Attenuated SARS-cov-2 vaccine strain including n gene transcriptional repression and nsp1 protein mutation, and use thereof

Abstract

The present invention relates to an attenuated SARS-CoV-2 vaccine strain including nucleocapsid N gene transcriptional repression and a non-structural protein 1 (nsp1) protein mutation, and a use thereof. The attenuated SARS-CoV-2 vaccine strain according to the present invention has excellent safety and efficacy as a vaccine, and thus can be effectively used as an attenuated live vaccine for the prevention of coronavirus disease 2019.

Description

Attenuated SARS-CoV-2 vaccine strain containing transcriptional suppression of N gene and mutation of nsp1 protein and use thereof

[0001] The present invention relates to an attenuated SARS-CoV-2 vaccine strain comprising a transcriptional suppression of the N (nucleocapsid) gene and a mutation of the nsp1 (non structural protein 1) protein, and uses thereof.

[0002]

[0003] This research was supported by the Ministry of Science and ICT's National Research Foundation of Korea's New Mutant Infectious Disease Response Platform Core Technology Development (Project Number: 2021M3E5E3080533).

[0004] Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is a new type of coronavirus that first emerged in Wuhan, China in December 2019 and has since spread throughout China and around the world. Infection with SARS-CoV-2 causes a variety of respiratory infection symptoms, ranging from mild to severe, including fever, malaise, cough, shortness of breath, and pneumonia. Coronavirus disease 2019 (COVID-19) caused by SARS-CoV-2 has caused more than 7 million deaths worldwide, emerging as the largest global health crisis since the 1918 influenza pandemic.

[0005] SARS-CoV-2, designated as severe acute respiratory syndrome coronavirus, is an enveloped virus with a 30-kb positive-sense single-stranded RNA genome and belongs to the genus Betacoronavirus. SARS-CoV-2 is composed of four major structural proteins (S-spike, E-envelope, M-membrane, N-nucleocapsid), 16 nonstructural proteins (NSPs 1-16), and 5 to 8 accessory proteins.

[0006] In December 2020, the first mRNA vaccine against SARS-CoV-2 was approved, marking the beginning of global vaccinations. mRNA vaccines, which target only the virus's S protein, boast over 90% efficacy in preventing infection and are readily mass-produced. However, they require injections, necessitating specialized medical personnel, offer limited protection against variants, and do little to induce IgA antibodies, which prevent the virus from initially infecting the respiratory mucosa.

[0007] Meanwhile, Korean Patent Publication No. 2022-0165731 discloses a 'recombinant poxvirus-based vaccine for SARS-COV-2 virus', and Korean Patent Registration No. 2425492 discloses a 'development method for an epitope-based peptide vaccine for SARS-COV-2 virus', but the 'attenuated SARS-CoV-2 vaccine strain including transcriptional inhibition of the N gene and mutation of the nsp1 protein and its use' of the present invention is not described.

[0008] The present invention was derived from the above-mentioned needs, and the present inventors inserted an mCherry sequence after the TRS (transcription regulatory sequence) of the N gene of SARS-CoV-2, deleted amino acids 26 to 141 of the nsp1 protein, and induced mutations in amino acids 164 to 165 to produce an attenuated mutant strain (NfCtQF). Afterwards, VeroE6 cells or Calu-3 cells were infected with the NfCtQF, and the growth curve was analyzed. As a result, the growth rate of NfCtQF was confirmed to be reduced compared to the wild type, indicating that it was attenuated. In addition, after inoculating mice with NfCtQF, the vaccine efficacy was analyzed through challenge infection. As a result, it was confirmed that the total IgG and IgA antibody production increased compared to the control group (injected with PBS), and the survival rate was 100%, thereby completing the present invention.

[0009] To solve the above problem, the present invention provides an attenuated SARS-CoV-2 (Severe acute respiratory syndrome coronavirus 2) vaccine strain comprising a mutation in the N gene and a mutation in the nsp1 protein.

[0010] In addition, the present invention provides a vaccine composition for preventing coronavirus infection-19, comprising the attenuated SARS-CoV-2 vaccine strain as an active ingredient.

[0011] In addition, the present invention provides a method for preventing COVID-19 by administering the vaccine composition to an animal.

[0012] In addition, the present invention provides a kit for detecting SARS-CoV-2, comprising the attenuated SARS-CoV-2 vaccine strain as an active ingredient.

[0013] In addition, the present invention provides a method for providing information on coronavirus disease-19 infection, comprising a step of reacting the attenuated SARS-CoV-2 vaccine strain with immune serum isolated from a subject suspected of having coronavirus disease-19.

[0014] In addition, the present invention provides a method for producing a vaccine against COVID-19, comprising a step of subculturing the attenuated SARS-CoV-2 vaccine strain in a vaccine production cell line.

[0015] In addition, the present invention provides a recombinant vector comprising a SARS-CoV-2 gene including an N gene and an nsp1 protein coding gene, wherein the N gene has an mCherry coding sequence and a P2A (self cleavage peptide) coding sequence sequentially inserted in the 3' direction of a TRS (transcription regulatory sequence), and the nsp1 protein has amino acids 26 to 141 deleted from the amino acid sequence of SEQ ID NO: 2, the 164th amino acid is substituted from lysine to glutamine, and the 165th amino acid is substituted from histidine to phenylalanine.

[0016] The attenuated SARS-CoV-2 variant comprising the transcriptional suppression of the N gene of the present invention and the mutation of the nsp1 protein has excellent safety and efficacy as a vaccine, and thus can be usefully utilized as an attenuated live vaccine for the prevention of COVID-19.

[0017] Figure 1A is a schematic diagram of cDNA in which mCherry and P2A (self cleavage peptide) coding sequences were inserted behind the TRS (transcription regulatory sequence) of the N gene to produce an N gene mutant mutant strain (Nf), and Figure 1B shows the results of measuring the virus titer after infecting VeroE6 cells or Calu-3 cells with the N gene mutant mutant strain (Nf). WT: wild-type SARS-CoV-2, MOI: multiplicity of infection.

[0018] Figure 2 shows the results of daily body weight measurements for 10 days after infection of C57BL / 6 mice and IFNaRKO (interferon receptors knockout) C57BL / 6 mice with the N gene mutant strain (Nf) (B) and the results of RT-PCR for the N gene performed by extracting RNA from lung tissues collected on days 3, 7, and 10 post-infection (C). WT: wild-type SARS-CoV-2, dpi: days post-infection.

[0019] Figure 3A is a schematic diagram of cDNA that deleted amino acids 26-141 of the nsp1 protein and induced mutations in amino acids 164-165 to produce an N gene and nsp1 protein mutant mutant strain (NfCtQF), and Figure 3B shows the results of measuring virus titers after infecting VeroE6 cells or Calu-3 cells with the N gene and nsp1 protein mutant mutant strain (NfCtQF). WT: wild-type SARS-CoV-2, Nf:N gene mutant mutant strain, MOI: multiplicity of infection.

[0020] Figure 4 shows the results of confirming the expression of mCherry after the process of infecting VeroE6 cells with an N gene mutant mutant strain (Nf) and an N gene and nsp1 protein mutant mutant strain (NfCtQF), culturing them, recovering them, and reinfecting them was performed a total of 9 times (P1 to P9).

[0021] Figure 5 is a schematic diagram illustrating the animal testing process for evaluating the vaccine efficacy of the N gene and nsp1 protein mutant strain (NfCtQF). Prime: 1st vaccination, Boost: 2nd vaccination, Challenge: challenge infection, BALF: Bronchoalveolar Lavage Fluid, FRNT: Focus reduction neutralization test.

[0022] Figure 6 shows the results of antibody measurement (A, B, C) and neutralizing antibody analysis (Focus reduction neutralization test, FRNT50) (D, E) in blood and bronchoalveolar lavage fluid (BALF) collected 2 and 4 weeks after the first vaccination (Prime). Ctrl: Control group injected with PBS, NfCtQF:N gene and nsp1 protein mutant strain inoculated group.

[0023] Figure 7 shows the results of measuring body weight (A) and survival rate (B) during animal experiments to evaluate vaccine efficacy, and measuring virus titers in lung and nasal turbinate tissues (C, D). Ctrl: Control group injected with PBS, NfCtQF:N gene and nsp1 protein mutant strain vaccinated group.

[0024] Figure 8 shows the mutant base sequence of the N gene (A) and the mutant amino acid sequence of the nsp1 protein (B) of the N gene and nsp1 protein mutant mutant strain (NfCtQF). FIG. 8A shows that the mcherry coding sequence (bold) and the P2A (self cleavage peptide) coding sequence (underlined) are sequentially inserted in the 3' direction of the TRS (transcription regulatory sequence, bold + underlined) of the N gene, which is the 27,926th base in the full-length SARS-CoV-2 sequence of SEQ ID NO: 1 of the present invention, and FIG. 8B shows that the 26th to 141st amino acids are deleted in the amino acid sequence of the nsp1 protein of SEQ ID NO: 2 of the present invention, the 164th amino acid is substituted from lysine (K) to glutamine (Q), and the 165th amino acid is substituted from histidine (H) to phenylalanine (F).

[0025] In order to achieve the purpose of the present invention, the present invention provides an attenuated SARS-CoV-2 (Severe acute respiratory syndrome coronavirus 2) vaccine strain comprising a mutation of the N gene and a mutation of the nsp1 protein.

[0026] The term “vaccine strain” as used herein means a mutant.

[0027] The genome sequence of the attenuated SARS-CoV-2 vaccine strain according to one embodiment of the present invention may be composed of the base sequence of SEQ ID NO: 1.

[0028] In the attenuated SARS-CoV-2 vaccine strain according to the present invention, the mutation of the N gene may be a sequential insertion of an mcherry coding sequence and a P2A (self cleavage peptide) coding sequence at base 27,926 in the base sequence of SEQ ID NO: 1. The 27,926th base in the base sequence of SEQ ID NO: 1 is the 3' end of the TRS (transcription regulatory sequence) of the N gene, and an external sequence was inserted after this sequence to suppress transcription of the N gene (see FIGS. 1A and 8A).

[0029] In addition, in the attenuated SARS-CoV-2 vaccine strain according to the present invention, the mutations of the nsp1 protein may be, but are not limited to, deletion of amino acids 26 to 141 in the amino acid sequence of SEQ ID NO: 2, substitution of amino acid 164 from lysine (K) to glutamine (Q), and substitution of amino acid 165 from histidine (H) to phenylalanine (F) (see FIGS. 3A and 8B).

[0030] The attenuated SARS-CoV-2 vaccine strain according to the present invention was developed using reverse genetics using GenBank No. NC_045512.2 as a reference sequence.

[0031] The present invention also provides a vaccine composition for preventing coronavirus disease-19, comprising the attenuated SARS-CoV-2 vaccine strain as an active ingredient.

[0032] In the vaccine composition of the present invention, the attenuated SARS-CoV-2 vaccine strain is as described above.

[0033] The form of the vaccine composition according to the present invention may be selected from the group consisting of a live vaccine, an inactivated vaccine, a subunit vaccine produced using the genes of an attenuated SARS-CoV-2 vaccine strain, a vector vaccine, a chimeric vaccine, a DNA and RNA vaccine, but is not limited thereto.

[0034] In the present invention, the term “prevention” means any act of suppressing or delaying the occurrence, spread, and recurrence of COVID-19 by administering a vaccine composition according to the present invention.

[0035] Additionally, the vaccine composition of the present invention may further comprise a pharmaceutically acceptable carrier and / or adjuvant. Furthermore, in addition to the carrier, the vaccine composition of the present invention may further comprise an excipient and / or diluent.

[0036] The term "pharmaceutically acceptable" as used herein refers to a substance that is physiologically tolerable and does not typically cause allergic reactions such as gastrointestinal upset, dizziness, or similar reactions when administered to a mammal. Examples of such carriers, excipients, and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition, fillers, anticoagulants, lubricants, wetting agents, flavoring agents, emulsifiers, and preservatives may be additionally included.

[0037] In addition, "adjuvant" as used herein means a pharmaceutical or immunological agent administered for the purpose of enhancing the immune response of a vaccine. The adjuvant may be Freund's, aluminum hydroxide, aluminum phosphate, alum (potassium aluminum sulfate), MF59, virosome, AS04 [a mixture of aluminum hydroxide and monophosphoryl lipid A (MPL)], AS03 (a mixture of DL-α-tocopherol, squalene, and polysorbate 80, an emulsifier), CpG, Flagellin, Poly I:C, AS01, AS02, ISCOMs, or ISCOMMATRIX.

[0038] The vaccine composition of the present invention can be formulated using methods known in the art to enable rapid, sustained, or delayed release of the active ingredient when administered to a mammal. Formulations include powders, granules, tablets, emulsions, syrups, aerosols, soft or hard gelatin capsules, sterile injectable solutions, and sterile powder forms.

[0039] The vaccine composition according to the present invention may be administered via various routes, including oral, parenteral, e.g., suppository, transdermal, intravenous, intraperitoneal, intramuscular, intralesional, nasal, and intrathecal administration. It may also be administered using an implantable device for sustained release, continuous, or repeated release. The frequency of administration may be once a day or divided into several doses within a desired range, and the administration period is not particularly limited.

[0040] The present invention also provides a method for preventing COVID-19 by administering the vaccine composition to an animal.

[0041] In the method for preventing coronavirus infection-19 according to the present invention, the animal may be an animal other than a human, and may preferably be a dog, cat, pig, cow, bird, etc., but is not limited thereto.

[0042] The present invention also provides a kit for detecting SARS-CoV-2, comprising the attenuated SARS-CoV-2 vaccine strain as an active ingredient.

[0043] The kit may include an attenuated SARS-CoV-2 vaccine strain according to the present invention and a reagent capable of detecting an antibody specifically binding to the SARS-CoV-2 vaccine strain. In the kit of the present invention, the attenuated SARS-CoV-2 vaccine strain functions as an antigen, and the reagent for detecting the virus (antigen)-antibody complex may include, but is not limited to, a reagent for radial immunoassay, an enzyme-linked immunosorbent assay (ELISA), or an immunofluorescence analysis.

[0044] The present invention also provides a method for providing information on coronavirus disease-19 infection, comprising a step of reacting the attenuated SARS-CoV-2 vaccine strain with immune serum isolated from a subject suspected of having coronavirus disease-19.

[0045] The term "subject" used in the present invention refers to, but is not limited to, an animal that has developed or may develop the coronavirus disease-19.

[0046] The method for providing information on COVID-19 infection according to the present invention may comprise the step of reacting a sample (immune serum) isolated from a suspected COVID-19 patient with an attenuated SARS-CoV-2 vaccine strain of the present invention under conditions that allow for the formation of antigen / antibody complexes, and then detecting the formation of the antigen / antibody complex. The method for detecting the formation of the antigen / antibody complex can be performed using a method known in the art.

[0047] The present invention also provides a method for producing a vaccine against COVID-19, comprising a step of subculturing the attenuated SARS-CoV-2 vaccine strain in a vaccine production cell line.

[0048] In the manufacturing method of the present invention, the attenuated SARS-CoV-2 vaccine strain or antigen derived therefrom can be converted into a physiologically acceptable form. This can be done based on experience in manufacturing vaccines used for influenza vaccination. For example, for the manufacture of vaccine injections, the virus particles are lyophilized in 100 ml of phosphate-buffered saline (PBS) in the presence of 1% human albumin and 2% peptone in an ampoule, preferably a glass ampoule. Alternatively, the vaccine injections can be produced by sequential lyophilization of the virus in the formulation. The formulation may contain additional additives such as mannitol, dextran, sugar, glycine, lactose, or polyvinylpyrrolidone, or other adjuvants such as antioxidants, inert gases, stabilizers, or recombinant proteins suitable for in vivo administration (e.g., human serum albumin). The glass ampoule is then sealed and can be stored between 4°C and room temperature for several months. However, unless otherwise required, the ampoule may preferably be stored below -20°C.

[0049] The present invention also provides a recombinant vector comprising a SARS-CoV-2 gene including an N gene and an nsp1 protein coding gene, wherein the N gene has an mCherry coding sequence and a P2A (self cleavage peptide) coding sequence sequentially inserted in the 3' direction of a TRS (transcription regulatory sequence), and the nsp1 protein has amino acids 26 to 141 deleted from the amino acid sequence of SEQ ID NO: 2, the 164th amino acid is substituted from lysine to glutamine, and the 165th amino acid is substituted from histidine to phenylalanine.

[0050]

[0051] Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely illustrative of the present invention and the scope of the present invention is not limited thereto.

[0052]

[0053] Example 1. Production of N gene mutant strain

[0054] We attempted to create a mutant strain (Nf) of the N gene of Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) by inserting an mCherry sequence behind the TRS (transcription regulatory sequence) of the N gene. Specifically, the mCherry sequence was inserted 3' behind the TRS (transcription regulatory sequence) of the N gene (positions 28,274-29,533 of GenBank No. NC_045512.2) in the full-length sequence of SARS-CoV-2 (GenBank No. NC_045512.2) using the primers in Table 1 below, thereby inducing a mutation in the N gene. In addition, a P2A (self-cleavage peptide) sequence was inserted behind the mCherry sequence so that the N protein could be expressed in its original structure (Figs. 1A, 8A).

[0055] More specifically, PCR for inducing N gene mutation was performed under the concentrations and conditions shown in Tables 2 and 3 below (KOD-Plus-Neo, TOYOBO, Cat. No KOD-401), followed by PCR purification (GEL / PCR Purification Mini Kit, Favorgene, FAGCK 001-1). Afterwards, considering the molecular weight, SLIC (Sequence ligation independent cloning) was performed at a 1:3 ratio of vector and insert (mCherry-P2A) (T4 polymerase, enzynomics, DP004L). The conditions used for SLIC were as follows: 25°C for 2 minutes to activate T4 polymerase, and then 0.1 M EDTA was added to a final concentration of 0.01 M to inactivate T4 polymerase, followed by SLIC at 75°C for 20 minutes. Afterwards, the N gene mutation mutant strain was obtained through sequencing.

[0056] In order to introduce the secured clone into SARS-CoV-2 full-length cDNA, SARS-CoV-2 full-length cDNA was reacted with restriction enzymes BamHI (BamHI-HF, NEB, R3136L) and StuI (StuI, NEB, R0187L) at 10U each at 37℃ for 6 hours, and the N gene mutant mutant gene was cut with restriction enzyme EciI (EciI, NEB, R0590L) at 2U, 37℃ for 4 hours, followed by PCR purification and gel purification (Zymoclean Gel DNA Recovery Kit, ZYMO research, D4008), respectively. Afterwards, SARS-CoV-2 full-length cDNA was generated through Gibson assembly (GeneArt™ Gibson Assembly HiFi Master Mix, Invitrogen™, A46628). Finally, a SARS-CoV-2 full-length cDNAN gene mutant mutant strain was obtained through sequencing.

[0057] NUsed to create genetically mutant strains Primer sequence name Primer sequence (5'-3') Sequence number NTRS-mCherry-FATCTAAACGAACAAACATTAAATGGTGAGCAAGGGCGAGAAGTTCG3 NTRS-mCherry-RTGGCTCCCGGACCCCTTGTACAAGCTCTGTCCATGC4 NTRS-P2A-FTCTTGTTAAAGCAGGCAGGGACGGTGGAAGAAAAACCCCGGTCCTTCTGATAATGGAACCCAAAATC5 NTRS-P2A-RTTTAGTTTTGTTCGTTTAGATGAAATC6

[0058] N Used to create genetically mutant strains PCR concentrationComponentVolume(50 ㎕ reaction)Final conditionD.W29 ㎕-10X buffer5.0 ㎕1 ㎕0.12 pmolTemplate (1 ng / ㎕)1 ㎕0.02 ngPolymerase (1 unit / ㎕)1.0 ㎕0.02 Unit

[0059] N Used to create genetically mutant strains PCR conditionsStepTemperatureTime1. Initial denaturation94℃3min2. Denaturation98℃10sec3. Annealing68℃30sec4. Extension68℃5min5. Final extension68℃5min

[0060] (2-4 steps)x25 cycles

[0061]

[0062] 1-1. Attenuation analysis

[0063] The N gene mutant strain (Nf) was cultured in VeroE6 cells (2.5 × 10 5 cells / well) or Calu-3 cells (2.5 × 10 5 After infection with 0.1 MOI (Multiplicity of infection) per well (cell / well), the medium was harvested at 0, 6, 12, 18, 24, and 36 hours, and the virus count was measured using a plaque assay. Wild-type SARS-CoV-2 was infected with the same MOI and used as a control.

[0064] As a result, it was confirmed that the virus count at 24 or 36 hours after infection with the N gene mutant variant (Nf) was reduced by about 100 times compared to the wild-type SARS-CoV-2 (Fig. 1B). In addition, it was confirmed that the expression levels of Nsp1, S, M, E, and N proteins of the N gene mutant variant (Nf) were reduced compared to the wild-type SARS-CoV-2. As a result of measuring the LD50 (Lethal Dose 50) value by infecting mice, the LD50 of the wild-type SARS-CoV-2 was 1.3 × 10 2 PFU, whereas the N gene mutant mutant strain (Nf) is 5×10 3 It was confirmed that the survival rate of PFU was 80%.

[0065] The above results showed that the N gene mutant strain (Nf) was attenuated by confirming a reduced viral replication rate and reduced protein production compared to the wild-type SARS-CoV-2.

[0066]

[0067] 1-2. Safety Analysis

[0068] 6- to 8-week-old C57BL / 6 mice and IFNaRKO (interferon receptors knockout) C57BL / 6 mice (Jackson Laboratory) were injected with 5 × 10 N gene mutant mutant strain (Nf). 3After intranasal infection with 5 × 10 PFU, body weights were measured daily for 10 days, and lung tissues were harvested on days 3, 7, and 10 after infection, and RNA was extracted and RT-PCR for the N gene was performed using the primers in Table 2 below (Fig. 2A). Wild-type SARS-CoV-2 was injected intranasally at a density of 5 × 10 3 Infected with PFU and used as a control group.

[0069] N Primer used for RT-PCR for the genePrimer sequence (5'-3')Sequence numberNgene-FGACCCGTGCTCCTATTCAC7Ngene-RCAGCGAATGCACCCCCG8

[0070] As a result, it was confirmed that the body weight and N gene expression levels of mice infected with the N gene mutant mutant strain (Nf) in both C57BL / 6 mice and IFNaRKO C57BL / 6 mice did not significantly differ compared to the control group infected with wild-type SARS-CoV-2 (Fig. 2B, C).

[0071] Through the above results, it was found that the N gene mutant strain (Nf) maintains safety even in an environment with a weakened immune system.

[0072]

[0073] Example 2. Production of mutant strains of N and nsp1 genes

[0074] In order to further induce mutations in the nsp1 (nonstructural protein 1) gene in the N gene mutant mutant strain (Nf), an N and nsp1 gene mutant mutant strain (NfCtQF) was created. Specifically, using the primers in Table 5 below, amino acids 26 to 141 of the nsp1 protein were deleted, the 164th amino acid K (Lysine) was substituted with Q (Glutamine), and the 165th amino acid H (Histidine) was substituted with F (Phenylalanine) (Figs. 3A and 8B).

[0075] More specifically, PCR was performed under the concentrations and conditions of Tables 2 and 3 above (KOD-Plus-Neo, TOYOBO, Cat. No KOD-401), followed by PCR purification (GEL / PCR Purification Mini Kit, Favorgene, FAGCK 001-1). Afterwards, considering the molecular weight, SLIC (Sequence ligation independent cloning) was performed at a ratio of 1:3 with the vector and insert (mCherry-P2A) (T4 polymerase, enzynomics, DP004L). The conditions used for SLIC were 25°C for 2 minutes to activate T4 polymerase, and then 0.1 M EDTA was added to a final concentration of 0.01 M to inactivate T4 polymerase, followed by SLIC at 75°C for 20 minutes. Afterwards, cDNA containing the nsp1 gene mutation was obtained through sequencing.

[0076] In order to introduce the nsp1 gene mutation into the SARS-CoV-2 full-length cDNA, the N mutant SARS-CoV-2 full-length cDNA was reacted with restriction enzymes NruI (NruI-HF, NEB, R3192L) and XmaI (XmaI, NEB, R0180L) at 10 Unit each at 37°C for 6 hours, and the full-length cDNA was then treated with phosphatase at 1 Unit with rSAP (NEB, M0371L) at 37°C for 1 hour for cloning through ligase. The nsp1 gene mutant gene was also digested with the same restriction enzymes NruI and XmaI used to cut the full-length cDNA previously, at 37°C for 10 Unit for 6 hours, and then PCR purified and gel purified (Zymoclean Gel DNA Recovery Kit, ZYMO research, D4008), respectively. Cloning was performed by reacting the vector and insert at a molecular weight of 1:3 with T4 ligase (Enzynomics, M001L) at 400 Units at 16℃ overnight, and finally, through sequencing, a SARS-CoV-2 full-length cDNA N gene mutant mutant strain with an nsp1 gene mutation was obtained.

[0077] nsp1 Used to induce genetic mutations Primer sequence name Primer sequence (5'-3') Sequence number nsp1 (142-180) - RGTCGCGAACCTGTAAAACAGG 9 nsp1 (142-180) - FTCATTTGACTTAGGCGACGAGC 10 nsp1 (164Q165F) - FCACTCAGTTCAGCAGTGGTGTTACCCGTG 11 nsp1 (164Q165F) - RCACTGCTGAACTGAGTGTTCCAGTTTTCTTGAAAATCTTCATAAG 12 nsp1 (164A165A) - FCACTGCCGCCAGCAGTGGTGTTACCCG 13 nsp1 (164A165A) - RCTGCTGGCGGCAGTGTTCCAGTTTTCTT-GAAAATCTTC 14

[0078] Afterwards, the N and nsp1 gene mutant mutant strain (NfCtQF) was cultured in VeroE6 cells (2.5 × 10 5 cells / well) or Calu-3 cells (2.5 × 10 5 After infection with 0.1 MOI (cells / well), the medium was harvested at 0, 6, 12, 18, 24, and 36 hours, and the virus count was measured using a plaque assay. Wild-type SARS-CoV-2 or N gene mutant mutant strain (Nf) were infected with the same MOI and used as a control or comparison group.

[0079] As a result, the virus count of the N and nsp1 gene mutant mutant strain (NfCtQF) was confirmed to be reduced approximately 1,000-fold compared to the wild-type SARS-CoV-2 and approximately 10-fold compared to the N gene mutant mutant strain (Nf) (Fig. 3B). In addition, it was confirmed that the expression of mCherry was continuously maintained even after the process of infecting VeroE6 cells with the N and nsp1 gene mutant mutant strain (NfCtQF), culturing, harvesting, and reinfecting them was repeated nine times (Fig. 4).

[0080]

[0081] Example 3. Evaluation of vaccine efficacy of N and nsp1 gene mutant strains

[0082] To evaluate the vaccine efficacy of the N and nsp1 gene mutant mutant strain (NfCtQF), 5 × 10 N and nsp1 gene mutant mutant strain (NfCtQF) was injected into 6- to 8-week-old C57Bl / 6 K-18 hACE2 Tg mice (Jackson Laboratory), an animal model susceptible to SARS-CoV-2. 3 The first dose (prime) of PFU was administered intranasally, and 5×102 was administered 2 weeks later. 3 The second booster was administered intranasally with PFU, and two weeks later, wild-type SARS-CoV-2 was administered at a dose of 20×LD50 (2×10 4A challenge infection was performed with 100 PFU (Fig. 5). Instead of inoculating the N and nsp1 gene mutant mutant strain (NfCtQF), PBS was injected and used as a control.

[0083]

[0084] 3-1. Antibody analysis

[0085] Two weeks after the first and second vaccinations (for a total of four weeks), blood and bronchoalveolar lavage fluid (BALF) were collected, and the amount of virus-specific antibodies was measured using ELISA. The reagents and methods used are described in detail below. Capture IgG (Goat anti-Mouse IgG Heavy and Light Chain Antibody, Bethyl Laboratories®, A90-116A), Capture IgA (Rabbit anti-Mouse IgA Heavy Chain Antibody, Bethyl Laboratories®, A90-104A), and SARS-CoV-2 spike RBD protein (Recombinant SARS-CoV-2 Spike RBD His-tag Protein, CF (100 ug), R&D system, 10500-CV-100) were coated on a 96-well immuno plate using coating buffer (ELISA plate coating buffer, R&D system, DY006). After reacting mouse serum or BALF samples on the coated plate, detector antibodies (Anti-mouse IgG, HRP-linked Antibody, cell signaling, 7076 or Goat Anti-Mouse IgA alpha chain (HRP), abcam, ab97235) were added, and the amount of total and RBD-specific IgG and IgA antibodies was measured using TMB solution (Substrate reagent pack, R&D system, DY999). In addition, to measure the neutralizing ability of virus-specific antibodies present in mouse serum or BALF, Focus reduction neutralization test (FRNT50) was performed as follows. First, mouse serum was inactivated at 56℃ for 30 minutes.Inactivated mouse serum was serially diluted 4-fold and added to a 96-well immunoplate with 6000 PFU / well of SARS-CoV-2 virus and incubated at 37°C for 1 hour. VeroE6 was added at 4x10. 4 / The above mixed culture medium was added to a 96-well plate laid so that it was evenly distributed and cultured at 37℃ for 8 hours. The cells were washed with PBS and fixed with 4% paraformaldehyde at room temperature for more than 12 hours. The 96-well plate was fixed with 100% methanol for 10 minutes and then washed with PBS. Blocking was performed for 30 minutes at room temperature using a blocking buffer (PBS, 1% BSA, 0.1% Tween-20). SARS-CoV-2 Nucleocapsid antibody (SinoBiological, 40143-R001) was diluted 1:3000 in the blocking buffer and incubated for 1 hour at room temperature. Afterwards, the cells were washed with PBS-T (PBS, 0.1% Tween-20) and PBS. After adding TMB stabilized substrate (TMB Stabilized Substrate for Horseradish Peroxidase, Promega, W4121), the reaction was allowed to proceed at room temperature for 30 minutes, and the number of stained foci was measured using immunospot.

[0086] As a result, it was confirmed that the amount of total IgG and RBD-specific IgG in the blood of the N and nsp1 gene mutant mutant strain (NfCtQF) vaccination group and the amount of total IgA in the bronchoalveolar lavage fluid increased compared to the control group (Figs. 6A, 6B, 6C). In addition, it was confirmed that the value of FRNT50 in the blood and bronchoalveolar lavage fluid of the N and nsp1 gene mutant mutant strain (NfCtQF) vaccination group increased compared to the control group, indicating that the amount of neutralizing antibody production increased due to the N and nsp1 gene mutant mutant strain (NfCtQF) vaccination (Figs. 6D, 6E).

[0087]

[0088] 3-2. Analysis of challenge infection results

[0089] During the 10-day animal experiment to evaluate vaccine efficacy, the body weight and survival rate of mice were measured daily. Two and seven days after challenge infection, lung and nasal turbinate tissues were collected and the virus count was measured through plaque analysis.

[0090] As a result, the body weight of the group vaccinated with the N and nsp1 gene mutant strains (NfCtQF) did not change during the 10 days of animal experiment, and all survived, but the body weight of the control group gradually decreased, and all died on the 8th day (Figs. 7A, 7B). In addition, it was confirmed that the number of viruses in the lungs and nasal turbinate tissues of the group vaccinated with the N and nsp1 gene mutant strains (NfCtQF) was significantly reduced compared to the control group (Figs. 7C, 7D).

Claims

1. Attenuated SARS-CoV-2 (Severe acute respiratory syndrome coronavirus 2) vaccine strain containing mutations in the N (nucleocapsid) gene and mutations in the nsp1 (non-structural protein 1) protein.

2. In the first paragraph, the mutation of the N gene is characterized in that the mCherry coding sequence and the P2A (self cleavage peptide) coding sequence are sequentially inserted in the 3' direction of the TRS (transcription regulatory sequence) of the N gene, an attenuated SARS-CoV-2 vaccine strain.

3. An attenuated SARS-CoV-2 vaccine strain according to claim 1, characterized in that the mutation of the nsp1 protein is characterized in that amino acids 26 to 141 in the amino acid sequence of SEQ ID NO: 2 are deleted, the 164th amino acid is substituted from lysine to glutamine, and the 165th amino acid is substituted from histidine to phenylalanine.

4. A vaccine composition for preventing coronavirus disease-19, comprising the attenuated SARS-CoV-2 vaccine strain of any one of claims 1 to 3 as an active ingredient.

5. A vaccine composition according to claim 4, characterized in that the composition further comprises a pharmaceutically acceptable carrier or adjuvant.

6. A method for preventing coronavirus disease-19 by administering the vaccine composition of Article 4 to an animal.

7. A kit for detecting SARS-CoV-2, comprising the attenuated SARS-CoV-2 vaccine strain of any one of claims 1 to 3 as an active ingredient.

8. A method for providing information on coronavirus disease-19 infection, comprising a step of reacting an attenuated SARS-CoV-2 vaccine strain of any one of claims 1 to 3 with serum isolated from a subject suspected of having coronavirus disease-19.

9. A method for producing a vaccine against COVID-19, comprising a step of subculturing the attenuated SARS-CoV-2 vaccine strain of any one of claims 1 to 3 in a vaccine production cell line.

10. A recombinant vector comprising a SARS-CoV-2 gene including an N gene and an nsp1 protein coding gene, wherein the N gene has an mCherry coding sequence and a P2A (self cleavage peptide) coding sequence sequentially inserted in the 3' direction of a TRS (transcription regulatory sequence), and the nsp1 protein has amino acids 26 to 141 deleted from the amino acid sequence of SEQ ID NO: 2, the 164th amino acid is substituted from lysine to glutamine, and the 165th amino acid is substituted from histidine to phenylalanine.

Images