode and / or other representative value of the number of occurrences of the first sequence in the genome of each cell in the population of cells is at least 6 per cell.

[0412] Example 40, Information limitation for the first sequence

[0413] In any one of Examples 37 to 39, the information about the first sequence is at least one selected from the following:

[0414] Whether the first sequence exists in the genome of each cell belonging to the cell population;

[0415] Whether at least one cell among the cells belonging to the above cell population contains the first sequence in the genome;

[0416] The proportion of cells among the cells belonging to the above cell population that contain the first sequence in the genome;

[0417] The number of cells in the cell population that contain the first sequence in their genomes;

[0418] The mean, median, mode, and / or other representative value of the number of times the first sequence is included in the genome of each cell belonging to the cell population; and

[0419] Whether the average, median, mode, and / or other representative value of the number of times the first sequence is included in the genome of each cell belonging to the cell population meets a predetermined criterion.

[0420] Example 41, RNP delivery method

[0421] In Examples 30 to 40,

[0422] The process of introducing, administering, treating, and / or delivering the CRISPR complexes or the CRISPR RNAs into the cell (same for the first cell, the second cell, and the cell population) is performed by one or more methods selected from the following:

[0423] Delivery via electroporation; lipofection; lipid nanoparticles (LNPs); and other carriers.

[0424] Example 42, DSBs occur simultaneously

[0425] In Examples 30 to 40, when a plurality of double-stranded nucleic acid breaks occur within the genome of a cell as a result of performing the method, each of the double-stranded nucleic acid breaks occurs simultaneously.

[0426] Example 43: Meaning of DSB simultaneous occurrence

[0427] In Example 42, the simultaneous occurrence of each of the double-stranded nucleic acid cleavages is selected from the following:

[0428] The time difference when all double-stranded nucleic acid breaks occur is 0; and

[0429] All double-stranded nucleic acid breaks occur within a time sufficiently faster than the cell's genome repair machinery can operate to repair one or more double-stranded nucleic acid breaks,

[0430] Accordingly, multiple double-stranded nucleic acid breaks occur within the cell genome, leaving the cell genome in a broken state for a certain period of time.

[0431] Example 44, Cell Death Time

[0432] In Examples 30 to 40, when a cell or a cell population dies as a result of performing the method, the death of the cell or cell population occurs within a time range selected from the following:

[0433] About 1 minute, about 2 minutes, about 3 minutes, about 4 minutes, about 5 minutes, about 6 minutes, about 7 minutes, about 8 minutes, about 9 minutes, about 10 minutes, about 11 minutes, about 12 minutes, about 13 minutes, about 14 minutes, about 15 minutes, about 16 minutes, about 17 minutes, about 18 minutes, about 19 minutes, about 20 minutes, about 21 minutes, about 22 minutes, about 23 minutes, about 24 minutes, about 25 minutes, about 26 minutes, about 27 minutes, about 28 minutes, about 29 minutes, about 30 minutes, about 31 minutes, about 32 minutes, about 33 minutes, about 34 minutes, about 35 minutes, about 36 minutes, about 37 minutes, about 38 minutes, about 39 minutes, about 40 minutes, about 41 minutes, about 42 minutes, About 43 minutes, about 44 minutes, about 45 minutes, about 46 minutes, about 47 minutes, about 48 minutes, about 49 minutes, about 50 minutes, about 51 minutes, about 52 minutes, about 53 minutes, about 54 minutes, about 55 minutes, about 56 minutes, about 57 minutes, about 58 minutes, about 59 minutes, about 60 minutes, about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours, about 10 hours, about 11 hours, about 12 hours, about 13 hours, about 14 hours, about 15 hours, about 16 hours, about 17 hours, about 18 hours, about 19 hours, about 20 hours, about 21 hours, about 22 hours, about 23 hours, about 24 hours, about Within 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, or about 10 days;

[0434] About 1 minute, about 2 minutes, about 3 minutes, about 4 minutes, about 5 minutes, about 6 minutes, about 7 minutes, about 8 minutes, about 9 minutes, about 10 minutes, about 11 minutes, about 12 minutes, about 13 minutes, about 14 minutes, about 15 minutes, about 16 minutes, about 17 minutes, about 18 minutes, about 19 minutes, about 20 minutes, about 21 minutes, about 22 minutes, about 23 minutes, about 24 minutes, about 25 minutes, about 26 minutes, about 27 minutes, about 28 minutes, about 29 minutes, about 30 minutes, about 31 minutes, about 32 minutes, about 33 minutes, about 34 minutes, about 35 minutes, about 36 minutes, about 37 minutes, about 38 minutes, about 39 minutes, about 40 minutes, about 41 minutes, about 42 minutes, About 43 minutes, about 44 minutes, about 45 minutes, about 46 minutes, about 47 minutes, about 48 minutes, about 49 minutes, about 50 minutes, about 51 minutes, about 52 minutes, about 53 minutes, about 54 minutes, about 55 minutes, about 56 minutes, about 57 minutes, about 58 minutes, about 59 minutes, about 60 minutes, about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours, about 10 hours, about 11 hours, about 12 hours, about 13 hours, about 14 hours, about 15 hours, about 16 hours, about 17 hours, about 18 hours, about 19 hours, about 20 hours, about 21 hours, about 22 hours, about 23 hours, about 24 hours, about After 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, or about 10 days;

[0435] Within the two numerical ranges mentioned above, for example, within about 1 day to about 3 days.

[0436] Cancer treatment methods

[0437] Example 45, Method for Treating Cancer

[0438] A method of treating a patient's cancer using CRISPR complexes or CRISPR RNAs,

[0439] Each of the above CRISPR complexes is any one selected from Examples 12 to 13,

[0440] Each of the above CRISPR RNAs is any one selected from Examples 14 to 16,

[0441] Here, the guide domain of the guide RNA of each of the above CRISPR complexes, or the guide domain of the guide RNA of each of the above CRISPR RNAs, all target the first sequence (also referred to as the target sequence, hereinafter the same),

[0442] The above method includes:

[0443] (a) a process of identifying, measuring, calculating, and / or determining information about a first sequence in the genome of each cancer cell of a cancer tumor sample from a patient;

[0444] (b) a process of evaluating information about a first sequence in the genome of each cancer cell of the cancer tumor identified, measured, calculated, and / or determined in (a), thereby identifying, measuring, calculating, and / or determining whether the cancer tumor comprises a first type cancer tumor;

[0445] Here, each cancer cell belonging to the first type of cancer tumor contains the first sequence in its genome;

[0446] (c) a process of introducing, administering, treating, and / or delivering the CRISPR complexes or the CRISPR RNAs to the cell population, if the cell population comprises a type 1 cancer tumor;

[0447] Here, as a result of performing the above process (c), the CRISPR complexes or the CRISPR complexes whose expression is induced by the CRISPR RNA cause multiple double-stranded nucleic acid cleavages in the genome of one or more cancer cells in the cancer tumor, thereby selectively killing the first type of cancer tumor in the cancer tumor.

[0448] Example 46, Cancer-Specific Target

[0449] In Example 45, the first sequence is selected from the following:

[0450] A sequence contained in an exogenous gene within the target cell genome; and

[0451] A sequence contained in a gene that has undergone copy-number variation compared to a standard reference genome within the target cell genome.

[0452] Example 47, Exogenous Gene Origin Limitation

[0453] In Example 46, the target sequence is a sequence included in an exogenous gene in the target cell genome, and the exogenous gene is a virus-derived exogenous gene.

[0454] Example 48, homologous or heterologous CRISPR / Cas complexes

[0455] In any one of Examples 45 to 47, each of the CRISPR complexes or each of the CRISPR RNAs is identical / same or homologous CRISPR complex or CRISPR RNA.

[0456] Example 49, Cell Identification Process

[0457] In any one of Examples 45 to 48, the first cancer tumor is one selected from the following, or a combination of two or more selected from the following.

[0458] A population of cancer cells comprising three copies of the first sequence within the cancer cell genome;

[0459] A population of cancer cells comprising four copies of the first sequence within the cancer cell genome;

[0460] A population of cancer cells comprising five copies of the first sequence within the cancer cell genome;

[0461] A population of cancer cells comprising six or more of the first sequences in the cancer cell genome;

[0462] A cancer tumor in which the average, median, mode and / or other representative values ​​of the number of times the first sequence is included in the genome of each cancer cell belonging to the cancer tumor are two or more per cancer cell;

[0463] A cancer tumor in which the average, median, mode and / or other representative values ​​of the number of times the first sequence is included in the genome of each cancer cell belonging to the cancer tumor are 3 or more per cancer cell;

[0464] A cancer tumor in which the average, median, mode and / or other representative value of the number of times the first sequence is included in the genome of each cancer cell belonging to the cancer tumor is 4 or more per cancer cell;

[0465] A cancer tumor in which the average, median, mode and / or other representative value of the number of times the first sequence is included in the genome of each cancer cell belonging to the cancer tumor is 5 or more per cancer cell; and

[0466] A cancer tumor in which the average, median, mode and / or other representative values ​​of the number of copies of the first sequence included in the genome of each cancer cell belonging to the cancer tumor are 6 or more per cancer cell.

[0467] Example 50, Information Semantic Limitation

[0468] In any one of Examples 45 to 49, the information about the first sequence is at least one selected from the following:

[0469] Whether the first sequence exists in the genome of each cancer cell belonging to the cancer tumor;

[0470] Among the cancer cells belonging to the above cancer tumor, whether at least one cancer cell contains the first sequence in the genome;

[0471] Among the cancer cells belonging to the above cancer tumor, the proportion of cancer cells containing the first sequence in the genome;

[0472] The number of cancer cells belonging to the cancer tumor that contain the first sequence in their genome;

[0473] The average, median, mode, and / or other representative values ​​of the number of times the first sequence is included in the genome of each cancer cell belonging to the cancer tumor; and

[0474] Whether the average, median, mode, and / or other representative values ​​of the number of times the first sequence is included in the genome of each cancer cell belonging to the cancer tumor meet a predetermined criterion.

[0475]

[0476] Experimental example

[0477] Hereinafter, the invention provided by this specification will be described in more detail through experimental examples and examples. These examples are intended solely to illustrate the subject matter disclosed by this specification, and it will be apparent to those skilled in the art that the scope of the subject matter disclosed by this specification is not limited by these examples.

[0478] Experimental Example 1. Experimental Materials and Methods

[0479] Experimental Example 1.1. Preparation of cells for use in the experiment

[0480] HeLa and HCT-116 cells were prepared for use in apoptosis experiments. Cell preparation and culture were performed using methods commonly used by practitioners.

[0481] Experimental Example 1.2. Preparation of CRISPR complex

[0482] The CRISPR complexes used in each experimental example were prepared as follows:

[0483] 1) An SpCas9 protein having an amino acid sequence of sequence number 1 was produced using a method commonly used by those skilled in the art.

[0484] 2) A guide RNA having an RNA sequence of sequence number 2 was prepared using a method commonly used by a skilled artisan. Here, the guide domain (spacer) sequence of each RNA is as disclosed in each experimental example.

[0485] 3) CRISPR complex (RNP) was prepared by mixing 1.4 μg of SpCas9 protein and 0.2 μg of guide RNA.

[0486] 4) The above CRISPR complex was loaded onto lipid nanoparticles, CRISPRMAX (manufactured by InVitrogen), and delivered to the target cells of each experimental example.

[0487] Experimental Example 1.3. CRISPR RNA Production

[0488] The CRISPR RNA used in each experimental example was prepared as follows:

[0489] 1) An mRNA encoding the SpCas9 protein having the amino acid sequence of SEQ ID NO: 1 was produced using a method commonly used by ordinary technicians. Specifically, the production was commissioned to TriLink.

[0490] 2) A guide RNA having an RNA sequence of sequence number 2 was prepared using a method commonly used by a skilled artisan. Here, the guide domain (spacer) sequence of each RNA is as disclosed in each experimental example.

[0491] 3) CRISPR RNA was prepared by mixing mRNA encoding SpCas9 protein of 1) and guide RNA of 2) at a 1:1 ratio.

[0492] 4) The above CRISPR RNA was loaded onto a lipid nanoparticle, MessengerMAX (Thermo Fisher Scientific Inc.), and delivered to the target cells of each experimental example.

[0493] Experimental Example 1.4. Preparation of vectors (CRISPR vectors) expressing each component of the CRISPR complex.

[0494] Viral vectors capable of expressing each component of the CRISPR / Cas complex were prepared. Specifically, a one-vector SpCas9 lentivirus containing DNA encoding the aforementioned SpCas9 and DNA encoding a guide RNA was produced in HEK293T cells using methods commonly used by skilled artisans. The CRISPR was delivered using 8 μL of lentivirus solution and 4 μg / mL of polybrene without puromycin selection.

[0495] Experimental Example 1.5. Production of Lentivirus Containing Luciferase Sequence

[0496] A lentivirus containing luciferase was prepared using a method commonly used by those skilled in the art. Here, the luciferase had the nucleic acid sequence of SEQ ID NO: 3, and the full-length sequence of the lentivirus genome was SEQ ID NO: 4.

[0497] The structure of the above lentivirus is schematically shown in Figure 25.

[0498] Experimental Example 2. Targeted Cell Death Experiment Using the CRISPR Complex #1

[0499] Experimental Example 2.1. Examples and Comparative Examples Used in the Experiment

[0500] The cell death effect was confirmed by delivering the CRISPR complex and CRISPR vector to target cells, respectively. The SpCas9 protein containing the amino acid sequence of SEQ ID NO: 1 was used, and guide RNAs targeting each target site were designed and used. The composition of the guide RNAs used in the experiment is shown in the table below.

[0501] 실험에 사용한 가이드 RNA의 구성LabelsgRNA ScaffoldGuide DomainNTSEQ ID NO: 2GCTCCGATCGGGTTACAACA (SEQ ID NO: 6)MT-50SEQ ID NO: 2GCAGAGGCAGGTGGATCATG (SEQ ID NO: 5)MT-3-1SEQ ID NO: 2ACCTTCATCCTCATATCCAC (SEQ ID NO: 8)MT-3-2SEQ ID NO: 2GTCACTGCAGGACTATGGGC (SEQ ID NO: 9)MT-3-3SEQ ID NO: 2GGCTTAGCAGGTGTGTGTAA (SEQ ID NO: 10)MT-3-4SEQ ID NO: 2GAGAGGACAACCCTCAAAGT 11) MT-3-5SEQ ID NO: 2TGGCTCTTCCGGTTTAACAC (SEQ ID NO: 12) MT-4-1SEQ ID NO: 2TGTGGTCATCCCCTGTTAGA (SEQ ID NO: 13) MT-4-2SEQ ID NO: 2AGCCAAGGTTTGCCTTTATG (SEQ ID NO: 14) MT-4-3SEQ ID NO: 2CACTGTATACAGCCTGCAGG (SEQ ID NO: 15) MT-4-4SEQ ID NO: 2AGACCGCCTCTGTGCAGGAG (SEQ ID NO: 16) MT-4-5SEQ ID NO: 2AGTGGTGTGTCATAGTCCCC (SEQ ID NO: 17) MT-5-1SEQ ID NO: 2ACCAACCTAAGTCTAACCTA (SEQ ID NO: 18) MT-5-2SEQ ID NO: 2TGAACTGTGGAAGAACTGCA (SEQ ID NO: 19)MT-5-3SEQ ID NO: 2GGGCACCTGCCACTGTATGG (SEQ ID NO: 20)MT-5-4SEQ ID NO: 2GTAGAGGTAGTTGTATACAC (SEQ ID NO: 21)MT-5-5SEQ ID NO: 2TGTATAGTCTGTGCATATGG (SEQ ID NO: 22)

[0502] The cell death composition of each embodiment comprises the SpCas9 protein of sequence number 1 and the guide RNA of the table above in the form of a CRISPR complex, CRISPR RNA, and CRISPR vector, and is distinguished by the form and guide RNA label. For example, in the case of Complex, MT-3-1, it refers to an embodiment comprising a CRISPR complex including the guide RNA of MT-3-1. In another example, in the case of RNA, MT-4-1, it refers to an embodiment comprising a CRISPR RNA including the guide RNA of MT-4-1. The same applies hereinafter.

[0503] Above, MT-50 is a guide RNA that targets 50 target sites within the cellular genome. Non-Target is a guide RNA that does not have a target site within the cellular genome. MT-3-1 to MT-3-5 are guide RNAs that target three target sites within the cellular genome. MT-4-1 to MT-4-5 are guide RNAs that target four target sites within the cellular genome. MT-5-1 to MT-5-5 are guide RNAs that target five target sites within the cellular genome.

[0504] Experimental Example 2.2. Cell Death Experimental Method

[0505] Specifically, the experiment was conducted in the following manner:

[0506] 1) Day 0: HeLa cells and HCT-116 cells prepared according to Experimental Example 1.1 were seeded in 24-well plates at 5 Х 10 per well. 4 The dog was very busy and was cultured for 1 day.

[0507] 2) Day 1: A target cell death composition containing each guide RNA according to Experimental Example 2.1 was delivered to the cells of 1) above. Each example or comparative example was delivered according to Experimental Example 1.2 to Experimental Example 1.4.

[0508] 3) Day 4: Cells from each experiment were photographed using an optical microscope. Using Promega CellTiter-Glo, cell viability was measured for each experiment. The degree of cell death was compared relative to the signal from the non-target group.

[0509] Survival data were obtained by repeating the experiment 3 or 4 times for each example.

[0510] Experimental Example 2.3. Cell Death Experiment Results

[0511] The experimental results are shown in Figures 1 to 6. The quantitative data for each experimental example are shown in the following table:

[0512] MT-3에 다이 정데 다이트CellDeliveryguide RNAAverage Cell viabilityHCT-116ComplexMock1.247HCT-116ComplexNT1.000HCT-116ComplexMT-500.225HCT-116ComplexMT-3-10.180HCT-116ComplexMT -3-20.557HCT-116ComplexMT-3-30.544HCT-116ComplexMT-3-40.480HCT-116ComplexMT-3-50.634HCT-116RNAMock1.174HCT-116RNANT1.00 0HCT-116RNAMT-500.231HCT-116RNAMT-3-10.147HCT-116RNAMT-3-20.588HCT-116RNAMT-3-30.611HCT-116RNAMT-3-40.268HCT-116RNAMT- 3-50.360HCT-116VectorMock1.018HCT-116VectorNT1.000HCT-116VectorMT-500.703HCT-116VectorMT-3-11.046HCT-116VectorMT-3-21.0 36HCT-116VectorMT-3-31.097HCT-116VectorMT-3-41.036HCT-116VectorMT-3-50.968HeLaComplexMock1.186HeLaComplexNT1.000HeLaCo mplexMT-500.123HeLaComplexMT-3-10.081HeLaComplexMT-3-20.492HeLaComplexMT-3-30.493HeLaComplexMT-3-40.364HeLaComplexMT-3- 50.470HeLaRNAMock1.158HeLaRNANT1.000HeLaRNAMT-500.184HeLaRNAMT-3-10.092HeLaRNAMT-3-20.505HeLaRNAMT-3-30.657HeLaRNAMT-3-40.390HeLaRNAMT-3-50.396HeLaVectorMock0.927HeLaVectorNT1.000HeLaVectorMT-500.587HeLaVectorMT-3-10.907HeLaVectorMT-3-20.876HeLaVectorMT-3-31.011HeLaVectorMT-3-40.935HeLaVectorMT-3-51.025.

[0513] MT-4에 다이 정데 다이트CellDeliveryGuide RNAAverage Cell ViabilityHCT-116ComplexMock1.017HCT-116ComplexNT1.000HCT-116ComplexMT-500.335HCT-116ComplexMT-4-10.293HCT-116ComplexMT -4-20.259HCT-116ComplexMT-4-30.302HCT-116ComplexMT-4-40.386HCT-116ComplexMT-4-50.238HCT-116RNAMock1.174HCT-116RNANT1.00 0HCT-116RNAMT-500.231HCT-116RNAMT-4-10.253HCT-116RNAMT-4-20.370HCT-116RNAMT-4-30.442HCT-116RNAMT-4-40.898HCT-116RNAMT- 4-50.463HCT-116VectorMock0.980HCT-116VectorNT1.000HCT-116VectorMT-500.682HCT-116VectorMT-4-10.955HCT-116VectorMT-4-20.9 56HCT-116VectorMT-4-30.951HCT-116VectorMT-4-40.879HCT-116VectorMT-4-50.808HeLaComplexMock1.010HeLaComplexNT1.000HeLaCo mplexMT-500.198HeLaComplexMT-4-10.123HeLaComplexMT-4-20.071HeLaComplexMT-4-30.220HeLaComplexMT-4-40.396HeLaComplexMT-4- 50.095HeLaRNAMock1.158HeLaRNANT1.000HeLaRNAMT-500.184HeLaRNAMT-4-10.182HeLaRNAMT-4-20.271HeLaRNAMT-4-30.329HeLaRNAMT-4-40.827HeLaRNAMT-4-50.262HeLaVectorMock0.999HeLaVectorNT1.000HeLaVectorMT-500.384HeLaVectorMT-4-10.779HeLaVectorMT-4-20.854HeLaVectorMT-4-30.801HeLaVectorMT-4-40.902HeLaVectorMT-4-50.609.

[0514] MT-5에 다이 정록 다이트CellDeliveryGuide RNAAverage Cell ViabilityHCT-116ComplexMock1.247HCT-116ComplexNT1.000HCT-116ComplexMT-500.225HCT-116ComplexMT-5-10.390HCT-116ComplexMT -5-20.547HCT-116ComplexMT-5-30.706HCT-116ComplexMT-5-40.645HCT-116ComplexMT-5-50.535HCT-116RNAMock1.174HCT-116RNANT1.00 0HCT-116RNAMT-500.231HCT-116RNAMT-5-10.139HCT-116RNAMT-5-20.799HCT-116RNAMT-5-30.781HCT-116RNAMT-5-40.409HCT-116RNAMT- 5-50.553HCT-116VectorMock1.018HCT-116VectorNT1.000HCT-116VectorMT-500.703HCT-116VectorMT-5-11.167HCT-116VectorMT-5-21.1 35HCT-116VectorMT-5-31.121HCT-116VectorMT-5-41.039HCT-116VectorMT-5-51.050HeLaComplexMock1.186HeLaComplexNT1.000HeLaCo mplexMT-500.123HeLaComplexMT-5-10.151HeLaComplexMT-5-20.434HeLaComplexMT-5-30.581HeLaComplexMT-5-40.709HeLaComplexMT-5- 50.267HeLaRNAMock1.158HeLaRNANT1.000HeLaRNAMT-500.184HeLaRNAMT-5-10.119HeLaRNAMT-5-20.678HeLaRNAMT-5-30.543HeLaRNAMT-5-40.400HeLaRNAMT-5-50.309HeLaVectorMock0.927HeLaVectorNT1.000HeLaVectorMT-500.587HeLaVectorMT-5-11.018HeLaVectorMT-5-20.957HeLaVectorMT-5-31.178HeLaVectorMT-5-41.039HeLaVectorMT-5-51.113.

[0515] Experimental results showed that in all MT-3, MT-4, and MT-5 cells, delivery of the CRISPR complex or CRISPR RNA resulted in a more superior cell killing effect than delivery of the CRISPR vector alone. In particular, delivery of the CRISPR vector resulted in almost no cell death.

[0516] This can also be confirmed through optical microscope photographs (Figs. 7 to 10).

[0517] Experimental Example 3. Targeted Cell Death Experiment #2 Using the CRISPR Complex

[0518] Experimental Example 3.1. Examples and Comparative Examples Used in the Experiment

[0519] There are cancer cells known to contain multiple viral genes within their genomes. These cancer cells contain multiple target sites containing the same target sequence (i.e., all or part of the viral genes), making the targeted cell killing method described herein applicable. To determine whether the targeted cell killing method can be applied to cancer cells, the following experiment was designed:

[0520] 1) Cells were infected with a lentivirus containing the luciferase gene. Lentiviruses have the ability to integrate all or part of their genes into random locations within the cellular genome. This integration occurs not in a single location but in multiple locations. Therefore, cells infected with the above lentivirus mimic the cancer cell environment.

[0521] 2) A CRISPR / Cas system targeting all or part of the luciferase gene was designed, and a composition for target cell death containing the same was prepared and delivered to the cells of 1) above to confirm the cell death effect. This simulates delivering a composition for target cell death targeting a known foreign gene to cancer cells containing the foreign gene.

[0522] The composition of the guide RNA used in the experiment and the composition of the target cell killing composition are shown in the following table.

[0523] Structure of guide RNA used in the experiment Labels gRNA ScaffoldGuide Domain NT SEQ ID NO: 2GCTCCGATCGGGTTACAACA (SEQ ID NO: 6) MT-50 SEQ ID NO: 2GCAGAGGCAGGTGGATCATG (SEQ ID NO: 5) LTR3(3) SEQ ID NO: 2ATCAGCGGCCGCTTGCTGTG (SEQ ID NO: 23) LTR5(4) SEQ ID NO: 2GACAAGATATCCTTGATCTG (SEQ ID NO: 24)

[0524] The method of referring to each embodiment is as disclosed in Experimental Example 2.1.

[0525] Here, LTR5(4) and LTR(5) each represent guide RNAs targeting the insertion region of luciferase. MT-50 is a guide RNA that targets 50 target sites within the cellular genome, regardless of luciferase activity. As a control, a guide RNA without target sites within the cellular genome was used.

[0526] Experimental Example 3.2. Cell Death Experimental Method

[0527] Specifically, the experiment was conducted in the following manner:

[0528] 1) Lentivirus containing luciferase was prepared according to Experimental Example 1.5.

[0529] 2) The HCT-116 cell line prepared according to Experimental Example 1.1 was transfected with the lentivirus of 1) above.

[0530] 3) Single cell colonies were isolated from the HCT-116 cell line of 2) and each was propagated separately.

[0531] 4) Eight different colonies (10_6, 10_13, 30_10, 100_2, 100_3, 100_12, 100_13, 100_15) were obtained according to the culture status of 3).

[0532] 5) Day 0: Cells from each colony were seeded in 24-well plates at 5 x 10 per well. 4 The dogs were busy. Wild-type HCT-116 cells that were not transfected with lentivirus were used as a control.

[0533] 6) Day 1: A target cell death composition containing each guide RNA according to Experimental Example 3.1 was delivered to the cells of 1) above. Each example or comparative example was delivered according to Experimental Example 1.2 to Experimental Example 1.4.

[0534] 7) Day 4: Cells from each experiment were photographed using an optical microscope. Using Promega CellTiter-Glo, cell viability was measured for each experiment. The degree of cell death was compared relative to the signal from the untreated Mock group. Furthermore, on Day 4, images of cells from each experimental group were taken using an optical microscope. Furthermore, each sample was stained with methylene blue and photographed.

[0535] Experimental Example 3.3. Cell Death Experiment Results

[0536] The experimental results are shown in Figures 11 to 13. The quantitative data for each carrier are shown in the following table:

[0537] CRISPR 복합체를 전달한 경우CellDeliveryGuide RNAAverage Cell ViabilityWTComplexNT1.000WTComplexMT500.306WTComplexLTR3(3)0.876WTComplexLTR5(4)0.67710_6ComplexNT1.00010_6ComplexMT500.33610_6ComplexLTR3(3)0.51310_6ComplexLTR5(4)0.22010_13ComplexNT1.00010_13ComplexMT500.30010_13ComplexLTR3(3)0.50810_13ComplexLTR5(4)0.33430_10ComplexNT1.00030_10ComplexMT500.48230_10ComplexLTR3(3)0.91630_10ComplexLTR5(4)0.774100_2ComplexNT1.000100_2ComplexMT500.187100_2ComplexLTR3(3)0.435100_2ComplexLTR5(4)0.301100_3ComplexNT1.000100_3ComplexMT500.327100_3ComplexLTR3(3)0.502100_3ComplexLTR5(4)0.407100_12ComplexNT1.000100_12ComplexMT500.324100_12ComplexLTR3(3)0.604100_12ComplexLTR5(4)0.373100_13ComplexNT1.000100_13ComplexMT500.509100_13ComplexLTR3(3)0.873100_13ComplexLTR5(4)0.717100_15ComplexNT1.000100_15ComplexMT500.332100_15ComplexLTR3(3)0.537100_15ComplexLTR5(4)0.375

[0538] CRISPR RNA를 전달한 경우CellDeliveryGuide RNAAverage Cell ViabilityWTRNANT1.000WTRNAMT500.190WTRNALTR3(3)0.836WTRNALTR5(4)0.88710_6RNANT1.00010_6RNAMT500.17810_6RNALTR3(3)0.16110_6RNALTR5(4)0.40610_13RNANT1.00010_13RNAMT500.25310_13RNALTR3(3)0.35010_13RNALTR5(4)0.43530_10RNANT1.00030_10RNAMT500.44230_10RNALTR3(3)0.46530_10RNALTR5(4)0.657100_2RNANT1.000100_2RNAMT500.234100_2RNALTR3(3)0.207100_2RNALTR5(4)0.372100_3RNANT1.000100_3RNAMT500.177100_3RNALTR3(3)0.293100_3RNALTR5(4)0.418100_12RNANT1.000100_12RNAMT500.166100_12RNALTR3(3)0.254100_12RNALTR5(4)0.393100_13RNANT1.000100_13RNAMT500.224100_13RNALTR3(3)0.543100_13RNALTR5(4)0.470100_15RNANT1.000100_15RNAMT500.325100_15RNALTR3(3)0.250100_15RNALTR5(4)0.402

[0539] If you delivered a CRISPR vectorCellDeliveryGuide RNAAverage Cell ViabilityWTVectorNT1.000WTVectorMT500.820WTVectorLTR3(3)1.084WTVectorLTR5(4)1.01810_6VectorNT1. 00010_6VectorMT500.88610_6VectorLTR3(3)0.96210_6VectorLTR5(4)1.00510_13VectorNT1.00010_13Vector MT500.81710_13VectorLTR3(3)0.97510_13VectorLTR5(4)0.97030_10VectorNT1.00030_10VectorMT500.88230 _10VectorLTR3(3)0.95230_10VectorLTR5(4)1.022100_2VectorNT1.000100_2VectorMT500.844100_2VectorLT R3(3)0.981100_2VectorLTR5(4)0.966100_3VectorNT1.000100_3VectorMT500.719100_3VectorLTR3(3)0.9361 00_3VectorLTR5(4)1.002100_12VectorNT1.000100_12VectorMT500.842100_12VectorLTR3(3)0.985100_12Vec torLTR5(4)1.000100_13VectorNT1.000100_13VectorMT500.851100_13VectorLTR3(3)1.014100_13VectorLTR5 (4)1.006100_15VectorNT1.000100_15VectorMT500.954100_15VectorLTR3(3)0.988100_15VectorLTR5(4)1.064

[0540] Experimental results showed that in all eight different colonies, the delivery of the CRISPR complex or CRISPR RNA showed a superior cell killing effect compared to the delivery of the CRISPR vector. This was confirmed visually through microscopic images (Figs. 14 to 24).

[0541] This suggests that if viral genes are randomly integrated into cells, targeting them could effectively kill them by delivering CRISPR complexes or CRISPR RNA. It also suggests that this could be applied to the treatment of certain cancers.

[0542]

[0543]

[0544]

[0545] The targeted cell killing method provided in this specification can kill target cells. Since the targeted cell killing method does not affect non-target cells, it can be applied to various therapeutic methods. For example, the targeted cell killing method can be used in cancer treatment.

Claims

1. A method of killing target cells, The target cell comprises at least three target sites, All of the above target sites contain the same target sequence, The above method includes: (a) Process for preparing multiple CRISPR RNAs; Here, each of the CRISPR RNAs comprises multiple mRNAs and multiple guide RNAs, Each of the above mRNAs is configured to express the same Cas protein, Each of the above guide RNAs targets the target sequence, The Cas protein and the guide RNA combine to form a CRISPR complex; and (b) a process of delivering the plurality of CRISPR RNAs to the target cell; As a result of performing the above method, multiple CRISPR complexes are formed within the target cell, By the above multiple CRISPR complexes, double strand nucleic acid breaks (Double Strand Breaks; DSBs) occur at least three target sites in the genome of the target cell, This causes the target cells to die.

2. In the method of paragraph 1, The above target cells are cancer cells or virus-infected cells.

3. In any one of the methods selected from paragraphs 1 and 2, The above target sequence is a sequence derived from a virus.

4. In any one of the methods selected from clauses 1 to 3, The above process (b) is a process of loading the plurality of CRISPR RNAs onto a lipid nanoparticle (LNP) and delivering them to the target cell.

5. A method of killing a group of target cells, Each of the above target cells comprises at least three target sites, All of the above target sites contain the same target sequence, The above method includes: (a) Process for preparing multiple CRISPR RNAs; Here, each of the CRISPR RNAs comprises multiple mRNAs and multiple guide RNAs, Each of the above mRNAs is configured to express the same Cas protein, Each of the above guide RNAs targets the target sequence, The Cas protein and the guide RNA combine to form a CRISPR complex; and (b) a process of introducing the plurality of CRISPR RNAs into the population; As a result of performing the above method, some of the plurality of CRISPR RNAs are delivered to each of the target cells, Multiple CRISPR complexes are formed within each of the above target cells, By the above multiple CRISPR complexes, double strand nucleic acid breaks (Double Strand Breaks; DSBs) occur at least three target sites in the genome of each target cell, This causes the population of target cells to die.

6. In the method of paragraph 5, The population of target cells above is a benign tumor or a malignant tumor.

7. In any one of the methods selected from clauses 5 to 6, The above target sequence is a sequence derived from a virus.

8. In any one of the methods selected from paragraphs 1 to 4, The above process (b) is a process of loading the plurality of CRISPR RNAs onto lipid nanoparticles (LNPs) and introducing them into a population of target cells.

9. As a method of target cell death, The above target cells include a first target cell and a second target cell, The first target cell comprises three or four target sites, The second target cell comprises five or more target sites, The target sites included in the first target cell and the second target cell all contain the same target sequence, The above method includes: (a) a process for preparing multiple CRISPR complexes; Here, each of the above CRISPR complexes comprises a Cas protein and a guide RNA, The above guide RNA targets the target sequence; (b) a process of delivering some of the plurality of CRISPR complexes to the first target cell; and (c) a process of delivering some of the plurality of CRISPR complexes to the second target cell; As a result of performing the above method, the plurality of CRISPR complexes cause double-stranded nucleic acid cleavage at at least three target sites included in the first target cell and the second target cell, This causes the first target cell and the second target cell to die.

10. In the method of paragraph 9, The above target sequence is a sequence derived from a virus.

11. In any one of the methods selected from clauses 9 to 10, The above target cells are cancer cells or virus-infected cells.

12. In any one of the methods selected from Articles 9 to 11, The above process (a) is a process for preparing a plurality of lipid nanoparticles (Lipid Nanoparticles; LNPs) loaded with one or more of the CRISPR complexes, The above process (b) is a process of delivering some of the plurality of lipid nanoparticles to the first target cell, The above process (c) is a process of delivering some of the plurality of lipid nanoparticles to the second target cell.

Images