Cilia protein as biomarkers and methods of use

Cilia proteins, including TfR1, GAPDH, and C1s, are used as biomarkers to detect endothelial damage and vascular injury by quantifying their levels in biological samples, addressing the need for improved detection of vascular flow-related conditions.

WO2025231042A1PCT designated stage Publication Date: 2025-11-06MEDICAL COLLEGE OF WISCONSIN INC +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/026913
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-30
Filing Date
2025-04-29
Publication Date
2025-11-06

AI Technical Summary

Technical Problem

There is a need for new markers and methods to detect changes caused by high or low vascular flow, leading to endothelial damage or dysfunction, vascular injury, and injury to other cell types and organs, as existing methods are inadequate for identifying these conditions.

Method used

The use of cilia proteins, such as Transferrin Receptor I (TfR1), Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH), and complement subcomponent C1 (C1s) as biomarkers, detected through antibodies, to identify endothelial damage or dysfunction by quantifying their levels in biological samples.

Benefits of technology

Cilia proteins serve as effective biomarkers for vascular dysfunction and injury, enabling early detection and monitoring of conditions like sickle cell disease and traumatic brain injury, providing insights into endothelial health and potential therapeutic interventions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025026913_06112025_PF_FP_ABST
    Figure US2025026913_06112025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention provides methods and kits for detecting cilium markers in samples and uses thereof for detecting and treating endothelial damage or dysfunction or vascular injury in the subject. Also provided are methods of sample processing, methods for detecting cilium markers on platelets, and methods of detecting traumatic brain injury.
Need to check novelty before this filing date? Find Prior Art

Description

[0001]650053.01187 CILIA PROTEIN AS BIOMARKERS AND METHODS OF USE CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 63 / 640,432, filed on April 30, 2024, the contents of which are herein incorporated by reference in their entirety. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH This invention was made with government support under grant number R61 HL154254 awarded by the National Institutes of Health. The government has certain rights in this invention. BACKGROUND Cilia, microtubule-based organelles that project from the apical luminal surface of endothelial cells (ECs), are widely regarded as low-flow sensors. Previous reports suggest that upon high shear stress, cilia on the EC surface are lost, and more recent evidence suggests that deciliation—the physical removal of cilia from the cell surface—is a predominant mechanism for cilia loss in mammalian cells. There is a need for need for new markers and methods of detecting changes that are caused by high or low vascular flow, leading to endothelial damage or dysfunction or vascular injury, as well as injury of other cell types, organs, and systems. SUMMARY Cilia and associated proteins, e.g., those proteins that are either expressed on the cilia or expressed on cells, such as endothelial cells or other cell types, that include cilia, are lost upon encountering turbulent blood flow, which leads to removal of cilia and associated proteins from the cells. The removed cilia and associated proteins can be detected on red blood cells, platelets, white blood cells, and in body fluids. This free cilia and the associated proteins can thus be used as biomarkers for altered flow in the blood, that is associated with vascular dysfunction and injury, and / or organ dysfunction and / or organ injury. In one aspect, the disclosure provides a method of detecting cellular damage, e.g., endothelial cell damage or dysfunction or vascular injury in a subject in need thereof, the method comprising: detecting one or more markers of free cilium (cilium markers) in a biological sample from the subject, wherein a higher or lower level of cilium markers detected in the biological sample compared to control indicates cellular damage, e.g., endothelial cell damage or dysfunction or vascular injury. In another aspect, the disclosure provides a kit comprising: at least one antibody that binds to at least one cilium marker, and instructions for use. The kit may further comprise at least one secondary agent that has a detectable label. The one or more antibodies may bind to at least one of 650053.01187 Transferrin Receptor I (TfR1), Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH), and complement subcomponent C1 (C1s). In another aspect, the disclosure provides a method of detecting and occlusive avent associated with sickle cell disease (SCD) in a subject, the method comprising: detecting one or more markers of cilium in a first biological sample from the subject. In another aspect, the disclosure provides a method of detecting cilia on platelets in a sample from a subject, comprising obtaining a blood sample, isolating the platelets, and detecting one or more markers of cilium on the surface of the platelets. In another aspect, the disclosure provides a method of sample processing, comprsing analyzing cells of a blood sample obtained from a subject and quantifying one or more markers of cilium associated with the platelets of the blood sample. In the method, analyzing the cells of the sample comprises selectively identifying platelets and detecting one or more markers of cilium associated with the platelets. In a futher aspect, the disclosure provides a method of sample processing, comprising producing a fraction of a blood sample from a subject, introducing the sample to an immobilized antibody under conditions sufficient to bind the antibody to the one or more markers of cilium associated with a platelet in the sample, selectively removing unbound components in the sample, and quantify the one or more markers of cilium in the fraction. In a further aspect, the disclosure provides a method of detecting cilium markers on red blood cells and / or platelets, in a sample from a subject, the method comprising obtaining a blood sample from a subject; isolating the cells, such as red blood cells (RBCs) and / or platelets from the sample, and detecting one or more markers of cilium on the surface of the red blood cells and / or platelets. In another aspect, the disclosure provides a method of detecting Traumatic Brain Injury (TBI) in a subject, the method comprising detecting one or more markers of cilium in a biological sample from the subject. In some embodiments, the biological sample comprises a blood sample. In some embodiments, the biological samples comprises RBCs and / or platelets. BRIEF DESCRIPTION OF THE DRAWINGS FIG.1. Shear stress causes brain ECs to express fewer cilia proteins in vitro. HBMVECs were subjected to graded strengths of shear stress (2 dyne / cm2, 4 dyne / cm2, and 10 dyne / cm2) by the Ibidi flow system. A total of 2 dyne / cm2was utilized as a “steady-state” flow condition. Following flow with durations as indicated, the expression of cilia-associated proteins was quantified as MFI by flow cytometry. NRF2, the transcription factor reported to control cilia formation and function, was also included in the study. Expression of proteins in the samples was normalized against their respective “no flow” controls. ANOVA was performed to compare 650053.01187 between the experimental groups versus steady-state control group for 10-minute or 24-hour time points. ANOVAs were 2 way. Analysis was also performed between 10 minutes and 24 hours in 2 dyne / cm2group. In all 3 protein expressions, no statistical difference was observed between 4 dyne / cm2and 10 dyne / cm2groups. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. For all groups reported in this figure, n = 6 except for IFT88 (n = 5 for 10 dyne group). FIGS.2A-2K. Shear stress causes deciliation of endothelial and epithelial cells in vitro. (2A–2D) HUVECs grown on monolayer. Fluid shear stress of 20 dyne / cm2was perfused onto the cells, and the perfusate was collected (2A). The drop concentrated perfusate was analyzed with DIC microscopy and stained with markers for cilia (acetylated-α-tubulin) (2B) and basal body (γ- tubulin) (2C). Enlarged images are also shown in the boxes. (2D) Merged image is shown. (2E and 2F) Immunostaining (acetylated-α-tubulin, green, cilia; and DAPI, blue, nucleus) for the presence and absence of the cilia from the epithelial cell population before (2E) and after (2F) the application of 10 dyne / cm2shear stress, respectively. (2G and 2H) Phase contrast DIC image of a primary cilium in a single live cell (white dotted box). The same cell was imaged before and after 4-minute application of 10 dyne / cm2fluid shear stress. (2I) Perfusate under DIC microscopy. (2J) A separate experiment, where perfusate was collected and stained with ciliary marker (acetylated-α-tubulin; green) to confirm the presence of cilia using both fluorescence and phase contrast imaging . (2K) Cilia and cell lysates were immunoblotted with cilia marker (acetylated-α-tubulin) to molecularly confirm the presence of the cilia in the perfusate (n = 6).2E–2K represent porcine kidney epithelial cells (LLC-PK1). FIGS. 3A-3D. Shear stress results in ECs with fewer cilia proteins in vivo. Flk1mCherryArl13bGFPdouble-transgenic zebrafish embryos at 29.5 hpf were subjected to 32°C temperature for 3 hours. Single cells were harvested from dechorionated embryos, and expression of cilia-specific proteins was quantified by flow cytometry in live ECs (mCherry+) versus non-ECs (mCherry–). Representative dot plots show the gating strategy as applied during FACS analysis to identify ECs (3A). Stress-responsive protein Klf4 was quantified in ECs (3B). Protein quantification was done by measuring MFI. Cilia-specific proteins were quantified in ECs (3C) as well as non-ECs (3D). Arl13b expression is marked by enhanced green fluorescent protein expression. For Arl13b n = 6 (for EC and non-EC); γ-tubulin n = 5 (for EC and non-EC); Ift88 n = 4 (EC) and n = 5 (non-EC); Inversin (n = 3 for EC and non-EC); Klf4 n = 3 (for EC and non-EC). A linear mixed model was used to examine the differences between treatment group and control group within EC (mCherry+) or non-EC (mCherry–). Time processed nested within day was treated as random. ARL13b and Inversin expression data were log-transformed to improve fit. FIGS. 4A-4F. Sickle RBCs adhere to brain ECs triggering deciliation, and cilia are found on sickle RBCs and plasma from SCD. HBMVECs exposed to sickle (SS) or healthy (AA) 650053.01187 RBCs were subjected to shear stress (1 dyne / cm2), and fraction of SS (n = 6) and AA (n = 5) RBCs adhered to ECs after stress induction was calculated, P = 0.0081 (4A). SS and AA RBCs were tested for ARL13b cilia prior to flow and proportion of ARL13b cilia adhered to circulating SS RBCs (n = 16) versus AA RBCs (n = 12) were quantified, P < 0.0001 (4B). After flow, ARL13b expression on SS RBCs (n = 11), but not AA RBCs (n = 6), upon interaction with ECs, P = 0.0006 (4C). (4A– 4C) Mann-Whitney-Wilcoxon test P values are provided. Representative field (magnification 63×; scale bar = 20 μm) of a smear of SS RBCs shows cilia presence on these sickle cells, detected with FITC-conjugated anti-Arl13b antibody (4D). Western blot plot shows the detection of cilia-specific proteins in plasma samples of healthy controls (AA) versus sickle (SS). Red asterisk represents the top IFT88 band that was used for quantification (4E). Please note that Western blots from only 4 AA and SS samples are shown in 4E. A separate gel for the other 6 samples was run and quantified. Quantification includes all 10 samples from each group. Cilia-specific proteins were quantified from plasma samples of healthy controls (AA) (n = 10) versus sickle (SS) (n = 10) and normalized against housekeeping protein bACTIN (4F). *P < 0.05, ***P < 0.001. A 2-tailed t test or Mann- Whitney-Wilcoxon test was performed to compare between groups. FIGS. 5A-5B. Cilia shedding triggered by sickle RBCs is dependent on RBC-induced increased EC ROS generation. Human brain microvascular ECs were sham treated or treated with the NOX inhibitor apocynin (5A), prior to exposure or not with sickle RBCs (SS RBCs) (n = 6). Exposure of HBMVECs to SS RBCs increased ROS generation in ECs, which is dependent on NOX. Flow cytometry analysis shows ARL13b bound to SS RBCs (n = 6) prior to (baseline) and after interaction with shear-stressed ECs pretreated with apocynin (5B). *P < 0.05, and ****P < 0.0001. +a= ECs treated with apocynin. For 5A, 1-way ANOVA test was performed, and for 5B, Wilcoxon’s signed-rank test was performed. FIGS. 6A-6E. Attenuating ROS production rescues cilia proteins in ECs. HBMVECs were treated with ROS-inducing PMA in presence or absence of NOX inhibitor VAS2870. Untreated groups were also included as controls. ROS production was quantified as MFI by flow cytometry (6A). Oxidative stress counteracting protein heme oxygenase 1 (HO-1) was quantified (6B). NRF2, the transcription factor reported to control cilia formation and function, was also included in the study (6C). Cilia proteins are downregulated by PMA and rescued by NOX inhibitor VAS2870 (6D and 6E). ****P < 0.0001. ANOVA (1 way) was performed, and Bonferroni’s correction was used to adjust for multiple comparisons (n = 5 for all groups). FIGS. 7A-7B. Validation of shear stress as induced by Ibidi flow system. Human brain microvascular endothelial cells were subjected to 10 dyne / cm2 shear stress for 24 hours, as induced by ibidi flow system and subsequently monitored for flow responsive genes KLF4 or KLF2 by 650053.01187 qRT-PCR (7A) as well as the respective proteins by flow cytometry (7B). KLF4 and KLF2 gene expressions were normalized against GAPDH and plotted as fold change. *P<0.05 FIGS. 8A-8F. Loss of cilia proteins from brain endothelial cells following shear stress induced by shaker method in vitro. Human brain microvascular endothelial cells were subjected to graded strengths of shear stress (4 dyne / cm2 and 10 dyne / cm2) as induced by ‘shaker’ method and subsequently the expression of cilia-specific proteins was quantified by flow cytometry. Stress- responsive proteins were quantified (8A) along with non-cilia housekeeping (8B) or cilia-specific proteins (8C-8F) by measuring median fluorescent intensity. Comparison across groups (4 dyne vs. Control, 10 dyne vs. Control and 4 dyne vs. 10 dyne) were performed for all proteins. In all three group comparisons, P,0.001 for Arl13b, Tubulin, IFT88, and Inversin proteins. For Alk1, P=0.0003 for 4 dyne vs. Control, P,0.001 for 10 dyne vs. Control and P=0.0004 for 4 dyne vs. 10 dyne comparison. For Dynein, P,0.001 for 4 dyne vs. Control and 10 dyne vs. Control, and P=0.0173 for 4 dyne vs.10 dyne comparison. N=3 for all protein targets except for β-actin, which is n=4. FIGS. 9A-9B. Scheme for shear stress EC FACS experiments in vitro and in vivo. 9A shows the scheme the treatment of HBMVECs post shear stress for FACS analysis. 9B shows the scheme for fish treatment conditions, and subsequent analysis prior to FACS. FIG. 10. Temperature-induced shear stress experimental design in zebrafish. The 3 groups and the conditions for incubation for each are depicted in a pictorial format. All blood flow parameters were evaluated at 48 hours post fertilization (hpf) stage. FIGS. 11A-11B. PMBC flow parameters assessed at two temperatures of 32°C and 35°C. 11A shows pulse, blood flow velocity, vessel diameter and shear stress measured in primordial midbrain channels (PMBCs) across the three groups (G1-G3 shown in FIGS.14A-14F) at 32°C. 11B shows pulse, blood flow velocity, vessel diameter and shear stress measured in PMBCs across the three groups (G1-G3 shown in FIGS.14A-14F) at 35°C. *P<0.001. FIGS. 12A-12B. DA flow parameters assessed at two temperatures of 32°C and 35°C. 12A shows pulse, blood flow velocity, vessel diameter and shear stress measured in dorsal aorta (DA) across the three groups (G1-G3 shown in FIGS.14A-14F) at 32°C. 12B shows pulse, blood flow velocity, vessel diameter and shear stress measured in DA across the three groups (G1-G3 shown in FIGS.14A-14F) at 35°C. *P<0.001. FIGS. 13A-13B. PMBCs and DA flow parameters assessed at two temperatures of 32°C. 13A shows pulse, blood flow velocity, vessel diameter and shear stress measured in primordial midbrain channels (PMBCs) across the three groups (G1-G3 shown in FIGS.14A-14F) at 32°C. 13B shows pulse, blood flow velocity, vessel diameter and shear stress measured in DA across the three groups (G1-G3 shown in FIGS.14A-14F). *P<0.0001. 650053.01187 FIGS. 14A-14F. Whole mount images of casper fish at 35°C and 32°C.14A,14D (group 1), 14B,14E (group 2) and 14C,14F (group 3) Casper transparent 48 hours post fertilization (48 hpf) fish embryos incubated at 35°C and 32°C were stained with O-dianisidine stain (red blood cells). Note group 3 (14C) embryos at 35°C display curved axis. Anterior is left and posterior is right. Dorsal is up. FIGS. 15A-15C. Cilia on circulating mouse sickle RBCs. 15A and 15B shows blood smears from SS sickle mouse stained for IFT88 and Arl13b antibodies. The green stain is cilia on RBCs. 15C quantification is from a different experiment from 15A & 15B. For the quantification of Arl13b positive cilia adhering to control (AA) vs. sickle RBCs (SS), four mice per group were used. 1 smear from each mouse, and four fields in each smear were counted. Thus, a total of data from 16 smears counted from control mice and sickle mice group (n=4 per group) are presented. #P<0.0001. FIGS. 16A-16D. Normal and sickle mouse models examined for the deciliation process. 16A illustrates mouse models from normal hβA / hβA alleles (AA), corrected hβAb. / hβs alleles (AS), and sickle hβs / hβs alleles (SS) examined for the deciliation process. 16B illustrates a validation via western blot of genotype in normal (AS) mice with apparent expression for hβA / hβs alleles and Sickle (SS) mice with apparent expression for hβs / hβs alleles.16C illustrates RBC phenotypes for both mouse models. Arrows indicate sickle RBC in sickle mouse model.16D shows bar graphs for the quantification of normal and sickle RBC phenotype in normal and sickle mouse models, respectively. N = 3 in each group. FIGS. 17A-17F. Sickled RBC induces the deciliation process. 17A are fluorescence micrographs showing the flow shear stress induction of the deciliation process in sickled RBC at 5.0 dyn / cm2. The acetylated alpha tubulin (green) and DAPI (blue) were used for cilia and nucleus markers, respectively. 17B shows graphs illustrating a quantification analysis demonstrating the significance of the deciliation process. N = 3 in each group. 17C are brightfield and fluorescence micrographs showing the significant attachments of cilia fragments to normal (AA) sickled (SS) RBC. The Arl13b (green) was used for cilia markers. 17D is a graph showing a quantification of number of RBCs with Arl13b cilia in AA and SS blood. 17E is a graph showing a quantification analysis demonstrating the percent distribution of normal vs. sickle-looking RBCs in SS blood.17F is a graph showing a quantification analysis shows percent of cilia on normal vs. sickle-looking RBCs in SS blood. N=4 mice per group, and data for each group has 4 smears / mice = 16 total smears. FIGS. 18A-18F. Comparative proteomic analyses of cilia fragments in normal and sickle cell disease mouse models. 18A shows cluster analysis of 637 total protein expression between normal and sickle cell disease. 18B shows a volcano plot analysis of normal (red) and 650053.01187 sickle cell disease (blue). Proteins showing within the shaded red and blue box are exclusively expressed in normal and sickle cell disease, respectively. 18C shows a Venn diagram analysis showing the shared and exclusively expressed proteins between normal and sickle cell disease.18D- 18F are gene ontology (GO) analyses illustrating the enrichment differences of cilia fragments between normal and SCD. 18D shows a biological process bar graph describing the biological objectives to which the gene product contributes. 18E shows a cellular component bar graph describing the localization in the cell where the gene exerts its activity. 18F shows a molecular function bar graph describing the biochemical activity of each gene product. N = 3 in each group. FIGS. 19A-19D. Signaling pathways and cellular components are uniquely expressed in sickle cell disease. 19A-19C illustrate Signaling pathways involved in SCD. 19A and 19B are bar graphs showing exclusive signaling pathways involved in normal and SCD, respectively.191C is a bar graph showing shared and differential expression of signaling pathways between normal and SCD. 19D is a bar graph showing a protein classification analysis that describes the protein class associated with normal and SCD. The bar graph represents the percentage of gene hit against the total number of signaling pathways and protein class hits. N = 3 in each group. FIGS. 20A-20F. Post translation modifications (PTMs) affects the protein profile in sickle cell disease.20A is a pie graph showing a post translation modification analysis that reveals a total of 130 proteins. The pie graph describes the percentage and classification of the PTMs.20B is a Venn diagram showing the shared and exclusively expressed PTMs between normal and SCD. 20C is a bar graph indicating the exclusively expressed PTMs proteins in normal and SCD.20D is a pie diagram showing the exclusively expressed PTMs proteins matching with ciliary extracellular vesicles (ciEV), bona fide cilia, and novel proteins.20E is an immunoblot analysis of blood plasma from normal and SCD mouse models used to validate the exclusively expressed PTMs proteins. 20F shows bar graphs illustrating a quantification analysis of validated proteins in mouse models (N = 3 in each group). FIGS. 21A-B. Flow cytometry analysis of cilia protein ARL13B in response to severe Traumatic Brain Injury (TBI) in mice. 21A shows dot plots and gating strategy for positive control (TBI unstained), negative control (pre-TBI stained), and experimental (TBI stained) mice at day one in total blood cells. ARL13B antibody (red, Y-axis) and transgenic eGFP (green, X-axis) double-positive signal identifies and validates Arl13B protein.21B is a graph showing the median fluorescence intensity (MFI) of ARL13B before TBI and at days 1, 7, and 14 days post-TBI. N=3 mice per group. ARL13B-eGFP mice were used in these studies. Figure 22. Analysis of cilia protein ARL13b and IFT88 in different cell types post TBI. Post TBI, single cell suspension from brain cortex was isolated and analyzed by flow cytometry. 650053.01187 MFI for ARL13B (left panels) and IFT88 (right panels) in all cells, astrocytes and endothelial cells is shown. *P<0.05. FIGS. 23A-B. ARL13b cilia protein detection in blood cells post TBI. 23A shows a depiction of endothelial cells carrying cilia (green) impacted by flow changes post TBI, which releases cilia that is captured on blood cells. 23B are graphs showing the detection of ARL13b on all cells, red blood cells, and platelets pre-TBI and at days 1, 7, and 14 post-TBI. ARL13B-GFP transgenic mice were subjected to TBI. Fifty ^l blood was collected in heparinized tube each time point from a given mouse, washed x2 with FACS buffer and fixed with 4% paraformaldehyde. Fixed cells were stained with antibodies to identify different blood cell types (RBC: Ter119+, and platelet: CD41+) and cilia protein ARL13B. Stained cells were analyzed by flow cytometer and cell-associated cilia proteins are presented as % cells positive for ARL13B. n=3. FIGS. 24A-24B. The effect of shear flow of normal RBC in deciliation process. 24A shows representative immuno-fluorescence images that illustrate the effect of different shear flow of normal RBC in deciliation process.24B are graphs showing the effect of each shear flow on the distribution of cilia length is shown in the histogram. FIGS. 25A-25B. The effect of shear flow of sickled RBC in deciliation process. 25A shows representative immuno-fluorescence images that illustrate the effect of different shear flow of sickled RBC in deciliation process. 25B are graphs showing the effect each shear flow on the distribution of cilia length is shown in the histogram. FIGS. 26A-26B. Validation of cilia proteome. 26A. illustrates an immunoblot analysis showing the enrichment of cilia fragments from mouse blood plasma in normal (AS) and sickled (SS) mouse models. To validate cilia fragments purity, a positive (ARL13B) and negative (Actin) cilia markers were used. 26B. is a graph illustrating the cilia proteomic profile was validated and compared to other cilia proteomic studies, including ciliary an extracellular vesicles proteomic study. The bar graph shows the percentage of protein profile match with the current study. FIGS. 27A-27C. Gene Ontology (GO) analyses. 27A-27C are GO analyses showing detected genes in proteomic data. The ratio (line graph) and the adjusted p-value (bar graph) describe the three different GO analyses. The ratio represents the significantly expressed genes involved over the total gene in each category of the (27A) biological processes, (27B) molecular function and (27C) cellular component, respectively. FIG.28. Shared and differential expression of cellular component between normal and SCD. FIG 28 shows a protein classification analysis describing the cellular component associated with normal and SCD. The bar graph represents the percentage of gene hit against the total number of cellular component hits. N = 3 in each group. 650053.01187 FIGS. 29A-29E. Validation of post translation modifications (PTMs) proteins expression in sickle cell disease. 29A illustrates Coomassie blue staining showing the equal loading across the examined human samples. 29B-29E are complete and uncropped immunoblot images of blood plasma from normal and SCD human patients. A total of 4 candidates were selected, one was not PTMs (TfR1; 29B), two exclusively expressed PTMs proteins (C1s; 29C and GAPDH; 29D), and one for deciliation process maker (ARL13B; 29E). N = 3 in each group. FIGS. 30A-30C. ECs decrease expression of ciliary markers post-TBI. scRNAseq identifies the loss of Arl13b gene expression from EC clusters (30A). Expression of ARL13B protein was quantified by flow cytometry from total cells, GFAP+ cells, or ECs derived from brain cortex. For any given post-TBI time point or uninjured control (no-TBI), the ARL13B expression in single cells from ipsilateral side was normalized against single cells from site-matched paired contralateral side. Each group of mice were euthanized on separate days at the indicated endpoints (30B). In an additional experiment, expression of ARL13B protein was quantified by flow cytometry from endothelial cells derived from brain cortex. Here, each group of mice were injured on separate days to coincide all endpoints on a same day. Thus, all groups of mice were euthanized the same day but with different endpoints (30C). For 24A, n=4. For 24B, n=6. For 24C, n=3. Data are mean ± SEM. * p<0.05 vs. control (Pre-TBI or No Injury). For statistical analysis, ANOVA or Kruskal-Wallis was performed; Tukey’s test or Dunn’s was used to adjust for multiple comparisons. FIGS.31A-31B. Analysis of TBI blood samples. Blood samples were collected from two different rats both before and 24 hours after TBI (2 timepoints per rat).1.5 ml of blood was collected and divided evenly into 3 tubes at each time point, which were then processed to create a 1) plasma sample, 2) platelet enriched plasma sample, and 3) serum sample. The samples were analyzed by gel electrophoresis to assess total protein concentration (FIG.31B) or immunoblotted for ARL13B (FIG. 31A) to determine the imapact of blood sample type on the detection of cilia proteins.The results demonstrate a larger increase ARL13B following TBI in plasma and platelet rich plasma samples, as compared to serum samples. These results suggest that in some cases (e.g., TBI), markers of cilium (e.g., ARL13B) may be preferentially detected in plasma. DETAILED DESCRIPTION The present invention provides methods and kits for detecting cilia, and cilium markers, in a biological sample and uses thereof. As used herein, “detecting cilia” can refer to the detection of whole cilia or fragments thereof. In the present disclosure, we demonstrate that cilia and associated proteins serve as a biomarker for altered flow (high or low) in disease conditions, and as markers of organ dysfunction and / or organ injury, and thus may be used as a prognostic or diagnostic marker for illness in patients. 650053.01187 In some diseases, injuries, or conditions (e.g., medication side-effects, organ damage), blood flow rate is either lower or higher in the body which can result in vascular damage and injury, and / or organ damage and injury. Thus, ECs that underlie all blood vessels in the body are the first line of flow sensors, which reacts to the altered flow patterns by either dispensing or keeping cilium on the cell surface. Likewise, the cilia from cilia-producing cells in different tissues and organs can also lose cilia under certain types of stress, such as injury or disease. Thus, the net result is more or lesser cilia in the biological fluid, which can be monitored by assays (e.g., ELISA analysis). In some embodiments, the basal body associated with cilium serve as a marker for the origin of cilium in biofluids (serum, plasma, blood, urine, cerebrospinal fluid, seminal fluid, saliva, tears, synovial fluid, breast milk, bile, amniotic fluid, aqueous humor, vaginal lubrication, sweat, lymph, bone marrow). Ciliary length is often correlated with mechanosensory action in blood vessels, with cells experiencing low shear stress having longer cilia and cells in blood vessels with high shear stress having shorter cilia or no cilia. Cilia include an axoneme that projects into the lumen and are anchored to the cell through transition fibers that connect to the basal body, a centriole-derived structure. Recent work suggests that cilia can be physically removed from mammalian cells, a process called deciliation, which releases the ciliary membrane and axoneme from the basal body. The Examples demonstrate that the detection or quantification of ciliary proteins in circulation may serve as a biomarker for pathologic conditions of altered flow or changes in blood viscosity. The Examples show that compared with steady-state controls, high shear stress on endothelial cells resulted in about 20% less expression of any cilia-associated proteins after 10-minute perfusion (FIG. 1). The reduction of protein expression in the groups was even pronounced (>50%) at 24 hours postperfusion (FIG.1). Further, in the cerebral and systemic vasculature, occlusive events in SCD have been postulated to be initiated by sickle RBCs’ adhesion to the endothelium. The Examples demonstrate that ciliary proteins may be high in plasma from patients with SCD. In the first Example, plasma from 10 patients with SCD and 10 healthy individuals using Western blot for the presence of ciliary proteins ARL13b, γ-tubulin, and IFT88 (FIGS.4E-4F) were tested. All 3 ciliary proteins were enriched in the plasma from patients with SCD compared with healthy volunteers (FIG.4F). In a second Example, a proteomic screen was performed using isolated cilia fractions from sickle cell trait (SCT) and SCD mouse models to identify selectively expressed proteins. Two proteins identified as more selectively expressed in the SCD mouse model, TfR1 and GAPDH, were also found to be more highly expressed in the blood of humans patients with SCD than healthy individuals. These results demonstrate that in a pathologic condition predisposed to vascular occlusion and / or compromised blood flow, ciliary proteins are present on the surface of RBCs, 650053.01187 further accumulate on RBCs upon EC contact, and are enriched in plasma. Cilia proteins may be used as biomarkers for diagnosis of flow-mediated alterations of the vascular endothelium. Also, in the second example, the protein C1s was identified as more selectively expressed in the SCT model than the SCD model. C1s was also found to be more highly expressed in the blood of healthy individuals than human patients with SCD. This result also suggests that processes related to C1s function (e.g., innate and adaptive immune response processes) may be downregulated in SCD, and that the lower expression of C1s may also be a marker of a pathological condition predisposed to and / or indicating vascular occlusion and compromised blood flow. The Examples also demonstrate the association of markers of cilium to platelets. In a third Example, a mouse model was used to identify and validate markers of cilium in TBI. The results demonstrated that markers of cilium (e.g., ALR13b) were not enriched on blood cells pre-TBI, but are elevated post-TBI on both RBCs and platelets, and the elevation increases over time. The results suggest a link between elevated levels of RBC / platelet ciliary proteins and the underlying pathology of post concussive syndrome. In addition, the results showed decreased ciliary proteins on brain cells following TBI, including a rapid loss of cilia in brain endothelial cells (ECs), which was detectable as early as day 1 post-TBI. Without wishing to be bound by a particular theory, these results suggest that the loss of endothelial cell ciliary protein from brain cortex cells causes the enrichment of ciliary protein in blood cells. In one embodiment, cilia-specific proteins can be quantified in the plasma as biomarkers of endothelial damage or dysfunction. The Examples detected ciliary fragments in effluents in cell culture from ECs and epithelial cells and were able to detect fewer cilia-expressing cells in vivo in ECs. Further, human sickle RBCs displayed enhanced ARL13b ciliary protein on their surface compared with normal RBCs, and once they encountered brain ECs under intermittent flow conditions, the presence of the ciliary protein on these sickle cells was 2.3-fold higher. These results concur with the detection of ciliary proteins at higher levels in SCD plasma compared with healthy plasma. Interestingly, we observed all 3 representative components of the ciliary structure — namely axoneme, transition zone, and basal body — in the plasma of patients with SCD. For SCD, the identification of enhanced cilia protein on RBCs and / or platelets may prognosticate adverse events such as vascular wall weakening, and susceptibility for hemorrhage, both clinically relevant features observed in patients with SCD. Having this information is beneficial for making informed clinical decisions. Methods: In one embodiment, the disclosure provides a method of detecting endothelial damage or dysfunction or vascular injury in a subject in need thereof. The method comprises detecting one or more markers of cilium in a biological sample from the subject. As shown in the examples, a higher 650053.01187 level of certain cilium markers detected in the biological sample compared to control may indicate endothelial damage or dysfunction or vascular injury in the subject. Alternatively, a lower level of certain cilium markers detected in the biological sample compared to control may indicate endothelial damage or dysfunction or vascular injury in the subject.The method can then further comprise administering a therapeutic that can treat the endothelial damage or dysfunction or vascular injury, or monitoring the vasculature of the subject (e.g., MRI, etc.). Endothelial damage or dysfunction is characterized by a loss of barrier function and an infiltration of cellular material into the vascular wall and loss of physiological vascular tone. There is a loss of nitric oxide mediated physiological vasodilation, increased endothelial adhesion and migration of leucocytes and macrophages into the subendothelial vascular wall. Hypoxia, shear forces and oxidative stress trigger events for endothelial dysfunction. Among other things, it leads to a situation in which vasoactive substances, like acetylcholine or serotonin, which normally produce vasorelaxation, cause vasoconstriction. Disorders associated with endothelial dysfunction include; traumatic brain injury (TBI), hypertension, atherosclerosis, diabetes, immune system dysfunction, infections, inflammations, cardiovascular disease, stroke, SCD (e.g., sickle cell anemia), artery-vein malformations, varicose veins, altered tumor vasculature, Thrombotic Thrombocytopenic Purpura (TTP), hemorrhages and preeclampsia. Vascular injury is any disruption to blood vessel function including those that cause loss of blood, blood clot, bruising, swelling, soreness, pain or swelling. As used herein, a “subject” may be interchangeable with a “patient” or “individual” and means an animal, which may be a human or non-human animal, in need of treatment. In particular embodiments, the subject is a human subject. A subject in need may be any subject wherein endothelial injury or disfunction may have occurred, including but not limited to subject suspected of having, or diagnosed with TBI, hypertension, atherosclerosis, diabetes, immune system dysfunction, infections, inflammations, cardiovascular disease, stroke, sickle cell disease, sickle cell anemia, artery-vein malformations, varicose veins, altered tumor vasculature, hemorrhages and preeclampsia. In one example, the subject has sickle cell disease. The term “biological sample” as used herein includes, but is not limited to, a sample containing tissues, cells, and / or biological fluids isolated from a subject. Examples of biological samples include, but are not limited to, tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, cerebrospinal fluid, seminal fluid, synovial fluid, breast milk, bile, amniotic fluid, aqueous humor, vaginal lubrication, sweat, lymph, bone marrow, mucus and tears. In some embodiments, the biological sample is a biopsy (such as a tumor biopsy). A biological sample may be obtained directly from a subject (e.g., by blood or tissue sampling) or from a third party (e.g., received from an intermediary, such as a healthcare provider or lab technician). In some embodiments, the 650053.01187 biological sample is selected from the group consisting of or comprising tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus and tears. In certain embodiments, the biological sample comprises a biopsy. In some embodiments, the biological sample is a blood or plasma sample. In some embodiments, the biomarker is preferentially detected in plasma over serum. As used herein, the term “marker” or “biomarker” refers to a biological molecule present in a subject at varying concentrations useful in predicting the risk or incidence of a disease or a condition. For example, the biomarker can be a protein present in higher or lower amounts in a subject at risk for endothelial damage or vascular injury. The biomarker can include nucleic acids, ribonucleic acids, or a polypeptide used as an indicator or marker for endothelial damage or vascular injury in the subject. Disclosed herein are biomarkers indicative of free cilium, termed interchangeably “cilium or cilia markers,” “markers of cilia or cilium,” or “markers of free cilia or cilium,” and like terms, e.g., “cilia or cilium biomarkers.” Such markers include proteins that are present on / in cilia, or the associated cilia-forming cells, such as endothelial cells, e.g., those cells that comprise (or comprised) the cilia. Cilia markers that are proteins found in or on cilia may be specifically termed “ciliary markers” or “ciliary proteins”. Cilia markers also include proteins that are aberrantly expressed in a subject diagnosed with or suspected of having SCD. Cilia markers can also include cilia basal bodies and proteins present on / in the basal bodies (“basal body cilium marker”). Cilia markers can also include proteins associated with cilia or cilia-forming cells such as epithelial cells (e.g., present on or in the cilia or cilia-producing cell, such as epithelial cells), wherein the protein comprises a post-translational modification as compared to the same protein in a control subject, or comprises a different post-translational modification as compared to the same protein in a control subject (post-translational modification (PTM) of a protein associate with cilium). By way of example, but not by way of limitation, as described herein, the cilia markers are indicative of endothelial damage or vascular injury, and may be used to diagnose or confirm a diagnosis of diseases or conditions associated with such damage. By way of example but not by way of limitation, detection of the cilia markers according to the present disclosure can be used to detect, diagnose, or confirm a diagnosis of SCD and / or Traumatic Brain Injury (TBI). In some embodiments, the cilia markers comprise one or more of TfR1, GAPDH, C1s, ADP- ribosylation factor-like protein 13B (ARL13b), Intraflagellar transport protein 88 homolog (IFT88), acetylated-α tubulin, Nuclear factor-erythroid factor 2-related factor 2 (NRF2), and the basal body markers comprising γ-tubulin and Inversin. In some embodiments, the methods comprise detecting two or more cilium markers, alternatively three or more cilium markers. In some embodiments, the marker comprises one or more of TfR1, GAPDH, C1s. In some embodiments, the markers consist of one or more of TfR1, GAPDH, C1s. Many of the cilia biomarkers disclosed herein have not previously been associated with cilium or with diseases such as SCD or TBI, and are accordingly 650053.01187 novel as cilia markers. By way of example, in some embodiments, the marker comprises ARL13b and according to the methods disclosed herein, can be diagnostic of TBI. In some aspects, the one or more markers of cilium comprise a post translational modification (PTM) of a protein associated with cilium of SCD (e.g., a modified version of the protein) as compared to the protein from a control sample. PTMs may include any type of peptide modification including but not limited to phosphoryl, s-nitrosyl, glycosyl, acetyl, methyl, carbamyl, or sumoyl modifications, as well as oxidation, ubiquitination, or proteolytic cleavage. For example, the marker of cilium may include acetylated α tubulin. In some aspects, the one or more markers of cilium comprise a ciliary marker and / or a basal body cilium marker, and / or a post-translationally modified protein. In some embodiments, the detecting step detects at least one ciliary marker and at least one basal body marker. The one or more markers may be selected from the group comprising TfR1, GAPDH, C1s, ARL13b, γ-tubulin, IFT88, Inversin, nuclear factor-erythroid factor 2-related factor 2 (NRF2), and acetylated-α-tubulin, or any combination thereof. The one or more markers may be selected from the group consisting of TfR1, GAPDH, C1s, ARL13b, γ-tubulin, IFT88, Inversin, nuclear factor-erythroid factor 2-related factor 2 (NRF2), and acetylated-α-tubulin, or any combination thereof. In one example, the one or more ciliary markers is selected from ADP-ribosylation factor-like protein 13B (ARL13b), Intraflagellar transport protein 88 homolog (IFT88), acetylated-α tubulin, and Nuclear factor- erythroid factor 2-related factor 2 (NRF2), and the one or more basal body marker selected from γ- tubulin or Inversin. In some embodiments, the one or more ciliary markers comprise TfR1, GAPDH, C1s. In some embodiments, the one or more ciliary markers consist of TfR1, GAPDH, C1s, or a combination thereof. In some embodiments, the one or more comprises one or more markers listed in Tables 1-5 The term "control" for measuring the level of the one or more markers may refer to a sample from a non-diseased patient, a positive control, or a negative control with a known amount of the marker, or may refer to a first sample taken from the same patient from an earlier timepoint that can be used to monitor the change in levels of the marker over time. The term “marker of normal cilium” refers to markers, or levels of markers, commonly seen in control (e.g., a non-diseased patient. One skilled in the relevant art will understand and employ the proper control to measure the level of the markers and any changes thereof. For example, in some embodiments, the disclosed methods comprise detecting and / or quantifying the one or more markers of cilium in a second biological sample from the same subject, wherein the biological sample is taken at a later time than the first sample. In some aspects, an increase (or decrease, as in the case of C1s, for example) in the level of cilium protein in the second sample as compared to the first sample may indicate endothelial damage or dysfunction or vascular 650053.01187 injury in the subject. In some embodiments, the second sample is obtained from the same subject at an earlier timepoint. Therefore, it is contemplated that the cilium markers described herein can be monitored and detected over time, to give an assessment of the risk of or the development of endothelial damage or dysfunction or vascular injury in the subject. In some embodiments, the detecting and / or quantifying one or more cilium markers comprises contacting the sample with one or more antibodies to a marker of cilium, and detecting the presence of and / or quantifying the antibody in the sample. Suitable antibodies to markers of cilium can be found in the art, or made by using a laboratory animal to make suitable monoclonal antibodies. Such methods are well known in the art. Exemplary suitable antibodies can be found commercially. Primary antibodies used herein include ARL13b (Proteintech catalog 17711-I-AP), acetylated tubulin (Sigma catalog T6793), IFT88 (Thermo Fisher Scientific catalog PA5-18467), Inversin (Proteintech catalog 10585-I-AP), Dynein (Thermo Fisher Scientific catalog MA1-070), gTubulin (GeneTex catalog GTX113286), Alk1 (Abcam catalog ab51870), KLF4 (Proteintech catalog 11880-I-AP), HO-1 (BD, catalog 566391), NRF2 (BioLegend, catalog 939202), and bactin (Sigma catalog A5441 and Cell Signaling Technology catalog 4970P). Secondary antibodies used are goat anti-mouse PECy7 (BioLegend), donkey anti-rabbit PE (Thermo Fisher Scientific), donkey anti-goat AF657 (Thermo Fisher Scientific), donkey anti-rabbit BV421 (BioLegend), and donkey anti-rabbit AF488 (Thermo Fisher Scientific). However, this disclosure is not limited by these antibodies, and any suitable antibodies that are specific and sensitive and capable of strongly binding to cilium markers can be used in the practice of the disclosure described herein. Additional exemplary antibodies are provided in the Examples. Suitably, the primary antibody that is capable of binding the marker of cilium may be directly conjugated to a detectable marker. In other instances, a secondary reagent or secondary antibody capable of binding the first antibody can be used, where the secondary antibody is conjugated to the detectable marker. In some embodiments, a control protein is also used as a measure for quantification of the marker, e.g., the control protein is tested at multiple amounts and a curve is produced correlating the brightness of a signal to the amount of protein to correlate the amount of the cilium marker in the sample. These techniques are well known in the art. Suitable detectable markers are known in the art and include, for example, fluorescent proteins (green fluorescent proteins (GFP), red fluorescent protein (RFP, dsRed, etc.), yellow fluorescent protein (YFP) EBFP, ECFP, mHoneydew, mBanana, mOrange, tdTomato, mTangerine, mStrawbery, mCherry, mGrape, mRaspberry, mPlum, etc. and include all known in the art, for example, those described in Fluorescent Proteins and Their Applications in Imaging Living Cells and Tissues Dmitriy M. Chudakov, Mikhail V. Matz, Sergey Lukyanov, and Konstantin A. 650053.01187 Lukyanov, Physiological Reviews 201090:3, 1103-1163, incorporated by reference in its entirety), reporter enzymes, ligand / substrate binding (biotin / streptavidin), and others known in the art. When using a reporter enzyme, detection is accomplished by measuring the activity of the reporter enzyme via incubation with the appropriate substrate to produce a measurable product. Suitable enzyme labels are horseradish peroxidase (HRP) and alkaline phosphatase (AP). Other suitable enzymes include, but are not limited to, β-galactosidase, acetylcholinesterase, and catalase. The choice of substrate depends upon the required assay sensitivity and the instrumentation available for signal-detection (spectrophotometer, fluorometer, or luminometer). In some embodiments, the method of detecting and / or quantifying is detecting and / or quantifying using an enzyme-linked immunoassay (ELISA). ELISA techniques are readily known in the art. The ELISA may be a direct ELISA, an indirect ELISA, or a sandwich ELISA, among others. In some aspects, the direct or indirect immobilization of markers on a surface can be used. In other embodiments, the primary or secondary antibody bay be immobilized on a suitable surface. In another embodiment, the detecting is detecting using flow cytometry (e.g., using beads in which the marker is conjugated), for example, by binding of the cilium marker to an antibody conjugated to the bead, or other suitable methods known in the art. The methods described herein may have an additional washing step. The washing step may be added to remove any addition of irrelevant protein or other molecules that do not specifically bind to the antibody or reporter marker. The detection may include measuring the signal generated via the direct or secondary reporter marker in the assay. In some embodiments, the method further comprises administering a therapeutic to treat the endothelial damage or vascular injury. As used herein, the terms “treating” or “to treat” each mean to alleviate symptoms, eliminate the causation of resultant symptoms either on a temporary or permanent basis and / or to prevent or slow the appearance or to reverse the progression or severity of resultant symptoms of the named disease or disorder. The endothelial damage or dysfunction or vascular injury that is being detected may be associated with a disease or disorder. By way of example, but not by way of limitation, diseases and disorders include SCD (e.g., sickle cell anemia), atherosclerosis, stroke, artery-vein malformations, varicose veins, altered tumor vasculature, hemorrhages, preeclampsia, TBI, and hypertension. In some embodiments, the endothelial damage may be associated with preeclampsia, polycystic kidney disease, hypertension, TBI, SCD, or stroke. In some embodiments, the endothelial damage may be associated with pain related to a disease or disorder disclosed herein. Sickle cell disease is a group of blood disorders, with the most common being sickle cell anemia. Sickle cell disease causes vaso-occlusion events which can lead to pain (e.g., acute pain 650053.01187 crisis), ischemia and organ damage. Current exemplary treatments include medications to reduce pain and blood transfusions, among others. In some embodiments, a marker disclosed herein can be used to predict the possibility of a vaso-occlusion event occurrence in a subject having SCD. Atherosclerosis or atherosclerotic vascular disease is a disease in the wall of the artery that leads to lesions and narrowing of the artery. Damage to the endothelium upsets the balance between vasoconstriction and vasodilation and initiates a number of events / processes that promote or exacerbate atherosclerosis; these include increased endothelial permeability, platelet aggregation, leukocyte adhesion, and generation of cytokines. Current exemplary treatment for atherosclerosis may be dietary changes, therapeutics (e.g., statins and other cholesterol medications, including, for example, a cholesterol absorption inhibitor called ezetimibe (Zetia)), blood thinners (e.g., Warfarin, aspirin, coumadin, etc.), blood pressure medications, surgical procedures (angioplasty and stent placement, endarterectomy, fibrinolytic therapy. Stroke is a medical condition in which poor blood flow to the brain causes cell death. Endothelial dysfunction occurs after stroke and leads to oxidative stress, inflammation, increased vascular tone, blood-brain barrier (BBB) damage, and further thrombovascular complications in the brain. Exemplary treatments are include blood thinners. Stroke is associated with blood components leaking into the brain and can be prognosticated in advance by the cilia biomarker test, allowing for preventative measures (e.g., blood thinner treatment) before adverse effects. Arteriovenous malformations (AVMs) happen when a group of blood vessels in the body forms incorrectly. In these malformations, arteries and veins are unusually tangled and form direct connections, bypassing normal tissues. Monitoring cilia markers will allow for detection of changes in the flow in the lesion, which is now diagnosed by imaging or after the flow is leaked out. Therapy treatment such as inclusion of coils and such and their effect on the malformation could also be determined by cilia biomarker detection kit. Varicose veins, also known as varicoses, are a medical condition in which superficial veins become enlarged and twisted. Dysfunctional endothelium has a pivotal role perpetuating the inflammatory cascade, with consequent pathological venous changes and chronic venous disease worsening. Endothelial dysfunction may be the central player in the link between varicose veins and deep vein thrombosis. Current treatments are surgery, laser treatment and blood thinning medications. The effects of these treatments can be evaluated and monitored by the methods described herein for detecting the ciliary biomarker profile from blood. Hemorrhage is blood escaping from the circulatory system from damaged blood vessels and compromised and permeable endothelium. This will result in close monitoring and additional preventive clinical measures to stop the impending crisis. 650053.01187 Preeclampsia is a disorder of pregnancy characterized by the onset of high blood pressure. The increased blood pressure in mother leads to preterm birth of the child. Thus, detecting increased blood pressure changes early with cilia biomarker will alter the course of treatment. Endothelial dysfunction results in hypertension and many of the other symptoms and complications associated with preeclampsia. Preeclampsia can be treated by early delivery of the baby, hypertensive drugs, among others. Hypertension, also known as high blood pressure (HBP), is a medical condition in which the blood pressure in the arteries is persistently elevated. Exemplary treatments are known in the art, and include, for example, blood pressure medicines capable of lowering blood pressure. Hypertension will lead to more cilia protein in blood, and thus can be indicative of the problem and lead to changes in medication regimen. Polycystic kidney disease is often present in patients who are prone to ballooning of blood vessels in the brain and are monitored for vessel break and bleeding. Typically, blood thinners and anti-hypertensive drugs are used. With a cilia test in hand, blood vessels prone to rupture are likely to increase cilia protein and deposition in the blood, which will allow physicians to alter the course of treatment. Traumatic brain injury (TBI) is usually caused by a violent blow or sudden jolt to the head. In addition to neuronal damage or dysfunction, TBI is also known to injure the cerebral blood vessels leading to hemorrhage, edema, and changes in cerebral blood flow (CBF). Depending on the severity of the injury and associated vascular sequelae, TBI can result in three phases of altered CBF. Initially, hypoperfusion or decreased blood flow occurs, and this is followed by hyperemic or increased blood flow, before transitioning to another period of decreased blood flow often caused by vasospasm.TBI can be monitored using the cilia biomarker methods described herein. In some embodiments, a method disclosed herein can determine whether a patient needs an MRI test, a CT scan or other imaging modality. This has profound implications for return to work and save MRI costs or prioritize which patients needs immediate attention in ER. In some embodiments, a cilia biomarker test described herein can be used to minimize “brain radiation” exposure to children and teens. The cilia biomarker test could also be used to determine if the treatment is working for TBI, and how effective the treatment is. Another use for biomarkers is prognosticating outcomes post TBI and providing advance information to physician in conjunction with scanning data for referrals to clinic (such as sleep disorder or pain mitigation). The methods described herein can also be used to detect organ injury in general. For example, detecting, diagnosing, evaluating, and monitoring organ injury due to drug intake, and monitoring the effects of medication on organ health, e.g., in clinical trials, is contemplated herein. And, while endothelial cells are exemplified throughout the application as proof of concept, it is 650053.01187 well known in the art that other cell types produce cilia and that the methods and compositions disclosed herein would be equally effective for other cilia-producing cells. The methods described herein can be used to detect abnormal tumor vasculature. Vessels in tumors are tortuous and have abnormal flow. Thus, normalizing flow will help drugs penetrate the tumor. However, whether flow is normalized or not is currently determined by imaging. A cilia biomarker test will help assess the efficacy of flow in the tumor bed post treatment. Also, cilia are longer on tumor cells resistant to therapy. Currently, there is no reliable detection platform for resistant cells. Cilia analysis on these cells using the biomarker kit may inform the resistant populations, which can then be targeted for killing. In some embodiments, the disclosure provides a method of detecting an occlusive event associated with sickle cell disease (SCD) in a subject having SCD. The method comprises detecting one or more markers of cilium in a biological sample from the subject. The disclosure also provides methods of monitoring the levels of cilium markers within biological samples taken from a subject over time. For example, the method may further comprise detecting the one or more markers of cilium in a second biological sample from the same subject, wherein the biological sample is taken at a later time than the first sample, and wherein an increase in the level of cilium protein (or decrease, as with C1s) in the second sample as compared to the first sample indicates an occlusive event. Therefore, it is contemplated that the cilium markers described herein can be monitored and detected over time, to give an assessment of the risk or the development of occlusive event. In some embodiments, the disclosure provides a method of detecting endothelial damage associated with TBI in a subject having or suspected of having TBI. The endothelial damage may be to brain endothelial cells. The endothelial damage may be to brain endothelial cells in the ipsilateral cortex. The endothelial damage may be to brain endothelial cells in the contralateral cortex. The method comprises detecting one or more markers of cilium in a biological sample from the subject. The one or more marker of cilium may comprise ARL13b. In some embodiments, the marker consists of ARL13b. In some embodiments, the marker comprises or consists of one or more makers selected from the group consisting of TfR1, GAPDH, C1s, ARL13b, γ-tubulin, IFT88, Inversin, nuclear factor-erythroid factor 2-related factor 2 (NRF2), and acetylated-α-tubulin, or any combination thereof. The disclosure also provides methods of monitoring the levels of cilium markers within biological samples taken from a subject over time. For example, the method may further comprise detecting the one or more markers of cilium in a second biological sample from the same subject, wherein the biological sample is taken at a later time than the first sample, and wherein an increase in the level of cilium protein in the second sample as compared to the first sample indicates endothelial damage. Therefore, it is contemplated that the cilium markers 650053.01187 described herein can be monitored and detected over time, to give an assessment of the risk or the development of endothelial damage associated with TBI. In some embodiments, the method further comprises administering a therapeutic to the subject to treat the TBI and / or the entothelial damage associated with the TBI. A skilled artisan will be aware of many therapeutics that may be administered to TBI patient post-TBI including, without limitation, substances that decrease intracranial pressure (ICP) such as mannitol infusion; substances that reduce inflammation; and substances that reduce hemogenic endothelial cell accumulation. In some embodiments, the therapeutic is administered within 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 14 days, 21 days, or 28 days post-TBI. In one embodiment, the therapeutic is administered within 7 days post-TBI. The detecting one or more markers can comprise contacting the sample with one or more antibodies to a marker of cilium, and detecting the presence of the antibody in the sample. In some aspects, the method further comprises contacting the sample with a secondary antibody with a detectable marker, and detecting the detectable marker in the sample. In some examples, the first or secondary antibody are attached to a solid support. In some aspects, the method includes ELISA or flow cytometry, among others. In some embodiments, the method further comprises, administering a therapeutic to treat the occlusive event in the subject having SCD. In some embodiments, the occlusive event is treated in a subject with a disease or condition that is not SCD. The term "occlusive event" comprises vascular wall weakening or increased susceptibility to hemorrhage, among other characteristics. Exemplary treatments include, but are not limited to, for example, medications to reduce pain (NSAIDS, aspirin, narcotics, etc.) and blood transfusions, among others. Further, scans may be recommended (e.g., MRI, etc.). For example, if cilia levels are high, a scan may be recommended because the aneurysm (dilated blood vessel) may be showing signs of breakage, which would not be good for the patient health. Currently, patients are routinely scanned for such dilated vessels in the hope that over time the condition does not get worse. These scans are done on routine scheduled visits to the clinic. Thus, saving unnecessary scans by ordering the disclosed cilia diagnostic tests will be beneficial. Also, scanning for when need arises instead of routinely scanning patients would reduce the number of scans a subject is exposed and provide a non-invasive means for monitoring a subject. Additionally, changing the course of treatment based on the impending crisis is benefit clinically as well by identifying increased cilia. In some embodiments, the disclosure provides a method of detecting cilia or markers on red blood cells and / or platelets in a sample from a subject, the method comprising obtaining a blood sample from a subject; isolating the red blood cells (RBCs) and / or platelets from the sample, and detecting one or more markers of cilium on the surface of the red blood cells and / or platelets. The 650053.01187 detection of cilium or cilium markers on the RBCs and / or platelets is indicative of damaged blood vessels and / or endothelial cells. In some embodiments, the method comprises obtaining a second blood sample from a subject; isolating a second set of red blood cells and / or platelets from the sample, detecting one or more markers of cilium on the surface of the RBCs and / or platelets, and comparing the level of cilium on the RBCs and / or platelets from the first sample to the second sample, where the second sample is taken at a later time than the first sample, and wherein the increase in cilium associate with the RBCs and / or platelets indicates damage to one or more blood vessels and / or endothelial cells within the subject. The first and second sample may be taken weeks, months or years apart for monitoring. In some embodiments, the method may comprise taking a third, fourth, fifth, sixth, etc. sample and comparing to the earlier samples to monitor changes in cilia concentration in the samples and alter to any changes within the subject. For example, a sample may be taken monthly to monitor a condition described herein. In some examples, the samples may be taken weekly (e.g., preeclamsia) to monitor the pregnant subject. In some embodiments, the disclosure provides a method of sample processing, the method comprising analyzing cells of a blood sample obtained from a subject, and quantifying the one or more markers of cilium. In an aspect, the analyzing comprises selectively identifying red blood cells and / or platelets and detecting one or more markers of cilium associated with the red blood cells and / or platelets. The red blood cells and / or platelets may be selectively identified using flow cytometry and / or detected by contacting the blood sample with at least one labeled antibody that binds to the one or more makers of cilium, and measuring the quantity of the antibody. In some embodiments, the quantity of the one or more markers of cilium associated with the red blood cells and / or platelets is compared to a control quantity from one or more control subjects who do not have a condition. The condition may comprise, without limitation, TBI, SCD, atherosclerosis, stroke, artery-vein malformations, varicose veins, altered tumor vasculature, hemorrhages, preeclampsia, or hypertension. In some embodiments, a quantity of the one or more markers of cilium in the subject that is higher than the control quantity indicates a presence, or risk of developing, the condition. In further embodiments, a quantity of the one or more markers of cilium in the subject that is lower than the control quantity indicates a presence, or risk of developing, the condition. The method may further comprise analyzing the cells and quantifying the one or more markers of cilium in a second sample obtained from the subject. In some embodiments, the disclosure provides a method of sample processing, the method comprising producing a fraction of a blood sample, comprising introducing to the blood sample an antibody that is immobilized to a solid support under conditions sufficient to bind the antibody to one or more markers of cilium and selectively removing components of the sample that are not bound to the antibody; and quantifying the one or more markers of cilium in the fraction, wherein 650053.01187 the one or more markers of cilium is associated with a red blood / cell and or platelet in the sample. A skilled artisan will be aware of methods for selectively removing the unbound components from the sample, including, without limitation, washing the sample. In some embodiments, the sample is processed prior to producing the fraction. The processing may comprise lysing the blood sample. In some embodiments, a quantity of the one or more markers of cilium indicates the presence or absence of a condition. In some embodiments, the method further comprises performing the method of sample processing on a second blood sample. The second blood sample may be obtained from the subject at an earlier or later timepoint than the blood sample, or from a second subject who does not have the condition. In some embodiments, the method further comprises providing a relative risk of the subject developing endothelial damage and / or vascular injury based at least in part on the quantity of the one or more markers of cilium. Kits: Disclosed herein are kits for carrying out the methods described herein, including kits for measuring the cilium marker in a biological sample. In some embodiments, the kit comprises at least one antibody that binds to at least one cilium marker, and instructions for use. In some embodiments, the kit further comprises a chip (e.g., a chip comprising at least one antibody that binds to at least one cilium marker described herein). In some embodiments, the chip comprises an antibody that binds to a cilium marker, the cilium marker comprising one or more of, consisting of one or more of, or selected from the group consisting of TfR1, GAPDH, C1s, ARL13b, γ-tubulin, IFT88, Inversin, nuclear factor-erythroid factor 2-related factor 2 (NRF2), and acetylated-α-tubulin. In some embodiments, the chip comprises an antibody that binds to Arl13b. In some embodiments, the kit further comprises at least one secondary antibody with a detection label. The kits contemplated herein can contain one or more antibodies that bind to a cilium marker, the cilium marker comprising one or more of, consisting of one or more of, or selected from the group consisting of TfR1, GAPDH, C1s, ARL13b, γ-tubulin, IFT88, Inversin, nuclear factor-erythroid factor 2-related factor 2 (NRF2), and acetylated-α-tubulin. In some embodiments, the kits include at least one antibody for detection of one or more markers comprising TfR1, GAPDH, C1s, or combinations thereof. In some embodiments, the one or more markers consist of TfR1, GAPDH, C1s, or a combination thereof. In some embodiments, the kits include at least one antibody for detection of one or more markers comprising ALR13b. In some embodiments, an ELISA kit to detect cilium is provided. In some embodiments, the ELISA kit comprises a solid support, at least one primary antibody that binds specifically to cilium, at least one secondary antibody specific to the primary antibody and having a detectable marker, and instructions for use. The detectable marker can be an enzyme reporter. The detectable marker can be a fluorescent marker or a colorimetric marker. In some embodiments, the ELISA kit can 650053.01187 screen for the detection of basal body of cilium based on proteins expressed on cells of origin of cilium using the methods described herein. The kit would comprise one or more antibodies specific to the basal body of cilium, described herein. In another aspect, a combination ELISA kit to screen both cilium and basal body of cilium markers can be provided. The kit can include at least one ciliary marker and at least one basal body marker antibody, and methods of detecting both markers separately (e.g., different reporter molecules for each marker). In some embodiments, the kit may be an immunofluorescent detection kit to detect cilium and basal body for basic research or clinical samples, the kit comprising one or more antibodies that bind to cilium markers. The primary antibodies may be directly conjugated to a fluorescent molecule, or a fluorescently conjugated secondary antibody may be used. Suitable antibodies are known and described herein. The kits and methods described herein provide a benefit over prior methods of detection. Because ECs experience altered flow or shear stress in various pathophysiologic conditions, such as preeclampsia, polycystic kidney disease, hypertension, TBI, and stroke to name a few, circulating ECs have been considered as possible biomarkers of vascular insult or endothelial dysfunction. However, due to their low numbers in circulation, and difficulty in detection, their application has been limited. On the other hand, as shown here, cilia from damaged ECs can be detected readily in circulation and biological samples. This method is a better alternative to detecting circulating ECs given that blood components are the only point of contact for EC cilia expressed on the luminal side. Also, given that cilia are expressed in most EC beds and that flow influences cilia integrity, any condition where flow is compromised constitutes an opportunity for the application of cilia biomarkers, broadening the value of cilia biomarkers for vascular injury. At minimum, the ability to detect ciliary proteins in blood or other body fluids and in various conditions influenced by flow provides an additional tool in the clinical toolbox to inform the physician of a possible pathology. In summary, our work warrants extended investigation to understand whether and how cilia-specific proteins in circulation can be developed into prognosticative markers of disease where the flow- related homeostasis of the endothelium is compromised. The present disclosure is not limited to the specific details of construction, arrangement of components, or method steps set forth herein. The compositions and methods disclosed herein are capable of being made, practiced, used, carried out and / or formed in various ways that will be apparent to one of skill in the art in light of the disclosure that follows. The phraseology and terminology used herein is for the purpose of description only and should not be regarded as limiting to the scope of the claims. Ordinal indicators, such as first, second, and third, as used in the description and the claims to refer to various structures or method steps, are not meant to be construed to indicate any specific structures or steps, or any particular order or configuration to such structures or steps. All methods described herein can be performed in any suitable order unless 650053.01187 otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to facilitate the disclosure and does not imply any limitation on the scope of the disclosure unless otherwise claimed. No language in the specification, and no structures shown in the drawings, should be construed as indicating that any non-claimed element is essential to the practice of the disclosed subject matter. The use herein of the terms “including,” “comprising,” or “having,” and variations thereof, is meant to encompass the elements listed thereafter and equivalents thereof, as well as additional elements. Embodiments recited as “including,” “comprising,” or “having” certain elements are also contemplated as “consisting essentially of” and “consisting of” those certain elements. As used in this specification and the claims, the singular forms “a,” “an,” and “the” include plural forms unless the context clearly dictates otherwise. For example, the term “a therapeutic” or “an antibody” should be interpreted to mean “one or more therapeutics” and “one or more antibodies,” respectively, unless the context clearly dictates otherwise. As used herein, the term “plurality” means “two or more.” Furthermore, in those instances where a convention analogous to “at least one of A, B and C, etc.” is used, in general such a construction is intended in the sense of one having ordinary skill in the art would understand the convention (e.g., “a system having at least one of A, B and C” would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and / or A, B, and C together.). It will be further understood by those within the art that virtually any disjunctive word and / or phrase presenting two or more alternative terms, whether in the description or figures, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms. For example, the phrase “A or B” will be understood to include the possibilities of “A” or "B" or “A and B.” All language such as “up to,” “at least,” “greater than,” “less than,” and the like, include the number recited and refer to ranges which can subsequently be broken down into ranges and subranges. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if a concentration range is stated as 1% to 50%, it is intended that values such as 2% to 40%, 10% to 30%, or 1% to 3%, etc., are expressly enumerated in this specification. These are only examples of what is specifically intended, and all possible combinations of numerical values between and including the lowest value and the highest value enumerated are to be considered to be expressly stated in this disclosure. Use of the word “about” to describe a particular recited amount or range of amounts is meant to indicate that values very near to the recited amount 650053.01187 are included in that amount, such as values that could or naturally would be accounted for due to manufacturing tolerances, instrument and human error in forming measurements, and the like. All percentages referring to amounts are by weight unless indicated otherwise. No admission is made that any reference, including any non-patent or patent document cited in this specification, constitutes prior art. In particular, it will be understood that, unless otherwise stated, reference to any document herein does not constitute an admission that any of these documents forms part of the common general knowledge in the art in the United States or in any other country. Any discussion of the references states what their authors assert, and the applicant reserves the right to challenge the accuracy and pertinence of any of the documents cited herein. All references cited herein are fully incorporated by reference, unless explicitly indicated otherwise. The present disclosure shall control in the event there are any disparities between any definitions and / or description found in the cited references. The following examples are meant only to be illustrative and are not meant as limitations on the scope of the invention or of the appended claims. EXAMPLES Example 1: Cilia proteins are biomarkers of altered flow in the vasculature Cilia are microtubule-based organelles that are present in most eukaryotic cells (1) and are distinguished based on the arrangement of 9 outer microtubule doublets enclosing a central doublet (9+2) or not (9+0).9+0 cilia are often referred to as primary nonmotile cilia and 9+2 cilia as motile cilia (2). However, these definitions need revisiting given the recent evidence suggesting that mixed cilia (motile and nonmotile) can be found in eukaryotic cells (3). Cilia function as mechanosensors for cells. In endothelial cells (ECs) that line the vasculature, the 9+0 cilia are often found on the apical (luminal) surface and are thought to sense blood flow and transduce these mechanical signals into chemical signals inside the cells that control shear-responsive behavior (4, 5). Primary endothelial cilia’s role as mechanosensors has been reported in mouse aortic ECs in vitro, isolated mouse arteries, blood vessels from human placenta ex vivo, and in vivo mouse models (6–10). Shear stress from physiologic blood flow elicits cilia bending (11). Shear stress, the tangential force of blood flow on the surface of the endothelium, normally varies throughout the macro- and microvasculature and can drastically vary in different physiologic and pathologic conditions. Ciliary length is often correlated with mechanosensory action in blood vessels, with cells experiencing low shear stress having longer cilia and cells in blood vessels with high shear stress having shorter cilia or no cilia (12, 13). In both zebrafish and mammals, primary cilia are considered enriched in regions of low shear stress (11, 14). At low shear stress, in the mammalian retinal vasculature, primary cilia are suggested to act in concert with bone morphogenetic protein 9 to 650053.01187 minimize vessel regression before onset of high shear stress–mediated vascular remodeling (15). Thus, collectively, EC cilia are widely considered as low shear stress sensors. In our own work, we have corroborated some of these initial findings and identified EC cilia in regions of low shear stress, such as bifurcation junctions in the juvenile zebrafish vasculature (16). Thus, the question arises as to what happens to EC cilia under increased shear stress conditions. Seminal work from Iomini et al. shows disassembly of primary cilia from human umbilical vein ECs (HUVECs) experiencing laminar shear stress of 15 dyne / cm2for 1 hour (13). Cilia include an axoneme that projects into the lumen and are anchored to the cell through transition fibers that connect to the basal body, a centriole-derived structure (1). Recent work suggests that cilia can be physically removed from mammalian cells, a process called deciliation, which releases the ciliary membrane and axoneme from the basal body (17). Intact shed cilia were recovered in culture media and contained both membrane and axoneme fragments. Further, this deciliation process was reported to be rapid and was suggested as the predominant mode of cilia loss in mammalian cells. In a separate study, whole cilia or partial ciliary fragments were observed in urine from mice subjected to chemically induced acute kidney injury (18) presumably from kidney epithelial cells, thus attributing this phenomenon to multiple cell types and tissues. The consequence of high shear stress–induced deciliation in embryonic ECs is directly associated with vascular instability and hemorrhage in embryonic zebrafish (16, 19–21) and vascular barrier integrity (22, 23). In mice (24, 25), ciliary mutants show extensive hemorrhages. These studies collectively suggest the hypothesis that cilia in ECs are disassembled (deciliation) upon disruption of vascular homeostasis, thus causing release of the ciliary fragments into circulation. Detection or quantification of ciliary proteins in circulation may serve as a biomarker for pathologic conditions of altered flow or changes in blood viscosity. In this study, we tested this hypothesis using a combination of cellular, vertebrate, and human model systems. Results Increased shear stress in ECs facilitates deciliation in vitro. To test the effect of shear stress on EC cilia in vitro, we chose cells from a microvascular brain vessel bed, human primary brain microvascular ECs (HBMVECs), and a macrovessel venous bed, HUVECs. We applied laminar flow shear stress of 0, 2, 4, and 10 dyne / cm2on HBMVECs, which was reported previously (26), and used 2 different methods for subjecting the cells to shear stress. In a microfluidic device–based unidirectional shear stress method (Ibidi system), we used graded strengths of shear stress starting at 2 dyne / cm2and increased to 4 and 10 dyne / cm2for 10 minutes and 24 hours (FIG. 1). With a shaker method, which is based on circulatory motion-associated shear stress, we applied 4 and 10 dyne / cm2for 4 minutes (FIG. 8). After shear stress, cells were collected for FACS analysis of specific markers: KLF4, KLF2, ALK1 (flow), ARL13b (cilia axoneme), γ-tubulin (cilia basal 650053.01187 body), IFT88 (cilia transition zone protein), Inversin (cilia basal body), NRF2 (cilia-related gene), and bACTIN (housekeeping gene) (Figure 9A). With both methods, we observed the control flow marker expression increase in brain ECs. With the Ibidi method, KLF4 (FIG.7A) and KLF2 (Figure 7B) expression were significantly increased in 10 dyne / cm2condition compared with the “no flow” control at 24 hours. With the shaker method, a linear increase in ALK1-expressing cells at 4 and 10 dyne / cm2(P < 0.0001) (FIG.8A) was observed. With both methods, interestingly, all ciliary markers tested showed reduction in protein levels at 10 dyne / cm2and 4 dyne / cm2(FIGS. 1 and 8C–8F), with no change in housekeeping bACTIN protein expression (FIG. 8B). With Ibidi method, at a shorter period of 10 minutes, compared with 24 hours, lower protein expression levels were generally observed (FIG. 1), which was distinct at 2 dyne / cm2, a physiologically steady-state situation. At 10 minutes as well as 24 hours, the 4 and 10 dyne / cm2groups showed significantly reduced cilia-associated protein expression compared with the steady-state control group. Compared with steady-state controls, experimental groups (4 and 10 dyne / cm2) had about 20% less expression of any cilia-associated proteins after 10-minute perfusion (FIG.1). The reduction of protein expression in the groups was even pronounced (>50%) at 24 hours postperfusion (Figure 1). For HUVECs plated on a monolayer, we used the shaker method to apply high shear stress at 20 dyne / cm2as reported previously in the literature (27, 28). Effluents were collected, drop concentrated, and analyzed by differential interference contrast (DIC) microscopy. Staining was performed on the effluents for ciliary marker acetylated-α-tubulin and basal body (γ-tubulin). As shown (FIGS 2A–2D), the effluents showed positivity for both acetylated-α-tubulin (FIG.2B) and γ-tubulin (FIG.2C) proteins. We also applied 10 dyne / cm2shear stress to a porcine kidney epithelial cell line, LLC-PK1, using the shaker method and stained for ciliary marker acetylated-α-tubulin (FIGS.2E-F), which clearly showed loss of cilia marker staining after shear stress. A single cilium observed by phase contrast microscopy (FIG. 2G, white box) was missing after shear stress (FIG. 2H). Further, effluents (FIG. 2I) collected from these experiments were positive for acetylated-α- tubulin (FIG.2J), and Western blots for acetylated-α-tubulin clearly showed expression in isolated cilia with no actin protein detected in the same isolate (FIG 2K). Thus, collectively, these data argue that shear stress of greater than 2 dyne / cm2can influence cilia removal, loss of cilia proteins on cell surface, and presence of cilia proteins and fragments in effluents in macro- and microvessel beds as well as kidney epithelial cells. Increased shear stress in vivo results in ECs with lower amounts of cilia protein expression. To test the effect of shear stress on EC cilia in vivo, we took advantage of the versatility of the vertebrate zebrafish model system (FIG. 9B). Previously, others (29, 30) have reported that increasing the incubation temperature of zebrafish embryos from 28°C to 34.5°C increases their 650053.01187 heartbeat and blood flow rate. Upon increasing temperature, we calculated that the shear stress increased from 2.3 to 3.1 dyne / cm2in the primordial midbrain venous channel (PMBC) (16) and from 2.0 to 2.97 dyne / cm2in the dorsal aorta (DA). However, these measurements were made at 33 hours postfertilization (hpf), after 5 hours of incubation from 28 to 33 hpf at the higher temperature. We performed a systematic analysis of the effect of temperature (32°C and 35°C) with shorter (3.5 and 5 hours) and longer (24 hours) incubation periods starting at 28 hpf (blood flow commenced in brain), then measured blood flow–associated parameters in the PMBCs and DAs at 48 hpf (FIGS. 10–13). Three groups of embryos (n = 20–50 per group) (FIG. 10) were analyzed in both PMBC (FIGS.11 and13A) and DA (FIGS.12 and 13B) vessels for blood flow (pulse, blood flow velocity, vessel diameter, shear stress) parameters. The samples included group 1 (G1): 0–48 hpf (28°C); group 2 (G2): 0–28 hpf (28°C) followed by 3.5 or 5 hours of incubation at 32°C or 35°C and returning to 28°C until 48 hpf; and group 3 (G3): 0–28 hpf (28°C) followed by incubation at 32°C or 35°C until 48 hpf (Figure 10). We made the following overall observations: (a) the 35°C over 32°C temperature showed more robust changes in blood flow parameters (pulse, velocity, vessel diameter, and shear stress) but also induced scoliosis (curvature of spine) in embryos (FIG.14); (b) irrespective of the vessel caliber or location, for the most part, G3 embryos showed higher blood flow parameters; (c) shear stress values were generally higher for PMBC (3–5 dyne / cm2[32°C] or 4–7 dyne / cm2[35°C]) versus DA vessels (2.5–3 dyne / cm2[32°C] or 3.5–5.2 dyne / cm2[35°C]); and (d) exposure for 3.5 hours at 32°C also showed robust changes in the assessed parameters of the PMBC except for blood flow velocity (FIG.13A), with no significant changes observed in the DA (FIG. 13B). It is noteworthy that increasing shear stress by this method only showed hemorrhages in brain vessels and not the trunk, which is thought to be associated with loss of cilia in ECs (16). Thus, we chose the shorter time point of about 3 hours’ incubation (29.5–32.5 hpf) and lower temperature (32°C) for increasing shear stress in PMBCs of transgenic (Tg) (flk: mCherry; bactin: Arl13b-GFP) zebrafish embryos, where ECs were labeled red, and cilia were labeled green. Single- cell suspension and subsequent FACS analysis on live and labeled ECs (FIG.9B) were performed as described in the Methods section. Markers assessed included Klf4 (flow), Arl13b (cilia axoneme), γ-tubulin (cilia basal body), Inversin (cilia basal body), and Ift88 (cilia transition zone). In the shear stress induction group (experimental), we observed the expected increase in Klf4- expressing MFI in ECs (Figure 3, A and B). All cilia markers assessed showed a decrease in experimental samples compared with control samples (FIG. 3C) when assessed in the mCherry+(EC) population. In the mCherry–(non-EC) population (FIG. 3D), the reduction of the respective cilia-associated protein expressions was less pronounced compared with what was observed in the EC population. These results suggest that upon increased shear stress in brain vessels in vertebrate embryos, ECs express fewer ciliary proteins on their cell surface. 650053.01187 Circulating RBCs adhere to brain ECs and accumulate cilia proteins postadhesion. To investigate ciliary proteins in circulation in a pathophysiologic model with translational and clinical significance, we selected sickle cell disease (SCD). SCD is caused by a single mutation in the β- globin gene that changes the sixth amino acid in the β-globin protein of hemoglobin from glutamic acid to valine (31), which makes RBCs highly susceptible to sickling due to the production of sickle hemoglobin (Hb S) and thus impairs Hb capacity to deliver oxygen to tissues. In the cerebral and systemic vasculature, occlusive events in SCD have been postulated to be initiated by sickle RBCs’ adhesion to the endothelium (32). Thus, we hypothesized that sickle RBCs adhere to brain ECs, triggering cilia shedding, and that ciliary proteins would be high in plasma from patients with SCD. We first investigated whether RBCs isolated from patients homozygous for Hb S (SS) would adhere preferentially to a monolayer of brain ECs, compared with healthy volunteers with normal Hb A (AA). A graduated height flow chamber adhesion assay to quantify the adhesion of RBCs to ECs was performed as described previously (33, 34). Indeed, 58% ± 9% of SS RBCs compared with 7% ± 1.8% of AA RBCs adhered to brain ECs subjected to shear stress of 1 dyne / cm2(Figure 4A). Next, we performed flow cytometric analysis on circulating RBCs isolated from SS patients for the presence of cilia protein ARL13b, prior to and following exposure to brain ECs in the flow chamber. Compared with AA RBCs, which showed 1% ± 0.47% of bound ARL13b, SS RBCs showed a remarkable 23-fold increase to 23% ± 2.5% of bound ARL13b prior to exposing brain ECs to the AA and SS RBCs, respectively (FIG. 4B). Upon flow exposure, ARL13b presence on AA RBCs was not affected, but it did increase further by 2.3-fold on SS RBCs to 54% ± 8.8% (FIG. 4C), suggesting that SS RBCs may have collected additional cilia from brain ECs. We performed a blood smear to directly visualize accumulation of ARL13b on SS RBCs (FIG.4D). A similar blood smear was performed from blood isolated from sickle SS mice and immunostained for ARL13b and IFT88 proteins (FIG. 15). ARL13b- and IFT88-positive cilia-expressing mouse RBCs were found in smears from SS mice (FIGS. 15A and 15B). Quantification (FIG.15) showed a 2-fold enrichment of ARL13b-positive RBCs in SS versus AA mouse blood. Finally, we investigated plasma from 10 patients with SCD and 10 healthy individuals using Western blot for the presence of ciliary proteins ARL13b, γ-tubulin, and IFT88 (FIGS.4E and 4F). All 3 ciliary proteins were enriched in the plasma from patients with SCD compared with healthy volunteers (FIG. 4F). Taken together, these data sets suggest that in a pathologic condition predisposed to vascular occlusion and / or compromised blood flow, ciliary proteins are present on the surface of RBCs, further accumulate on RBCs upon EC contact, and are enriched in plasma. Thus, collectively, our work suggests cilia proteins as potential biomarkers for diagnosis of flow-mediated alterations of the vascular endothelium. EC cilia stability is dependent on ROS generation in brain ECs. To investigate the underlying mechanism associated with loss of cilia in brain ECs due to shear stress or RBC 650053.01187 interaction, we focused on excessive reactive oxygen species (ROS) and oxidative stress. Previous work has suggested that interactions of sickle RBCs with HUVECs induce endothelial oxidative stress (35). Thus, we investigated whether adhesion of SS RBCs from patients with SCD patients to brain ECs triggers ROS generation in ECs. Indeed, SS RBC interactions with brain ECs increased EC ROS levels compared with basal levels of EC ROS (P < 0.05; FIG.5A). Pretreatment of brain ECs with the NADPH oxidase (NOX) inhibitor, apocynin, reduced ROS generation in ECs to baseline levels (P < 0.0001; FIG.5A), suggesting that SS RBC–induced increased ROS production in brain ECs is dependent on activation of NOX enzymes. To investigate the effect of increased ROS levels in ECs on SS RBCs-cilia, in subsequent experiments, we analyzed by flow cytometry SS RBCs for the presence of the ciliary protein ARL13b prior to and following exposure in the flow chamber to brain ECs pretreated with apocynin. Before exposure to apocynin-treated brain ECs, SS RBCs showed approximately 35% ARL13b cilia expression, but after exposure to apocynin-treated brain ECs, SS RBCs showed a decrease of approximately 20% in ARL13b expression (P < 0.05, FIG.5B). We interpret these data to mean that inhibition of NOX enzymes in brain ECs with apocynin prevented SS RBCs from collecting additional ARL13b protein from brain ECs. To assess if attenuating oxidative stress in brain ECs will rescue cilia protein levels, we treated human brain ECs with PMA, a known oxidative stress inducer, in ECs in the presence or absence of the NOX small-molecule inhibitor VAS2870. We then quantified the expression of total ROS, heme oxygenase 1 (HO-1, oxidative stress counteractor), and cilia-associated proteins NRF2, IFT88, and γ-tubulin (FIG.6) levels using flow cytometry method. As expected, PMA induced ROS in brain ECs (FIG.6A), which was partially attenuated by VAS2870. HO-1 levels (FIG.6B) were lower in PMA-treated brain ECs, and upon NOX inhibition, levels were restored to control levels. Interestingly, all 3 cilia-associated proteins (FIGS.6C–6E) were reduced upon PMA treatment, and levels were restored to baseline upon NOX inhibition in brain ECs. Taking the sickle RBC ROS data and brain EC–based ROS data together, oxidative stress appears to be one of the key pathways in ECs that is responsible for cilia stability. Discussion Our present study reveals that cilia-specific proteins can be quantified in the plasma and should be explored as biomarkers of endothelial damage or dysfunction. In the ECs lining the vascular wall, cilia have been postulated as a low-flow sensor (11). In support of this hypothesis, cilia are indeed enriched in regions of vessel wall where flow is minimal, such as curvature in the vessel (14, 16). Under steady state, the vasculature experiences a constant flow. In the venous system, an average shear force of 1–4 dyne / cm2is reported while capillaries experience shear from 10–20 dyne / cm2(26). In arteries, shear force varies from 4 dyne / cm2in the common carotid artery to 13 dyne / cm2in the brachial artery (36). We previously demonstrated in zebrafish embryos, that 650053.01187 upon incubation of embryos at 34.5°C, 2–4 dyne / cm2shear stress is induced in brain microvessels that results in brain hemorrhage and loss of ciliary structures in primordial midbrain venous channels (16). Others have also reported that loss of ciliary proteins in zebrafish causes brain vessel instability resulting in hemorrhages (19). Further, primary cilia are disassembled when HUVECs (macrovessels) are subjected to 15 dyne / cm2of laminar shear stress (13). Thus, collectively, 4–20 dyne / cm2shear force as observed in vivo is sufficient to make ECs lose ciliary proteins in vitro and was indeed observed in this study. Here, we were able to detect ciliary fragments in effluents in cell culture from ECs and epithelial cells and were able to detect fewer cilia-expressing cells in vivo in ECs subjected to high shear stress. The question of how cilia on the EC surface may be influenced by altered flow to facilitate detachment remained an open question. In addition to increased or disturbed physical flow, we hypothesized that blood constituents, in particular, RBCs, may also contribute to the deciliation process in ECs (17) in pathologic conditions (FIG.7). We chose SCD, where the RBC morphology is altered to have a sickled shape and RBCs are known to cause oxidative stress–mediated damage to EC membranes (35, 37, 38). Further, in SCD, blood flow is altered because of enhanced adhesion of sickle RBCs to themselves and the endothelium, promoting vascular occlusion (39), which can subsequently facilitate damage to the endothelium (35). Thus, this pathophysiologic model offers the ideal opportunity to identify cilia proteins emerging from the damaged endothelium that may be the result of sickle RBC adhesion to the endothelium. Remarkably, we found that human sickle RBCs displayed enhanced ARL13b ciliary protein on their surface compared with normal RBCs, and once they encountered brain ECs under intermittent flow conditions, the presence of the ciliary protein on these sickle cells was 2.3-fold higher. These results concur with the detection of ciliary proteins at higher levels in SCD plasma compared with healthy plasma. Interestingly, we observed all 3 representative components of the ciliary structure — namely axoneme, transition zone, and basal body — in the plasma of patients with SCD, suggesting that cilia disassembly is not partial. These results also concur with the recent observations in mammalian cells, where cilia shed from cells expressing mCherry-αtubulin (axoneme marker) contained atubulin in the ciliary fragments, suggesting that axoneme is shed together with the ciliary membrane (17). To investigate the underlying mechanism associated with cilia stability in static and flow- induced sickle RBCs / brain ECs interaction, we focused on oxidative stress and ROS generation (Figure 7). Human sickle RBCs adhere to brain ECs similar to HUVECs (35) and induce increased ROS generation. Sickle RBCs exposed to brain ECs treated with apocynin, a NOX inhibitor, showed decreased cilia protein expression. These data argue that cilia on sickle RBCs are influenced upon interaction with ROS-quenched brain ECs (FIG. 7). Two interrelated possibilities emerge to explain this result: either ECs retain more cilia when oxidative stress is minimized and thereby 650053.01187 RBCs capture fewer cilia from ECs, or RBCs lose cilia when they interact with ROS-inhibited ECs and thus have fewer cilia. It is difficult to differentiate between the two. Under static conditions, brain ECs were responsive to stress inducers such as PMA, and showed enhanced total ROS, which upon treatment with a different NOX inhibitor, VAS2870, quenched ROS production following the PMA-induced oxidative stress. Interestingly, the cilia protein levels that were decreased in PMA- treated brain ECs returned to baseline in NOX inhibitor–treated brain ECs. The static condition result argues against the possibility that ECs’ cilia are not available for interaction upon ROS inhibition and supports the second hypothesis that RBCs lose cilia upon interaction with ROS- inhibited ECs. These results collectively argue that cilia stability in both ECs and RBCs is susceptible to increased ROS levels in brain ECs. This interpretation is also in line with previous studies in epithelial cells where they show that, after ischemic injury in murine kidneys, reduction of oxidative stress accelerates the recovery of primary cilia length (40). For SCD, the identification of enhanced cilia protein on RBCs may prognosticate adverse events such as vascular wall weakening, and susceptibility for hemorrhage, both clinically relevant features observed in patients with SCD. Having this information is beneficial for making informed clinical decisions. Because ECs experience altered flow or shear stress in various pathophysiologic conditions, such as preeclampsia, polycystic kidney disease, hypertension, and stroke to name a few, circulating ECs have been considered as possible biomarkers of vascular insult or endothelial dysfunction (41, 42). However, due to their low numbers in circulation, and difficulty in detection, their application has been limited. On the other hand, as shown here, cilia from damaged ECs can be detected readily in circulation. This method is perhaps a better alternative to detecting circulating ECs given that blood components are the only point of contact for EC cilia expressed on the luminal side. Also, given that cilia are expressed in most EC beds and that flow influences cilia integrity, any condition where flow is compromised constitutes an opportunity for the application of cilia biomarkers, broadening the value of cilia biomarkers for vascular injury. At minimum, the ability to detect ciliary proteins in blood or other body fluids and in various conditions influenced by flow provides an additional tool in the clinical toolbox to inform the physician of a possible pathology. In summary, our work warrants extended investigation to understand whether and how cilia-specific proteins in circulation can be developed into prognosticative markers of disease where the flow- related homeostasis of the endothelium is compromised. Methods Antibodies Primary antibodies used in this study include ARL13b (Proteintech catalog 17711-I-AP), acetylated tubulin (Sigma catalog T6793), IFT88 (Thermo Fisher Scientific catalog PA5-18467), Inversin (Proteintech catalog 10585-I-AP), Dynein (Thermo Fisher Scientific catalog MA1-070), 650053.01187 γTubulin (GeneTex catalog GTX113286), Alk1 (Abcam catalog ab51870), KLF4 (Proteintech catalog 11880-I-AP), HO-1 (BD, catalog 566391), NRF2 (BioLegend, catalog 939202), and bactin (Sigma catalog A5441 and Cell Signaling Technology catalog 4970P). Secondary antibodies used are goat anti-mouse PECy7 (BioLegend), donkey anti-rabbit PE (Thermo Fisher Scientific), donkey anti-goat AF657 (Thermo Fisher Scientific), donkey anti-rabbit BV421 (BioLegend), and donkey anti-rabbit AF488 (Thermo Fisher Scientific). Cell culture Primary HBMVECs (Cell Systems Corporation catalog ACBRI 376) and HUVECs (Glyco Tech) were maintained at 37°C in a 5% CO2 incubator in endothelial cell complete medium (Promocell, catalog C22010). As per vendor’s description, cells were isolated from the cortex region of the brain from a pediatric male donor. The cells were isolated without using antibody labeling to preserve the cells’ natural properties for enhanced biological relevance. LL-CPK1 (CL101.1TM) porcine renal epithelial cells from proximal tubule were obtained from ATCC. All cell culture wells were seeded equally, and wells were randomized to control versus experimental conditions with duplicates or triplicates per condition. All experiments were performed between passages 4 and 6. Cells that had reached approximately 90% confluence were used in the shear stress experiment. For ROS quantification experiments, cells were treated with PMA (Sigma, catalog P8139-5MG) at a concentration of 50 ng / mL for 1 hour. To inhibit ROS production in respective experimental groups, cells were treated with 20 μM NOX inhibitor VAS 2870 (Sigma, catalog SML0273-5MG) 1 hour prior to PMA treatment. Human patient studies Blood samples were collected from adult patients with SCD homozygous for Hb S and from healthy adult donors. Patients and donors were recruited under the study protocol approved at Duke University. All patients with SCD had not been transfused for at least 3 months and had not experienced an acute vaso-occlusive crisis for the past 3 weeks, and 98% of the patients tested were on hydroxyurea. Blood samples were collected into citrate tubes. All RBCs were washed in PBS with Ca2+and Mg2+with collection of the plasma and removal of buffy coat. Western blot Plasma isolated from blood collected from patients with SCD (SS) and healthy (AA) volunteers was used for quantification of the following proteins: ARL13b, IFT88, and γ-tubulin. These samples were run on SDS-PAGE, and traditional Western blot protocols were performed. Primary antibodies used were explained before. Secondary antibodies used include anti-rabbit HRP (catalog 7074, Cell Signaling Technology) and anti-mouse HRP (catalog 7076, Cell Signaling Technology). Quantification was done using ImageJ software (NIH) and plotted against the housekeeping control protein bACTIN. 650053.01187 In vitro EC shear stress experiments Ibidi perfusion. To generate shear stress in vitro, we utilized the Ibidi pump system. Prior to initiating perfusion, HBMVECs were seeded onto a μ-slide (0.6 mm channel height; Ibidi, 81106) at 0.5 × 106cells per slide. Slides, media, and a perfusion set (red, 10962) were incubated in a humidified cell culture incubation chamber (37°C in 5% CO2) overnight prior to perfusion to prevent bubble formation, per manufacturer recommendations. Immediately prior to perfusion, medium was added to the syringe reservoirs (12 mL total) and air bubbles were removed. The μ- slide was attached to the perfusion set under sterile conditions, and then the fluidic unit was connected to the Ibidi pump and air tubing inside the cell culture incubation chamber. Using the vendor-specific PumpControl software, HBMVECs were perfused at 0, 2, 4, or 10 dyne / cm2for 10 minutes or 24 hours. A total of 2 dyne / cm2was included as representative of steady state that mimics in vivo condition. To prevent acute cell detachment upon initiation of high shear stress at 10 dyne / cm2, cells were acclimatized to flow at 4 dyne / cm2for 5 minutes and then subjected to flow at 10 dyne / cm2for either 10 minutes or 24 hours. For experiments at 2 and 4 dyne / cm2, no acclimatization was necessary, and cells were subjected to flow for 10 minutes or 24 hours. Per manufacturer recommendations with the 0.6 mm μ-slides and red perfusion sets, the minimum shear stress possible was 2.3 dyne / cm2(rounded off to and referred to as 2 dyne / cm2). Immediately following perfusion, cells were trypsinized with TrypLE express (Thermo Fisher Scientific, 12604013) and used for downstream analysis. All the samples subjected to any magnitude of perfusion had their respective no flow controls. Any protein expression in a given sample was normalized against that of no flow control. Shaker method A shaking incubator (New Brunswick Scientific) was used as previously described to induce shear stress (43). The formula used applied to calculate the stress is: shear stress = (6 × F × m) / (w × h2), where F = moment of inertia (i.e., function of centrifugal force based on rpm and size of the shaker), m = viscosity of the fluid (i.e., function of temperature), w = diameter of plates (i.e., function of area of dish), and h = height of the fluid (i.e., function of volume). A 100 mm culture dish (confluent with cells) that was placed on an orbital shaker at 240 rotations per minute (RPM) resulted in a shear stress of 10 dyne / cm2and at 96 RPM resulted in a shear stress of 4 dyne / cm2. The cells were under shear stress for 4 minutes. For HUVEC and epithelial cell shear stress experiments, the deciliation was induced by mechanical force, as previously described (43, 44). Cell populations were first rinsed briefly and gently with 10 mL of PBS (pH 7.4). A 150 mm culture dish was placed in a flow chamber as previously discussed (6). A shear stress of 10 or 20 dyne / cm2was applied to the cell for 4 minutes. The media containing the excised cilia were carefully transferred to a 50 mL centrifuge tube and 650053.01187 centrifuged for 30 minutes at 3000g at 4°C. The supernatant containing the excised cilia was then transferred to a polyallomer tube and centrifuged for 1 hour at 70,000g at 4°C in an ultracentrifuge. The purified primary cilia were then resuspended in the PBS buffer or RIPA buffer for further analyses. Quantitative reverse-transcription PCR Total RNA was extracted using TRI Reagent and Direct-zol RNA Miniprep (Zymo Research, R2051). RNA was reverse-transcribed into cDNA using 250 ng total RNA (iScript gDNA clear cDNA synthesis kit; BioRad, 172-5034). RNA levels were quantified using custom-designed primers (Primer3) for KLF2, KLF4, and GAPDH. cDNA and primers were mixed with iTaq Universal SYBR Green Supermix (BioRad, 172-5121) and run with the following cycling protocol: 95°C for 2:00 minutes, followed by 40 cycles of 95°C for 0:10 minutes and 60°C for 0:30 minutes (BioRad, CFX96 Real-Time System). Quantification of gene expression was performed using the 2-ΔΔCT method (45). Samples were all run in quadruplicate, and target genes were normalized to GAPDH. Primers were KLF2 (133 bp)—forward: CACCAAGAGTTCGCATCTGA (SEQ ID NO: 1), reverse: CGTGTGCTTTCGGTAGTGG (SEQ ID NO: 2); KLF4 (132 bp)—forward: CGGCTGTGGATGGAAATTCG (SEQ ID NO:3), reverse: ATGTGTAAGGCGAGGTGGTC (SEQ ID NO: 4); and GAPDH (128 bp)—forward: CCAAGGAGTAAGACCCCTGG (SEQ ID NO: 5), reverse: (SEQ ID NO: 6). In vitro adhesion assays HBMVECs were cultured until they reached confluence on clear glass slides precoated with 2% gelatin. Slides coated with brain ECs were washed, then fit into a variable height flow chamber and tested for their ability to support adhesion of RBCs. The flow chamber was mounted on the stage of an inverted phase contrast microscope (Diaphot, Nikon Inc.) connected to a thermoplate (Tokai Hit Co., Ltd.) set at 37°C. Fluorescence-labeled RBCs suspended at 0.2% (v / v) in PBS with Ca2+and Mg2+were infused into the flow chamber and allowed to adhere to brain ECs for 10 minutes without flow. Before exposure to flow, a minimum of 3 fields at each of 7 different locations along a line oriented to future flow were examined, and the total number of fluorescent cells was counted. Fluid flow (PBS with Ca2+and Mg2+) with a calibrated syringe pump was then started for a period of 15 minutes. Effluent was collected and tested by flow cytometry for cilia shedding from brain ECs by RBC contact. After exposure to flow, the fields were examined, and the number of fluorescent adherent RBCs to brain ECs was counted. The fraction of adherent cells was presented as number of cells attached per field after exposure to flow / total number of cells present per field before flow. 650053.01187 The wall shear stress was calculated as tw = 6Qm / wh2, where tw = wall shear stress (dyne / cm2); Q = volumetric flow rate (cm3 / s); m = media viscosity, w = width of the flow channel, and h = height of the flow chamber as a function of position along the microscope slide. Blood flow in small vessels may be continuous (nonpulsatile) with shear stresses of 1–2 dyne / cm2, or flow may be intermittent (pulsatile). Our data were obtained using pulsatile flow conditions. Shear stress zebrafish flow parameter measurements The transgenic line Tg(bact:Arl13b-GFP) was obtained from Brian Ciruna (University of Toronto, Toronto, Ontario, Canada). Tg(kdrl:mCherry-CAAX), Casper, and wild-type AB lines were obtained from Zebrafish Informational Resource Center. Embryos from the wild-type (AB) strain were used in this study. Freshly fertilized embryos were procured through natural breeding of adult zebrafish and were raised at 28.0°C in E3 medium containing 0.1 mM N-Phenylthiourea (PTU; Sigma) to inhibit pigment formation. For shear stress experiments, at 28 hpf, fish embryos were divided into 3 groups: G1: 0–48 hpf (28°C); G2: 0–28 hpf (28°C) followed by 3.5 or 5 hours of incubation at 32°C or 35°C and returning to 28°C until 48 hpf; and G3: 0–28 hpf (28°C) followed by incubation at 32°C or 35°C until 48 hpf (FIG. 10). Control and experimental embryos were subsequently dechorionated at 48 hpf for imaging. A stereomicroscope (Zeiss SteREO Discovery V12 Microscope equipped with Hamamatsu Orca Flash high-speed camera and a workstation equipped with HCImage software, Hamamatsu Photonics) was used to visualize the blood vessels of zebrafish embryos as previously described (46). High-speed video microscopy movies of the heart and tail in 1000 frames per 10 seconds at 100× magnification were recorded for the PMBCs and the DA. The recorded movies were analyzed according to our previous protocols (47, 48) using MicroZebraLab blood flow from Viewpoint (version 3.4.4), and 4 cardiac parameters were calculated for each vessel: pulse, blood flow velocity, vessel diameter, and shear stress using the following formula: τ = 4μVmean / D, where μ = blood viscosity (dyne / cm2), V = average blood velocity (μm / s), and D = vessel diameter (μm). This experiment was performed multiple times, and data from 3 independent experiments are reported. Whole-mount staining of Casper zebrafish using O-dianisidine Embryos from Casper strain were used to visualize hemorrhage in the brain after the induction of shear stress as described in the section above. At 48 hpf, embryos were dechorionated and stained with O-dianisidine (stains RBCs). The stain was prepared by mixing 0.6 mg / mL of O- dianisidine (Sigma), 0.65% hydrogen peroxide, 0.01 M sodium acetate (pH 4.5), and 40% (v / v) ethanol solution. Embryos were washed with PTU-E3 medium, which is N-Phenylthiourea dissolved in egg water made in-house, and then 0.6 mg / mL of the stain was added and left for 15 minutes in the dark. After staining, embryos were postfixed in 4% paraformaldehyde at 4°C for at 650053.01187 least 1 hour. Three percent (w / v) methyl cellulose was used to fix the embryos on the slide for imaging under a bright-field microscope (Stemi 508, Zeiss). Zeiss AxioCam ERc 5s professional digital camera was used for imaging. In vivo (zebrafish) shear stress experiments Embryos from a cross of Tg(bact:Arl13b-GFP) and Tg(kdrl:mCherry-CAAX) were used in this study (FIG. 9B). Freshly fertilized embryos were procured through natural breeding of adult zebrafish and were kept at 28.0°C in 1× E3 embryo medium (E3 medium) containing 5 mmol / L NaCl, 0.17 mmol / L KCl, 0.33 mmol / L CaCl2, 0.33 mmol / L MgSO4, and 0.05% methylene blue. For shear stress experiments, at 29.5 hpf, fish embryos were transferred to an incubator at 32.0°C for 3 hours. Control and experimental embryos were subsequently dechorionated and digested to yield single cells (FIG. 9B). The composition of digestion buffer used was RPMI 1640 medium (Thermo Fisher Scientific) supplemented with 10% FCS, collagenase D (1 mg / mL), and DNase I (10 μg / mL). Embryos were digested for 30 minutes at 37°C and subsequently passed through a 70 μm cell strainer. Cells were centrifuged at 300g for 5 minutes and washed twice with PBS before use for downstream applications. This experiment was performed multiple times, and data from 3 independent experiments are reported. Flow cytometry Single-cell suspensions were washed 3 times with FACS buffer (1× PBS with 5% FBS and 0.1% NaN3) at 300g for 5 minutes and were subsequently incubated with Live / Dead fixable yellow dead cell stain as per manufacturer’s protocol, to exclude any dead cells, wherever applicable. Then, cells were fixed and permeabilized using Cytofix / Cytoperm buffer (BD, catalog 554722) or transcription factor buffer set (BD, catalog 562574) and stained for the following proteins: ARL13b, IFT88, Inversin, Dynein, γ-tubulin, Alk1, KLF4, HO-1, NRF2, and bACTIN. Suitable secondary reagents were used to detect the respective proteins. Primary antibodies were diluted 1:50, and secondary antibodies were diluted 1:500. BD perm wash buffer (catalog 554723) was used for antibody dilutions and washing. Primary antibodies were incubated for 45 minutes and secondaries for 30 minutes at 4°C. Suitable secondary antibody controls were included. To quantify total ROS, assay kit was used as per the manufacturer’s instruction (Thermo Fisher Scientific, catalog 88-5930- 74). After the completion of staining, cells were resuspended in FACS buffer. Stained cells were run on a flow cytometer (BD LSRFortessa). Sample acquisition was done using FACSDiva software (BD) with subsequent analysis on FlowJo software. To determine the presence of the ciliary protein ARL13b on human RBCs, unlabeled RBCs prior to infusion into the variable height flow chamber, and effluent containing RBCs collected postflow and RBCs postinteraction with brain ECs, were labeled with FITC-conjugated Arl13b antibody for 30 minutes on ice. RBCs were then washed and tested by flow cytometric analysis as previously 650053.01187 described (49). To determine whether ROS generation in brain ECs can be increased by sickle RBCs and contributes to deciliation, slides coated with brain ECs were sham-treated or pretreated with the NOX inhibitor apocynin at 10 μM for 1 hour at 37°C, washed, and fitted into the flow chamber. Treated brain ECs were then exposed to unlabeled sickle RBCs for 10 minutes. Sickle RBCs were lysed with RBC lysis buffer and brain ECs scraped from the glass slide for testing for ROS levels using CM-H2-DCFDA (Invitrogen) as described previously in detail (50). One hundred thousand events per sample were acquired and tested by flow cytometric analysis. In separate experiments, and as described above, unlabeled sickle RBCs were tested by flow cytometry for ARL13b ciliary protein binding prior to infusion into the chamber (baseline levels) and postflow and once sickle RBCs interacted with brain ECs treated with 10 μM apocynin. Mouse sickle RBCs: cilia staining and quantification For the blood smear preparation, approximately 5 μL of whole blood from AA control mouse and SS sickle mouse was added to a glass slide and allowed to dry for 24 hours. The smear was fixed with acetone for 10 minutes. At the end of incubation, the slides were washed with PBS, and the primary antibody (ARL13b or IFT88) at the concentration of 1:500 was added to the slides and incubated at 4°C overnight. The slides were washed with PBS, and secondary antibody was added at a concentration of 1:500 and incubated for 1 hour at room temperature in the dark. At the end of incubation, the slides were washed with PBS, the mounting reagent was added, and the coverslip was placed on top of the blood smear and imaged at 63× on a confocal microscope (Zeiss LSM 510 laser module) with bright-field for RBCs and 488 green channel for ARL13b- or IFT88- positive cilia detection. All the cilia-positive RBCs were quantified with multipoint tool in ImageJ software and represented as graphs. Statistics Data were presented as mean and SEM. A 2-tailed t test or 1- or 2-way ANOVA was performed to compare groups on the outcomes. Pearson’s correlation and regression analysis were used to investigate the relationships between continuous variables. Cilia protein in vivo under different sheer stress was expressed as fold change relative to the mean of the control group. A linear mixed model (LMM) was then used to examine differences between experimental and control groups. The differences of cilia proteins (ARL13b, γ-tubulin, IFT88, and Inversin) within EC (mCherry+) or non-EC (mCherry–) were also analyzed by LMM. P < 0.05 was considered significant. Dunnett’s test, Tukey’s test, or Bonferroni correction was used to adjust for multiple comparisons. Data were log-transformed to improve fit for some analyses. Nonparametric tests were used where parametric assumptions were not satisfied. Statistical analysis was performed using SAS V9.4 (SAS Institute Inc.), R, and GraphPad Prism software (version 9.0). Example 2: Cilia Markers for Detection of Vascular Injury in Sickle Cell Disease 650053.01187 Cilia are mechanosensory organelles in the vasculature that sense blood flow and are involved in various pathophysiological conditions. In SCD, which is a genetically inherited disorder, the red blood cell (RBC) is sickled and tends to aggregate in the vasculature, causing obstruction of normal blood flow. Previously, we reported that altered shear stress and interaction between microvasculature endothelial cells and sickle RBC induces the level of reactive oxygen species (ROS). As a result, patients with SCD experience high deciliation events. Yet, the shear stress effect of sickled RBC on cilia and the vasculature ciliary protein profile in SCD is not known. Here, we examined the cilia stability under different shear stress on microvasculature endothelial cells in vitro. The induced shear stress of sickled RBC at 5.0 Dyn / cm2 resulted in significant deciliation events. Proteins that localize in cilia can be released into the extracellular environment when the cilia is damaged by mechanical injury or disease. Different disease states and tissue injury mechanisms will result in unique cellular environments that change the properties of proteins by addition of modifying groups such as phosphoryl, s-nitrosyl, glycosyl, acetyl, methyl, carbamyl, or sumoyl. Additional modifications can include oxidation, ubiquitination, or proteolytic cleavage resulting in formation of cilia protein fragmentation products. These post-translational modifications (PTM) of cilia proteins will alter the molecular size and / or charge of the proteins allowing for the detection of these changes by immunoassay techniques such as immunoprecipitation, immunoblot, proximity ligation assay or by mass spectrometry. The addition of one or more of these specific modifying groups via reversible or irreversible covalent reactions will 1) provide a unique disease state signature based on the type of modifying group that is added, 2) provide additional and more sensitive diagnostic information beyond what is provided by the measurable total protein concentration changes, 3) allow for determination of injury or disease progression by identification of oxidized, ubiquitinated, or fragmented cilia proteins, 4) allow for determination of injury recovery or disease remission as reversible modifications are removed, and 5) create patient specific injury index scores based on changes in the ratio of modified to non-modified measured proteins. We will also use two or more proteins as biomarkers to detect and evaluate diseases, including traumatic brain injury. The ratios or differences among these proteins are more reliable than other “single” biomarker that is currently used. Employing two or more biomarkers will increase the sensitivity to detect severity, duration, and outcome of the diseases. Our strategy will also eliminate potential false positive or negative in determining disease detection. The comparative proteomic analysis of ciliary proteins isolated from whole blood revealed a unique protein expression in control and SCD mouse models. A total of 175 ciliary proteins were expressed exclusively in the control group (see Table 1), whereas 45 ciliary proteins were expressed 650053.01187 exclusively in SCD (see Table 2). A total of 421 ciliary proteins were expressed in both the control and SCD groups (see Table 4)The bioinformatics analyses further showed the unique and differential expression of biological processes, molecular functions, cellular components, signaling pathways, and protein classes between control and SCD mouse models. The post-translational modifications (PTMs) analyses also indicated that there is unique processing of ciliary proteins in SCD. A total of 9 and 3 PTMs proteins were expressed exclusively in control and SCD, respectively (see Table 3). A total of 118 PTMs proteins were expressed in both control and SCD (see Table 5). Consistent with the animal studies, our translational studies have validated the unique expression of TfR1, C1s, GAPDH, and ARL13B proteins in patients with SCD. All in all, our work provides the first evidence that cilia are clinically relevant in SCD, and ciliary proteins can be utilized to evaluate and monitor patients with SCD. Primary cilia Cilia are microtubule-based and antenna-like organelles that protrude upward in most mammalian cell types. In the vasculature, cilia are positioned at the apical luminal side of endothelial cells and play a crucial role in sensing blood flow, mediating signal transduction, and regulating various biological. Because cilia house many ion channels, transmembrane receptors, and other transporters, ciliary proteins became the focus of numerous proteomic studies. Since the post-translational modifications (PTMs) analysis exhibits the chemical modifications of proteins to affect their shape, activity, distribution, interactions, and stability, a more revolutionary and targeted proteomic analysis of PTMs has emerged. In addition, the PTM analysis of ciliary proteins has revealed crucial cilia markers, including the acetylated α-tubulin protein. The misregulation of tubulin acetylation has been found to play a role in neurological disorders, cancer, heart diseases, and other pathological conditions. Sickle cell disease SCD is an inherited genetic disorder that has no current cure. There are many forms of SCD, depending on the nature of hemoglobinopathy. Sickle cell anemia is the most common and severe form of the disease, which is the carrier of two allele mutations in the hemoglobin β subunit (HbSS). In the case of Sickle Cell Trait (SCT) there is only one allele mutation in the hemoglobin β subunit (HbAS), and usually there is no sign of the disease. The two allele mutation in SCD leads to structural and functional changes in red blood cells (RBCs), including sickling, decreased deformability, and increased stiffness. Vasculature integrity in sickle cell disease One of the common hallmarks of SCD is the instability of blood vessel integrity. The frequent polymerization and depolymerization of hemoglobin have been shown to cause oxidative stress, microvessel injury, as well as large vessel injury. Through a series of adhesive events, the 650053.01187 RBC can blockade the vasculature and obstruct the normal flow of blood, leading to a Vaso- occlusive crisis. The implication of these events can result in hemolytic anemia, ischemia, pain crisis, and organ injury. Because cilia structure and function are constantly regulated under shear stress, resulting in cilia disassembling and complex intertwined signaling pathways, cilia stability is believed to be impacted during the Vaso-occlusive crisis. Previously, our work has shown that sickled RBC induces oxidative stress in vasculature endothelial cells, triggering significant deciliation events in patients with SCD. Yet, ciliary proteins during this event are not known. Thus, we hypothesized that ciliary proteins are differentially expressed in response to the Vaso-occlusive crisis in SCD. To examine this, we evaluated the ciliary protein profile in SCD mouse model and validated potential ciliary biomarkers in patients with SCD. Results To examine and compare the cilia protein profile after the deciliation process between sickle cell disease (SCD) and sickle cell trait (SCT), we used two mouse models, as previously described. The genetic makeup of the SCD mouse model exhibited two allele mutations described as hemoglobin beta S (hβS / hβS; SS). The replacement of one human hemoglobin beta A (hβS / hβA; AS) was used as a control for SCT (FIG.16A-16B). To validate the red blood cell (RBC) phenotype of these two mouse models, whole blood from AS and SS mice was smeared and examined for normal and sickled RBC (FIG. 16C). As expected, the SCT mouse model had normal RBC, whereas the SCD mouse model had a significant number of sickled RBC (FIG.16C). To understand the interaction between sickled RBC and cilia under shear stress of blood flow, we applied shear flow of whole blood from AS and SS mice on primary human brain microvascular endothelial cells (HBMVECs) monolayer in vitro. We used a wide range of shear stress starting from 0 Dyn / cm2(negative control for deciliation) to 10 Dyn / cm2(positive control of deciliation) to determine the optimal flow rate of interaction between sickled RBC and cilia. Our result indicated that the induced shear flow of sickled RBC at 5.0 Dyn / cm2resulted in a substantial interaction with cilia, causing significant deciliation events (FIGS. 17A-17B). Representative images and cilia lengths were analyzed and measured at all examined shear stress (FIGS.24A-24B, 25A-25B). Because the genetic makeup of wildtype mouse (AA) and SCT mouse is not the same, even though both have normal RBC phenotype, we needed to examine if RBC from AA mouse has a different interaction with cilia when compared to SCD mouse model. Consistently, our result showed that only sickled RBC had extensive interaction with cilia, as shown in (FIG. 17C). Furthermore, our quantification analyses showed a significant number of sickled RBC attached to cilia fragments (FIG.17D). When normal RBCs were compared to sickled RBC within SS samples, cilia fragments were significantly attached to only sickle-looking RBC (FIGS. 17E-17F). 650053.01187 For cilia proteomic analysis, we isolated cilia fractions from AS and SS mouse models. First, cilia were enriched from whole blood samples, isolated by conventional centrifugation method, and validated for purity before proteomic analysis (FIG. 26A), as previously described. Next, we used a comparative proteomic analysis using the tandem LC-MS-MS technique. A minimum of two peptides per protein and one tryptic end per peptide were required for further evaluation. While the analysis of cilia factions detected a total of 637 proteins, the clustering analysis showed the relative abundance between examined samples (FIG.18A). To further evaluate the relative abundance in cilia fraction, we examined the fold change of protein expression between AS and SS samples. Our result indicated that there are exclusively expressed proteins in AS and SS samples (FIG. 18B). Notably, there were 175 proteins exclusively expressed in AS (Table 1), 41 proteins exclusively expressed in SS (Table 2), and 421 proteins differently expressed in both AS and SS samples (FIG. 18C). Further, we compared and validated our identified cilia fractions with other cilia proteomic studies (FIG. 26B). To understand the complexity of the identified cilia faction, we used the Gene Ontology (GO) analysis to illustrate the makeup of the biological processes, cellular components, and molecular functions (FIG. 27). Markedly, the GO analysis showed the differential expression among the exclusively expressed proteins in AS and SS samples (FIGS.27A-27C). Interestingly, the bioinformatic analysis has further revealed the unique signaling pathways that were abolished or induced in SCD (FIGS. 19A-19C). Similarly, the protein class analysis revealed the uniqueness of protein classification that is associated with SCT and SCD (FIGS.18D, 28). Because many proteins are only active and functional after the post translations and modifications (PTMs) process, we evaluated the PTMs of cilia fraction status in AS and SS samples. Our analysis indicated that there 130 proteins were post-translationally modified. The majority (60%) had gone through the oxidation process, followed by acetylation (22%), carbamylating (12%), and phosphorylation (6%) (FIG.20A). Notably, there were 9 and 3 PTM proteins that were expressed exclusively in AS and SS, respectively (Table 3). In addition, there were 118 PTMs proteins that were expressed in both AS and SS (FIGS. 20B-20C). Interestingly, some of these identified PTM proteins have been known to be bona fide ciliary proteins, and the rest were denoted as novel ciliary proteins (FIG.20D). To examine the translational relevance of these findings, we correlated and validated our results in human subjects. We examined whole blood samples from healthy individuals (AA) and patients with SCD (SS). Next, we selected a total of 4 proteins to evaluate, including one exclusively expressed PTM protein the SCT mouse model (C1s), and the SCD mouse model (GAPDH). We also examined one protein we identified in our study and which was exclusively expressed in SCD 650053.01187 (TfR1), and one marker previously described as expressed in SCD patients (Arl13b). Consistently with proteomic analysis, our immunoblots analysis has validated the unique expression of all selected proteins in SCD patients (FIGS.20E-20F, 29A-29E). Discussion Unlike normal RBC, sickled RBC is known to have high internal viscosity, increased stiffness, and low deformability, which result in abnormal blood flow. These features do contribute to the aggregation of sickled RBC in blood vessels, resulting in blood flow blockage or ischemia, vessel damage, and pain crisis. Previously, our group has shown that cilia fractions are higher in patients with SCD and can be used as a surrogate biomarker of the damaged endothelium. In this study, we examined the proteome profile of cilia fractions isolated from the SCD mouse model. Our results show that sickled RBC predominantly interacts with the luminal cilia of blood vessels. The shear stress of 5.0 Dyn / cm2is optimal for this interaction to result in significant deciliation events. Even though all produced RBC in SCD mice exhibit the same mutation, only the sickle-looking or crescent RBC seems to adhere more to cilia fractions. This suggests that the level of cilia fractions in blood plasma is proportional to the number of sickled RBC at a given time. Hence, this piece of evidence can be clinically relevant to evaluate and predict the state of SCD. The comparative proteomic analysis between SCT and SCD cilia fraction clearly shows the up and down-regulation of many biological processes, cellular components, and molecular function proteins. In some cases, many proteins are only expressed in SCD, or expression is completely abolished in SCD. This further suggests the dynamic regulation of ciliary proteins during the deciliation process. Concurrently, many pathophysiological processes and signaling pathways could be at play at this point. In fact, our results indicate that cilia-associated neurological disease signaling pathways, such as Parkinson’s disease and Alzheimer’s disease-amyloid secretase pathways, are completely abolished in the SCD mouse model. On the other hand, inflammation signaling pathway components, including B cell activation, T cell activation, interleukin, and P53 signaling pathway, are significantly abundant and only expressed in the SCD mouse model. This result further supports the growing evidence that inflammation in SCD is highly induced via activating the ROS system, innate immune response, and both intrinsic and extrinsic coagulation pathways. Notably, the PDGF signaling pathway, which promotes angiogenesis and vessel stability, is significantly reduced by 56% in SCD. This, in return, coincides with the growing evidence that patients with SCD are genetically predisposed to hemorrhagic stroke. Since PTMs are required for many ciliary proteins’ functions, we evaluated the PTMs of cilia fraction in the SCD mouse model. The PTMs analysis result indicates that cilia fractions are either oxidized, acetylated, carbamylated, or phosphorylated. Ironically, all 3 PTMs protein fractions expressed exclusively in the SCD mouse model are oxidized. This includes the 650053.01187 evolutionarily conserved enzyme Gm3839 or GAPDH, which might be a necessary step to regulate the metabolic reprogramming of stored sickled RBC. Because of the abnormal regulation of iron in SCD, GAPDH could also be induced to recruit the apotransferrin to regulate the iron uptake in sickled RBC. Consistent with these findings, our proteomic analysis shows that TfR1, which is a transmembrane protein responsible for iron delivery into cells, and GAPDH proteins are uniquely and significantly expressed in the SCD mouse model. Remarkably, our translational studies have confirmed the unique expression of TfR1 and GAPDH proteins in patients with SCD. As for the unique expression of C1s protein in SCD patients, the PTMs carbamylation seems to be crucial for C1s structure and function. While the exact mechanism of this process is largely not clear, the downregulation of C1s could result in sequestering the innate and adaptive immune response. This might explain the increased rate of bacterial infection and mortality rate in SCD patients. In fact, the downregulation of C1 and C3 in SCD patients experiencing parasite infections has been shown to increase both the morbidity and mortality rates. All in all, our translation studies have confirmed the increased deciliation events and downregulation of C1s in patients with SCD when compared to healthy individuals. Thus, the downregulation or reduced appearance of C1s, or a specific PTM of C1s, in a biological sample from a subject as compared to a normal control may indicate endothelial damage or dysfunction or vascular injury in the subject. Biomarker products utilizing cilia proteins with post-translational modification will provide greater sensitivity and specificity to differentiate between health conditions. The protein post- translational modification that occurs is highly dependent on the environmental conditions present. The disease environment results in specific protein modifications that will provide a signature to increase the positive predictive value for diagnostics based on this product. These signatures will allow for differentiation between disease, injury, and non-pathologic stressors. Further, the protein modifications will only occur in the presence of the specific stress creating a sensitive biomarker that does not require prior knowledge of an individual’s normal baseline protein concentrations or comparison to normal healthy values forgoing the need to establish potentially subjective threshold values for different patient populations. In summary, our current study shows that cilia fractions are highly present in the blood plasma of SCD patients. The proteomic analyses provide the first evidence of differential expression of ciliary proteins during SCD. Translational studies in human subjects reveal clinically relevant and promising ciliary protein biomarkers that might be utilized to evaluate and predict the state of SCD. Cell culture The Primary Human Brain Microvascular Endothelial Cells (HBMVECs; Cell Systems #ACBRI 376) were cultured in complete classic medium with 10% serum, cultureboost, and 650053.01187 attachment factor (Cell System #4Z0-500). The HBMVECs were cultured at 37°C in a 5% CO2 incubator. Human studies The protocol for human participation in this study was approved by Duke University. Blood samples from healthy donors and patients with SCD were collected into citrate tubes and stored at -80°C. For at least three months prior, all patients with SCD had not received any blood transfusion, and 98% of them had been placed under hydroxyurea treatment. Shear-stress and Immunocytochemistry studies Cells were stained and processed using standard protocol, as previously described. Briefly, cells were grown on cover slip in 100-mm culture dish at 70-80% confluence. Culture media was replaced with whole blood collected from SCT and SCD mice. Cells culture dishes were then placed on orbital shaker (Cole-Parmer) using different speed for 4 minutes to provide 2.5, 5.0, 7.5, and 10.0 dyn / cm2shear stress. Cells grown on cover slip were than washed with 1XPBS, incubated in 3% glutaraldehyde for 10 minutes, incubated in 1% Triton- X for 5 minutes, incubated in ARL13B primary antibody (Proteintech; 1:100) for overnight at 4°C, incubated in secondary antibody FITC fluorescence (1:500) for 1 hour at room temperature, and cells were mounted with DAPI (vector laboratory). For ciliogenesis studies, images were taken with Nikon Ti-E to measure and analyze cilia length using Nikon Element software. Immunoblotting Blood plasma isolated from patients with SCD (SS) and healthy (AA) volunteers were analyzed by SDS-PAGE on a 10% SDS-polyacrylamide gel to quantify ARL13b, GAPDH, Transferrin 1 TfR1), Complement (C1). For equal loading, gels were stained with Coomassie blue dye (Bio-Rad, blue R-250). Proteins were transferred into Polyvinylidene difluoride (PVDF) membrane and blocked with 5% nonfat milk in 1X TBST solution. PVDF membranes were incubated with primary anti-ARL13b (Proteintech; 1:2000 dilution), GAPDH (Proteintech; 1:5000 dilution), Transferrin (ABCam1:1000), and Complement C1 (OriGene 1:2000) for overnight at 4°C with agitation. Next, membranes were incubated with secondary anti-mouse (1:1000 dilution) or anti-rabbit (1:1000 dilution) for 1 hour at room temperature with agitation. Membranes were then incubated with horseradish peroxidase (HRP) and visualized using Azure Biosystems (280). Animal studies All animals’ procedures were approved by California Northstate University, Chapman University, and Medical College of Wisconsin. SCD and SCT mouse models were obtained from The Jackson Laboratory(strain#013071). The genotyping of mouse models was verified following the Jackson Laboratory protocol instructions. Briefly, common primers 5’-TTG AGC AAT GTG GAC AGA GAA GG-3’, HbS primers 5’- AAT TCT GGC TTA TCG GAG GCA AG-3’, and HbA 650053.01187 primers 5’- GTT TAG CCA GGG ACC GTT TCA G-3’ were used to assess the genotyping of mice. Deciliation analyses in SCD mouse: Whole blood from AA, AS, and SS was smeared on glass slide, dried for overnight, fixed with acetone for 10 minutes, washed with 1XPBS, incubated with AR13B primary antibody (Proteintech; 1:500) for overnight, washed with 1XPBS, incubated with secondary antibody FITC fluorescence (1:500) for 1 hour at room temperature, washed with 1XPBS, and a coverslip was mounted for cilia and RBC analysis using either Nikon Ti-E or 63X confocal microscope. Cilia enrichments: Primary cilia were isolated from blood plasma for proteomic analysis, as previously described. Briefly, after obtaining whole blood from mice, plasma containing cilia fractions was centrifuged for 3,000xg at 4°Cfor 30 minutes, collected supernatant was spun for 70,000xg at 4°Cfor I hour (Beckman Optima L-60), pelleted cilia were re-suspended in radioimmunoprecipitation assay (RIPA) buffer for protein quantification followed by Western blot or proteomic analyses. Proteomic analyses Sample preparation: Enriched cilia from three independent samples of AS and SS mice (total of 6 samples) were precipitated with methanol and chloroform mixture. Next, the pellets were reduced with 5 mM TCEP, alkylated in dark for 20 minutes with iodoacetamide, digested at 37°C overnight with 1 ug of trypsin, followed by 90% formic acid neutralization. Liquid chromatography with tandem mass spectrometry (LC-MS-MS): Samples were then loaded onto EvoTips and run on an Evosep One coupled to a timsTOF Pro mass spectrometer (Bruker Daltonics). Peptides were separated with a gradient of Buffer A (0.1% formic acid in H2O) and Buffer B (0.1% formic acid in acetonitrile) on a 15 cm × 150 μm ID column with BEH 1.7 μm C18 beads (Waters) and integrated tip pulled in-house. MS scans were acquired in PASEF mode, with one MS1 TIMS-MS survey scan and ten PASEF MS / MS scans per 1.1s acquisition cycle. Both ion accumulation time and ramp time in the dual TIMS analyzer were set to 100ms and ion mobility range was 1 / K0 = 0.6 to 1.6 Vs cm–2. The m / z range was 100-1700. Precursor ions selected for MS / MS analysis were isolated with a 2 Th window for m / z < 700 and 3 Th window for m / z > 700. Collisional energy was lowered linearly from 59 eV at 1 / K0 = 1.6 Vs cm–2 to 20 eV at 1 / K0 = 0.6 Vs cm–2as a function of increasing mobility. Precursors for MS / MS were picked at an intensity threshold of 2500, target value of 20 000, and an active exclusion of 24 s. Singly charged precursor ions were excluded with a polygon filter. Protein profiling: 650053.01187 Proteins were analyzed with the Integrated Proteomics Applications (San Diego, CA.), tandem mass spectra were extracted from raw files using RawExtract (Version 1.9.9) and were searched against Uniprot mus musculus database with reversed sequences using ProLuCID. Peptide candidates were filtered using DTASelect program (version 2.0). A minimum of two peptides per protein and one tryptic end per peptide were required for further evaluation. Post-translation Modifications (PTMs): A static modification of carbamidomethylation on cysteine (57.02146) and differential modifications of oxidation of methionine (15.9949 M), phosphorylation of serine, threonine or tyrosine (79.9663 STY), acetylation of lysine (42.010565 K), and carbamylation of lysine (43.005814 K) were considered. Data were searched with 50 ppm precursor ion tolerance and 600 ppm fragment ion tolerance. Data were filtered using DTASelect2 to a protein false positive rate of < 1%. A minimum of two peptides per protein and one tryptic end per peptide were required. Statistical models for peptide mass modification (modstat) and tryptic status (trypstat) were applied. Bioinformatic analyses The proteomic data was analyzed with Ontologizer application (version 2.0), as described before. For targeted analyses, panther classification system was used (version 14.0) to analyze protein classes, signaling pathways, as well as biological processes, cellular component, and molecular function. The clustering analysis, volcano plot, Venn diagram were analyzed using R project for statistical computing software (version 3.5.3). Statistical analyses Dataset distributions were normalized via log transformation when the dataset was not normally distributed or heterogeneous variance was detected. All quantifiable data are reported as the mean±standard error of the mean and power analysis was determined from the coefficient variant. ANOVA (analysis of variance) was used for statistical analyses followed by a Tukey post hoc test. The statistical analyses were performed using GraphPad Prism software (version 9.5.1). The number of experimental replicates, sample sizes, and probability levels P values are indicated in each graph and figure legends. Table 1: Protein fractions expressed only in control (AS) samples. T- AS Spec. ct. SS Spec. ct. Accession # test p- Description =2 5 5 650053.01187 AS Spec. ct. SS Spec cession # T-t . ct. Ac est p- value Description S1 S2 S3 S1 S2 S3 us s s =3 =1 lus a1 s 1 1 s 1 us 1 Q ip us IC us 1 us 650053.01187 AS Spec. ct. SS Spec cession # T-t . ct. Ac est p- value Description S1 S2 S3 S1 S2 S3 =1 s =2 lus 1 =1 us 1 us 1 0 A3 a3 4 4 90 sb a2 1 al 2 650053.01187 AS Spec. ct. SS Spe ccession # T- c. ct. A test p- value Description S1 S2 S3 S1 S2 S3 s =2 lus lus =1 90 =4 us s h s 0 us =1 65 1a s 1 0 650053.01187 AS Spec. ct. SS Spec. ssion # T-te ct. Acce st p- value Description S1 S2 S3 S1 S2 S3 lus 90 4 4 ein ER er lus ial =1 us us a7 =2 3 a1 s 1 s s =3 650053.01187 T-test p AS Spec. ct. SS Spec. ct. Accession # - value Description S1 S2 S3 S1 S2 S3 er fkl us =3 fh =3 =2 2 it us 1 =4 =2 650053.01187 T-test p- AS Spec. ct. SS Spec. ct. Accession # value Description S1 S2 S3 S1 S2 S3 6a us =3 s =2 4 lus =1 lus lus lus us 0 lus 650053.01187 AS Spec. ct. SS Spec cession # T-t . ct. Ac est p- value Description S1 S2 S3 S1 S2 S3 g lus b 90 ing a a =3 us ein 0 er us 0 D0 pd s =2 0 650053.01187 AS Spec. ct. SS Spec cession # T-t . ct. Ac est p- value Description S1 S2 S3 S1 S2 S3 =1 =1 ily 0 lus us 1 0 s c8 55 2a 0 ain s =1 s ein d1 650053.01187 n # T-te AS Spec. ct. SS Spec. ct. Accessio st p- value Description S1 S2 S3 S1 S2 S3 s us us 1 us =2 sa =3 s =1 s 650053.01187 AS Spec. ct. SS Spec cession # T-t . ct. Ac est p- value Description S1 S2 S3 S1 S2 S3 s =1 - in ip 1 1 =1 s us =1 us =1 =2 us lus =1 90 f lus 650053.01187 AS Spec. ct. SS Spec cession # T-t . ct. Ac est p- value Description S1 S2 S3 S1 S2 S3 s =1 Table 2: Protein fractions expressed only in sickle cell (SS) samples. AS Spec. SS Spec. Accession No T-test p- ct. valuect.Descriptionus 1 90 us 1 us 1 us =1 1 2 us m 1 us 1 us 2 650053.01187 AS Spec. SS Spec. Accession No T-test p- ct. valuect.DescriptionS1 S2 S3 S1 S2 S3 nit us 3 (i) 2 us =1 s =1 lus ry 90 s 1 e 2 1 3 650053.01187 AS Spec. SS Spec. Accession No T-test p- ct. valuect.DescriptionS1 S2 S3 S1 S2 S3 90 k2 p1 90 =1 =1 or 90 Table 3: Post-translational modifications (PTMs) protein fractions expressed only in control (AS) and (SS) samples. AS Spec. SS Spec. PTM Accession T-test cttD i tis =2 s s 650053.01187 AS Spec. SS Spec. PTMs Accession T-test ct. # p-valuect.DescriptionS1 S2 S3 S1 S2 S3 s s =2 us =2 us =1 =3 =5 se 39 Table 4:Proteins expressed in both control (AS) and sickle cell (SS) samples Accession T-test p- AS Spec. ct. SS Spec. ct. # value S1 S2 S3 S1 S2 S3 Description 4 090 =1 us 90 650053.01187 Accession T-test p- AS Spec. ct. SS Spec. ct. # value S1 S2 S3 S1 S2 S3 Description B mnt mmbrn ifi h rn lf t ex 0 x us lus s 3 2 1 1 n1 l1 us lus t =1 al 650053.01187 Accession T-test p- AS Spec. ct. SS Spec. ct. # value S1 S2 S3 S1 S2 S3 Description Str ind d h h r tin 1 OS=M m ulus se us om s 0 im lus sn n 2 lus s lus 650053.01187 Accession T-test p- AS Spec. ct. SS Spec. ct. # value S1 S2 S3 S1 S2 S3 Description P tidl r ll i trn i mr FKBP1A =1 us ot1 us 0 s log 1 0 lus s lus 650053.01187 Accession T-test p- AS Spec. ct. SS Spec. ct. # value S1 S2 S3 S1 S2 S3 Description Diint rin nd mtll r tin dmin 0 1 90 lnc 1 s nx it q s 90 s 0 us 650053.01187 Accession T-test p- AS Spec. ct. SS Spec. ct. # value S1 S2 S3 S1 S2 S3 Description Nibnlik r tin 1 OS=M m l lus =1 Hp us po5 11 1 090 1 lnb us us 650053.01187 Accession T-test p- AS Spec. ct. SS Spec. ct. # value S1 S2 S3 S1 S2 S3 Description Ubi itin rbxltrminl hdr l 5 OS=Mus s 0 6 1 s 1 s it b =1 lus F2 1 us l2 s us ic 90 ic 650053.01187 Accession T-test p- AS Spec. ct. SS Spec. ct. # value S1 S2 S3 S1 S2 S3 Description Htr n n l r ribn l r tin K =1 1 1 s lus s 1 n -4 1 it a s it i2 0 O) 90 lus us 650053.01187 Accession T-test p- AS Spec. ct. SS Spec. ct. # value S1 S2 S3 S1 S2 S3 Description Ann xin A4 OS=M m l OX=10090 2 1 us lna 090 us lus 1 90 lus c 1 0 us 650053.01187 Accession T-test p- AS Spec. ct. SS Spec. ct. # value S1 S2 S3 S1 S2 S3 Description Un nvntinl m inI OS=M m l s a 0 a 0 90 lus s us =1 0 us 90 90 650053.01187 Accession T-test p- AS Spec. ct. SS Spec. ct. # value S1 S2 S3 S1 S2 S3 Description H t h k rtin HSP 90bt OS=M m lus 90 us 1 =1 90 s ein 3 it as s us s cl 650053.01187 Accession T-test p- AS Spec. ct. SS Spec. ct. # value S1 S2 S3 S1 S2 S3 Description T m lx rtin 1 bnit l h OS=M s s 3 us 1 T) us 90 lus it 90 s 1 lus us s 650053.01187 Accession T-test p- AS Spec. ct. SS Spec. ct. # value S1 S2 S3 S1 S2 S3 Description Krtin t II t kltl 2 idrml OS=Mus s 90 90 s 1 =1 0 s s s nit us 2 1 us 2 1 tl3 us 3 us 2 650053.01187 Accession T-test p- AS Spec. ct. SS Spec. ct. # value S1 S2 S3 S1 S2 S3 Description Im rtin 7 OS=M m l OX=10090 GN=Ipo7 lb x 90 90 s3 0 t a1 0 us s s s us 90 0 =1 650053.01187 Accession T-test p- AS Spec. ct. SS Spec. ct. # value S1 S2 S3 S1 S2 S3 Description 26S rt m nnATP r lt r bnit 2 1 1 =1 90 0 90 s 90 0 s us 650053.01187 Accession T-test p- AS Spec. ct. SS Spec. ct. # value S1 S2 S3 S1 S2 S3 Description Cdhrin13 OS=M m l OX=10090 lus 1 lus 0 lus s a- =1 T) 0 ein 1 0 s a- =1 650053.01187 Accession T-test p- AS Spec. ct. SS Spec. ct. # value S1 S2 S3 S1 S2 S3 Description S 1 f mil dmin ntinin r tin 1 OS=Mus n 2 1 90 it i3 90 nit b1 0 =1 0 1 us ysf s us s s 650053.01187 Accession T-test p- AS Spec. ct. SS Spec. ct. # value S1 S2 S3 S1 S2 S3 Description R rltd r tin Rb35 OS=M m l s lus us s us lus 1 1 lus s Table 5: post-translational modifications (PTMS) proteins expressed in both control (AS) and sickle cell (SS) samples AS Spec. SS Spec. T-test =3 3 ne =1 650053.01187 Glucose-6-phosphate 1- Q00612 5.07E-01 6 5 6 6 2 4 dehydrogenase X OS=Mus musculus OX=10090 GN=G6pdx =3 ne 90 4 =3 =1 us =1 us =1 us =1 4x s =2 s 1 n 1 =4 =1 090 ein =3 650053.01187 P0DP26 3.01E-02 6 14 10 26 18 15 Calmodulin-1 OS=Mus musculus OX=10090 GN=Calm1 PE=1 SV=1 Calmodulin-2 OS=Mus musculus =1 us =1 s =2 s 1 =4 ein us 1b =1 us az s ae ide 0 g id- rl3 =3 =2 ein 12 us =2 ein se 650053.01187 OX=10090 GN=Fkbp1a PE=1 SV=2 ADP-ribosylation factor 3 OS=Mus 3 us 2 2 s 4 um 4 us l2 s ag s lus 3 lus =1 se 0 3 2 e 7 us 2 us 1 =3 650053.01187 Actin-related protein 2 / 3 complex P59999 7.88E-01 4 3 0 2 3 0 subunit 4 OS=Mus musculus OX=10090 GN=Arpc4 PE=1 SV=3 2B us s =1 s =3 s 4b us 1c us 1a us 5 =5 a lus =1 5 4 s c ein 1 b 650053.01187 Myosin light polypeptide 6 Q60605 2.71E-01 15 10 11 14 13 14 OS=Mus musculus OX=10090 GN=Myl6 PE=1 SV=3 lus =2 n s =2 s 1 s 4a =3 090 us 1 us 1 s =2 =4 ein =3 =3 3 650053.01187 RIKEN cDNA 2210010C04 gene Q9CPN9 3.40E-01 30 10 6 6 3 4 OS=Mus musculus OX=10090 GN=2210010C04Rik PE=1 SV=1 3 us 090 =3 ne =1 us l2 =5 lus =1 =3 ber 0 References 1. Malicki JJ, Johnson CA. The cilium: cellular antenna and central processing unit. Trends Cell Biol.2017;27(2):126–140. 2. Goetz SC, Anderson KV. The primary cilium: a signalling centre during vertebrate development. Nat Rev Genet.2010;11(5):331–344. 3. Nguyen QPH, et al. Comparative super-resolution mapping of basal feet reveals a modular but distinct architecture in primary and motile cilia. Dev Cell.2020;55(2):209–223. 4. Egorova AD, et al. Primary cilia as biomechanical sensors in regulating endothelial function. Differentiation.2012;83(2):S56–S61. 5. Hierck BP, et al. Primary cilia sensitize endothelial cells for fluid shear stress. Dev Dyn. 2008;237(3):725–735. 6. Nauli SM, et al. Endothelial cilia are fluid shear sensors that regulate calcium signaling and nitric oxide production through polycystin-1. Circulation.2008;117(9):1161–1171. 650053.01187 7. AbouAlaiwi WA, et al. Ciliary polycystin-2 is a mechanosensitive calcium channel involved in nitric oxide signaling cascades. Circ Res.2009;104(7):860–869. 8. Mohieldin AM, et al. Vascular endothelial primary cilia: mechanosensation and hypertension. Curr Hypertens Rev.2016;12(1):57–67. 9. Pala R, et al. The roles of primary cilia in cardiovascular diseases. Cells.2018;7(12):E233. 10. Luu VZ, et al. Role of endothelial primary cilia as fluid mechanosensors on vascular health. Atherosclerosis.2018;275:196–204. 11. Goetz JG, et al. Endothelial cilia mediate low flow sensing during zebrafish vascular development. Cell Rep.2014;6(5):799–808. 12. Abdul-Majeed S, et al. Mechanisms regulating cilia growth and cilia function in endothelial cells. Cell Mol Life Sci.2012;69(1):165–173. 13. Iomini C, et al. Primary cilia of human endothelial cells disassemble under laminar shear stress. J Cell Biol.2004;164(6):811–817. 14. Dinsmore C, Reiter JF. Endothelial primary cilia inhibit atherosclerosis. EMBO Rep. 2016;17(2):156–166. 15. Vion AC, et al. Primary cilia sensitize endothelial cells to BMP and prevent excessive vascular regression. J Cell Biol.2018;217(5):1651–1665. 16. Eisa-Beygi S, et al. Characterization of endothelial cilia distribution during cerebral-vascular development in zebrafish (Danio rerio). Arterioscler Thromb Vasc Biol.2018;38(12):2806–2818. 17. Mirvis M, et al. Primary cilium loss in mammalian cells occurs predominantly by whole-cilium shedding. PLoS Biol.2019;17(7):e3000381. 18. Kong MJ, et al. Fragmentation of kidney epithelial cell primary cilia occurs by cisplatin and these cilia fragments are excreted into the urine. Redox Biol.2019;20:38–45. 19. Kallakuri S, et al. Endothelial cilia are essential for developmental vascular integrity in zebrafish. J Am Soc Nephrol.2015;26(4):864–875. 20. Arnold CR, et al. Comparative analysis of genes regulated by Dzip1 / iguana and hedgehog in zebrafish. Dev Dyn.2015;244(2):211–223. 21. Lamont RE, et al. Hedgehog signaling via angiopoietin1 is required for developmental vascular stability. Mech Dev.2010;127(3–4):159–168. 22. Jones TJ, et al. Primary cilia regulates the directional migration and barrier integrity of endothelial cells through the modulation of hsp27 dependent actin cytoskeletal organization. J Cell Physiol. 2012;227(1):70–76. 650053.01187 23. Ma N, Zhou J. Functions of endothelial cilia in the regulation of vascular barriers. Front Cell Dev Biol.2020;8:626. 24. Cortellino S, et al. Defective ciliogenesis, embryonic lethality and severe impairment of the Sonic Hedgehog pathway caused by inactivation of the mouse complex A intraflagellar transport gene Ift122 / Wdr10, partially overlapping with the DNA repair gene Med1 / Mbd4. Dev Biol. 2009;325(1):225–237. 25. Gorivodsky M, et al. Intraflagellar transport protein 172 is essential for primary cilia formation and plays a vital role in patterning the mammalian brain. Dev Biol.2009;325(1):24–32. 26. DeStefano JG, et al. Effect of shear stress on iPSC-derived human brain microvascular endothelial cells (dhBMECs). Fluids Barriers CNS.2017;14(1):20. 27. Worthen LM, Nollert MU. Intracellular calcium response of endothelial cells exposed to flow in the presence of thrombin or histamine. J Vasc Surg.2000;32(3):593–601. 28. Zhang F, et al. Effects of fluid shear stress on expression of Smac / DIABLO in human umbilical vein endothelial cells. Curr Ther Res Clin Exp.2013;74:36–40. 29. Barrionuevo WR, Burggren WW. O2 consumption and heart rate in developing zebrafish (Danio rerio): influence of temperature and ambient O2. Am J Physiol.1999;276(2 pt 2):R505–R513. 30. Baker K, et al. Defective “pacemaker” current (Ih) in a zebrafish mutant with a slow heart rate. Proc Natl Acad Sci U S A.1997;94(9):4554–4559. 31. Ingram VM. A specific chemical difference between the globins of normal human and sickle-cell anaemia haemoglobin. Nature.1956;178(4537):792–794. 32. Switzer JA, et al. Pathophysiology and treatment of stroke in sickle-cell disease: present and future. Lancet Neurol.2006;5(6):501–512. 33. Zennadi R, et al. Sickle red cells induce adhesion of lymphocytes and monocytes to endothelium. Blood.2008;112(8):3474–3483. 34. Zennadi R, et al. Epinephrine acts through erythroid signaling pathways to activate sickle cell adhesion to endothelium via LW-alphavbeta3 interactions. Blood.2004;104(12):3774–3781. 35. Sultana C, et al. Interaction of sickle erythrocytes with endothelial cells in the presence of endothelial cell conditioned medium induces oxidant stress leading to transendothelial migration of monocytes. Blood.1998;92(10):3924–3935. 36. Reneman RS, Hoeks AP. Wall shear stress as measured in vivo: consequences for the design of the arterial system. Med Biol Eng Comput.2008;46(5):499–507. 37. Nader E, et al. The red blood cell-inflammation vicious circle in sickle cell disease. Front Immunol.2020;11:454. 650053.01187 38. Stuart J, Johnson CS. Rheology of the sickle cell disorders. Baillieres Clin Haematol. 1987;1(3):747–775. 39. Kurantsin-Mills J, et al. Flow dynamics of human sickle erythrocytes in the mesenteric microcirculation of the exchange-transfused rat. Microvasc Res.1987;34(2):152–167. 40. Kim JI, et al. Reduction of oxidative stress during recovery accelerates normalization of primary cilia length that is altered after ischemic injury in murine kidneys. Am J Physiol Renal Physiol. 2013;304(10):F1283–F1294. 41. Erdbruegger U, et al. Circulating endothelial cells: markers and mediators of vascular damage. Curr Stem Cell Res Ther.2010;5(4):294–302. 42. Tenreiro MM, et al. Cellular response of the blood-brain barrier to injury: potential biomarkers and therapeutic targets for brain regeneration. Neurobiol Dis.2016;91:262–273. 43. Mohieldin AM, et al. Protein composition and movements of membrane swellings associated with primary cilia. Cell Mol Life Sci.2015;72(12):2415–2429. 44. Mohieldin AM, et al. Proteomic identification reveals the role of ciliary extracellular-like vesicle in cardiovascular function. Adv Sci (Weinh).2020;7(16):1903140. 45. Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc.2008;3(6):1101–1108. 46. Al-Kandari H, et al. Ecotoxicological assessment of thermally- and hydrogen-reduced graphene Oxide / TiO2 photocatalytic nanocomposites using the zebrafish embryo model. Nanomaterials (Basel).2019;9(4):488. 47. Benslimane FM, et al. Cardiac function and blood flow hemodynamics assessment of zebrafish (Danio rerio) using high-speed video microscopy. Micron.2020;136:102876. 48. Yalcin HC. Hemodynamic Studies for Analyzing the Teratogenic Effects of Drugs in the Zebrafish Embryo. In: Félix L, ed. Teratogenicity Testing: Methods and Protocols. Springer; 2018:487–495. 49. Udani M, et al. Basal cell adhesion molecule / lutheran protein. The receptor critical for sickle cell adhesion to laminin. J Clin Invest.1998;101(11):2550–2558. 50. MacKinney A, et al. Disrupting the vicious cycle created by NOX activation in sickle erythrocytes exposed to hypoxia / reoxygenation prevents adhesion and vasoocclusion. Redox Biol. 2019;25:101097. 51. McDonald, W.H., et al. MS1, MS2, and SQT-three unified, compact, and easily parsed file formats for the storage of shotgun proteomic spectra and identifications. Rapid Commun Mass Spectrom 18, 2162-2168 (2004). 650053.01187 52. Xu, T., et al. ProLuCID: An improved SEQUEST-like algorithm with enhanced sensitivity and specificity. J Proteomics 129, 16-24 (2015). 53. Tabb, D.L., McDonald, W.H. & Yates, J.R., 3rd. DTASelect and Contrast: tools for assembling and comparing protein identifications from shotgun proteomics. J Proteome Res 1, 21-26 (2002). 54. Robinson, P.N., Wollstein, A., Bohme, U. & Beattie, B. Ontologizing gene-expression microarray data: characterizing clusters with Gene Ontology. Bioinformatics 20, 979-981 (2004). 55. Mi, H., et al. Protocol Update for large-scale genome and gene function analysis with the PANTHER classification system (v.14.0). Nat Protoc 14, 703-721 (2019). Example 3: Detection of Markers of Cilium on Red Blood Cells (RBCs) and Platelets To identify and validate novel markers of cilium, we employed a mouse model of traumatic brain injury (TBI), using transgenic ARL13b-eGFP mouse.1For TBI generation in mice, we have used the closed skull modification of the controlled cortical impact model (PMID 29149385, 18599043).2,3In this work, we refer to this model as the controlled cranial impact (CCrI) model. To induce TBI, mice are anesthetized with inhalational isoflurane in 25% O2 / 75% N2 gas and positioned lying prone under the stereotaxic impactor device (Leica MyNeuroLab Electromagnetic Stereotaxic Impactor) on a warming pad. After induction of anesthesia (5% isoflurane), the isoflurane is lowered to 1.5% for the remainder of the procedure. The animal’s head is positioned perpendicular to the impactor tip (5 mm diameter stainless steel tip) and supported on a bed of sterile gauze to allow free movement of the animal’s head after impact. The impactor tip is positioned in contact with the skin, centered over the right parietal bone of the skull. The tip is retracted by the device and the device is lowered 2.6 mm to create the depth of travel of the impactor tip below the surface of the skin. Velocity of impact varies from 3 to 6 m / s to generate different severities of TBI from mild to severe. Dwell time of the impact was set to 200 ms. After a single impact, the animal is removed from isoflurane and returned to its home cage to recover. Animals are kept warm until they regain consciousness. This modified procedure requires no surgery and on average, requires less than 5 minutes total time and exposure to anesthesia. We discovered that markers of cilium (e.g., ARL13b) are elevated post-TBI on both RBCs and platelets and that the elevation increases over time. While RBCs are the most abundant cells in the blood and play a primary role in oxygen transport to hypoxic tissue, platelets are central to clotting and inflammation, all critical processes post-TBI. Therefore, the detection of elevated levels of ciliary proteins bound to RBCs and platelets could potentially link these blood cells-bound cilia to the underlying pathology of post concussive syndrome. In addition, we discovered that ciliary proteins are decreased in brain cells following TBI, including a rapid loss in brain endothelial cells (ECs), which was detectable as early as day 1 post- 650053.01187 TBI. We also found post-TBI association of ciliary proteins with blood cells that showed no ciliary enrichment pre-TBI. Without wishing to be bound by a particular theory, these results suggest that the loss of endothelial cell ciliary protein from brain cortex cells causes the enrichment of ciliary protein in blood cells. Detection of Ciliary Protein on Blood Cells Transgenic ARL13b-eGFP mice (n=3 / group) were subjected to TBI. Blood samples were collected pre-TBI and at days 1, 7, and 14 post-TBI and investigated by flow cytometry to determine ARL13b levels before and after TBI (FIGS.21A-B). The cells were stained with ARL13b antibody, and the identity of the detected ARL13b protein was validated based on a positive signal for both ARL13b antibody (red, Y-axis) and transgenic eGFP (green, X-axis). Analysis of the median fluorescence intensity (MFI) of ARL13B before and after TBI demonstrated that ARL13b level was high in blood after day-1 post-TBI (FIG. 21A) and remained elevated throughout day-7 and day-14 post-TBI (FIG.21B). In addition, ARL13b-cell interaction was investigated for specific blood cell types (FIG.23B). ARL13b-GFP (n=3) transgenic mice were subjected to TBI. Fifty ^l blood was collected in heparinized tube at each time point from a given mouse, washed x2 with FACS buffer and fixed with 4% paraformaldehyde. Fixed cells were stained with antibodies to identify different blood cell types (RBC: Ter119+, and platelet: CD41+) and cilia protein ARL13b. Stained cells were analyzed by flow cytometer and cell-associated cilia proteins were calculated as % cells positive for ARL13b. The results demonstrated that RBCs and platelets, which had no ARL13b enrichment pre-TBI, elevated levels of bound ARL13b post-TBI. In addition, this elevation of ARL13b increased over time, as the highest ARL13b levels were detected on day 14 post-TBI. Detection of Ciliary Protein on Brain Cells We also quantified the levels of cilia protein on brain cells in a mouse model of TBI, using ex vivo flow cytometry (FIG. 22). Mice were euthanized pre-TBI and at days 1 and 7 post-TBI, and tissues were harvested following perfusion. Single cell suspensions were prepared from injured ipsilateral cortex versus uninjured contralateral cortex samples. Myelin debris was removed and subsequently cells were fixed and stained with antibodies to identify cell clusters such as ECs (CD31) and astrocytes (GLAST, Gfap), and to detect cilia proteins (ARL13b, IFT88). Following staining, cells were analyzed by flow cytometry. Total cellular ciliary proteins remained unchanged at day 1 but showed significant decrease at day 7 post-TBI (FIG. 22). Interestingly, compared to total cells or other neurovascular unit-cell population such as astrocytes, we observed the loss of ARL13b in the EC population as early as day 650053.01187 1 (FIG.22, left panel). This data demonstrates that brain vessel ECs are prone to lose cilia very rapidly post-TBI. We further investigated any change in cilia-specific markers at the gene level using scRNAseq. Cilia gene Arl13b expression was uniquely compromised in EC sub-clusters 0 and 3 at day 1 post- TBI and such loss was never recovered (FIG.30A). Arl13b expression was uniquely low in EC sub- cluster 1 at day 7 post-TBI, when the cluster was observed to be significantly expanding (FIG.30A). Progressive loss of Arl13b gene expression over time was also noted in EC sub-cluster 2 (FIG.30A). We also used flow cytometry to quantify changes in cilia protein expression in single endothelial cells isolated from injured ipsilateral and paired un-injured contralateral cortex samples at day 1 and 7 post-injury. We did not see any significant change in the expressions of cilia protein ARL13B in total cells harvested from the injured ipsilateral side, normalized to uninjured contralateral side at day 1, but the expression of the protein was significantly reduced in ipsilateral ECs at day 7 post- sTBI (FIG.30B). We observed a similar trend of ARL13B expression in astrocytes, detected as GFAP+ cells (Figure 30B). Interestingly at day 1 post-sTBI, expression of ARL13B was significantly reduced in ipsilateral ECs, as normalized to contralateral ECs, and remained so even at day 7 post- sTBI (FIG. 30B). Because cerebral perfusion was reduced in the non-impacted contralateral hemisphere, we conducted an additional experiment to compare cilia protein expression within each brain hemisphere across all study timepoints. In this experimental duplicate, we injured different groups of mice on different days to collect and analyze all study endpoints on the same day. Compared to no-TBI cortex-derived ECs, we observed significantly reduced ARL13B in ECs harvested from the impacted (ipsilateral) cortex at day 1 (FIG.30C). Interestingly, the cilia protein ARL13B was not only reduced in the ECs harvested from the side of injury, but also reduced in ECs from the contralateral non-impacted side (FIG. 30C) suggesting a diffuse injury throughout the brain cortex that may have resulted from the global alterations in CBF observed after sTBI. Methods Mice All mouse experiments were approved by the Medical College of Wisconsin Institutional Animal Care and Use Committee. C57BL / 6J mice were purchased from Jackson Laboratories (Bar Harbor, ME) and bred under specific-pathogen-free conditions at the MCW Biomedical Resource Center. A breeder pair of ARL13B-EGFPtg mice were generously donated by David Clapham (Janelia Research Campus, Ashburn, VA, USA)29 to create a colony maintained by the Rarick laboratory. All ARL13B-EGFPtg mice used were from the Rarick colony. All experiments were performed on 12- to 14-week-old mice. Animals used in this study were housed in a 12- hour light / 12- hour dark cycle with free access to food (standard mouse chow) and water ad libitum. Animals were monitored by lab staff and animal facility staff, which included full-time veterinarians. For the end 650053.01187 point tissue collection, mice were deeply anesthetized using inhaled isoflurane (4%), a thoracotomy was performed to access the heart to draw blood samples followed by trans-cardiac perfusion to flush and clear circulating blood from the organs with heparinized phosphate buffered saline (PBS). Traumatic Brain Injury (TBI) TBI was applied in age-matched (12- to 14-week-old) male C57BL / 6J mice using the non- surgical, closed-skull modification of the controlled cortical impact model30. The closed-skull modification maintains the integrity of the skull and meninges allowing for appropriate changes to intracranial pressure and cerebrospinal fluid dynamics and avoiding complications that may occur with a surgical craniotomy including non-TBI related inflammation and cellular responses. A severe TBI with hemorrhage was created using a single impact with the following parameters: 5 mm diameter tip; 2 mm impact depth, 0.2 s dwell time, and 6 m / s velocity (Leica MyNeuroLab Impact One Stereotaxic Impactor, Leica Biosystems, Richmond, IL). To induce TBI, mice were anesthetized in an induction chamber using 4% inhaled isoflurane. Mice were then moved under the impact device with their head positioned on a bed of gauze perpendicular to the impact tip with isoflurane anesthesia delivered via nosecone maintained at 1.5%. This allowed free movement of the animal’s head in response to the impact. The impactor tip was positioned over the right parietal bone at ∼10° angle to achieve greater contact between the flat surface of the tip and the curved skull. Anesthesia was stopped immediately after impact limiting the total time of anesthesia exposure to less than 5 minutes for the procedure, including induction. Body temperature was maintained during the procedure and recovery periods by placing the mice on a heated recirculating water pad. Flow cytometry At the respective endpoints, 5 mm x 5 mm brain cortex samples were collected from the site of injury after the brains were perfused as described above. The area and the volume of tissue samples remained consistent within mice. Similar to the cortex samples harvested from the side of injury, specimens were also collected from the symmetrical site-matched un-injured contralateral side. Matching cortex samples from no-TBI control mice were also collected. Cortex samples were finely dissected and digested in 5 ml buffer (1 mg / ml collagenase D, 100 µg / ml DNase, 5 mM CaCl2, papain suspension 60 U, 10% fetal bovine serum (FBS) in RPMI medium) in a dish for 30 minutes inside a shaker maintained at 80 RPM, 37°C. To remove any undigested fraction or tissue particles, samples were then passed through a 40 µm cell strainer (pluriSelect, cat# 43-50040-01). Myelin debris were then removed using specific magnetic beads (Miltenyi Biotech, cat# 130-096-733) per manufacturer’s recommended protocol. Single-cell suspensions were then washed twice with FACS buffer (1× PBS with 5% FBS and 0.1% NaN3) at 300g for 5 minutes and were subsequently incubated with Live / Dead fixable yellow dead cell stain (Thermo Fisher cat# L34968) as per manufacturer’s protocol, to exclude any dead cells, wherever 650053.01187 applicable. Then, cells were fixed and permeabilized using Cytofix / Cytoperm buffer (BD, cat# 554722) and stained with the following antibodies to identify different blood-brain- barrier associated cell clusters (CD31+ cells as EC population, CD31-CD184+GFAP+ cells as astrocytes or glial cells) and cilia proteins: CD31-BUV396 (BD, cat# 740231), CD184-PerCP Cy5.5 (Biolegend, cat# 146509), purified monoclonal GFAP (Biolegend, cat# 644702) and purified polyclonal ARL13B (Proteintech, cat# 17711-I-AP). Suitable secondary reagents were used to detect the respective primary antibodies. Primary antibodies were diluted 1:100, and secondary antibodies were diluted 1:500. BD perm wash buffer (cat# 554723) was used for antibody dilutions and washing. Primary antibodies were incubated for 45 minutes and secondaries for 30 minutes at 4°C. Suitable secondary antibody controls were included. After the completion of staining, cells were resuspended in FACS buffer. Stained cells were run on a flow cytometer (Becton Dickinson LSRFortessa). Sample acquisition was done using Becton Dickinson’s FACSDiva software with subsequent analysis on FlowJo software. Tracking cilia protein in blood ARL13B-EGFPtg mice were subjected to TBI as described above. 50 µl of blood was collected in heparinized tubes from each mouse pre- and post-TBI from the jugular vein. Blood cells were fixed in 4% paraformaldehyde and labeled with antibodies to detect the cilia protein ARL13B as described above. After staining, cells were resuspended in FACS buffer and run in the flow cytometer as described above. The transgenic EGFP signal was detected to validate the ARL13B signal as detected by the antibody. At least 50,000 blood cells were run per sample. Single cell RNA sequencing Single cell suspensions were prepared from brain cortex samples post-injury (Days 1, 7, and 28) and from no-TBI control mice using the cell isolation procedure described for flow cytometry.5 mm x 5 mm cortex specimens were collected specifically from the site of injury and site- matched cortex from un-injured control mice. After removing myelin debris, single cell isolations were fixed and processed for library construction as per manufacturer’s (10x Genomics) protocol. For multiplexing, samples were probed using the single cell fixed RNA transcriptome probe kit. For a single library construction, 4 samples from each time point were multiplexed by the dual index plate reagent following the preparation of gel emulsion using the 10x Genomics Chromium X instrument. For sequencing, 4 libraries were multiplexed. Each library is identifiable by a specific set of i5 and i7 primers as included in the dual index plate. Following the construction as recommended by the manufacturer, cDNA library products were validated with TapeStation (Agilent Technologies), by using High Sensitivity D5000 ScreenTape and analyzing with TapeStation analysis software version 3.1. The Chromium X (10x Genomics) generated barcoded gel-bead emulsions from post-fixed single cell, and Illumina-compatible library preps were subsequently sequenced on Illumina High Seq-2500 650053.01187 platform. We sequenced ∼10,000 cells per sample. Feature-barcode matrix was generated using the Cell Ranger 7.1.0 (10x Genomics). Sequenced data were aggregated, and reads were aligned by the Cell Ranger. The following quality control steps were conducted: 1. Cells that have unique feature counts over 3500 or less than 200 were excluded for further analysis; and 2. Cells that have over 5% of unique molecular identifiers were derived from the mitochondrial genome were excluded for further analysis. Seurat package was used for data normalization, principal component analysis, Uniform Manifold Approximation and Projection (UMAP), clustering analysis and differential expression analysis. Genes were considered significantly differentially expressed at a false discovery rate of 5%. Gene set enrichment analyses (GSEA) were performed to identify important pathways. Based on FindMarkers function from Seurat, we used gseKEGG function in ClusterProfile Package31 for GSEA. Library org.Mm.eg.db was used for gene ID mapping. We used dotplot and gseaplot2 for further visualizing the GSEA results. Statistics Data were presented as mean and standard deviation (SD), or standard error of the mean (SEM) as noted. Changes in cerebral perfusion measured using LSCI were analyzed using repeated measures two-way ANOVA and each time point post impact was compared to the pre-TBI value. A two-tailed two-sample t test or one-way ANOVA was performed to compare differences between groups as appropriate based on the number of comparisons. The differences of % total Arl13b+ blood cells between pre- and post-TBI were evaluated by a paired t test. Kruskal-Wallis Test was used where parametric assumptions were not satisfied. Dunnett’s test, Sidak’s, or Tukey’s test was used to adjust for multiple comparisons. P < 0.05 was considered statistically significant. Statistical analysis was performed using SAS V9.4 (SAS Institute Inc.) and GraphPad Prism software (version 10.2.0). References 1. Delling, M., DeCaen, P.G., Doerner, J.F., Febvay, S. & Clapham, D.E. Primary cilia are specialized calcium signalling organelles. Nature 504, 311-314 (2013). 2. Kochanek PM, Wallisch JS, Bayır H, Clark RSB. Pre-clinical models in pediatric traumatic brain injury-challenges and lessons learned. Childs Nerv Syst.2017 Oct;33(10):1693-1701. 3. Huh JW, Widing AG, Raghupathi R. Midline brain injury in the immature rat induces sustained cognitive deficits, bihemispheric axonal injury and neurodegeneration. Exp Neurol. 2008 Sep;213(1):84-92.

Claims

650053.01187 CLAIMS What is claimed:

1. A method of detecting endothelial damage or dysfunction or vascular injury in a subject in need thereof, the method comprising: detecting the level of one or more markers of cilium in a biological sample from the subject, wherein a difference in the level of the one or more markers of cilium detected in the biological sample compared to a control indicates endothelial damage or dysfunction or vascular injury, and wherein the one or more markers of cilium comprises C1s, TfR1, and / or GAPDH.

2. The method of claim 1, wherein the detecting the level of one or more markers of cilium comprises contacting the sample with one or more antibodies to the one or more markers of cilium, and detecting the binding of the antibody to the one or more markers of cilium in the sample.

3. The method of any one of the preceding claims, wherein the detecting is by enzyme-linked immunoassay (ELISA).

4. The method of claim 1 or 2, wherein the detecting is by flow cytometry.

5. The method of any one of the preceding claims, wherein the one or more markers of cilium comprises a ciliary marker, a basal body cilium marker, or a post-translational modification (PTM) of a protein associated with cilium.

6. The method of any one of the preceding claims, wherein the subject is suspected of having or diagnosed as having SCD or TBI.

7. The method of any one of the preceding claims, wherein the method further comprises, treating the endothelial damage or dysfunction or vascular injury.

8. The method of any one of the preceding claims, wherein the endothelial damage or dysfunction or vascular injury is associated with a disease selected from sickle cell disease (SCD), atherosclerosis, stroke, artery-vein malformations, varicose veins, altered tumor vasculature, hemorrhages, preeclampsia, traumatic brain injury (TBI), and hypertension.

9. The method of any one of the preceding claims, wherein the biological sample is a sample selected from serum, blood, plasma, urine, cerebrospinal fluid, seminal fluid, saliva, tears, synovial650053.01187 fluid, breast milk, bile, amniotic fluid, aqueous humor, vaginal lubrication, sweat, lymph, and bone marrow, optionally wherein the biological sample comprises RBCs or platelets.

10. A kit comprising: at least one antibody that binds to at least one marker of cilium, and instructions for use, wherein the at least one antibody binds to one of GAPDH, TfR1, and C1s, optionally, wherein the kit comprises at least one secondary antibody comprising a detectable label.

11. The kit of claim 10, wherein the kit comprises antibodies that bind to each of GAPDH, TfR1, and C1s.

12. A method of detecting an occlusive event associated with sickle cell disease (SCD) in a subject having SCD, the method comprising: detecting one or more markers of cilium in a first biological sample from the subject, wherein the one or more markers of cilium comprises at least one of GAPDH, TfR1, and C1s.

13. A method of detecting cilia on red blood cells and / or platelets in a sample from a subject, the method comprising obtaining a blood sample from a subject; isolating the red blood cells (RBCs) and / or platelets from the sample, and detecting one or more markers of cilium on the surface of the red blood cells and / or platelets, wherein the one or more markers of cilium comprises at least one of GAPDH, TfR1, and C1s.

14. The method of claim 13, wherein the detection of the one or more markers of cilium on the RBCs and / or platelets is indicative of damaged blood vessels.

15. The method of claim 13 or 14, wherein the method further comprises obtaining a second blood sample from a subject; isolating a second set of red blood cells and / or platelets from the sample, detecting one or more markers of cilium on the surface of the RBCs and / or platelets, and comparing the level of the one or more markers of cilium on the RBCs and / or platelets from the first sample to the second sample, wherein the second sample is taken at a later time than the first sample, and wherein an increase in the level of the one or more markers of cilium associated with the RBCs and / or platelets in the second sample as compared to the first sample indicates damage to one or more blood vessels within the subject.

16. The method of claim 12, the method further comprising: detecting the one or more markers of cilium in a second biological sample from the same subject, wherein the second biological sample is taken at a later time than the first biological sample, and650053.01187 wherein an increase in the level of the one or more markers of cilium in the second sample as compared to the first sample indicates an occlusive event.

17. The method of any one of claims 12-16, wherein the detecting the one or more markers of cilium comprises contacting the sample with one or more antibodies to a marker of cilium, and detecting the binding of the antibody to the one or more markers of cilium in the sample.

18. The method of claim 17, wherein the method further comprises: contacting the sample with a secondary antibody with a detectable marker, and detecting the detectable marker in the sample.

19. The method of claim 18, wherein the antibody to the marker of cilium, or secondary antibody are attached to a solid support.

20. The method of any one of claims 12-19, wherein the detecting is by enzyme-linked immunoassay (ELISA).

21. The method of any one of claims 12-19, wherein the detecting is by flow cytometry, optionally wherein the antibody to the marker of cilium, or secondary antibody are attached to beads.

22. The method of any one of claims 12-21, wherein the one or more markers of cilium is a ciliary marker or a basal body cilium marker, or a post-translational modification (PTM) of a protein associated with cilium.

23. The method of any one of claims 12-22, wherein the method further comprises detecting lower levels of a marker of cilium compared to control.

24. The method of claim 23, wherein the marker of cilium comprises C1s protein.

25. The method of any one of claims 12-24, wherein the method further comprises, administering a therapeutic to treat the occlusive event.

26. The method of any one of claims 12-25, wherein the occlusive event comprises vascular wall weakening or increased susceptibility to hemorrhage.

27. The method of any one of claims 1-9 or 12-26, the method comprising obtaining a sample from the subject.

28. A method of detecting cilia on platelets in a sample from a subject, the method comprising  obtaining a blood sample from a subject; isolating the platelets from the sample, and650053.01187 detecting one or more markers of cilium on the surface of the platelets.

29. The method of claim 28, wherein the detection of the one or more markers of cilium on the RBCs and / or platelets is indicative of endothelial damage, optionally wherein the endothelial damage is associated with TBI.

30. The method of claim 28 or 29, wherein the method further comprises obtaining a second blood sample from a subject; isolating a second set of platelets from the sample, detecting one or more markers of cilium on the surface of the platelets, and comparing the level of the one or more markers of cilium on the platelets from the first sample to the second sample, where the second sample is taken at a later time than the first sample, and wherein an increase in one or more markers of cilium associated with the RBCs in the second sample as compared to the first sample indicates damage to endothelial cells within the subject.

31. The method of any one of claims 28-30, wherein the detecting the one or more markers of cilium comprises contacting the sample with one or more antibodies to a marker of cilium, and detecting the binding of the antibody to the one or more markers of cilium in the sample.

32. The method of claim 31, wherein the method further comprises: contacting the sample with a secondary antibody comprising a detectable marker, and detecting the detectable marker in the sample.

33. The method of claim 32, wherein the antibody to the marker of cilium, or secondary antibody are attached to a solid support.

34. The method of any one of claims 28-33, wherein the detecting is by enzyme-linked immunoassay (ELISA).

35. The method of any one of claims 28-33, wherein the detecting is by flow cytometry, optionally wherein the antibody to the marker of cilium, or secondary antibody are attached to beads.

36. The method of any one of claims 28-35, wherein the method further comprises, administering a therapeutic to treat the TBI, optionally wherein the therapeutic treats the endothelial damage.

37. The method of any one of claims 28-36, the method comprising obtaining a sample from the subject.650053.01187 38. The method of any one of claims 28-27, wherein the one or more markers of cilium comprises C1s, TfR1, GAPDH, ARL13b, γ-tubulin, IFT88, Inversin, NRF2, acetylated-α-tubulin, or a combination thereof.

39. The method of claim 38, wherein the one or more markers of cilium comprises ARL13b.

40. A method of sample processing, comprising: (a) analyzing cells of a blood sample obtained from a subject, comprising: (i) selectively identifying platelets of the blood sample; and (ii) detecting one or more markers of cilium associated with the platelets of the blood sample; and (b) quantifying the one or more markers of cilium associated with the platelets of the blood sample.

41. The method of claim 40, wherein step (a)(i) comprises flow cytometry.

42. The method of claim 40 or 41, further comprising comparing (i) a quantity of the one or more markers of cilium associated with the platelets of the blood sample resulting from the quantifying in (b), and (ii) a control quantity of the one or more markers of cilium associated with the platelets in one or more control subjects.

43. The method of claim 42, wherein the quantifying the one or more markers of cilium in (b) indicates a presence of, or a risk of developing, a brain injury in the subject, when the quantity of the one or more markers of cilium is higher than the control quantity of the one or more markers of cilium associated with the one or more control platelets in the one or more control subjects, wherein the one or more control subjects does not have the brain injury.

44. The method of claim 42, wherein the quantifying the one or more markers of cilium in (b) indicates a presence of, or a risk of developing, a condition, when the quantity of the one or more markers of cilium is higher than the control quantity of the one or more markers of cilium associated with the one or more control platelets in the one or more control subjects, wherein the one or more control subjects does not have the condition, wherein the condition comprises SCD, atherosclerosis, stroke, artery-vein malformations, varicose veins, altered tumor vasculature, hemorrhages, preeclampsia, and hypertension.

45. The method of claim 42, wherein the quantifying the one or more markers of cilium in (b) indicates a presence of, or a risk of developing, a condition, when the quantity of the one or more markers of cilium is lower than the control quantity of the one or more markers of cilium associated with the one or more control platelets in the one or more control subjects, wherein the one or more control subjects does not have the condition, wherein the condition comprises SCD, atherosclerosis,650053.01187 stroke, artery-vein malformations, varicose veins, altered tumor vasculature, hemorrhages, preeclampsia, or hypertension.

46. The method of any one of claims 40-45, further comprising performing (a)-(b) on a second blood sample obtained from the subject at an earlier time point than the blood sample.

47. The method of any one of claims 40-46, wherein the detecting the one or more markers of cilium in (a)(ii) comprises: (1) contacting the blood sample with at least one antibody that binds to the at least one cilia biomarker, wherein the at least one antibody is labeled; and (2) measuring a quantity of the at least one antibody.

48. The method of any of claims 40-47, wherein the one or more markers of cilium comprises C1s, TfR1, GAPDH, ARL13b, γ-tubulin, IFT88, Inversin, NRF2, acetylated-α-tubulin, or a combination thereof.

49. A method of processing a sample, comprising: (a) producing a fraction of a blood sample obtained from a subject, comprising: (i) introducing the blood sample to an antibody under conditions sufficient to bind the antibody to one or more markers of cilium in the blood sample, wherein the antibody is immobilized to a solid support; and (ii) selectively removing components of the blood sample that are not bound to the antibody; and (b) quantifying the one or more markers of cilium within the fraction, wherein the one or more markers of cilium is associated with a platelet in the blood sample.

50. The method of claim 49, comprising performing (a)-(b) using an ELISA.

51. The method of claim 49 or 50, further comprising processing the blood sample before (a), wherein the processing comprises lysing the blood sample.

52. The method of any one of claims 49-51, wherein a quantity of the one or more markers of cilium resulting from the quantifying in (b) indicates a presence or an absence of a condition.

53. The method of any one of claims 49-52, wherein the condition comprises TBI, SCD, atherosclerosis, stroke, artery-vein malformations, varicose veins, altered tumor vasculature, hemorrhages, preeclampsia, or hypertension.

54. The method of any one of claims 49-53, further comprising performing (a)-(b) on a second blood sample.650053.01187 55. The method of claim 54, wherein the second blood sample is obtained from the subject at an earlier timepoint than the blood sample.

56. The method of claim 54, wherein the second blood sample is obtained from the subject at a later timepoint than the blood sample.

57. The method of claim 54, wherein the second blood sample is from a second subject, wherein the second subject does not have a condition selected from the group consisting of TBI, SCD, atherosclerosis, stroke, artery-vein malformations, varicose veins, altered tumor vasculature, hemorrhages, preeclampsia, or hypertension.

58. The method of any one of claims 49-57, wherein the one or more markers of cilium comprises C1s, TfR1, GAPDH, ARL13b, γ-tubulin, IFT88, Inversin, NRF2, acetylated-α-tubulin, or a combination thereof.

59. The method of any one of claims 49-58, further comprising providing a relative risk of the subject developing endothelial damage and / or vascular injury based at least in part on the quantifying in (b).

60. A method of detecting traumatic brain injury in a subject in need thereof, the method comprising: detecting the level of one or more markers of cilium in a biological sample from the subject, wherein a difference in the level of the one or more markers of cilium detected in the biological sample compared to a control indicates traumatic brain injury.

61. The method of claim 60, wherein the detecting the level of one or more markers of cilium comprises contacting the sample with one or more antibodies to the one or more markers of cilium, and detecting the binding of the antibody to the one or more markers of cilium in the sample.

62. The method of claim 60 or 61, wherein the detecting is by enzyme-linked immunoassay (ELISA).

63. The method of claim 60 or 61, wherein the detecting is by flow cytometry.

64. The method of any one of claims 60-63, wherein the one or more markers of cilium comprises a ciliary marker, a basal body cilium marker, or a post-translational modification (PTM) of a protein associated with cilium.

65. The method of any one of claims 60-64, wherein the method further comprises,650053.01187 treating the traumatic brain injury.

66. The method of any one of claims 60-65, wherein the biological sample is a sample selected from serum, blood, plasma, urine, cerebrospinal fluid, seminal fluid, saliva, tears, synovial fluid, breast milk, bile, amniotic fluid, aqueous humor, vaginal lubrication, sweat, lymph, and bone marrow.

68. The method of any one of claims 60-65, wherein the biological sample comprises RBCs.

69. The method of any ones of claims 60-65, wherein the biological sample comprises platelets.

70. The method of any one of claims 60-69, wherein the one or more markers of cilium comprises C1s, TfR1, GAPDH, ARL13b, γ-tubulin, IFT88, Inversin, NRF2, acetylated-α-tubulin, or a combination thereof.

71. The method of claim 70, wherein the one or more markers of cilium comprises ARL13b.

72. A method of detecting cilia on red blood cells and / or platelets in a sample from a subject, the method comprising obtaining a blood sample from a subject; isolating the red blood cells (RBCs) and / or platelets from the sample, and detecting one or more markers of cilium on the surface of the red blood cells and / or platelets, wherein the subject is suspected of having traumatic brain injury.

73. The method of claim 72, wherein the one or more markers of cilium comprises C1s, TfR1, GAPDH, ARL13b, γ-tubulin, IFT88, Inversin, NRF2, acetylated-α-tubulin, or a combination thereof.

74. The method of claim 73, wherein the one or more markers of cilium comprises ARL13b.

75. The method of any one of claims 72-74, wherein the method further comprises obtaining a second blood sample from a subject; isolating a second set of red blood cells and / or platelets from the sample, detecting one or more markers of cilium on the surface of the RBCs and / or platelets, and comparing the level of the one or more markers of cilium on the RBCs and / or platelets from the first sample to the second sample, wherein the second sample is taken at a later time than the first sample, and wherein an increase in the level of the one or more markers of cilium associated with the RBCs and / or platelets in the second sample as compared to the first sample indicates damage to one or more blood vessels within the subject.

76. The method of any one of claims 72-75, wherein the detecting the one or more markers of cilium comprises650053.01187 contacting the sample with one or more antibodies to a marker of cilium, and detecting the binding of the antibody to the one or more markers of cilium in the sample.

77. The method of claim 76, wherein the method further comprises: contacting the sample with a secondary antibody with a detectable marker, and detecting the detectable marker in the sample.

78. The method of claim 77, wherein the antibody to the marker of cilium, or secondary antibody are attached to a solid support.

79. The method of any one of claims 72-78, wherein the detecting is by enzyme-linked immunoassay (ELISA).

80. The method of any one of claims 72-78, wherein the detecting is by flow cytometry, optionally wherein the antibody to the marker of cilium, or secondary antibody are attached to beads.

81. The method of any one of claims 72-80, wherein the one or more markers of cilium is a ciliary marker or a basal body cilium marker, or a post-translational modification (PTM) of a protein associated with cilium.

82. The method of any one of claims 72-81, wherein the method further comprises detecting lower levels of a marker of cilium compared to control.

83. The method of any one of claims 72-82, wherein the method further comprises, administering a therapeutic to treat the traumatic brain injury.

84. The method of any of claims 1-12, 60-66, 70, and 71, wherein the marker of cilium is preferentially detected in plasma over serum.

Citation Information

Patent Citations

  • Cilia protein as biomarkers and methods of use

    WO2022246229A1