Methods and compositions for screening compounds useful in treating heart diseases
Zebrafish models are used to identify therapeutic agents for sodium channel-related heart diseases by administering candidate compounds to embryos with genetic disruptions, improving the effectiveness of disease modeling and compound screening.
Patent Information
- Application Number
- PCT/US2025/029882
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-16
- Filing Date
- 2025-05-16
- Publication Date
- 2025-11-20
AI Technical Summary
Current preclinical models are inadequate for effectively identifying and characterizing therapeutic agents that correct pathological electrophysiological phenotypes associated with sodium channel-related heart diseases, leading to a lack of effective treatments for conditions like Brugada syndrome, arrhythmogenic right ventricular cardiomyopathy, and other cardiac conduction disorders.
Utilizing zebrafish models and screens to identify therapeutic agents by administering candidate compounds to zebrafish embryos with genetic disruptions in sodium channel genes, monitoring for improvements in cardiac disease symptoms, and evaluating pharmacodynamic and pharmacokinetic profiles.
The method enhances the likelihood of identifying compounds that effectively treat cardiac diseases by providing a more comprehensive modeling of complex diseases and assessing potential adverse effects, increasing the probability of successful further testing.
Smart Images

Figure IMGF000029_0001 
Figure 00000058_0000 
Figure 00000059_0000
Abstract
Description
[0001]PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 METHODS AND COMPOSITIONS FOR SCREENING COMPOUNDS USEFUL IN TREATING HEART DISEASES Cross-Reference To Related Applications This application claims benefit of U.S. Provisional Application No.63 / 648,263, filed on May 16, 2024, the contents of which are incorporated herein by reference in their entirety. Statement as to Federally Funded Research This invention was made with government support under 5R24OD035402-02 awarded by the National Institute of Health (NIH). The government has certain rights in the invention. Sequence Listing The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on May 16, 2025, is named 51836-002WO2_Sequence_Listing_5_16_25 and is 7,978 bytes in size. Background of the Invention The invention relates to materials and methods useful for screening compounds that correct pathological electrophysiological phenotypes associated with sodium channel-related heart diseases. Sodium channel-related diseases, such as cardiac conduction disorders (CCDs) and arrhythmogenic cardiomyopathies (ACMs), are a key cause of morbidity and mortality throughout the world. Sodium-channel related diseases encompass a wide range of clinical conditions characterized by cardiac conduction abnormalities, including both acquired and hereditary forms, which can occur either alone or in association with structural heart abnormalities. The classic inherited form of sodium channel-related disease is Brugada syndrome (BrS), which is associated with loss-of-function variants in the SCN5A gene leading to decrease function of the main cardiac voltage-gated sodium channel NaV1.5. Besides BrS, other inherited forms of CCDs or ACMs include arrhythmogenic right ventricular cardiomyopathies (ARVCs) and LMNA-related cardiomyopathies which are caused by pathogenic variants in the LMNA gene. Together, CCDs and ACMs are marked by diminished sodium current (INa), cardiac conduction slowing, atrial fibrillation, heart failure, and / or lethal arrhythmias. Because there is no disease-modifying therapeutic to date, the mainstay treatment remains the implantable cardioverter-defibrillator or pacemaker, which is associated with significant adverse events. This innovation bottleneck may be attributed to the lack of a preclinical model that not only recapitulates human disease but is also suitable for empiric drug discovery. PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 Accordingly, there is a need in the art for methods aimed at identifying and characterizing therapeutic agents that correct pathological electrophysiological phenotypes associated with sodium channel-related heart diseases. Summary of the Invention The present disclosure relates to materials and methods for the identification of therapeutic agents that correct pathological electrophysiological phenotypes associated with sodium channel- related heart diseases that are difficult to identify with conventional preclinical models. Our zebrafish models and screens disclosed herein facilitate identification and characterization of therapeutic compounds for cardiac diseases in a whole organism, allowing for more comprehensive modeling of complex diseases, while simultaneously evaluating the pharmacodynamic and pharmacokinetic profiles, including potential adverse effects. Consequently, hits from such phenotype-based screens have a higher probability of passing further tests in other preclinical models for effectiveness, toxicity, and pharmacokinetic profile compared to compounds identified in target-based screens. In one aspect, the invention features a method of identifying a therapeutic agent for treating a cardiac disease, including: (a) administering a candidate therapeutic agent to a zebrafish or zebrafish embryo whose genome has a heterozygous or homozygous disruption in a gene encoding a cardiac voltage-gated sodium channel, where the zebrafish or zebrafish embryo has a sign of the cardiac disease, and (b) monitoring the zebrafish or zebrafish embryo for the sign of the cardiac disease, where detection of improvement in a sign of the cardiac disease indicates the identification of a therapeutic agent for treating the cardiac disease. In some embodiments, the gene is scn12ab or scn12aa. In another aspect, the invention features a method of identifying a therapeutic agent for treating a cardiac disease, including: (a) administering a candidate therapeutic agent to a zebrafish or zebrafish embryo whose genome includes a transgenic human JUP, where the zebrafish or zebrafish embryo has a sign of the cardiac disease, and (b) monitoring the zebrafish or zebrafish embryo for the sign of the cardiac disease, where detection of improvement in the sign of the cardiac disease indicates the identification of a therapeutic agent for treating the cardiac disease. In some embodiments, the JUP gene is a mutant JUP harboring a pathogenic variant associated with Naxos disease. In yet another aspect, the invention features a method of identifying a therapeutic agent for treating a cardiac disease, including: PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 (a) administering a candidate therapeutic agent to a zebrafish or zebrafish embryo whose genome has a heterozygous or homozygous disruption in lmna, where the zebrafish or zebrafish embryo has a sign of the cardiac disease, and (b) monitoring the zebrafish or zebrafish embryo for the sign of the cardiac disease, where detection of improvement in the sign of the cardiac disease indicates the identification of a therapeutic agent for treating the cardiac disease. In any of the aforementioned aspects and embodiments, the candidate therapeutic agent is administered to a zebrafish. Still further, in any of the aforementioned aspects and embodiments, the sign of the cardiac disease is a change in heart rate, maximal action potential upstroke velocity (maximum dV / dt or Vmax), action potential duration (APD), cardiac conduction velocity (CV), sodium current (INa), electrocardiogram (ECG) readout, or contractile function. In some embodiments, the Vmax, the APD, or the CV is the ventricular Vmax, the ventricular APD, or the ventricular CV. In still other embodiments, the ECG readout is heart rate, P wave duration, PR interval, QRS duration, or QTc interval. In still other embodiments, contractile function involves abnormalities of ventricular volumes, ejection fraction, myocardial shortening, or cardiac output. In any of the aforementioned aspects and embodiments, the cardiac disease is an SCN5A- related cardiac disease. In any of the aforementioned aspects and embodiments, the cardiac disease is a slowing in cardiac conduction or an arrhythmia. In any of the aforementioned aspects and embodiments, where the cardiac disease is a loss- of-function SCN5A channelopathy or a gain-of-function SCN5A channelopathy. In some embodiments, the SCN5A-related cardiac disease is Brugada syndrome (BrS), progressive cardiac conduction defect (PCCD), dilated cardiomyopathy (DCM), long-QT syndrome type 3 (LQT3), sudden infant death syndrome (SIDS), atrial fibrillation (AF), sick sinus syndrome (SSS), atrial standstill (AS), idiopathic ventricular fibrillation (IVF), and sudden infant death syndrome (SIDS); arrhythmogenic cardiomyopathy (ACM) including arrhythmogenic right ventricular cardiomyopathy (ARVC) and Naxos disease; or LMNA-related cardiomyopathy. In still other aforementioned aspects and embodiments, the cardiac disease includes a loss of sodium channel function. In still another aspect, the invention features a therapeutic agent identified by any of the aforementioned methods. PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 Accordingly, in some aspects, the invention features a method of treating a cardiac disease in an individual, including administering to the individual CX614, NCGC00189349-01, BMS265246, AZD1480, pelitinib, bosutinib, or a pharmaceutically acceptable salt thereof. Further, in some aspects, the invention features a method of altering the sodium current or heart rate in an individual, including administering to the individual CX614, NCGC00189349-01, BMS265246, AZD1480, pelitinib, bosutinib, or a pharmaceutically acceptable salt thereof. And in some aspects, the invention features a method of increasing cardiac voltage-gated sodium channel function in a target cell in an individual, including administering to the individual CX614, NCGC00189349-01, BMS265246, AZD1480, pelitinib, bosutinib, or a pharmaceutically acceptable salt thereof. In yet another aspect, the invention features a method of identifying an agent for increasing cardiac voltage-gated sodium channel function in a heart, including: (a) administering a candidate agent to a zebrafish or zebrafish embryo whose genome has a heterozygous or homozygous disruption in scn12ab, and (b) monitoring the zebrafish or zebrafish embryo for an increase in the cardiac voltage-gated sodium channel function in the heart of the zebrafish or zebrafish embryo. In another aspect, a method of identifying an agent for increasing cardiac voltage-gated sodium channel function in a heart, including: (a) administering a candidate agent to a zebrafish or zebrafish embryo whose genome has a transgenic expression of mutant human JUP encoding plakoglobin, and (b) monitoring the zebrafish or zebrafish embryo for an increase in the cardiac voltage-gated sodium channel function in the heart of the zebrafish or zebrafish embryo. In another aspect, a method of identifying an agent for increasing cardiac voltage gated sodium channel function in a heart, including: (a) administering a candidate agent to a zebrafish or zebrafish embryo whose genome has a heterozygous or homozygous disruption in lmna, and (b) monitoring the zebrafish or zebrafish embryo for an increase in the cardiac voltage-gated sodium channel function in the heart of the zebrafish or zebrafish embryo. In some embodiments for the identification of compounds for increasing cardiac voltage gated sodium channel, an increase in the cardiac voltage-gated sodium channel function is an increase in heart rate, maximal action potential upstroke velocity (maximum dV / dt or Vmax), cardiac conduction velocity (CV), or sodium current (INa). In some embodiments, the candidate therapeutic agent is administered to a zebrafish. In some embodiments, the candidate therapeutic agent is administered to a zebrafish embryo. PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 In some aspects, the therapeutic agent is identified by any of the aforementioned screening methods. In some aspect, the invention features a zebrafish whose genome includes a heterozygous or homozygous disruption in a gene encoding a cardiac voltage-gated sodium channel. In some embodiments, genome disruption includes a heterozygous or homozygous disruption in scn12ab. In some embodiments, the zebrafish does not include a genomic disruption in scn12aa. In some aspects, the invention features a zebrafish embryo whose genome includes a heterozygous or homozygous disruption in a gene encoding a cardiac voltage-gated sodium channel. In some embodiments, the genome disruption includes a heterozygous or homozygous disruption in scn12ab. In some embodiments, the genome disruption does not comprise a genomic disruption in scn12aa. In still another aspect, the invention features a method of editing scn12ab sequence in a zebrafish cell by introducing into the zebrafish cell guide a guide RNA including the nucleic acid sequence of CAATGCCAAACGCTACCAGG (SEQ ID NO: 1), GCAGCCATACTGTTTCCACC(SEQ ID NO: 2), AGGTCTGCGCGGGGTTTAGG (SEQ ID NO: 3), or GGGACGCCCACCAGTGCTGA (SEQ ID NO: 4), and an RNA-guided endonuclease, where the guide RNA forms a complex with the RNA- guided endonuclease and the endonuclease cleaves the zebrafish cell’s chromosomal DNA in a site- specific manner, thereby editing the scn12ab sequence in the zebrafish cell. In some embodiments, the RNA-guided endonuclease is a Cas9 protein or a Cas12 protein. In other aspects, the invention features a guide RNA molecule including the nucleic acid sequence of CAATGCCAAACGCTACCAGG (SEQ ID NO: 1), GCAGCCATACTGTTTCCACC (SEQ ID NO: 2), AGGTCTGCGCGGGGTTTAGG (SEQ ID NO: 3), GGGACGCCCACCAGTGCTGA (SEQ ID NO: 4). In some embodiments, the zebrafish cell including the guide RNA molecule and an RNA- guided endonuclease. In still some embodiments, the zebrafish cell of claim 36, where the RNA- guided endonuclease is a Cas9 protein or a Cas12 protein. In another aspect, the invention features a method of identifying a therapeutic agent for treating arrhythmogenic cardiomyopathy (ACM), including: (a) administering a candidate therapeutic agent to a zebrafish or zebrafish embryo whose genome has a heterozygous or homozygous disruption in a gene encoding a cardiac voltage-gated sodium channel, wherein the zebrafish or zebrafish embryo has a sign of ACM, and (b) monitoring the zebrafish or zebrafish embryo for the sign of ACM, where detection of improvement in a sign of ACM indicates the identification of a therapeutic agent for treating ACM. In some embodiments, the gene is scn12ab or scn12aa. PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 In another aspect, the invention features, a method of identifying a therapeutic agent for treating ACM, including: (a) administering a candidate therapeutic agent to a zebrafish or zebrafish embryo whose genome includes a transgenic human JUP, wherein the zebrafish or zebrafish embryo has a sign of ACM, and (b) monitoring the zebrafish or zebrafish embryo for the sign of ACM, where detection of improvement in the sign of ACM indicates the identification of a therapeutic agent for treating ACM. In some embodiments, the JUP gene is a mutant JUP harboring a pathogenic variant associated with Naxos disease. In another aspect, the invention features a method of identifying a therapeutic agent for treating ACM, including: (a) administering a candidate therapeutic agent to a zebrafish or zebrafish embryo whose genome has a heterozygous or homozygous disruption in lmna, wherein the zebrafish or zebrafish embryo has a sign of ACM, and (b) monitoring the zebrafish or zebrafish embryo for the sign of ACM, where detection of improvement in the sign of ACM indicates the identification of a therapeutic agent for treating ACM. Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims. Brief Description of the Figures The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application with color drawings will be provided by the Office upon request and payment of the necessary fee. FIG.1 shows generation of scn12ab knockout (KO) in zebrafish. A. Embryos from wild-type (WT) zebrafish crosses were injected with CRISPR / Cas9 reagents targeting exon 1 of scn12ab. Mosaic F0 fish were outcrossed to WT fish and resultant F1 fish were screened for desired germline mutations. Fish with the same alleles were in-crossed to generate experimental animals in expected Mendelian ratios. B. Western blot using adult ventricular lysates confirming KO of scn12ab (major isoform of the cardiac sodium channel) at the protein level. C. Quantification of Western blots showing a decrease in the protein level of scn12ab in heterozygous (HET) and homozygous (HOMO) KO hearts. One-way ANOVA (P=0.0005) was followed by Tukey's multiple comparisons test between the genotype groups (*P=0.0189, **P=0.0089, ***P=0.0004). D-F. Measurement of ventricular dimensions during maximum relaxation (diastole) in hearts isolated from 5 dpf larvae. There was a significant increase in ventricular area (D) and length (E) in the HOMO but not HET hearts. Ventricular width is shown in F. One-way ANOVA using Kruskal-Wallis test (Area: P=0.0329; Length: P=0.0036) was PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 followed by Dunn's multiple comparisons test between the genotype groups (Area: *P=0.0354; Length: **P=0.0051 WT vs. HOMO, **P=0.0097 HET vs. HOMO). Each circle represents one animal. FIG.2 shows scn12ab knockout (KO) recapitulates sodium channelopathy in a gene dosage- dependent manner. Hearts were isolated from 5 days post-fertilization sibling wild-type (WT), heterozygous (HET), and homozygous (HOMO) scn12ab KO zebrafish larvae and optically mapped using a voltage-sensitive dye. A. There was a gene-dosage dependent decrease in ventricular but not atrial conduction velocity (CV), as exemplified by the representative isochrone maps. One-way ANOVA (P<0.0001) was followed by Tukey's multiple comparisons test between the genotype groups (*P=0.0441, ***P=0.0002, ****P<0.0001). B. Similarly, there was a gene dosage-dependent decrease in both ventricular and atrial Vmax (maximum action potential upstroke velocity, dV / dt). One-way ANOVA (P<0.0001 for both ventricular and atrial Vmax) was followed by Tukey's multiple comparisons test between the genotype groups (ventricular: ***P=0.0003, ****P<0.0001; atrial: **P=0.0038,***P=0.0002, ****P<0.0001). C. There was only a significant increase in ventricular action potential duration (APD) between WT vs. HOMO but not atrial APD. One-way ANOVA (P=0.0209) was followed by Tukey's multiple comparisons test between the genotype groups (*P=0.0316). APD was measured at 80% repolarization while the hearts were paced at 100 bpm. The dotted squares in the isochrone maps in A reflect the main atrial and ventricular areas in the hearts from which the parameters were measured. Each circle represents one animal. FIG.3 shows scn12ab knockout (KO) leads to conduction slowing in adult fish. Two-lead surface ECG was performed in anesthetized fish from the scn12ab KO line. A. Representative averaged ECG tracings demonstrating similarity to human ECG with the notable exception of the inverted T wave. B. There was no significant difference in the length of the fish that underwent ECG measurement. C. There was a significant decrease in heart rate in both heterozygous (HET) and homozygous (HOMO) mutants compared to wild-type (WT) siblings. One-way ANOVA (P=0.0414) was followed by Tukey's multiple comparisons test (WT vs. HET:*P=0.0347; WT vs. HOMO: *P=0.0468). D-F. There was a significant increase in P-wave duration, PR interval, and QRS duration in the HOMO fish compared to WT and HET siblings. One-way ANOVA (P-wave duration: P<0.0001; PR interval: P=0.0006) was followed by Tukey's multiple comparisons test (*P=0.0212,***P=0.0008, ****P<0.0001). For QRS duration, Kruskal-Wallis test (P<0.0001) was followed by Dunn's multiple comparisons test (***P=0.0005, ****P<0.0001). G. There was a significant increase in QTc duration in the HOMO compared to WT siblings. One-way ANOVA (P=0.0307) was followed by Dunnett's multiple comparisons test (*P=0.0401). H-L. Ajmaline treatment of fish prior to ECG recording uncovered additional electrical phenotype in the HET fish compared to WT siblings. **P=0.0029 (t-test) for heart rate and *P=0.0346 (Mann Whitney test) for QRS duration. Each circle represents one fish. PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 FIG.4 shows scn12ab knockout (KO) leads to decreased Na+ current in a gene dosage- dependent manner. Average current voltage (I-V) relationships (A), dot plots of INa density at -20 mV (B), and representative current tracings (C) in wild-type (WT), heterozygous (HET) and homozygous (HOMO) scn12ab KO ventricular myocytes showing a gene dosage-dependent decrease of INa density in HET and HOMO cells. One-way ANOVA (P<0.0001) was followed by Tukey's multiple comparisons test (WT vs. HET: **P=0.0015; HET vs. HOMO: **P=0.0012; WT vs. HOMO: ****P<0.0001). Voltage-dependency of activation (D) and V1 / 2 (E) and k (F) of the Boltzmann fits of every cell measured. Solid lines are Boltzmann fits to the average data. V1 / 2 did not differ significantly but k was significantly increased in HOMO cells. One-way ANOVA (P=0.0007) was followed by Tukey's multiple comparisons test (**P=0.0086, ***P=0.0005). Voltage-dependency of inactivation (G) and V1 / 2 (H) and k (I) of the Boltzmann fits of every cell measured. Solid lines are Boltzmann fits to the average data. V1 / 2 did not differ significantly but k was significantly increased in HOMO cells. One- way ANOVA (P=0.0225) was followed by Tukey's multiple comparisons test (WT vs. HOMO: *P=0.0305; HET vs. HOMO: *P=0.0349). Numbers in brackets in A, D and G correspond to total numbers of cells from 4 WT, 2 HET and 2 HOMO fish. Circles in B, E, F, H, I represent individual cells. FIG.5 shows heart rate screens of compound libraries using scn12ab knockout (KO) embryos. A-D. Heart rate (HR) measurements by video microscopy of wild-type (WT), heterozygous (HET) and homozygous (HOMO) scn12ab KO embryos at 2- and 3-days post-fertilization (dpf) and 3 different temperatures. The timepoint of 2 dpf at 25 °C was ultimately chosen for establishing the screen. Each circle represents one animal. One-way ANOVA was followed by Tukey’s multiple comparisons tests: ANOVA P=0.0665 (A); ANOVA P<0.0001, ***P=0.0002, ****P<0.0001 (B); ANOVA P=0.0005, ***P=0.0004, *P=0.0278 (C); ANOVA P=0.0026, *P=0.0340, **P=0.0025 (D). Schematics of the first (E) and second (F) HR screens using scn12ab HOMO embryos treated with 1,280 (E) and 4,182 (F) compounds in quadruplicates (green wells were filled with equal volume of DMSO and blue wells were filled with equal volume of E3 medium). HR was analyzed semi-automatically using custom MATLAB scripts and primary screen hits are selected for secondary (confirmatory) screens. Lead candidates are followed up using voltage mapping of isolated hearts from 5 dpf scn12ab HET and HOMO embryos. Candidates that rescue the ventricular maximal upstroke velocity of action potential (Vmax) are further studied using patch clamping of isolated ventricular myocytes from adult scn12ab HET fish. FIG.6 Secondary screens confirming heart rate rescue by lead compounds in scn12ab embryos. Scn12ab homozygous KO (HOMO; A-F) and heterozygous KO (HET; G-K) embryos were treated with different lead compounds from 1 dpf to 2 dpf when their heartrates were measured by videography. Each circle represents 1 embryo. X=CX614, Y=NCGC00189349-01, B=BMS265246, Z=AZD1480, P=pelitinib, O=bosutinib. Concentration was 10 μM for all compounds except bosutinib PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 which was 5 μM. Unpaired t-test was used for all comparisons with DMSO treated controls. *P<0.05,**P<0.01, ***P<0.001. FIG.7 shows pharmacologic rescue of maximum action potential upstroke velocity (Vmax) in scn12ab knockout (KO) larvae. A-B. There was a significant rescue of ventricular conduction velocity (CV) in homozygous (HOMO) scn12ab KO hearts at 50 µM but not in heterozygous (HET) hearts. Representative isochrone maps are shown for HET hearts treated with DMSO vs.5 µM of the compound X. One-way ANOVA (P=0.0236 for HOMO) was followed by Dunnett's multiple comparisons test versus DMSO (*P=0.0146). C-D. There was a significant rescue of ventricular Vmax at both drug concentrations in both HOMO and HET hearts, as exemplified by the representative maps from the HET hearts. One-way ANOVA (HOMO: P=0.0008; HET: P<0.0001) was followed by Dunnett's multiple comparisons test versus DMSO (HOMO: *P=0.0276, ***P=0.0005; HET: ***P=0.0001 for 5 µM, ***P=0.0007 for 50 µM). E-F. There was a significant decrease in ventricular action potential duration (APD) at both drug concentrations in HOMO hearts and at 5 µM in HET hearts, as exemplified by the representative maps from the HET hearts. One-way ANOVA (HOMO: P=0.0005; HET: P=0.0045) was followed by Dunnett's multiple comparisons test versus DMSO (HOMO: *P=0.0107, ***P=0.0004; HET: **P=0.0026). APD was measured at 80% repolarization while the hearts were paced at 100 bpm. Hearts were isolated from 5 days post-fertilization (dpf) larvae. The dotted squares in the representative maps reflect the main ventricular areas in the hearts from which the parameters were measured. Each circle represents one animal. FIG.8 shows dose responses of CX614 (X) on scn12ab HOMO (A) and HET (B) ventricular Vmax. Each data point consists of 8-11 hearts for HOMO (A) and 5-8 hearts for HET (B). Drug treatment was done overnight from 4 dpf to 5 dpf when the hearts were isolated for optical mapping. FIG.9 shows rescue of maximal upstroke velocity of action potential (Vmax) by NCGC00189349-01 (Y) in scn12ab heterozygous (HET) knockout (KO) larvae. A-B. There was a significant rescue of ventricular conduction velocity (CV) in scn12ab HET KO hearts at 10 μM but not at 5 μM. C-D. There was a trend towards improving atrial CV with Y treatment but no statistical significance. E-F. There was a significant rescue of ventricular Vmax at both drug concentrations in HET hearts and a nonsignificant trend in the atria (G-H). I-J. There was a significant decrease of ventricular action potential duration (APD) at 10 μM but not at 5 μM, and a nonsignificant trend in the atria (K-L). APD was measured at 80% repolarization while the hearts were paced at 100 bpm. Hearts were isolated from 5 days post-fertilization (dpf) larvae treated by the compound overnight. Each circle represents one heart. Unpaired student t-test was used for all comparisons with DMSO treated hearts. *P<0.05, ****P<0.0001. FIG.10 shows rescue of maximal upstroke velocity of action potential (Vmax) by BMS265246 (B) and pelitinib (P) in scn12ab homozygous (HOMO) knockout (KO) larvae. A-B. There was trend towards increasing ventricular and atrial conduction velocity (CV) in scn12ab HOMO KO hearts with PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 both drugs. C. There was a trend towards improving ventricular CV with the drugs but no statistical significance. D. There was a significant rescue of atrial Vmax with B at 500 nM and P at 5 μM. One-way ANOVA (P=0.0109) was followed by Dunnett’s multiple comparisons test versus DMSO (B at 500 nM: *P=0.0192; P at 5 μM: *P=0.0109). E-F. There was a significant increase of ventricular action potential duration (APD) with drug P at 5 μM only. One-way ANOVA (P=0.0154) was followed by Dunnett’s multiple comparisons test versus DMSO (P at 5 μM: *P=0.0266). APD was measured at 80% repolarization while the hearts were paced at 100 bpm. Hearts were isolated from 5 days post- fertilization (dpf) larvae treated by the compounds overnight. Each circle represents one heart. FIG.11 shows rescue of maximal upstroke velocity of action potential (Vmax) by AZD1480 (Z) in scn12ab homozygous (HOMO) knockout (KO) larvae. A-B. There was a significant rescue of ventricular conduction velocity (CV) in scn12ab HOMO KO hearts with drug Z at 50 μM. One-way ANOVA (P=0.0187) was followed by Dunnett’s multiple comparisons test versus DMSO (Z at 50 μM: *P=0.0138). C-D. There was a significant rescue of ventricular Vmax with drug Z at 50 μM. One-way ANOVA (P=0.0319) was followed by Dunnett’s multiple comparisons test versus DMSO (Z at 50 μM: *P=0.0347). E-F. There was a significant increase of atrial action potential duration (APD) with drug Z at 50 μM. One-way ANOVA (P=0.0424) was followed by Dunnett’s multiple comparisons test versus DMSO (Z at 50 μM: *P=0.0244). APD was measured at 80% repolarization while the hearts were paced at 100 bpm. Hearts were isolated from 5 days post-fertilization (dpf) larvae treated by the compound overnight. Each circle represents one heart. FIG.12 shows rescue of maximal upstroke velocity of action potential (Vmax) by bosutinib (O) in scn12ab homozygous (HOMO) knockout (KO) larvae. A-B. There was a trend toward improvement of ventricular conduction velocity (CV) in scn12ab HOMO KO hearts with drug O at 50 µM but it was not statistically significant. C-D. There was a significant rescue of ventricular Vmax with drug O at 50 µM. One-way ANOVA (P=0.0020) was followed by Dunnett’s multiple comparisons test versus DMSO (O at 50 µM: ***P=0.0009). Hearts were isolated from 5 days post-fertilization (dpf) larvae treated by the compound overnight. Each circle represents one heart. FIG.13 shows pharmacological rescue of sodium current (INa) in scn12ab knockout (KO) ventricular myocytes. Average current voltage (I-V) relationships (A), dot plots of INa density at -20 mV (B), and representative current tracings (C) in heterozygous (HET) scn12ab KO ventricular myocytes treated with DMSO vs.1 µM of CX614, showing a differential effect of CX614 on the cells (small vs. large). One-way ANOVA (P<0.0001) was followed by Tukey's multiple comparisons test (****P<0.0001) . Voltage-dependency of activation (D), V1 / 2 (E) and k (F) of the Boltzmann fits of every cell measured. Solid lines are Boltzmann fits to the average data. V1 / 2 did not differ significantly but k was significantly decreased in the 1 µM, large responder group. One-way ANOVA (P<0.0001) was followed by Tukey's multiple comparisons test (**P=0.0013, ****P<0.0001). Voltage-dependency of inactivation (G), V1 / 2 (H) and k (I) of the Boltzmann fits of every cell measured. Solid lines are PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 Boltzmann fits to the average data. V1 / 2 did not differ significantly but k was significantly decreased in the 1 µM, large responder group. One-way ANOVA (P<0.0001) was followed by Tukey's multiple comparisons test (***P<0.0001). Numbers in brackets in A, D and G correspond to total numbers of cells from 4 HET fish. Circles in B, E, F, H, I represent individual cells. FIG.14 shows rescue of heart rate by lead compounds in Naxos ARVC zebrafish model. A. Transgenic zebrafish embryos with either wild-type human plakoglobin (PgWT) or mutant plakoglobin (Naxos) modeling arrhythmogenic right ventricular cardiomyopathy (ARVC) were treated with DMSO vs. X (CX614) from 1 dpf to 2 dpf. Heart rate measurement by videography showed that the slower heart rates of Naxos embryos were rescued by X. One-way ANOVA (P<0.0001) was followed by Tukey’s multiple comparisons test (**P=0.0079; ****P<0.0001). B-D. Heart rate of Naxos embryos were rescued by lead compounds Y (NCGC00189349-01), B (BMS265246), and Z (AZD1480). Unpaired t-test used for comparison with DMSO treated embryos. *P<0.05, **P<0.01, ****P<0.0001. Each circle represents 1 embryo. Concentration was 10 μM for all compounds. FIG.15 shows rescue of maximal upstroke velocity of action potential (Vmax) by CX614 (X) in Naxos larvae. Transgenic zebrafish embryos with either wild-type human plakoglobin (PgWT) or mutant plakoglobin (Naxos) modeling arrhythmogenic right ventricular cardiomyopathy (ARVC) were treated with DMSO vs. X (CX614). A. Treatment with X abolishes the significant difference in ventricular conduction velocity (CV) between PgWT and Naxos hearts. Representative isochrone maps are shown. One-way ANOVA (P=0.0122) was followed by Šidák multiple comparisons test (*P=0.0441). B. There was a significant rescue of ventricular Vmax in Naxos hearts. One-way ANOVA (P=0.0005) was followed by Šidák multiple comparisons test (PgWT DMSO vs. Naxos DMSO: *P=0.0436; Naxos DMSO vs. Naxos X: *P=0.0261). C. There was a trend towards decreasing ventricular action potential duration (APD) in both PgWT and Naxos hearts but without statistical significance. APD was measured at 80% repolarization while the hearts were paced at 100 bpm. Hearts were isolated from 5 days post-fertilization (dpf) larvae treated overnight with DMSO or X at 5 µM. The dotted squares in the representative maps reflect the main ventricular areas in the hearts from which the parameters were measured. Each circle represents one heart. FIG.16 shows rescue of maximal upstroke velocity of action potential (Vmax) by NCGC00189349-01 (Y) and BMS265246 (B) in Naxos larvae. A-B. There was a trend towards improvement of ventricular conduction velocity (CV) in Naxos hearts with Y and B treatment but without statistical significance. C-D. There was a significant rescue of ventricular Vmax in Naxos hearts by both Y and B. E-F. There was a significant decrease in ventricular action potential duration (APD) in Naxos hearts with compound B but not compound Y. APD was measured at 80% repolarization while the hearts were paced at 100 bpm. Hearts were isolated from 5 days post-fertilization (dpf) larvae treated overnight with DMSO vs. Y or B at 10 µM. Each circle represents one heart. Student’s unpaired t-test was used for comparison with DMSO treated larvae. **P<0.01, ***P<0.001. PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 FIG.17 shows rescue of heart rate by lead compounds in laminopathy zebrafish model. Zebrafish embryos with lmna heterozygous (HET) knockout (KO) modeling laminopathy were treated with DMSO vs. X (CX614), Y (NCGC00189349-01), B (BMS265246), or Z (AZD1480) from 1 dpf to 2 dpf. A-D. Measurement of heart rate by videography showed that the slower heart rates of lmna HET embryos were rescued by all four compounds. Unpaired t-test was used for comparison with DMSO treated embryos. *P<0.05. Each circle represents 1 embryo. Concentration was 5 µM for compound X and 10 µM for compounds Y, Z, and B. FIG.18 shows rescue of maximal upstroke velocity of action potential (Vmax) by CX614 (X) in lmna HET larvae. A. There was a trend towards improvement of ventricular conduction velocity (CV) in lmna HET hearts with X but without statistical significance. B. There was a significant rescue of ventricular Vmax in lmna HET hearts by X. C. There was no significant change in ventricular action potential duration (APD) in lmna HET hearts with X. APD was measured at 80% repolarization while the hearts were paced at 100 bpm. Hearts were isolated from 5 days post-fertilization (dpf) larvae treated overnight with DMSO vs. X at 5 µM. Each circle represents one heart. Student’s t-test was used for comparison with DMSO treated larvae. **P<0.01. FIG.19 shows rescue of maximal upstroke velocity of action potential (Vmax) by NCGC00189349-01 (Y) and BMS265246 (B) in lmna HET larvae. A-B. There was a trend towards improvement of ventricular conduction velocity (CV) in lmna HET hearts with Y but not B. C-D. There was a significant rescue of ventricular Vmax in lmna HET hearts by both Y and B. E-F. There was a significant decrease in ventricular action potential duration (APD) in lmna HET hearts with both Y and B. APD was measured at 80% repolarization while the hearts were paced at 100 bpm. Heart were isolated from 5 days post-fertilization (dpf) larvae treated overnight with DMSO vs. Y or B at 10 µM. Each circle represents one heart. Student’s t-test was used for comparison with DMSO treated larvae. *P<0.05, ***P<0.001. FIG.20 shows rescue of sodium current (INa) by CX614 (X) in lmna heterozygous (HET) knockout (KO) ventricular myocytes. Average current voltage (I-V) relationships (A), dot plots of INa density at -20 mV (B), and representative current tracings (C) in heterozygous (HET) lmna KO ventricular myocytes treated with DMSO vs.5 µM of CX614, showing a significant increase of INa. Voltage-dependency of activation (D), V1 / 2 (E) and k (F) of the Boltzmann fits of every cell measured. Solid lines are Boltzmann fits to the average data. V1 / 2 and k were both significantly decreased with X treatment, suggesting earlier activation. Voltage-dependency of inactivation (G), V1 / 2 (H) and k (I) of the Boltzmann fits of every cell measured. Solid lines are Boltzmann fits to the average data. V1 / 2 and k did not differ significantly with X treatment. Numbers in brackets in A, D and G correspond to total numbers of cells from 3 lmna HET fish. Cells were treated with DMSO or compound X in culture media overnight after isolation. Circles in B, E, F, H, I represent individual cells. Student’s t-test was used for comparison with DMSO treated cells. *P<0.05. PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 FIG.21 shows CX614 (X) regularizes action potentials in lmna HET ventricular myocytes. Isolated ventricular myocytes from lmna heterozygous (HET) knockout (KO) fish modeling laminopathy were treated overnight with DMSO vs. CX614 at 5 µM before patch clamp. A. Representative voltage tracings recorded during current clamp (I=0) showing regularization of action potentials (consistent R-R interval without evidence of early depolarization) in cells treated with CX614. B. Summary data showing a significant improvement in the regularization of actional potentials with CX614 treatment. Cells were treated with DMSO or compound X in culture media overnight after isolation. Data were collected independently from 3 lmna HET fish. Chi-square test: *P<0.05. FIG.22 shows heart rate screen of compound library using lmna HET KO embryos. Schematics of the improved heart rate screen using lmna HET embryos treated in quadruplicates with compounds from a compound library with 4,182 compounds. Green wells were filled with equal volume of DMSO. Videos were recorded at 2X objective and heart rate was automatically extracted from the videos using custom machine learning algorithms. So far 800 compounds had been screened and 11 compounds which increased the heart rate by at least 10% were chosen for secondary (confirmatory) screens. Lead candidates will be followed up using voltage mapping of isolated hearts from 5 dpf lmna HET embryos. Candidates that rescue the ventricular maximal upstroke velocity of action potential (Vmax), APD, and / or conduction velocity (CV) will be further studied using patch clamp of isolated ventricular myocytes from adult lmna HET fish. Definitions The term “sign” as used herein refers to an observable and / or quantifiable indicator or phenomenon, e.g., of the presence of an indication, e.g., of the presence of a cardiac disease. In some instances, a sign may be a phenotype associated with the indication, e.g., the cardiac disease. In some instances, a sign may be a symptom associated with the indication, e.g., the cardiac disease. In some instances, a sign of a cardiac disease may be a change (e.g., an increase or a decrease) in heart rate, a maximal action potential upstroke velocity (maximum dV / dt or Vmax), an action potential duration (APD), a cardiac conduction velocity (CV), a sodium current (INa) or an electrocardiogram (ECG) readout. In some instances, a sign may be a measure (increase or decrease) of the heart’s contractile function, diastolic or systolic volumes, ejection fraction, or cardiac output. In some instances, the ECG readout is heart rate, P wave duration, PR interval, QRS duration, or QTc interval. In some instances, any of the values described above may be an atrial, atrioventricular, or ventricular value thereof. As used herein, “CX614” or “CX-614” refers to an ampakine compound, i.e., 2,3,6a,7,8,9- Hexahydro-11H-1,4-dioxino[2,3-g]pyrrolo[2,1-b][1,3]benzoxazin-11-one. CX614 has the Chemical Abstracts Service (CAS) number 191744-13-5; formula C13H13NO4, and molar mass of 247.25 g / mol. PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 As used herein, “NCGC00189349-01” refers to a compound having a National Chemical Genomics Center (NCGC) identification number of 00189349-01. NCGC00189349-01 has a PubChem CID number of 45203599, formula C22H18FN5O, and molar mass of 387.4 g / mol. As used herein, “BMS265246” or “BMS-265246” refers to a cyclin-dependent kinase (CDK) 1 / 2 inhibitor, i.e., 4-Butoxy-1H-pyrazolo[3,4-b]pyridin-5-yl) (2,6-difluoro-4-methylphenyl)methanone. BMS265246 has the CAS number 582315-72-8, formula C18H17F2N3O2, and molar mass of 345.34 g / mol. As used herein, “AZD1480” or “AZD-1480” refers to a JAK inhibitor compound, i.e., (S)-5- Chloro-N2-(1-(5-fluoropyrimidin-2-yl)ethyl)-N4-(5-methyl-1H-pyrazol-3-yl)pyrimidine-2,4-diamine, 5- Chloro-N2-[(1S)-1-(5-fluoro-2-pyrimidinyl)ethyl]-N4-(5-methyl-1H-pyrazol-3-yl)-2,4-pyrimidinediamine. AZD1480 has the CAS number 935666-88-9, formula C14H14ClFN8, and molar mass 348.77 g / mol. As used herein, “pelitinib” refers to an epidermal growth factor receptor (EGFR) inhibitor compound, i.e., (2E)-N-[4-[(3-Chloro-4-fluorophenyl)amino]-3-cyano-7-ethoxy-6-quinolinyl]-4- (dimethylamino)-2-butenamide. Pelitinib may also be referred to as EKB569, EKB-569, or WAY-EKB- 569. Pelitinib has the CAS number 257933-82-7, formula C24H23ClFN5O2, and molar mass 467.92 g / mol. As used herein, “bosutinib” refers to a tyrosine kinase inhibitor (TKI) compound, i.e., 4-[(2,4- Dichloro-5-methoxyphenyl)amino]-6-methoxy-7-[3-(4-methyl-1-piperazinyl)propoxy]-3- quinolinecarbonitrile. Bosutinib is sold under the name “Bosulif.” Bosutinib may also be referred to as SKI-606 or WAY-173606. Bosutinib has the CAS number 380843-75-4, formula C26H29Cl2N5O3, and molar mass 530.45 g / mol. Detailed Description of the Invention The present disclosure relates to materials and methods for the identification of therapeutic agents that correct pathological electrophysiological phenotypes associated with sodium channel- related heart diseases. This invention offers several key advantages over traditional models. First, the zebrafish cardiac electrophysiology is strikingly similar to that of human, especially in comparison with rodent models, due to the high degree of conservation between zebrafish and human in cardiac ion channel genes. Relatedly, zebrafish heart rates are 120-130 beats per minute (bpm) in adults at 28 °C and 120-150 bpm in 2-3 dpf embryos at 25 °C. These similarities are described in the art e.g., in van Opbergen CJM, et al. “Cardiac Ca2+ signaling in zebrafish: Translation of findings to man.” Prog. Biophys. Mol. Biol.2018;138:45-58, the disclosure of which is incorporated herein by reference. Second, zebrafish embryogenesis proceeds rapidly; the zebrafish heart undergoes rapid development starting around 5 hours post-fertilization (hpf) and is functional by 18 hpf, compared to 12 days post- fertilization (dpf) in mice and 35 dpf in humans, as described in Bakkers J. “Zebrafish as a model to study cardiac development and human cardiac disease.” Cardiovasc. Res.2011;91:279-288, the PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 disclosure of which is incorporated herein by reference. This allows for rapid identification and characterization of relevant cardiac phenotype, as we have shown here for heart rate (HR) at 2 dpf (FIG.5A-C), and conduction velocity (CV) and maximal upstroke velocity of the action potential (Vmax) at 5 dpf (FIG.2). Third, zebrafish eggs are fertilized externally, giving easy access both to genetic manipulation, for example, via injection of CRISPR / Cas9 reagents, and phenotyping platforms, such as cardiac videography, which allows for phenotypic screens rather than target-based screens as discussed above (FIG.5). In addition, our loss-of-function sodium channelopathy zebrafish model where the major SCN5A homolog scn12ab is genetically ablated is viable and fertile due to genetic compensation from a minor isoform of the cardiac sodium channel encoded by scn12aa. Altogether, these characteristics make the scn12ab zebrafish model suitable for in vivo high-throughput drug discovery, as we have demonstrated in this disclosure. The in vivo screens disclosed herein facilitate the study of therapeutic compounds on a particular disease in the whole zebrafish organism, which allows for more comprehensive modeling of complex diseases, while simultaneously evaluating the pharmacodynamic and pharmacokinetic profiles, including potential adverse effects. Consequently, hits from phenotype-based screens have a higher probability of passing further tests in other preclinical models for effectiveness, toxicity, and pharmacokinetic profile compared to compounds identified in target-based screens. Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims. The in vivo screens disclosed herein may be used to identify therapeutic compounds useful in treating sodium channel-related disorders, which include cardiac conduction disorders and arrhythmogenic cardiomyopathies (ACMs). Cardiac conduction disorders are also referred to as interchangeably as “conduction disorders” and “CCDs”. Cardiac conduction disorders refer to any cardiac condition characterized the disruption of electrical impulses that regular the heartbeat. CCDs encompass a wide range of clinical conditions characterized by cardiac conduction abnormalities, including both acquired and hereditary forms, which can occur either alone or in association with structural heart abnormalities. CCDs and ACMs lead to a variety of symptoms, including but not limited to, arrhythmias (where the heart beats too fast, too slow, or irregularly), palpitations, dizziness, lightheadedness, shortness of breath, fatigue, chest pain, syncope, blood clots, stroke, cardiac arrest, heart failure and death. The classic inherited form of sodium channel-related disorder is Brugada syndrome (BrS), which is associated with loss-of-function variants in the SCN5A gene leading to decrease function of the main cardiac voltage-gated sodium channel NaV1.5. Besides BrS, pathogenic variants in SCN5A are also associated with long-QT syndrome type 3 (LQT3), progressive cardiac conduction disease (PCCD), sick sinus syndrome (SSS), atrial fibrillation (AF), atrial standstill, dilated cardiomyopathy (DCM) with conduction disease, idiopathic ventricular fibrillation (IVF) and sudden infant death PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 syndrome (SIDS). Other sodium channel-related disorders include arrhythmogenic cardiomyopathies (ACMs) which encompasses arrhythmogenic right ventricular cardiomyopathies (ARVCs) and LMNA- related cardiomyopathies which are caused by pathogenic variants in the LMNA gene. Together, CCDs and ACMs are marked by diminished sodium current (INa), cardiac conduction slowing, heart failure and / or lethal arrhythmias. Because there is no disease-modifying therapeutic to date, the mainstay treatment remains the implantable cardioverter-defibrillator or pacemaker, which are associated with significant adverse events, need for frequent replacement when implanted in younger patients, emotional stress from fear of being shocked, and inequitable access, as described in e.g., Schwartz PJ, et al. “Inherited cardiac arrhythmias.” Nat. Rev. Dis. Prim.2020; 6(1):58, the disclosure of which is incorporated herein by reference. Although BrS itself is a rare disease, its pathogenesis is strongly associated with ventricular conduction slowing and may be conceptualized as a disease entity at the extreme end of the conduction slowing spectrum as described in e.g., Meregalli PG, et al. “Pathophysiological mechanisms of Brugada syndrome: Depolarization disorder, repolarization disorder, or more?” Cardiovasc. Res.2005; 67:367-378, the contents of which are incorporated herein by reference. Slowed conduction is a critical mediator of re-entry based ventricular arrhythmias including those associated with myocardial ischemia and heart failure. However, our understanding of the genetic and molecular underpinnings of conduction slowing remains rudimentary, which hinders breakthroughs in development of diagnostic, risk- stratification and therapeutic strategies for sudden cardiac deaths in these disorders. Existing preclinical models are limited by the inability to screen in vivo, underlying differences in cardiac electrophysiology (mouse models and cell models), limited genetic tractability and cost (large animal models), and / or suitability for high-throughput drug discovery (all animal models). In contrast to lower model organisms such as flies, worms, and yeast, zebrafish is a fully representative vertebrate which shares well-conserved genetic pathways with human, including those that govern cardiovascular development. Besides the fact that their externally fertilized eggs give easy access to genetic manipulation, the zebrafish cardiac action potential (AP) is strikingly similar to that of human, especially when compared to mouse, the most used organism in cardiac electrophysiology research. This is due to the high degree of conservation between zebrafish and human in cardiac ion channel genes, such as the SCN5A orthologs scn12aa (minor isoform) and scn12ab (major isoform). Furthermore, their high fecundity and rapid development observable under light microscopy make them suitable for high-throughput phenotypic screens. Drug discovery over the past few decades has largely focused on target-based strategies, which are usually executed by in vitro assays designed to look for small molecules with biological activity on a specific target. However, many biological processes and especially complex diseases cannot be faithfully reproduced in biochemical assays or even in cultured cells resulting in failure PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 when lead compounds are tested in model organisms. By contrast, in vivo phenotype-based screens are designed to study the effects of small molecules on a particular disease orthologous endpoint in the whole organism, which allows for 1) more faithful modeling of complex multi-cellular, multi-tissue diseases, 2) discovery of molecules that produce therapeutic effects through activity at multiple targets simultaneously (e.g. the anti-arrhythmic drug amiodarone), and 3) simultaneous evaluation of the pharmacodynamic and pharmacokinetic profiles as well as adverse or toxic effects. Consequently, hits from phenotype-based screens have a higher probability of passing further tests in other models for effectiveness, toxicity, and pharmacokinetic profile compared to compounds identified in target- based screens. Despite these advantages, however, the cost and lack of scalability of phenotypic screens led to the dominance of target-based approaches. This invention involves the development of zebrafish models of sodium channel-related cardiac disorders which result from pathogenic variants in the sodium channel genes or other causes of aberrant gene regulation, protein processing, or trafficking of sodium channels to and from the cell membrane. These models were utilized in chemical screens for therapeutic compounds capable of rescuing conduction abnormalities in these disorders without concomitant toxicity. We identified multiple small molecules which rescue these zebrafish models and may also be able to rescue human cell-based models of these same diseases. These compounds can prevent cardiac arrhythmias or cardiomyopathies by rescuing the sodium channel defect at the cell membrane. These disorders are among the most common inherited forms of arrhythmia and cardiomyopathy, but the underlying mechanisms also contribute to acquired forms of atrial fibrillation, conduction disease, ventricular arrhythmia, and heart failure. Cardiac conduction disorders (CCDs) and Arrhythmogenic Cardiomyopathies (ACMs) CCDs and ACMs include SCN5A-related cardiac diseases including, but not limited to, Brugada syndrome (BrS), progressive cardiac conduction defect (PCCD), dilated cardiomyopathy (DCM), long-QT syndrome type 3 (LQT3), sudden infant death syndrome (SIDS), atrial fibrillation (AF), sick sinus syndrome (SSS), atrial standstill (AS), idiopathic ventricular fibrillation (IVF), Naxos disease, arrhythmogenic cardiomyopathy (ACM) including arrhythmogenic right ventricular cardiomyopathy (ARVC), and LMNA-related cardiomyopathy. Loss-of-function SCN5A channelopathies are a group of cardiac disorders stemming from pathogenic variants in the SCN5A gene, leading to decrease function of the main cardiac sodium channel NaV1.5. The most prominent entity among this group is Brugada syndrome (BrS), which is characterized by decreased sodium current (INa) at the sarcolemma of cardiomyocytes, slowed ventricular conduction, and lethal arrhythmias. Long-QT syndrome type 3 (LQT3) is a genetic disorder caused by gain of function in the SCN5A-encoded NaV1.5 sodium channel resulting in a pathological increase in late sodium current, a PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 pathological increase in the window current, or both. This results in prolonged QT interval on the ECG and is associated with bradycardia, first-degree AV block, bundle branch block, conduction disease, atrial fibrillation, and ventricular arrhythmias particularly Torsades de Pointes. Other sodium channel-related disorders are caused by mutations in other pathways which result in reduced sodium channel number or function at the membrane. For example, LMNA-related cardiomyopathy is an inherited heart disease caused by pathogenic variants in the LMNA gene, which encodes for lamin A and lamin C. It is characterized by left ventricular enlargement and impaired systolic function associated with conduction defects and ventricular arrhythmias. The disease accounts for 10% of dilated cardiomyopathy (DCM) cases. LMNA-related cardiomyopathies have heterogeneous clinical manifestations, ranging from mild-to-moderate left ventricular dilatation to highly pro-arrhythmic profiles with sudden cardiac death as the first manifestation of disease. Another exemplar ACM is Naxos disease, which is an autosomal recessive cardiocutaneous syndrome characterized by arrhythmogenic right ventricular cardiomyopathy (ARVC), woolly hair, and palmoplantar keratoderma. Naxos disease may result from pathogenic variants in two causative genes both of which encode proteins involved in cell-cell adhesion: 1) a 2-base-pair deletion in the JUP gene encoding plakoglobin (c.2157delTG) truncating the C-terminal of the protein, and 2) a 1- base-pair deletion in the DSP gene encoding desmoplakin (c.7901delG) truncating the C-terminal of the protein. By adolescence, patients with Naxos disease develop electrocardiographic and / or echocardiographic abnormalities, fulfilling the criteria for arrhythmogenic right ventricular cardiomyopathy (ARVC). Naxos disease, and ARVC more generally, can cause ventricular tachyarrhythmias and increased risk of sudden death. Cardiac and Electrophysiology Assessments Zebrafish is an emerging model for studying cardiac diseases, as described in Bakkers J. “Zebrafish as a model to study cardiac development and human cardiac disease.” Cardiovasc. Res. 2011;91:279-288, including cardiac arrhythmia, and for determining the pathogenicity of candidate genes found on genome-wide association studies (GWASs) or whole-exome sequencing (WES) or whole-genome sequencing (WGS). Sequencing of the zebrafish genome has revealed that approximately 70% of human genes have at least one homolog in zebrafish as described in Howe K, Clark MD, Torroja CF, Torrance J, Berthelot C, Muffato M, Collins JE, Humphray S, McLaren K, Matthews L, et al. “The zebrafish reference genome sequence and its relationship to the human genome.” Nature.2013;496:498–503, the contents of which are incorporated herein by reference. Moreover, CRISPR / Cas9-mediated gene knock-out or traditional transgenesis in zebrafish can create genetic models that faithfully recapitulate human diseases, including cardiac diseases. These models may then be used for high-throughput phenotypic screens for therapeutic compounds. Hits from such screens can then be validated and further studied in zebrafish using a variety of cardiac and PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 electrophysiological techniques which we and others have developed. These include cardiac videography of embryonic and larval zebrafish, optical voltage mapping of whole isolated hearts, ECG measurement of adult fish, and patch clamping of isolated cardiomyocytes. Zebrafish Genetic Disease Models RNA-guided endonuclease includes any programmable endonucleases that can be used to perform targeted genome editing. RNA-guided endonucleases are exemplified by naturally occurring Type II CRISPR-Cas systems. In a target organism or cell, such as a human or zebrafish, RNA- guided endonucleases can make a target double-stranded break, which, with the addition of a DNA donor template, can be used to introduce a gene knock-in through homology directed repair (HDR), or can result in a genetic knock-out through non-homologous end joining (NHEJ). Zebrafish genome may be edited with CRISPR / Cas9 to evaluate gene variants relating to sodium channel-related cardiac disorders, such as Brugada syndrome, Naxos disease (a form of ARVC), and LMNA-related cardiomyopathy. An exemplary method to make a scn12ab zebrafish involves introducing into the zebrafish cell guide a guide RNA comprising the nucleic acid sequence of CAATGCCAAACGCTACCAGG (SEQ ID NO: 1), GCAGCCATACTGTTTCCACC (SEQ ID NO: 2), AGGTCTGCGCGGGGTTTAGG (SEQ ID NO: 3), or GGGACGCCCACCAGTGCTGA (SEQ ID NO: 4), and an RNA-guided endonuclease, where the guide RNA forms a complex with the RNA-guided endonuclease and the endonuclease cleaves the zebrafish cell’s chromosomal DNA in a site-specific manner, thereby editing the scn12ab sequence in the zebrafish cell. Exemplary genetic models include zebrafish or zebrafish embryos whose genomes have a heterozygous or homozygous disruption in scn12ab or lmna. The target site for editing in zebrafish may be selected using CRISPR guide selection tools, such as the CHOPCHOP webtool, which ranks target sites based on potential off-target effects and calculated editing efficiencies. Single guide (sg) RNA may be generated by in vitro transcription from oligonucleotide-based templates with commercial in vitro transcription kits or ordered directly from a commercial source such as Integrated DNA Technologies. DNA double-strand breaks (DSBs) introduced by CRISPR / Cas at the target site can be repaired through error-prone nonhomologous end-joining (NHEJ) pathway. The DSB repair by NHEJ generates indel mutations, which can cause frame shift and then abolish gene function if the mutations occur in an exon. sgRNA is typically combined in small molar excess of recombinant Cas9 protein (e.g., 1.1, 1.25, 1.5, 2.0 sgRNA molecules per molecule of recombinant Cas9) then incubated for approximately 5 min to allow formation of the sgRNA / Cas9 complex. This sgRNA / Cas9 injection mix can be injected intracellularly or into the yolk of one-cell stage zebrafish embryos by using glass needles and a micromanipulator. Injected zebrafish embryos may be maintained in E3 water at 28°C. PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 Mosaic founders (F0) were raised and outcrossed to a wild-type (WT) line after the age of 3 months. Sequencing analysis of F1 fish after outcross was performed in adult fish, and various truncating indels of relevant genes were confirmed using Sanger sequencing. Heterozygous F1 generation fish were sequenced to identify those with the same mutations and without having plausible off-targets which were determined by using a guide RNA design checker. Fish with the same mutations (or allele variants) were in-crossed, and cardiac phenotypes for F2 embryos may be evaluated as described below. Each F2 zebrafish or zebrafish embryo can be genotyped after evaluation of the cardiac phenotype to distinguish between zebrafish or zebrafish embryos with heterozygous or homozygous genomic disruptions, e.g., heterozygous and homozygous mutants. Cardiac phenotypes may be scored as early as 48-hours post fertilization (hpf), and genomic DNA may be taken from individuals for Sanger sequencing. The heart rate may be visually counted at 48 hpf using a stereomicroscope. Cardiac function may be evaluated at 48 hpf by using video microscopy with an upright microscope. Dissected hearts may be stained with FluoVolt (Thermo Fisher Scientific Inc., Waltham, MA, USA) and immobilized with commercially obtained Blebbistatin or Cytochalasin D for the measurement of membrane voltage changes using optical mapping. Adult fish can be anesthetized and immobilized for surface ECG and echocardiography measurements. Hearts may be explanted from adult fish and digested to isolate individual cardiomyocytes for culture, biochemistry, and patch clamp. Patch clamp Patch clamp refers to a laboratory technique used to make electrophysiological measurements of ionic currents or membrane voltage changes in individual isolated living cells or tissue sections. Measurements can be made on single ventricular cardiomyocytes from zebrafish which can be isolated using methods known in the art, such as by enzymatic dissociation as described e.g., in Sander V, et al. “Isolation and in vitro culture of primary cardiomyocytes from adult zebrafish hearts.” Nat. Protoc.2013;8:800-809, the disclosure of which is incorporated herein by reference. Sodium current (INa) measurements can be made directly on isolated cells using commercial available patch clamp set-ups, such as the Axon MultiClamp 700B Microelectrode Amplifier (Molecular Devices, Sunnyvale, CA, USA), interfaced to a Digidata 1550B A / D converter (Axon). Micropipettes or patch pipettes filled with a known electrolyte solution in line with a recording electrode connected to an amplifier is brought into contact with the membrane of an isolated cell. Another electrode is placed in a bath surrounding the cell or tissue as the reference ground electrode. After breaking through the cell membrane using brief negative pressure, the electrode becomes electrically continuous with the cell interior, establishing the whole-cell patch clamp configuration. The membrane voltage may then be clamped at a certain voltage according to a predetermined protocol in order to measure the various ionic currents. Alternatively, the amplifier may be placed on “current PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 clamp” mode in order to measure the membrane voltage changes. The resting membrane potential refers to the electrical potential difference across the cell membrane when the cell is not actively firing an action potential. It is typically measured using the current-clamp mode of patch-clamp recording, with no current injection (I = 0). ECG Electrocardiogram, referred to interchangeably with “EKG” and “ECG” is a noninvasive recording of the heart’s electrical activity. It is an electrogram of the heart with a graphical depiction of the voltage versus time of the electrical activity of the heart using electrodes. For humans, these electrodes are placed on the skin, typically on or near the chest. In zebrafish, adult fish are anesthetized e.g., in 0.02% tricaine, before being dried and mounted onto a holder inside of a zebrafish ECG instrument, such as the ZS-200 Zebrafish ECG Recording and Analysis System (iWorx Systems Inc.). To take the ECG measurement in zebrafish, electrodes may be gently placed on the ventral surface of the fish along the midline, and measurements may be made for 1 minutes at 25 °C after which the fish can be promptly placed back into water for recovery. These electrodes detect electrical impulse changes that are a consequence of cardiac muscle depolarization followed by repolarization during each cardiac cycle, generally referred to as a heartbeat. The terms “heart rate” and “HR” refer to the frequency of the heartbeat measured by the number of contractions of the heart per minute. Heart rate is typically reported in beats per minute (bpm). Heart rate measurements are used in the diagnosis of cardiac diseases, including atrial fibrillation (AF) and ventricle fibrillation (VF) which refer to irregular heart rhythm (arrhythmia) that originates in the atria or ventricles, respectively. The QRS complex refers to the combination of three of the graphical deflections seen on a typical ECG. The QRS complex is typically the central and most visually distinct part of the ECG tracing. In humans, the QRS complex corresponds to the depolarization of the right and left ventricles of the heart which depolarization leads to the simultaneous contraction of the two ventricles. The QRS duration refers to the entire timeframe that elapses during the QRS complex tracing, typically 80 to 100 milliseconds (ms) in humans. P wave measurements represent the electrical activity associated with atrial depolarization. In humans, a typical P wave duration is typically less than 120 ms and is the first positive deflection in an ECG. In humans, the PR interval is the time from the onset of the P wave to the start of the QRS complex and is typically between 0.12-0.2 seconds (120-200 ms). This time frame indicates the time it takes from the start of atrial depolarization to the start of ventricular depolarization, including the brief delay at the atrioventricular node. The QTc interval refers to the time from the start of the Q wave to the end of the T wave, representing the total duration of ventricular depolarization and repolarization. Functionally, it corresponds to the period of ventricular systole, from the onset of isovolumetric contraction to the end of isovolumetric relaxation. PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 In summary, ECG measurements can be used to make multiple endpoints critical to assessing cardiac diseases, including heart rate (HR), P wave duration, PR interval, QRS duration, and QTc interval. Voltage mapping Voltage mapping is a technique used to record intracardiac electrical activation or changes in membrane voltage or potential in relation to the anatomic location within the heart. This method can be used to analyze a anatomic location of interest, e.g., during arrhythmia mapping. In humans, it is typically performed using a roving catheter that directly contacts the endocardial surface. In animals including zebrafish, it is typically performed in explanted or isolated hearts loaded with a voltage sensitive dye and mapped optically. After mapping, the fluorescent signals can be used to reconstruct the changes in membrane voltage over time, including action potentials, through the entire heart or measured tissue. Key parameters of the action potentials can then be quantified, including the maximal upstroke velocity of the action potential or “Vmax” or “maximum dV / dt” and actional potential duration or “APD”. In addition, conduction velocity (CV) or the speed at which the electrical signal travels through the cardiac or measured tissue can also be quantified. As used herein, the terms “maximal upstroke velocity of the action potential” and “Vmax” refer to the peak rate of change in membrane potential that occurs during the initial depolarization phase, also referred to as “phase 0,” of the cardiac action potential. This phase represents the rapid transition of membrane voltage from a negative potential (e.g., the resting membrane potential) to a more positive potential. The Vmax is primarily determined by the magnitude and kinetics of the inward sodium current (INa), which is conducted through cardiac voltage-gated sodium channels (NaV). In humans, these channels are encoded by the SCN5A gene. In zebrafish models, the homologous channels are encoded by scn12ab (major isoform) and scn12aa (minor isoform). An increased INa during phase 0 leads to a more rapid depolarization, resulting in a higher Vmax. Therefore, Vmax provides a useful surrogate marker for the functional activity of cardiac voltage-gated sodium channels in mediating INa during phase 0 of the action potential. As used herein, the terms “action potential duration” and “APD” refer to the time course of voltage changes across the cardiomyocyte membrane during an action potential, specifically the period from the initial depolarization to the completion of repolarization. In healthy adult human ventricular myocytes, the typical APD ranges from 200-400 milliseconds. In failing human and animal ventricles, APD is characteristically prolonged, which can delay cellular repolarization and slow electrical conduction. APD can be used to measure the effectiveness of antiarrhythmic drugs, which are used to regulate heart rhythms. Other drugs that can influence the cardiac action potential include, but are not limited to, sodium channel blockers, beta blockers, potassium channel blockers, and calcium channel blockers. In preclinical models, such as zebrafish models, APD can be used to PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 assess the pharmacological effectiveness of therapeutic compounds, where effectiveness is indicated by a decrease of ventricular APD. As a non-limiting example, in the SCN5A loss-of-function zebrafish model, without any pharmacological intervention there was a significant increase in ventricular APD in homozygous scn12ab knockout fish in comparison to wild-type zebrafish. Upon drug treatment, there was a significant decrease of ventricular APD. As used herein, the terms “conduction velocity” and “CV” refer to the speed at which electrical impulses propagate through cardiac tissue. In the context of zebrafish models, cardiac conduction velocity is measured by determining the temporal and spatial progression of depolarization across the atrial and / or ventricular myocardium using high-resolution voltage mapping techniques. These techniques typically involve the use of optical voltage-sensitive dyes or genetically encoded voltage indicators in combination with high-speed fluorescence imaging to visualize voltage changes across the cardiac tissue in real time. Conduction velocity is calculated by measuring the time required for the depolarization wavefront to travel a known distance across the myocardium. A reduction in conduction velocity, which is the cardinal feature of cardiac conduction disorders (CCDs), is indicative of impaired electrical impulse propagation and may be associated with ion channel dysfunction, structural abnormalities, or pharmacological modulation. Accordingly, cardiac conduction velocity, as assessed by voltage mapping in zebrafish, serves as a functional readout for evaluating electrophysiological integrity and the effect of therapeutic or genetic interventions on cardiac electrical conduction. In summary, voltage mapping can be used to make multiple endpoints critical to assessing zebrafish cardiac electrophysiology or pathology, including Vmax, APD, and conduction velocity. Compound Screening Assays The screening method disclosed is a procedure for identifying therapeutic agents useful for treating cardiac diseases e.g., SCN5A-related cardiac diseases. The method involves screening any number of compounds for therapeutically active agents by employing the zebrafish system described herein. Based on our demonstration that these identified compounds pharmacologically rescue the cardiac function of zebrafish, as measured by, as a non-limiting example, an increase in sodium channel activity or heart rate, it will be readily understood that these identified compounds may provide an effective therapeutic agent in a mammal (e.g., a human patient or preclinical cardiac model). Moreover, since the screening procedures of the invention are performed in vivo it is unlikely that the identified compounds will be highly toxic to the host organism. Accordingly, the methods of the invention simplify the evaluation, identification, and development of active agents such as drugs that correct pathological electrophysiological phenotypes associated with sodium channel-related cardiac diseases. In general, the chemical screening methods of the invention provide a straightforward means for selecting natural product extracts or compounds of interest from a large population which PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 are further evaluated and condensed into a few active and selective materials. Constituents of this pool are then purified and evaluated in the methods of the invention to determine their therapeutic efficacy in other subjects, which include but are not limited to, preclinical models of cardiac diseases, such as in vitro cell models, including human and other mammalian cell models (e.g., stem cells differentiated into cardiomyocytes), and in vivo models, such as preclinical animal cardiac disease models. Test Extracts and Compounds In general, novel therapeutically active drugs are identified from large libraries of both natural product or synthetic (or semi-synthetic) extracts or chemical libraries according to methods known in the art. The screening method of the present invention is appropriate and useful for testing compounds from a variety of sources for compounds that correct pathological electrophysiological phenotypes associated with sodium channel-related cardiac diseases. The initial screens may be performed using a diverse library of compounds, but the method is suitable for a variety of other compounds and compound libraries. Such compound libraries can be combinatorial libraries, natural product libraries, or other small molecule libraries. In addition, compounds from commercial sources can be tested, as well as commercially available analogs of identified inhibitors. For example, those skilled in the field of drug discovery and development will understand that the precise source of test extracts or compounds is not critical to the screening procedure(s) of the invention. Accordingly, virtually any number of chemical extracts or compounds can be screened using the methods described herein. Examples of such extracts or compounds include, but are not limited to, plant-, fungal-, prokaryotic- or animal-based extracts, fermentation broths, and synthetic compounds, as well as modification of existing compounds. Numerous methods are also available for generating random or directed synthesis (e.g., semi-synthesis or total synthesis) of any number of chemical compounds, including, but not limited to, saccharide-, lipid-, peptide-, and nucleic acid-based compounds. Synthetic compound libraries are commercially available, e.g., from Tocris (Bristol, United Kingdom) and ChemBridge (San Diego, CA, USA). Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant, and animal extracts are commercially available from a number of sources, including Selleck Chemicals, MicroSource Discovery Systems, Analyticon Discovery, and BioAustralis. In addition, natural and synthetically produced libraries are produced, if desired, according to methods known in the art, e.g., by standard extraction and fractionation methods. Furthermore, if desired, any library or compound is readily modified using standard chemical, physical, or biochemical methods. In addition, those skilled in the art of drug discovery and development readily understand that methods for dereplication (e.g., taxonomic dereplication, biological dereplication, and chemical dereplication, or any combination thereof) or the elimination of replicates or repeats of materials already known for their therapeutic activity should be employed whenever possible. When a crude extract is found to PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 have therapeutic activity, further fractionation of the positive lead extract is necessary to isolate chemical constituents responsible for the observed effect. Thus, the goal of the extraction, fractionation, and purification process is the careful characterization and identification of a chemical entity within the crude extract therapeutic activity. Methods of fractionation and purification of such heterogenous extracts are known in the art. If desired, compounds shown to be useful agents for the treatment of cardiac disease are chemically modified or diversified according to methods known in the art. Since many of the compounds in libraries such as combinatorial and natural products libraries, as well as in natural products preparations, are not characterized, the screening methods of this invention provide novel compounds which are active as inhibitors or induced in the particular screens, in addition to identifying known compounds which are active in the screens. Therefore, this invention includes such novel compounds, as well as the use of both novel and known compounds in pharmaceutical compositions and methods of treating. Pharmaceutical Compositions Compounds identified in the screens (e.g., CX614, NCGC00189349-01, BMS265246, AZD1480, pelitinib, or bosutinib) disclosed suitable for use with the compositions and methods described herein can be formulated into a pharmaceutical composition for administration to a patient, such as a human patient, in a biologically compatible form suitable for administration in vivo. A pharmaceutical composition containing a compound identified in the screen or a pharmaceutically acceptable salt thereof, such as the hydrochloride salt thereof, may additionally contain a suitable diluent, carrier, or excipient. Compounds can be administered to a subject or patient, for example, orally, intravenous, intraperitoneal, subcutaneously, retro-orbitally, topically, or orally, among others. Under ordinary conditions of storage and use, a pharmaceutical composition may contain a preservative, (e.g., to prevent the growth of microorganisms). Pharmaceutical compositions containing an identified compound or a pharmaceutically acceptable salt thereof, can be prepared using methods known in the art. Procedures and ingredients for the preparation of suitable formulations are described, for example, in Beringer, P. Remington: The Science and Practice of Pharmacy (Linppincott Williams & Wilkins, 2012) and in The United States Pharmacopeia: The National Formulary (United States Pharmacopeial Convention NF 33, 2015). Pharmaceutical compositions may include sterile aqueous solutions, dispersions, or powders, (e.g., for the extemporaneous preparation of sterile solutions or dispersions). In all cases the form may be sterilized using techniques known in the art and may be fluidized to the extent that may be easily administered to a subject or patient in need of treatment. A pharmaceutical composition (e.g., (e.g., CX614, NCGC00189349-01, BMS265246, AZD1480, pelitinib, or bosutinib) may be administered to a patient, e.g., a human patient or preclinical animal model, alone or in combination with one or more pharmaceutically acceptable carriers, e.g., as PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 described herein, the proportion of which may be determined by the solubility and / or chemical nature of the compound, chosen route of administration, and standard pharmaceutical practice. Routes of Administration The compounds described herein (e.g., CX614, NCGC00189349-01, BMS265246, AZD1480, pelitinib, bosutinib) may be administered to a subject in need thereof (e.g., a rodent preclinical model of sodium-channel related cardiac disease) by way of various routes, including orally. Oral administration is particularly desirable, as its convenience and ease of self-administration are conducive to repeated dosing, when needed. The compounds described herein may also be administered by way of one or more of a variety of other routes. In addition to the oral route described above, compounds of the disclosure may be administered by way of, without limitation, enteral (into the intestine), gastroenteral, epidural (into the dura matter), transdermal, by inhalation (through the nose or mouth, via spray, aerosol, or dry powder) peridural, intracerebral (into the cerebrum), intracerebroventricular (into the cerebral ventricles), epicutaneous (application onto the skin), intradermal, (into the skin itself), subcutaneous (under the skin), intravenous bolus, intravenous drip, intraarterial (into an artery), intramuscular (into a muscle), intrathecal (into the spinal canal), intraperitoneal, (infusion or injection into the peritoneum), intravesical infusion, transdermal (diffusion through the intact skin for systemic distribution), transmucosal (diffusion through a mucous membrane), sublingual, intravascular (within a vessel or vessels), intraventricular (within a ventricle), iontophoresis (by means of electric current where ions of soluble salts migrate into the tissues of the body), irrigation (to bathe or flush open wounds or body cavities), laryngeal (directly upon the larynx), nasogastric (through the nose and into the stomach), occlusive dressing technique (topical route administration that is then covered by a dressing that occludes the area), oropharyngeal (directly to the mouth and pharynx), parenteral, percutaneous, periarticular, peridural, perineural, periodontal, rectal, retrobulbar (behind the pons or behind the eyeball), intramyocardial (entering the myocardium), submucosal, or topical. The most suitable route for administration in any given case will depend on the composition administered, the subject, pharmaceutical formulation methods, administration methods (e.g., administration time and administration route), the subject's age, body weight, sex, severity of the diseases being treated, the subject's diet, and the subject's excretion rate, among others. Multiple routes of administration may be used to treat a single subject, e.g., IM and IV, among others. Multiple routes of administration may be used to treat a single subject at one time, or the subject may receive treatment via one route of administration first and receive treatment via another route of administration during a second appointment, e.g., 1 week later, 2 weeks later, 1 month later, 6 months later, or 1 year later. PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 Methods of Use The compounds described herein (e.g., CX614, NCGC00189349-01, BMS265246, AZD1480, pelitinib, bosutinib) may be used in a method of treating a cardiac disease in an individual, e.g., by administering a compound described herein to the individual (e.g., an individual having the cardiac disease or an individual in need thereof). In some instances, the cardiac disease is a slowing in cardiac conduction or an arrhythmia. In some instances, the cardiac disease is a loss-of-function SCN5A channelopathy or a gain-of-function SCN5A channelopathy. In some instances, the SCN5A- related cardiac disease is Brugada syndrome (BrS), progressive cardiac conduction defect (PCCD), dilated cardiomyopathy (DCM), long-QT syndrome type 3 (LQT3), sudden infant death syndrome (SIDS), atrial fibrillation (AF), sick sinus syndrome (SSS), atrial standstill (AS), idiopathic ventricular fibrillation (IVF), and sudden infant death syndrome (SIDS); arrhythmogenic cardiomyopathy (ACM) including arrhythmogenic right ventricular cardiomyopathy (ARVC) and Naxos disease; or LMNA- related cardiomyopathy. The compounds described herein (e.g., CX614, NCGC00189349-01, BMS265246, AZD1480, pelitinib, bosutinib) may be used in a method of altering the sodium current or heart rate in an individual, e.g., by administering a compound described herein to the individual (e.g., an individual having the cardiac disease or an individual in need thereof). The compounds described herein (e.g., CX614, NCGC00189349-01, BMS265246, AZD1480, pelitinib, bosutinib) may be used in a method of increasing cardiac voltage-gated sodium channel function in a target cell in an individual, e.g., by administering a compound described herein to the individual (e.g., an individual having the cardiac disease or an individual in need thereof). In some instances, the increase in the cardiac voltage-gated sodium channel function is an increase in heart rate, maximal action potential upstroke velocity (maximum dV / dt or Vmax), cardiac conduction velocity (CV), or sodium current (INa). Examples The following examples are put forth so as to provide those of ordinary skill in the art with a description of how the methods and compositions described herein may be used and evaluated and are intended to be purely exemplary of the invention and are not intended to limit the scope of what the inventors regard as their invention. PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 Table of Contents Example 1. Generation and characterization of SCN5A loss of function zebrafish model. Objective Loss-of-function SCN5A channelopathies are a group of human cardiac disorders associated with decreased sodium channel function (e.g., NaV1.5). The most prominent entity among this group is Brugada syndrome, which is characterized by decreased sodium current (INa), slowed conduction, and lethal arrhythmias. Because there is no disease-modifying therapeutic to date, the mainstay treatment remains the implantable cardioverter defibrillator, which is associated with significant adverse events. This innovation bottleneck may be attributed to the lack of a suitable preclinical model that not only recapitulates various mechanistic elements of the human disease but is also amenable to empiric drug discovery. Here, we recapitulate SCN5A loss of function by knocking out the homologous gene scn12ab in zebrafish. The objective of this study was to generate a bona fide loss-of-function SCN5A channelopathy model in zebrafish by knocking out scn12ab, the major SCN5A ortholog in zebrafish (FIG.1). This model fully recapitulates SCN5A loss of function at both the organ and cellular levels as determined by optical voltage mapping of larval hearts (FIG.2), surface ECG of adult fish (FIG.3), and patch clamping of adult ventricular myocytes (FIG.4). At the same time, the knockouts are viable and fertile in the homozygous state and have a screenable phenotype as early as 2 days post-fertilization, thereby allowing for high-throughput drug screens (FIG.5), further described in Example 2. Results We generated a zebrafish model of loss-of-function SCN5A channelopathy that recapitulates Brugada syndrome (BrS) yet is viable and fertile in the homozygous state which facilitates use in high throughput drug screens. Here, we employed the zebrafish as the model organism which offers several key advantages over traditional SCN5A models. First and foremost, the zebrafish cardiac electrophysiology is strikingly like that of human, especially when compared to mouse, the most used PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 organism in electrophysiology research. This is due to the high degree of conservation between zebrafish and human in cardiac ion channel genes, such as the SCN5A orthologs scn12aa (minor isoform) and scn12ab (major isoform). Relatedly, zebrafish heart rates are 120-130 bpm in adults at 28 °C and 120-150 beats per minute (bpm) in 2-3 days post-fertilization (dpf) embryos at 25 °C, which are much closer to humans than rodents whose heart rates range between 300-600 bpm. Second, zebrafish embryogenesis proceeds rapidly; the zebrafish heart undergoes rapid development starting around 5-hour post-fertilization (hpf) and is functional by 18 hpf, compared to 12 dpf in mice and 35 dpf in humans. This allows for rapid identification and characterization of relevant cardiac phenotype, as we have shown here for heart rate (HR) at 2 dpf (FIG.5A-C), and conduction velocity (CV) and maximal upstroke velocity of the action potential (Vmax) at 5 dpf (FIG.2). Third, zebrafish eggs are fertilized externally, giving easy access both to genetic manipulation via Injection of CRISPR / Cas9 reagents and phenotyping platforms such as cardiac videography, which allows for phenotypic screens rather than target-based screens as discussed above (FIG.5). Finally, specific to our model is the fact that the scn12ab HOMO KOs are viable and fertile due to genetic compensation from the minor scn12aa isoform. This offers an advantage over mouse models where biallelic Scn5a loss of function leads to embryonic lethality. Altogether, these characteristics make the scn12ab zebrafish model suitable for high-throughput drug discovery, as we have demonstrated here in this disclosure. In addition to recapitulating key elements of BrS such as decreased Vmax (FIG 2B) and sarcolemma INa (FIG.3A), the scn12ab KO model also phenocopies other loss-of-function SCN5A channelopathies. These include decreased ventricular CV (FIG.2A) and increased P wave duration, PR interval, and QRS interval (FIG.3D-F) recapitulating progressive cardiac conduction defect; increased ventricular dimensions at 5 dpf (FIG. 1D-E) recapitulating dilated cardiomyopathy; and increased ventricular APD at 5 dpf (FIG.2C) and corrected QT interval (QTc) in adults (FIG.3G) recapitulating overlap syndrome. These characteristics make this model useful not just for studying BrS but also the full spectrum of loss-of-function SCN5A channelopathies, further described in Examples 5 and 6. Generation of a bona fide SCN5A loss of function model in zebrafish Like 70% of human genes which have at least one zebrafish homolog, SCN5A is orthologous to the zebrafish paralogs scn12aa (minor) and scn12ab (major) with 74.4% and 76.3% similarity at the protein level, respectively. Moreover, these two orthologs share even greater conservation in important functional domains including the transmembrane segments, voltage-sensors, pore loops, inactivation gate, and C-terminus. Moreover, expression in Chinese hamster ovary cells produced typical voltage-gated sodium currents. Based on transcript count from RNA sequencing of hearts isolated from developing zebrafish, scn12aa and scn12ab accounts for 5.6% and 94.4% of SCN5A- orthologous transcripts, respectively, in 72 hours post-fertilization hearts. With all this in mind, we PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 designed 4 gRNAs to target exon 1 of zebrafish scn12ab and generated a germline knockout (KO) mutant using CRISPR / Cas9. Incrossing the heterozygous F1 mutants harboring a large frameshift deletion, we obtained wild-type (WT), heterozygous (HET), and homozygous (HOMO) F2 offsprings in expected Mendelian ratio with no increased mortality or gross abnormalities observed in the HET and HOMO siblings, up to at least 1.5 years of age (FIG.1A). This is likely due to contributions from the minor scn12aa isoform that is sufficient for viability, unlike in mouse or human where homozygous SCN5A loss-of-function is embryonically lethal. To validate the KO, we performed Western blots on adult ventricular lysates and found a 40% reduction of the scn12ab protein in the HET fish and complete KO in the HOMO fish (FIG.1B-C), recapitulating SCN5A nonsense variants associated with BrS. Previously, others have targeted scn12ab and scn12aa in zebrafish using antisense oligos (morpholinos) and reported that knockdown of either channel resulted in marked cardiac chamber dysmorphogenesis and perturbed looping. Here, however, we did not observe such severe phenotype although we did observe an increase in ventricular area and length in HOMO hearts isolated from 5 days post-fertilization (dpf) larvae (FIG.1D-F). Interestingly, this is consistent with a dilated cardiomyopathy (DCM) phenotype which has been reported in patients with SCN5A loss-of-function variants, as known in the art. scn12ab KO recapitulates loss-of-function SCN5A channelopathy in both developing and adult hearts To understand the impact of scn12ab loss of function on cardiac electrophysiology, we performed high-resolution optical voltage mapping on hearts isolated from germline KOs at 5 dpf. Compared to WT siblings, there was a gene-dosage dependent decrease in both ventricular conduction velocity (CV; WT 18.1±2.0 vs. HET 13.7±1.0 vs. HOMO 4.8±0.6 mm / s) and maximum action potential upstroke velocity (Vmax; WT 89.8±3.0 vs. HET 77.0±1.8 vs. HOMO 45.0±1.91 / s) (FIG 2A-B). Since both CV and Vmax reflect cardiac NaV function, with Vmax being more specific than CV, these findings suggest that scn12ab KO faithfully recapitulates NaV loss of function in a gene-dosage dependent, consistent with both conduction disorders more generally and BrS, specifically. Finally, there was also a small but significant increase in ventricular action potential duration (APD) in HOMO hearts compared to WT (FIG 2C). Once again, this may be consistent with a DCM phenotype or related overlap syndromes reported with some SCN5A variants. To better characterize the scn12ab KO zebrafish model, we raised the fish to adulthood and performed surface ECGs in anesthetized fish. As shown in FIG.3A, the zebrafish ECG is similar to human ECG and allows for accurate measurement of key ECG parameters. Compared to WT siblings, we found a significant decrease in heart rate (HR) in both HET and HOMO fish (FIG 3B). However, for the rest of the ECG parameters, there were no significant changes in the HET but only in the HOMO fish which exhibited a severe electrical phenotype. This included a significant increase in PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 P-wave duration (WT 23.7±0.9 vs. HET 23.4±0.9 vs. HOMO 32.1±1.0 ms), PR interval (WT 57.8±1.8 vs. HET 55.6±1.9 vs. HOMO 65.0±1.5 ms) and QRS duration (WT 28.7±1.6 vs. HET 27.7±1.0 vs. HOMO 53.0±2.7 ms) (FIG.3C-F). Furthermore, there was also a significant increase in correct QTc interval in the HOMO fish (WT 298±12 vs. HET 305±12 vs. HOMO 338±10 ms) (FIG.3G). Consistent with the mapping data, these findings demonstrate general conduction slowing in both the atrium and ventricle, and a possible DCM and / or overlap syndrome phenotype in the HOMO fish. In terms of the HET fish, the only phenotype exhibited at baseline was decreased HR, which is consistent with findings in a cohort of BrS patients in Thailand. Interestingly, when challenged with ajmaline prior to ECG recording, the HET fish also developed QRS prolongation compared to WT siblings (WT 24.0±1.3 vs. HET 29.2±1.7 ms), akin to the uncovering of BrS ECG pattern during clinical provocation tests (FIG.3H-L). To directly measure the sodium current (INa), we performed patch clamp experiments on enzymatically isolated ventricular myocytes from adult fish and found a reduced INa density in the scn12ab HET and HOMO KO cells in a gene-dosage dependent manner (FIG.4A-C). For example, at -20 mV, the average INa density in WT, HET, and HOMO cells were respectively -176.7±9.1, - 107.7±17.6, and -21.3±2.1 pA / pF, indicating a 39% and 88% reduction in current density for HET and HOMO cells, respectively (FIG.4B). The residual current is likely from the minor scn12aa isoform with additional contributions from L- and T-type Ca2+currents. Tn terms of intrinsic channel biophysics, there was no change in either the voltage dependency (V1 / 2) and speed of current (k) activation or inactivation in the HET cells (FIG.4D-I), which was expected. For HOMO cells, however, while there was no significant change in activation and inactivation V1 / 2 (FIG.4E and 4H), there was a significant increase in both activation and inactivation k (FIG.4F and 4I). As suggested by the abnormal shapes of the activation and inactivation curves (FIG.4D and 4G), this is likely due to contributions from L- and T-type Ca2+currents, which have different biophysical properties, becoming apparent in the absence of the normally dominant INa. Taken together, these experiments clearly demonstrate a bona fide NaV loss of function phenotype in the scn12ab KO fish, with the HET recapitulating clinical BrS. The above-described results were obtained using the following materials and methods Materials and Methods Zebrafish maintenance and use Zebrafish (Danio rerio) were maintained in a dedicated fish facility at 28.5 °C with a circulating system which filters, treats with UV light, aerating the water continuously. All experiments using zebrafish followed animal protocols approved by the Institutional Animal Care and Use committee of Brigham and Women’s Hospital and Harvard Medical school. Genotyped heterozygous zebrafish mutants were used for mating and the generation of experimental animals, except where otherwise indicated. Otherwise, all experiments were conducted comparing genotyped heterozygotes and PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 homozygous mutants with WT siblings, from at least 2-3 independent intercrosses (i.e. different heterozygous parents). Animals were chosen randomly when they were removed from their tanks using a net (for adults) or from a petri dish using a dropper (for embryos). Experiments using larvae from heterozygous in-crosses were done in a blinded fashion, with the genotype added afterwards. For the other experiments, animals were placed into groups based on their genotype, so blinding was not possible. Sex in zebrafish is non-chromosomally determined and not apparent until adulthood. For adult experiments, both male and female adults were used in approximately equal proportions without any obvious differences between the sexes. The number of animals needed for each experiment was estimated based on published literature. Animals were excluded if they appeared visible sick or deformed, or if their hearts were damaged by the isolation procedure and not beating regularly and spontaneously. Generation of zebrafish mutants Wild-type (WT) AB / Tubingen (AB / Tu) zebrafish were mated and resultant fertilized embryos were injected with 4 different gRNAs targeting exon 1 of scn12ab (CAATGCCAAACGCTACCAGG, GCAGCCATACTGTTTCCACC, AGGTCTGCGCGGGGTTTAGG, GGGACGCCCACCAGTGCTGA), Alt-R® tracrRNA, and Alt-R® S.p. HiFi Cas9 Nuclease V3 (all from Integrated DNT Technologies, Tnc.), according to the manufacturer's instructions. Once they reach adulthood, these F0 fish were outcrossed to WT fish of the same background and resultant F1 fish were genotyped by Sanger sequencing using forward primer ATCTGTGCTCTTCTTCCTCAGC and reverse primer GGCCTTAGATTTGTTTGGTTTT, which amplifies the gRNA target sites in exon 1. F1 fish with the same germline mutant alleles were in-crossed to generate experimental F2 animals with siblings as controls (FIG.1A). Western blotting For ventricular samples, adult fish ventricles were flash frozen in liquid nitrogen immediately after isolation and cleaning in PBS. Frozen ventricles were pulverized using Cellcrusher-mini (Cellcrusher, Portland, Oregon, USA) and vortexed in RTPA buffer (#89900, ThermoFisher) containing protease inhibitor cocktails (cOmplete Mini, Roche Applied Science, Germany). For H9c2 samples, cells were washed one time in cold PBS before being scraped off also in cold PBS and spun down at 500 x g for 5 minutes. Pellets were homogenized via vortexing in the same RTPA buffer containing protease inhibitor cocktails. For both ventricular and cell homogenates, samples were centrifuged at >12,000 x g at 4°C for 15 minutes and the supernatants were collected as lysate and used for Western blots. Samples were mixed with 4X Laemmli sample buffer (#1610747, BioRad, USA) with 5% B-mercaptoethanol and incubated at room temperature for 30 minutes before being run on 4-15% Mini-PROTEAN® TGX™ Precast Protein Gels (#4561085, BioRad).Afterwards, the samples were PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 transfer to PVDF membrane and blocked with 5% BSA in Tris-buffered saline with 0.1% Tween® 20 detergent (TBST) for 1 hr at room temperature. Primary antibody incubation was done overnight at 4°C or 3 hours at room temperature, diluted in 5% BSA in TBST, following by 3 TBST washes. Secondary antibody incubation was done at room temperature for 1 hour, also diluted in 5% BSA in TBST, followed by 3 TBST washes. Primary antibodies used were against scn12ab (1:1000; rabbit polyclonal, custom made against N-terminus of zebrafish scn12ab, GenScript, USA), Scn5a (1:1000; rabbit polyclonal, ASC-005, Alomone Labs, Jerusalem, Israel), and a-tubulin (1:1000; mouse monoclonal, T6199, Sigma). Secondary antibodies used were goat anti-rabbit HRP-linked (7074S) and goat anti-mouse HRP-linked (7076S) antibodies (1:10,000; goat polyclonal, Cell Signaling Technology). Custom antibodies were validated first by GenScript using isotype TgG control antibody in ELTSA assays and later by us using genetically modified animals such as knock-out of the target protein. Membranes were developed using ProSignal® Femto ECL Reagent system (#20- 302, Genesee Scientific) and imaged with the Invitrogen iBright Tmaging Systems (ThermoFisher). The molecular weight labels provided in Western panels are the actual size of the molecular weight standards resolved with experimental protein lysates. High-speed in vivo cardiac video microscopy Video recording and measurements of ventricular dimensions were performed as previously described, e.g., in Shin JT, et al. “High-resolution cardiovascular function confirms functional orthology of myocardial contractility pathways in zebrafish.” Physiol. Genomics.2010;42:300-309, the disclosure of which is incorporated herein by reference. Briefly, non-anesthetized embryos at 2 days post-fertilization were placed on their side and imaged at 10X on an upright microscope with video capturing at 250 frames per second (fps). Heart rate and ventricular dimensions were measured using ImageJ (version 1.53a). ECG measurements Adult fish were anesthetized in 0.02% tricaine in systems water for approximately 3 minutes before they were removed for length measurement, drying, and mounting onto a customized sponge holder. Using the ZS- 200 Zebrafish ECG Recording and Analysis System (iWorx, Dover, NH, USA), the pre-mounted two-lead electrodes were gently placed on the ventral surface of the fish along the midline. ECG measurements were made for approximately 1 minute at 25 °C after which the fish were promptly placed back into water for recovery. For ajmaline challenge, fish were placed in systems water containing 10 µM of ajmaline for approximately 5 minutes before being transferred to systems water containing both tricaine for anesthesia and 10 µM of ajmaline for a total of 8 to 10 minutes of ajmaline exposure prior to ECG recording. Data analyses were done using the LabScribe Data Acquisition and Analysis Software version 4 (iWorx). PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 Optical voltage mapping of isolated zebrafish hearts Optical voltage mapping was performed as known in the art. Briefly, hearts were isolated from 5 dpf larvae and immediately incubated with a voltage-sensitive fluorescent dye in the FluoVolt™ Membrane Potential Kit (#F10488, Invitrogen) for 15-20 minutes at room temperature. The hearts were then transferred to a chamber (RC-49MFS; Warner Instruments) perfused with normal Tyrode solution (NTS) containing (in mmol / L): NaCl 136, KCl 5.4, CaCl21.8, MgCl21.0, Na2HPO40.3, glucose 5.0, and HEPES 10.0; pH 7.4 (NaOH) supplemented with 1 mmol / L cytochalasin D (Sigma), which decouples electrical impulses from contractions. The chamber was mounted onto the stage of an inverted microscope (TW-2000; Nikon) with wires connected to the chamber for pacing. The FluoVolt™ dye was excited with a 470 nm light-emitting diode, and the emission was collected by a high-speed 80x80-pixel CCD camera (RedShirtImaging) with 14-bit resolution. Using a 20x Objective and 0.5x C-mount adapter, the final magnification was 10x with a pixel-to-pixel distance of 2.4 µm. Signal processing, downstream analyses, and generation of representative maps were performed by using customized scripts in MATLAB (version R2018b, MathWorks). Dimensions of the isolated hearts were measured from the fluorescent images using ImageJ (version 1.53a). Isolation of ventricular myocytes for patch clamping. Single ventricular cardiomyocytes were isolated by an enzymatic dissociation procedure as known in the art. In short, each ventricle was isolated and cleaned in heparin buffer (10 U / ml heparin and 100 U / ml penicillin-streptomycin in PBS) before temporarily storing in perfusion buffer (10 mM HEPES, 30 mM taurine, 5.5 mM glucose and 10 mM BDM in PBS) on ice. Once all the hearts have been isolated, the perfusion buffer is changed to freshly prepared digestion buffer (perfusion buffer plus 12.5 µM CaCl2, 5 mg / ml of collagenase TT and 5 mg / ml of collagenase TV). The samples are digested for 1.5 to 2 hours at 32 °C in a thermomixer at 800 rpm. Afterwards the digested samples undergo washing in a series of stopping buffers which are perfusion buffer plus 5% FBS and increasing concentrations of CaCl2 until it reaches 1 mM. All centrifuge steps were done at 250g for 5 min at 4 °C. At the end of the last spin, the cells are resuspended in plating medium (MEM plus 2 mM GlutaMAX, 5 mM BDM, 5% (vol / vol) FBS, 100 U / ml penicillin-streptomycin and 1 / 500 dilution of Normocin) and placed on coverslips coated with poly-l-lysine inside 24-well plates for culture overnight at 28 °C with 5% CO2. For experiments with drug treatment, cells from each ventricle are aliquoted into multiple wells treated with either DMSO or the drug. Patch clamping for sodium current is performed on the following day. PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 Sodium current measurements The sodium current (INa) was recorded using Axon MultiClamp 700B Microelectrode Amplifier (Molecular Devices, Sunnyvale, CA, USA), interfaced to a Digidata 1550B A / D converter (Axon). Voltage control, data acquisition, and analysis were carried out using Clampex 11.1 and Clampfit 11.1 (Molecular Devices). Data were acquired at 10 to 20 kHz, and signals were low pass-filtered at 5 kHz before digitization and storage. Pipettes (resistance 2.5-3.5 Mn) were pulled from borosilicate glass capillaries (Harvard Apparatus, UK) using a DMZ universal microelectrode puller (Zeitz). Cell membrane capacitance (Cm) was estimated by dividing the time constant of the decay of the capacitive transient in response to 5 mV hyperpolarizing voltage clamp steps from -40 mV by the series resistance. Cm and series resistance were compensated for at least 80%. INa was measured at room temperature (20oC) using the whole-cell patch-clamp technique. The extracellular solution contained (in mmol / L): NaCl 135, KCl 3.5, CaCl2, MgCl21.2, glucose 8, HEPES 10. Pipettes were filled with a solution containing (in mmol / L): KCl 140, NaCl 3, MgATP 5, EGTA 1, HEPES 5 (pH 7.2 with KOH). INa was activated using 50-ms depolarizing voltage clamp steps from a holding potential of -120 mV. Voltage-dependency of inactivation was measured using a double-pulse protocol. INa was defined as the difference between peak and steady state current and current densities were calculated by dividing current amplitude by Cm. Voltage dependence of activation and inactivation curves were fitted with Boltzmann function (y=[1+exp{(V- V1 / 2) / k}]-1), where V1 / 2 is the half-maximal voltage of (in)activation and k, the slope factor (in mV). Statistical analysis Data are presented as mean ± standard error of the mean (SEM). Data were analyzed in GraphPad Prism 9 and Clampfit 11.1 (patch clamp experiments). Normality was tested using Shapiro- Wilk test. If passed, comparisons between two groups were made using unpaired two-tailed Student's t-test whereas comparisons between three groups were made using one-way ANOVA followed by Dunnett's test (if compared to a control group only) or Tukey's multiple comparisons test. If failed (i.e. non-normal distributions), comparisons between two groups were made using Mann-Whitney rank sum test whereas comparisons between three groups were made using Kruskal-Wallis test followed by Dunn's multiple comparisons test. Fisher exact test was used for comparison of events between two groups. Alpha level was set at 0.05 for all statistical tests. Example 2. Screening platform for rapid assessment of cardiovascular outputs in scn12ab KO zebrafish. Objective Using the SCN5A loss of function zebrafish model, as shown in Example 1, we developed a novel high-throughput screening pipeline to quickly identify therapeutic candidates that increase heart PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 rate (HR). Phenotype-based in vivo screens study the effects of small molecules on a particular disease in the whole organism, which allows for 1) more faithful modeling of complex multi-cellular, multi-tissue diseases, 2) discovery of molecules that produce therapeutic effects through activity at multiple targets simultaneously, and 3) evaluation of the pharmacodynamic and pharmacokinetic profiles as well as adverse or toxic effects. Consequently, hits from phenotype-based screens have a higher probability of passing further tests in other preclinical models for effectiveness, toxicity, and pharmacokinetic profile compared to compounds identified in target-based screens. In Example 2, we conducted two screens of 1,280 and 4,182 compounds (FIG.5) and discovered several candidates that modify cardiac NaV function, as measured by rescue of CV and / or Vmax in larval hearts (for example in FIG.7) and INa in adult ventricular myocytes (for example in FIG. 13). Results Drug screen using scn12ab knockout (KO) embryos Together with their high fecundity, the rapid development of zebrafish embryos (including cardiac development) which is observable under light microscopy makes them suitable for high- throughput phenotypic screens. However, the exact timing and methodology of setting up such a screen depend on identifying a relevant screenable phenotype. Based on studies linking SCN5A loss of function to bradycardia, as described e.g., in Butters TD, et al. “Mechanistic links between Na+ channel (SCN5A) mutations and impaired cardiac pacemaking in sick sinus syndrome.” Circ. Res. 2010;107:126-137, we sought to determine if the scn12ab KO embryos exhibit a significant decrease in HR at a stage when they are amenable for high-throughput screening. Since HR is exquisitely sensitive to temperature, especially in zebrafish, we recorded high speed cardiac videos of 2 dpf unanesthetized WT, HET, and HOMO scn12ab KO embryos at 3 different temperatures (21, 25 and 28 °C), and calculated their HR using MATLAB. Whereas there was only a small change in HR between WT and HOMO embryos at 21 °C (FIG.5A), there was a significant HR decrease in both HET and HOMO embryos at 25 °C (WT 163.7±1.3 vs. HET 152.3±1.7 vs. HOMO 149.6±2.4 ms) and a significant HR decrease in HOMO embryos at 28 °C (WT 195.5±2.3 vs. HET 189.9±1.9 vs. HOMO 181.3±2.7 ms) (FIG.5B-C). Since the percentage change is greatest between WT and HOMO embryos at 25 °C (8.6% decrease), we selected that temperature and developmental time point to perform the screen. As illustrated in FIG.5E-F, because the scn12ab HOMO KO fish are both viable and fertile, we were able to incross them to obtain 100% HOMO embryos without the need for genotyping. On 1 dpf, we placed the embryos in 96-well black optical plates which were prepared with drugs from a library of 1,280 compounds (FIG.5E) or 4,182 compounds (FIG.5F), in quadruplicate, such that the final drug concentration was 10 µM. On 2 dpf, we performed high speed video capture of the cardiac PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 region of the embryos, with the videos then processed to determine the HR of each individual embryo using custom scripts in MATLAB. The data were summarized and compared with embryos treated with DMSO from each plate. To maximize sensitivity during this primary screen, we considered any compound that increased the HR by 5% as a hit. In total, 49 compounds passed the threshold including known regulators of HR such as forskolin (activator of adenyl cyclase), salmeterol xinafoate (long-acting B2 adrenergic receptor agonist), and mifepristone (competitive inhibitor of progesterone receptor with known tachycardia side effects). From this list we selected 37 compounds for secondary screening which is the same as the primary screen but with 8 or more replicates for both HET and HOMO embryos. This secondary screen reduced the candidates by more than half. Of the remaining hits, we conducted validation experiments which included voltage mapping experiments in both HET and HOMO embryos and finally patch clamping of the leading candidate on adult isolated ventricular myocytes, described in detail in Example 3. The above-described results were obtained using the following materials and methods Materials and Methods Drug screening platform For the first screen (FIG.5E), homozygous scn12ab KO fish were incrossed and resultant embryos were dechorionated at 1 dpf and placed, one embryo per well, into black 96 well plates with clear bottom containing different compounds from the Tocriscreen 2.0 compound library with a total of 1,280 compounds. For the second screen (FIG.5F), homozygous scn12ab KO fish were incrossed and resultant embryos were not dechorionated but also placed into the same black 96 well plates with clear bottom, four embryos per well, at 1 dpf. The plates contained different compounds from a custom screening library from ChemBridge (San Diego, CA, USA) with a total of 4,182 compounds. For both screens, the embryos were plated with embryonic water (E3) such that the final compound concentration was 10 µM (FIG.5E-F). The next day, plates were removed from the fish incubator and placed onto the stage of an inverted Nikon microscope inside a humidified chamber with temperature controlled at 25 °C and humidity controlled at 85%. Videos focused on the heart are obtained for each embryo over at least 3 to 4 cardiac cycles using the Element software (Nikon) at approximately 100 fps. Afterwards, the video files are converted using a custom script in ImageJ and further transformed into line graphs using another custom script in MATLAB (version 2018b). Finally, the line graphs are analyzed manually in a semi-automated fashion using another custom script in MATLAB to obtain the heart rates. PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 Example 3. Pharmacologic rescue of cardiac dysfunction in SCN5A zebrafish model. Objective The objective of this study was to conduct secondary screens and rescue experiments on the scn12ab KO fish using select exemplary therapeutic compound candidates, several of which are shown in FIG.6 and described below. This set of experiments provides direct evidence that compounds identified in the screens, as described in Example 2, are able to modulate and rescue the NaV loss of function directly, in a model that is highly relevant to both Brugada syndrome (BrS) and loss-of-function SCN5A channelopathies generally. Results These compounds, which are designated as CX614 (X), NCGC00189349-01 (Y), BMS265246 (B), AZD1480 (Z), Pelitinib (P), and Bosutinib (O) were able to increase the HR of both HET and / or HOMO scn12ab KO embryos at 2 dpf and 25 °C (FIG.6). These and other secondary hits were then studied in more detail using voltage mapping of hearts isolated from 5 dpf scn12ab HET and HOMO larvae at different drug concentrations. One lead candidate compound, CX614, was also studied using patch clamp in ventricular myocytes isolated from adult scn12ab HET fish. Pharmacologic rescue of NaV loss of function in scn12ab KO hearts We conducted secondary screens on select candidates, 6 of which are shown in FIG.6. All 6 compounds were able to increase the HR of HET and / or HOMO scn12ab KO embryos at 2 dpf and 25 °C. These and other secondary hits were then studied in more detail using voltage mapping of hearts isolated from 5 dpf HET and HOMO embryos at different drug concentrations (FIG.7, 9-12). FIG.7A- B shows that compound X was able to significantly increase ventricular CV in HOMO scn12ab KO hearts at 50 µM but not in HET hearts (HOMO: DMSO 3.7±0.5 vs.5 µM 6.6±1.9 vs.50 µM 14.3±4.1 mm / s). In terms of ventricular Vmax, compound X was able to significantly rescue both HET and HOMO hearts at both drug concentrations (HOMO: DMSO 41.9±2.4 vs.5 µM 54.9±3.5 vs.50 µM 60.0±3.61 / s; HET: DMSO 60.9±1.9 vs.5 µM 75.7±2.6 vs.50 µM 76.7±2.41 / s). (FIG.7C-D). Finally, there was also a significant decrease of ventricular action potential duration (APD) at both drug concentrations in HOMO hearts (DMSO 319.7±28.8 vs.5 µM 213.0±13.3 vs.50 µM 186.4±13.4 ms) and at 5 µM in HET hearts (DMSO 263.3±10.6 vs.5 µM 204.2±10.7 vs.50 µM 257.7±14.1 ms) (FIG. 7E-F). Together, these data show that compound X was able to rescue the NaV-dependent parameters of CV and Vmax and possibly the DCM or overlap syndrome phenotypes in this SCN5A loss of function model. FIG.8 shows dose responses of CX614 (X) on scn12ab HOMO (A) and HET (B) ventricular Vmax. Each data point consists of 8-11 hearts for HOMO (A) and 5-8 hearts for HET (B). FIG.9 shows rescue of maximal upstroke velocity of action potential (Vmax) by NCGC00189349-01 (Y) in scn12ab heterozygous (HET) knockout (KO) larvae. There was a PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 significant rescue of ventricular conduction velocity (CV) in scn12ab HET KO hearts at 10 μM but not at 5 μM (FIG.9A-B). There was a trend towards improving atrial CV with Y treatment but no statistical significance, as shown in FIG.9C-D. There was a significant rescue of ventricular Vmax at both drug concentrations in HET hearts, as shown in FIG.9E-F, and a nonsignificant trend in the atria (FIG.9G- H). There was a significant decrease of ventricular action potential duration (APD) at 10 μM but not at 5 μM (FIG.9I-J), and a nonsignificant trend in the atria (FIG.9K-L). FIG.10 shows rescue of maximal upstroke velocity of action potential (Vmax) by BMS265246 (B) and pelitinib (P) in scn12ab homozygous (HOMO) knockout (KO) larvae. A-B. There was trend towards increasing ventricular and atrial conduction velocity (CV) in scn12ab HOMO KO hearts with both drugs. C. There was a trend towards improving ventricular CV with the drugs but no statistical significance. D. There was a significant rescue of atrial Vmax with B at 500 nM and P at 5 μM. One-way ANOVA (P=0.0109) was followed by Dunnett’s multiple comparisons test versus DMSO (B at 500 nM: *P=0.0192; P at 5 μM: *P=0.0109). E-F. There was a significant increase of ventricular action potential duration (APD) with drug P at 5 μM only. One-way ANOVA (P=0.0154) was followed by Dunnett’s multiple comparisons test versus DMSO (P at 5 μM: *P=0.0266). APD was measured at 80% repolarization while the hearts were paced at 100 bpm. Hearts were isolated from 5 days post- fertilization (dpf) larvae treated by the compounds overnight. FIG.11 shows rescue of maximal upstroke velocity of action potential (Vmax) by AZD1480 (Z) in scn12ab homozygous (HOMO) knockout (KO) larvae. There was a significant rescue of ventricular conduction velocity (CV) in scn12ab HOMO KO hearts with drug Z at 50 μM (A-B). There was a significant rescue of ventricular Vmax with drug Z at 50 μM (C-D). There was a significant increase of atrial action potential duration (APD) with drug Z at 50 μM. APD was measured at 80% repolarization while the hearts were paced at 100 bpm (E-F). FIG.12 shows rescue of maximal upstroke velocity of action potential (Vmax) by bosutinib (O) in scn12ab homozygous (HOMO) knockout (KO) larvae. There was a trend toward improvement of ventricular conduction velocity (CV) in scn12ab HOMO KO hearts with drug O at 50 µM but it was not statistically significant (A-B). There was a significant rescue of ventricular Vmax with drug O at 50 µM (C-D). To directly test the effect of compound X on INa, we isolated ventricular myocytes from adult scn12ab HET fish and treated them with DMSO vs.1 µM compound X overnight before performing patch clamp. As we were conducting the experiments, we noticed that some of the cells treated with compound X had a very large increase in INa whereas other treated cells did not seem to be affected at all, even if they are from the same fish and treated in the same well. Therefore, we separated the treated cells into two groups, a "small" response group and a "large" response group, as shown in FIG.13A-C. Remarkably, at -20 mV, the large response group had INa almost 4 times larger than the DMSO group and about 3 times larger than the small response group (DMSO -110.5±13.9 vs. small - 135.3±7.4 vs. large -430.9±29.8 pA / pF). There was no obvious morphologic or size differences PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 between cells in the small and large response groups, suggesting that these may be distinct subpopulations of myocytes with intrinsic differences or discrete manifestations of cell autonomous factors that determine whether a particular cell responds to the treatment with compound X. In terms of activation and inactivation kinetics, there were no differences in V1 / 2 but there was a significant decrease in k with the large response group (FIG.13F and 13I). This is most likely due to the large INa in the large response group which is causing a transient loss of voltage clamp control during the current influx. This set of experiments provides direct evidence that compound X is able to modulate and rescue the NaV loss of function directly, in a model that is highly relevant to BrS and loss-of- function SCN5A channelopathies generally. Materials and Methods Secondary heart rate screens For the secondary heart rate screens (FIG.6), adult homozygous scn12ab KO fish were incrossed for HOMO embryos and outcrossed to wild-type fish for HET embryos. The resultant embryos were placed at 1 dpf, one embryo per well, into black 96 well plates with clear bottom containing different compounds with the desired final compound concentration (usually 10 µM). The next day, plates were removed from the fish incubator and placed onto the stage of an inverted Nikon microscope inside a humidified chamber with temperature controlled at 25 °C and humidity controlled at 85%. Videos focused on the heart are obtained for each embryo over at least 3 to 4 cardiac cycles using the Element software (Nikon) at approximately 100 fps. Afterwards, the video files are converted using a custom script in ImageJ and further transformed into line graphs using another custom script in MATLAB (version 2018b). Finally, the line graphs are analyzed manually in a semi-automated fashion using another custom script in MATLAB to obtain the heart rates. Optical voltage mapping of isolated zebrafish hearts Optical voltage mapping was performed as known in the art. Briefly, hearts were isolated from 5 dpf larvae and immediately incubated with a voltage-sensitive fluorescent dye in the FluoVolt™ Membrane Potential Kit (#F10488, Invitrogen) for 15-20 minutes at room temperature. The hearts were then transferred to a chamber (RC-49MFS; Warner Instruments) perfused with normal Tyrode solution (NTS) containing (in mmol / L): NaCl 136, KCl 5.4, CaCl21.8, MgCl21.0, Na2HPO40.3, glucose 5.0, and HEPES 10.0; pH 7.4 (NaOH) supplemented with 1 mmol / L cytochalasin D (Sigma), which decouples electrical impulses from contractions. The chamber was mounted onto the stage of an inverted microscope (TW-2000; Nikon) with wires connected to the chamber for pacing. The FluoVolt™ dye was excited with a 470 nm light-emitting diode, and the emission was collected by a high-speed 80x80-pixel CCD camera (RedShirtImaging) with 14-bit resolution. Using a 20x Objective and 0.5x C-mount adapter, the final magnification was 10x with a pixel-to-pixel distance of 2.4 µm. PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 Signal processing, downstream analyses, and generation of representative maps were performed by using customized scripts in MATLAB (version R2018b, MathWorks). Dimensions of the isolated hearts were measured from the fluorescent images using ImageJ (version 1.53a). Isolation of ventricular myocytes for patch clamping. Single ventricular cardiomyocytes were isolated by an enzymatic dissociation procedure as known in the art. In short, each ventricle was isolated and cleaned in heparin buffer (10 U / ml heparin and 100 U / ml penicillin-streptomycin in PBS) before temporarily storing in perfusion buffer (10 mM HEPES, 30 mM taurine, 5.5 mM glucose and 10 mM BDM in PBS) on ice. Once all the hearts have been isolated, the perfusion buffer is changed to freshly prepared digestion buffer (perfusion buffer plus 12.5 µM CaCl2, 5 mg / ml of collagenase TT and 5 mg / ml of collagenase TV). The samples are digested for 1.5 to 2 hours at 32 °C in a thermomixer at 800 rpm. Afterwards the digested samples undergo washing in a series of stopping buffers which are perfusion buffer plus 5% FBS and increasing concentrations of CaCl2 until it reaches 1 mM. All centrifuge steps were done at 250g for 5 min at 4 °C. At the end of the last spin, the cells are resuspended in plating medium (MEM plus 2 mM GlutaMAX, 5 mM BDM, 5% (vol / vol) FBS, 100 U / ml penicillin-streptomycin and 1 / 500 dilution of Normocin) and placed on coverslips coated with poly-l-lysine inside 24-well plates for culture overnight at 28 °C with 5% CO2. For experiments with drug treatment, cells from each ventricle are aliquoted into multiple wells treated with either DMSO or the drug. Patch clamping for sodium current is performed on the following day. Sodium current measurements The sodium current (INa) was recorded using Axon MultiClamp 700B Microelectrode Amplifier (Molecular Devices, Sunnyvale, CA, USA), interfaced to a Digidata 1550B A / D converter (Axon). Voltage control, data acquisition, and analysis were carried out using Clampex 11.1 and Clampfit 11.1 (Molecular Devices). Data were acquired at 10 to 20 kHz, and signals were low pass-filtered at 5 kHz before digitization and storage. Pipettes (resistance 2.5-3.5 Mn) were pulled from borosilicate glass capillaries (Harvard Apparatus, UK) using a DMZ universal microelectrode puller (Zeiz). Cell membrane capacitance (Cm) was estimated by dividing the time constant of the decay of the capacitive transient in response to 5 mV hyperpolarizing voltage clamp steps from -40 mV by the series resistance. Cm and series resistance were compensated for at least 80%. INa was measured at room temperature (20oC) using the whole-cell patch-clamp technique. The extracellular solution contained (in mmol / L): NaCl 135, KCl 3.5, CaCl2, MgCl21.2, glucose 8, HEPES 10. Pipettes were filled with a solution containing (in mmol / L): KCl 140, NaCl 3, MgATP 5, EGTA 1, HEPES 5 (pH 7.2 with KOH). INa was activated using 50-ms depolarizing voltage clamp steps from a holding potential of -120 mV. Voltage-dependency of inactivation was measured using a double-pulse protocol. INa was PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 defined as the difference between peak and steady state current and current densities were calculated by dividing current amplitude by Cm. Voltage dependence of activation and inactivation curves were fitted with Boltzmann function (y=[1+exp{(V- V1 / 2) / k}]-1), where V1 / 2 is the half-maximal voltage of (in)activation and k, the slope factor (in mV). Statistical analysis Data are presented as mean ± standard error of the mean (SEM). Data were analyzed in GraphPad Prism 9 and Clampfit 11.1 (patch clamp experiments). Normality was tested using Shapiro- Wilk test. If passed, comparisons between two groups were made using unpaired two-tailed Student's t-test whereas comparisons between three groups were made using one-way ANOVA followed by Dunnett's test (if compared to a control group only) or Tukey's multiple comparisons test. If failed (i.e. non-normal distributions), comparisons between two groups were made using Mann-Whitney rank sum test whereas comparisons between three groups were made using Kruskal-Wallis test followed by Dunn's multiple comparisons test. Fisher exact test was used for comparison of events between two groups. Alpha level was set at 0.05 for all statistical tests. Example 4. Pharmacologic rescue of cardiac dysfunction in Naxos ARVC zebrafish model. Objective The objective of this study was to validate the select therapeutic compound candidates identified in the high throughput screen performed with the SCN5A loss of function zebrafish model. Of the compounds that were identified in the screen, several exemplary compounds were validated in multiple different zebrafish disease models, including the Naxos ARVC zebrafish model, which is described below. This set of experiments provides direct evidence that compounds identified in the screen modulate and rescue the sodium channel loss of function directly in a zebrafish model that is highly relevant to Naxos disease and arrhythmogenic right ventricular diseases (ARVC) generally. Results Previously, a zebrafish model of ARVC and Naxos disease was established by transgenic expression of either wild-type human plakoglobin (PgWT) or mutant plakoglobin (Naxos) in the zebrafish as described e.g., in Angeliki A, et al. “Identification of a new modulator of the intercalated disc in a zebrafish model of arrhythmogenic cardiomyopathy.” Sci Transl Med 2014;11;6(240):240ra74, the disclosure of which is incorporated herein by reference. That same study showed that cardiac voltage-gated sodium channel function as measured by INa was decreased in ventricular myocytes isolated from the Naxos zebrafish model. We have since then independently confirmed a decrease in the heart rate and ventricular Vmax of that same model (data not shown). Based on this, we hypothesized that the compounds found in our phenotypic screen using the loss-of- PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 function SCN5A model may be useful in also rescuing NaV function and conduction defects in the Naxos model and ARVC more generally. FIG.14 shows the rescue of heart rate by lead compounds in Naxos ARVC zebrafish model. Transgenic zebrafish embryos with either wild-type human plakoglobin (PgWT) or mutant plakoglobin (Naxos) modeling arrhythmogenic right ventricular cardiomyopathy (ARVC) were treated with DMSO vs.10 μM of compound X (CX614) from 1 dpf to 2 dpf. FIG.14A shows that the slower heart rates of Naxos embryos were rescued by X. One-way ANOVA (P<0.0001) was followed by Tukey’s multiple comparisons test (**P=0.0079; ****P<0.0001). FIG. B-D show that heart rate of Naxos embryos were also rescued by lead compounds Y (NCGC00189349-01), B (BMS265246), and Z (AZD1480). Unpaired t-test was used for comparison with DMSO treated embryos. *P<0.05, **P<0.01, ****P<0.0001. FIG.15 shows the rescue of maximal upstroke velocity of action potential (Vmax) by CX614 (X) in Naxos larvae. Transgenic zebrafish embryos with either wild-type human plakoglobin (PgWT) or mutant plakoglobin (Naxos) modeling arrhythmogenic right ventricular cardiomyopathy (ARVC) were treated with DMSO vs.5 μM of compound X (CX614) from 4 dpf to 5 dpf when the optimal voltage mapping experiment was performed. FIG.15A shows that treatment with X abolishes the significant difference in ventricular conduction velocity (CV) between PgWT and Naxos hearts. Representative isochrone maps are shown. One-way ANOVA (P=0.0122) was followed by Šidák multiple comparisons test (*P=0.0441). FIG.15B shows a significant rescue of ventricular Vmax in Naxos hearts. One-way ANOVA (P=0.0005) was followed by Šidák multiple comparisons test (PgWT DMSO vs. Naxos DMSO: *P=0.0436; Naxos DMSO vs. Naxos X: *P=0.0261). FIG.15C shows that there was a trend towards decreasing ventricular action potential duration (APD) in both PgWT and Naxos hearts but without statistical significance. FIG.16 shows the rescue of maximal upstroke velocity of action potential (Vmax) by NCGC00189349-01 (Y) and BMS265246 (B) in Naxos larvae. FIG.16A-B shows that there was a trend towards improvement of ventricular conduction velocity (CV) in Naxos hearts with Y and B treatment but without statistical significance. FIG.16C-D shows a significant rescue of ventricular Vmax in Naxos hearts by both Y and B. FIG.16E-F shows a significant decrease in ventricular action potential duration (APD) in Naxos hearts with compound B but not compound Y. Hearts were isolated from 5 days post-fertilization (dpf) larvae treated overnight with DMSO vs. Y or B at 10 μM. The above-described results were obtained using the following materials and methods. Materials and Methods Naxos ARVC model A zebrafish model of ARVC and Naxos disease was previously established by transgenic expression of either wild-type human plakoglobin (PgWT) or mutant plakoglobin (Naxos) in the PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 zebrafish e.g., in Angeliki A et al. “Identification of a new modulator of the intercalated disc in a zebrafish model of arrhythmogenic cardiomyopathy.” Sci Transl Med 2014;11;6(240):240ra74, the disclosure of which is incorporated herein by reference. In the original model, a UAS / GAL4 system was used where the expression of the wild-type or mutant plakoglobin (encoded by JUP gene) under the UAS was activated only by the presence of GAL4 which is under a cardiac-specific promoter (cmlc2). Therefore, a UAS:Naxos or UAS:PgWT line needs to be crossed to a cmlc2:GAL4 line in order to activate the transgenic expression of either WT or Naxos plakoglobin. In our hands, however, we discovered that there is significant gene expression leakage of the UAS:Naxos and UAS:PgWT lines such that the WT and Naxos plakoglobin were being expressed even in the absence of GAL4. Therefore, for the study in this example, we used the UAS:Naxos and UAS:PgWT lines without crossing them to the cmlc2:UAS line and still confirmed a milder but yet still significant Naxos phenotype in the UAS:Naxos embryos including a decrease in heart rate and decrease in ventricular Vmax. Heart rate measurement Adult UAS:Naxos and UAS:PgWT fish were incrossed separately and resultant embryos were placed at 1 dpf, one embryo per well, into black 96 well plates with clear bottom containing different compounds with the desired final compound concentration (usually 10 µM). The next day, plates were removed from the fish incubator and placed onto the stage of an inverted Nikon microscope inside a humidified chamber with temperature controlled at 25 °C and humidity controlled at 85%. Videos focused on the heart are obtained for each embryo over at least 3 to 4 cardiac cycles using the Element software (Nikon) at approximately 100 fps. Afterwards, the video files are converted using a custom script in ImageJ and further transformed into line graphs using another custom script in MATLAB (version 2018b). Finally, the line graphs are analyzed manually in a semi-automated fashion using another custom script in MATLAB to obtain the heart rates. Optical voltage mapping of isolated zebrafish hearts Optical voltage mapping was performed as known in the art. Briefly, hearts were isolated from 5 dpf larvae and immediately incubated with a voltage-sensitive fluorescent dye in the FluoVolt™ Membrane Potential Kit (#F10488, Invitrogen) for 15-20 minutes at room temperature. The hearts were then transferred to a chamber (RC-49MFS; Warner Instruments) perfused with normal Tyrode solution (NTS) containing (in mmol / L): NaCl 136, KCl 5.4, CaCl21.8, MgCl21.0, Na2HPO40.3, glucose 5.0, and HEPES 10.0; pH 7.4 (NaOH) supplemented with 1 mmol / L cytochalasin D (Sigma), which decouples electrical impulses from contractions. The chamber was mounted onto the stage of an inverted microscope (TW-2000; Nikon) with wires connected to the chamber for pacing. The FluoVolt™ dye was excited with a 470 nm light-emitting diode, and the emission was collected by a PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 high-speed 80x80-pixel CCD camera (RedShirtImaging) with 14-bit resolution. Using a 20x Objective and 0.5x C-mount adapter, the final magnification was 10x with a pixel-to-pixel distance of 2.4 µm. Signal processing, downstream analyses, and generation of representative maps were performed by using customized scripts in MATLAB (version R2018b, MathWorks). Dimensions of the isolated hearts were measured from the fluorescent images using ImageJ (version 1.53a). Statistical analysis Data are presented as mean ± standard error of the mean (SEM). Data were analyzed in GraphPad Prism 9. Normality was tested using Shapiro-Wilk test. If passed, comparisons between two groups were made using unpaired two-tailed Student's t-test whereas comparisons between three groups were made using one-way ANOVA followed by Dunnett's test (if compared to a control group only) or Tukey's multiple comparisons test. If failed (i.e. non-normal distributions), comparisons between two groups were made using Mann-Whitney rank sum test whereas comparisons between three groups were made using Kruskal-Wallis test followed by Dunn's multiple comparisons test. Fisher exact test was used for comparison of events between two groups. Alpha level was set at 0.05 for all statistical tests. Example 5. Pharmacologic rescue of loss-of-function in LMNA-related cardiomyopathy zebrafish model. Objective The objective of this study was to validate the select therapeutic compound candidates identified in the high throughput screen performed with the SCN5A loss of function zebrafish model. Of the compounds that were identified in the screen, exemplary compounds were validated in multiple different zebrafish disease models, including the LMNA-related cardiomyopathy zebrafish model, which is described below. This set of experiments provides direct evidence that compounds identified in the screen modulate and rescue the sodium channel loss of function directly in a zebrafish model that is highly relevant to LMNA-related cardiomyopathy. Results The previously described LMNA-related cardiomyopathy zebrafish model was generated by knocking out the LMNA homolog in zebrafish, lmna, in modeling early-onset cardiac conduction system diseases as described e.g., in Hayashi K, et al. “Impact of functional studies on exome sequence variant interpretation in early-onset cardiac conduction system diseases.” Cardiovasc. Res. 2020 Nov 1;116(13):2116-2130. In this model, there was a decrease in heart rate as early as 2 dpf and a decrease in cardiac conduction as early as 3 dpf. Based on this, we hypothesized that the PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 compounds found in our phenotypic screen using the loss-of-function SCN5A model may be useful in also rescuing the conduction defects in this LMNA-related cardiomyopathy zebrafish model. FIG.17 shows rescue of heart rate by four lead compounds in this LMNA-related cardiomyopathy zebrafish model. Zebrafish embryos with lmna heterozygous (HET) knockout (KO) modeling LMNA-related cardiomyopathy were treated with DMSO vs.5 μM of X (CX614), 10 μM of Y (NCGC00189349-01), 10 μM of B (BMS265246), or 10 μM of Z (AZD1480) from 1 dpf to 2 dpf, when heart rate was measured by videography. FIG. A-D shows that the slower heart rates of lmna HET embryos were rescued by all four compounds. Unpaired t-test was used for comparison with DMSO treated embryos. *P<0.05. FIG.18 shows rescue of maximal upstroke velocity of action potential (Vmax) by CX614 (X) in lmna HET larvae. Heart were isolated from 5 days post-fertilization (dpf) larvae treated overnight with DMSO vs.5 μM of X. FIG.18A shows a trend towards improvement of ventricular conduction velocity (CV) in lmna HET hearts with X but without statistical significance. FIG.18B shows a significant rescue of ventricular Vmax in lmna HET hearts by X. FIG.18C shows no significant change in ventricular action potential duration (APD) in lmna HET hearts with X. Student’s t-test was used for comparison with DMSO treated larvae. **P<0.01. FIG.19 shows rescue of maximal upstroke velocity of action potential (Vmax) by NCGC00189349-01 (Y) and BMS265246 (B) in lmna HET larvae. Hearts were isolated from 5 days post-fertilization (dpf) larvae treated overnight with DMSO vs. Y or B at 10 μM. FIG.19A-B shows a trend towards improvement of ventricular conduction velocity (CV) in lmna HET hearts with Y but not B. FIG.19C-D shows a significant rescue of ventricular Vmax in lmna HET hearts by both Y and B. FIG.19E-F shows a significant decrease in ventricular action potential duration (APD) in lmna HET hearts with both Y and B. Student’s t-test was used for comparison with DMSO treated larvae. *P<0.05, ***P<0.001. FIG.20 shows rescue of sodium current (INa) by CX614 (X) in lmna heterozygous (HET) knockout (KO) ventricular myocytes. Cells were treated with DMSO or 5 μM of X in culture media overnight after isolation. Average current voltage (I-V) relationships (A), dot plots of INa density at -20 mV (B), and representative current tracings (C) in heterozygous (HET) lmna KO ventricular myocytes all show a significant increase of INa with X treatment versus DMSO. Measurement of voltage dependency of activation shows that V1 / 2 and k were both significantly decreased with X treatment, suggesting earlier activation (D-F). By contrast, voltage dependency of inactivation shows that V1 / 2 and k did not differ significantly with X treatment (G-I). Student’s t-test was used for comparison with DMSO treated cells. *P<0.05. FIG.21 shows that CX614 (X) regularizes action potentials in lmna HET ventricular myocytes. Isolated ventricular myocytes from lmna heterozygous (HET) knockout (KO) fish modeling LMNA- related cardiomyopathy were treated overnight with DMSO vs. CX614 at 5 μM before patch clamp. PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 Representative voltage tracings during current clamp without injected current (I=0) show regularization of action potentials (consistent R-R interval without evidence of early depolarization) in cells treated with CX614 (A). Summary data in FIG.21B show a significant improvement in the regularization of actional potentials with CX614 treatment. Chi-square test: *P<0.05. The above-described results were obtained using the following materials and methods Materials and Methods LMNA-related cardiomyopathy zebrafish model Previously, a LMNA-related cardiomyopathy zebrafish model was generated by knocking out the LMNA homolog in zebrafish, lmna, in modeling early-onset cardiac conduction system diseases as described e.g., in Hayashi K, et al. “Impact of functional studies on exome sequence variant interpretation in early-onset cardiac conduction system diseases.” Cardiovasc. Res.2020 Nov 1;116(13):2116-2130. In this model, there was a decrease in heart rate as early as 2 dpf and a decrease in cardiac conduction as early as 3 dpf in the homozygous lmna KO embryos. However, we have subsequently discovered that the heterozygous mutants from this model also have a heart rate and cardiac conduction defect. Therefore, we used the lmna HET KO zebrafish and zebrafish embryos for studies in this example, since they model LMNA-related cardiomyopathy more faithfully. Heart rate measurement Adult lmna HOMO fish were out-crossed to wild-type fish to generate HET embryos. At 1 dpf, the resultant embryos were placed one embryo per well into black 96 well plates with clear bottom containing different compounds with the desired final compound concentration. The next day, plates were removed from the fish incubator and placed onto the stage of an inverted Nikon microscope inside a humidified chamber with temperature controlled at 25 °C and humidity controlled at 85%. Videos focused on the heart are obtained for each embryo over at least 3 to 4 cardiac cycles using the Element software (Nikon) at approximately 100 fps. Afterwards, the video files are converted using a custom script in ImageJ and further transformed into line graphs using another custom script in MATLAB (version 2018b). Finally, the line graphs are analyzed manually in a semi-automated fashion using another custom script in MATLAB to obtain the heart rates. Optical voltage mapping of isolated zebrafish hearts Optical voltage mapping was performed as known in the art. Briefly, hearts were isolated from 5 dpf larvae and immediately incubated with a voltage-sensitive fluorescent dye in the FluoVolt™ Membrane Potential Kit (#F10488, Invitrogen) for 15-20 minutes at room temperature. The hearts were then transferred to a chamber (RC-49MFS; Warner Instruments) perfused with normal Tyrode solution (NTS) containing (in mmol / L): NaCl 136, KCl 5.4, CaCl21.8, MgCl21.0, Na2HPO40.3, PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 glucose 5.0, and HEPES 10.0; pH 7.4 (NaOH) supplemented with 1 mmol / L cytochalasin D (Sigma), which decouples electrical impulses from contractions. The chamber was mounted onto the stage of an inverted microscope (TW-2000; Nikon) with wires connected to the chamber for pacing. The FluoVolt™ dye was excited with a 470 nm light-emitting diode, and the emission was collected by a high-speed 80x80-pixel CCD camera (RedShirtImaging) with 14-bit resolution. Using a 20x Objective and 0.5x C-mount adapter, the final magnification was 10x with a pixel-to-pixel distance of 2.4 µm. Signal processing, downstream analyses, and generation of representative maps were performed by using customized scripts in MATLAB (version R2018b, MathWorks). Dimensions of the isolated hearts were measured from the fluorescent images using ImageJ (version 1.53a). Isolation of ventricular myocytes for patch clamping. Single ventricular cardiomyocytes were isolated by an enzymatic dissociation procedure as known in the art. In short, each ventricle was isolated and cleaned in heparin buffer (10 U / ml heparin and 100 U / ml penicillin-streptomycin in PBS) before temporarily storing in perfusion buffer (10 mM HEPES, 30 mM taurine, 5.5 mM glucose and 10 mM BDM in PBS) on ice. Once all the hearts have been isolated, the perfusion buffer is changed to freshly prepared digestion buffer (perfusion buffer plus 12.5 µM CaCl2, 5 mg / ml of collagenase TT and 5 mg / ml of collagenase TV). The samples are digested for 1.5 to 2 hours at 32 °C in a thermomixer at 800 rpm. Afterwards the digested samples undergo washing in a series of stopping buffers which are perfusion buffer plus 5% FBS and increasing concentrations of CaCl2 until it reaches 1 mM. All centrifuge steps were done at 250g for 5 min at 4 °C. At the end of the last spin, the cells are resuspended in plating medium (MEM plus 2 mM GlutaMAX, 5 mM BDM, 5% (vol / vol) FBS, 100 U / ml penicillin-streptomycin and 1 / 500 dilution of Normocin) and placed on coverslips coated with poly-l-lysine inside 24-well plates for culture overnight at 28 °C with 5% CO2. For experiments with drug treatment, cells from each ventricle are aliquoted into multiple wells treated with either DMSO or the drug. Patch clamping for sodium current is performed on the following day. Sodium current measurements The sodium current (INa) was recorded using Axon MultiClamp 700B Microelectrode Amplifier (Molecular Devices, Sunnyvale, CA, USA), interfaced to a Digidata 1550B A / D converter (Axon). Voltage control, data acquisition, and analysis were carried out using Clampex 11.1 and Clampfit 11.1 (Molecular Devices). Data were acquired at 10 to 20 kHz, and signals were low pass-filtered at 5 kHz before digitization and storage. Pipettes (resistance 2.5-3.5 Mn) were pulled from borosilicate glass capillaries (Harvard Apparatus, UK) using a DMZ universal microelectrode puller (Zeiz). Cell membrane capacitance (Cm) was estimated by dividing the time constant of the decay of the capacitive transient in response to 5 mV hyperpolarizing voltage clamp steps from -40 mV by the PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 series resistance. Cm and series resistance were compensated for at least 80%. INa was measured at room temperature (20oC) using the whole-cell patch-clamp technique. The extracellular solution contained (in mmol / L): NaCl 135, KCl 3.5, CaCl2, MgCl21.2, glucose 8, HEPES 10. Pipettes were filled with a solution containing (in mmol / L): KCl 140, NaCl 3, MgATP 5, EGTA 1, HEPES 5 (pH 7.2 with KOH). INa was activated using 50-ms depolarizing voltage clamp steps from a holding potential of -120 mV. Voltage-dependency of inactivation was measured using a double-pulse protocol. INa was defined as the difference between peak and steady state current and current densities were calculated by dividing current amplitude by Cm. Voltage dependence of activation and inactivation curves were fitted with Boltzmann function (y=[1+exp{(V- V1 / 2) / k}]-1), where V1 / 2 is the half-maximal voltage of (in)activation and k, the slope factor (in mV). Action potential measurements Action potentials were measured using the same extracellular and intracellular solutions as above for sodium current measurements. The difference is that current clamp configuration was used without injection of addition current (I=0). Action potentials were recorded for approximately 50 seconds right after break-in. Statistical analysis Data are presented as mean ± standard error of the mean (SEM). Data were analyzed in GraphPad Prism 9 and Clampfit 11.1 (patch clamp experiments). Normality was tested using Shapiro- Wilk test. If passed, comparisons between two groups were made using unpaired two-tailed Student's t-test whereas comparisons between three groups were made using one-way ANOVA followed by Dunnett's test (if compared to a control group only) or Tukey's multiple comparisons test. If failed (i.e. non-normal distributions), comparisons between two groups were made using Mann-Whitney rank sum test whereas comparisons between three groups were made using Kruskal-Wallis test followed by Dunn's multiple comparisons test. Fisher exact test was used for comparison of events between two groups. Alpha level was set at 0.05 for all statistical tests. Example 6. Screening platform for rapid assessment of cardiovascular outputs in LMNA- related cardiomyopathy zebrafish model. Objective Using the LMNA-related cardiomyopathy zebrafish model described earlier, we developed a novel high-throughput screening pipeline to quickly identify therapeutic candidates that rescue the pathologic low heart rate or bradycardia, as a surrogate for rescuing cardiac conduction. This screen can be used to identify therapeutic compounds that rescue cardiac electric function in LMNA-related cardiomyopathy. PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 Results Using the same LMNA-related cardiomyopathy zebrafish model that was generated previously to model early-onset cardiac conduction system diseases as described e.g., in Hayashi K, et al. “Impact of functional studies on exome sequence variant interpretation in early-onset cardiac conduction system diseases.” Cardiovasc. Res.2020 Nov 1;116(13):2116-2130, we built a similar screening platform to quickly identify therapeutic candidates for LMNA-related cardiomyopathy. As noted earlier, there was a decrease in heart rate as early as 2 dpf and a decrease in cardiac conduction as early as 3 dpf in the homozygous lmna KO embryos. However, we have subsequently discovered that the heterozygous KO also has a slowed heart rate at 2 dpf. Based on this, we built a heart rate screen similar to the screens used in scn12ab HOMO KO zebrafish embryos (FIG.22). The key improvement here is that videos were automatically acquired using 2X objective without additional zoom instead of manually acquired using optical zoom. Also, the data analysis was fully automated using custom machine learning algorithms. This greatly enhanced the efficiency of this platform and expands its capabilities for high throughput phenotypic screens beyond heart rate. FIG.22 shows the schematics of this improved heart rate screen using lmna HET embryos treated in quadruplicates with compounds from a compound library with 4,182 compounds. So far 800 compounds were screened and 11 compounds were chosen for secondary (confirmatory) screens. Lead candidates will be followed up using voltage mapping of isolated hearts from 5 dpf lmna HET embryos. Candidates that rescue the ventricular maximal upstroke velocity of action potential (Vmax), APD, and / or conduction velocity (CV) will be further studied using patch clamp of isolated ventricular myocytes from adult lmna HET fish. The above-described results were obtained using the following materials and methods Materials and Methods Drug screening platform For this screen, homozygous lmna KO fish as described e.g., in Hayashi K, et al. “Impact of functional studies on exome sequence variant interpretation in early-onset cardiac conduction system diseases.” Cardiovasc. Res.2020 Nov 1;116(13):2116-2130, were out-crossed to wild-type zebrafish to generate 100% heterozygous lmna KO embryos (FIG.22). These embryos were dechorionated at 1 dpf and placed, four embryos per well, into black 96 well plates with clear bottom containing different compounds from a custom screening library from ChemBridge (San Diego, CA, USA) with a total of 4,182 compounds. The embryos were plated with embryonic water (E3) such that the final compound concentration was 10 µM. The next day, plates were removed from the fish incubator and placed onto the stage of an inverted Nikon microscope inside a humidified chamber with temperature controlled at 25 °C and humidity controlled at 85%. Videos of each well of the 96 well plate were PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 obtained over 150 frames at approximately 40 fps equaling 3.78 seconds, capturing at least 4 cardiac cycles using the Element software (Nikon). Afterwards, the video files were uploaded to a local server and analyzed using a deep learning model to detect heart movement. Subsequently, heart rate of individual embryos was calculated with the fast Fourier transform method. For the initial screen, compounds that increase the heart rate by at least 10% compared to DMSO treated controls were considered hits. Other Embodiments All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference to the same extent as if each independent publication or patent application was specifically and individually indicated to be incorporated by reference. While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the invention that come within known or customary practice within the art to which the invention pertains and may be applied to the essential features hereinbefore set forth, and follows in the scope of the claims. Other embodiments are within the claims.
Claims
PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 CLAIMS What is claimed is:
1. A method of identifying a therapeutic agent for treating a cardiac disease, comprising: (a) administering a candidate therapeutic agent to a zebrafish or zebrafish embryo whose genome has a heterozygous or homozygous disruption in a gene encoding a cardiac voltage-gated sodium channel, wherein the zebrafish or zebrafish embryo has a sign of the cardiac disease, and (b) monitoring the zebrafish or zebrafish embryo for the sign of the cardiac disease, wherein detection of improvement in a sign of the cardiac disease indicates the identification of a therapeutic agent for treating the cardiac disease.
2. The method of claim 1, wherein the gene is scn12ab.
3. The method of claim 1, wherein the gene is scn12aa.
4. A method of identifying a therapeutic agent for treating a cardiac disease, comprising: (a) administering a candidate therapeutic agent to a zebrafish or zebrafish embryo whose genome comprises a transgenic human JUP, wherein the zebrafish or zebrafish embryo has a sign of the cardiac disease, and (b) monitoring the zebrafish or zebrafish embryo for the sign of the cardiac disease, wherein detection of improvement in the sign of the cardiac disease indicates the identification of a therapeutic agent for treating the cardiac disease.
5. The method of claim 4, wherein the JUP gene is a mutant JUP harboring a pathogenic variant associated with Naxos disease.
6. A method of identifying a therapeutic agent for treating a cardiac disease, comprising: (a) administering a candidate therapeutic agent to a zebrafish or zebrafish embryo whose genome has a heterozygous or homozygous disruption in lmna, wherein the zebrafish or zebrafish embryo has a sign of the cardiac disease, and (b) monitoring the zebrafish or zebrafish embryo for the sign of the cardiac disease, wherein detection of improvement in the sign of the cardiac disease indicates the identification of a therapeutic agent for treating the cardiac disease.
7. The method of any one of claims 1-6, wherein the candidate therapeutic agent is administered to a zebrafish.PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 8. The method of any one of claims 1-6, wherein the candidate therapeutic agent is administered to a zebrafish embryo.
9. The method of any one of claims 1-8, wherein the sign of the cardiac disease is a change in heart rate, maximal action potential upstroke velocity (maximum dV / dt or Vmax), action potential duration (APD), cardiac conduction velocity (CV), sodium current (INa), electrocardiogram (ECG) readout, or contractile function.
10. The method of claim 9, wherein the Vmax, the APD, or the CV is the ventricular Vmax, the ventricular APD, or the ventricular CV.
11. The method of claim 9, wherein the ECG readout is heart rate, P wave duration, PR interval, QRS duration, or QTc interval.
12. The method of any one of claims 1-11, wherein the cardiac disease is an SCN5A-related cardiac disease.
13. The method of any one of claims 1-12, wherein the cardiac disease is a slowing in cardiac conduction or an arrhythmia.
14. The method of any one of claims 1-13, wherein the cardiac disease is a loss-of-function SCN5A channelopathy or a gain-of-function SCN5A channelopathy.
15. The method of any one of claims 12-14, wherein the SCN5A-related cardiac disease is Brugada syndrome (BrS), progressive cardiac conduction defect (PCCD), dilated cardiomyopathy (DCM), long- QT syndrome type 3 (LQT3), sudden infant death syndrome (SIDS), atrial fibrillation (AF), sick sinus syndrome (SSS), atrial standstill (AS), idiopathic ventricular fibrillation (IVF), and sudden infant death syndrome (SIDS); arrhythmogenic cardiomyopathy (ACM) including arrhythmogenic right ventricular cardiomyopathy (ARVC) and Naxos disease; or LMNA-related cardiomyopathy.
16. A therapeutic agent identified by the method of any one of claims 1-15.
17. A method of treating a cardiac disease in an individual, comprising administering to the individual CX614, NCGC00189349-01, BMS265246, AZD1480, pelitinib, bosutinib, or a pharmaceutically acceptable salt thereof.PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 18. A method of altering the sodium current or heart rate in an individual, comprising administering to the individual CX614, NCGC00189349-01, BMS265246, AZD1480, pelitinib, bosutinib, or a pharmaceutically acceptable salt thereof.
19. A method of increasing cardiac voltage-gated sodium channel function in a target cell in an individual, comprising administering to the individual CX614, NCGC00189349-01, BMS265246, AZD1480, pelitinib, bosutinib, or a pharmaceutically acceptable salt thereof.
20. A method of identifying an agent for increasing cardiac voltage-gated sodium channel function in a heart, comprising: (a) administering a candidate agent to a zebrafish or zebrafish embryo whose genome has a heterozygous or homozygous disruption in scn12ab, and (b) monitoring the zebrafish or zebrafish embryo for an increase in the cardiac voltage-gated sodium channel function in the heart of the zebrafish or zebrafish embryo.
21. A method of identifying an agent for increasing cardiac voltage-gated sodium channel function in a heart, comprising: (a) administering a candidate agent to a zebrafish or zebrafish embryo whose genome has a transgenic expression of mutant human JUP encoding plakoglobin, and (b) monitoring the zebrafish or zebrafish embryo for an increase in the cardiac voltage-gated sodium channel function in the heart of the zebrafish or zebrafish embryo.
22. A method of identifying an agent for increasing cardiac voltage gated sodium channel function in a heart, comprising: (a) administering a candidate agent to a zebrafish or zebrafish embryo whose genome has a heterozygous or homozygous disruption in lmna, and (b) monitoring the zebrafish or zebrafish embryo for an increase in the cardiac voltage-gated sodium channel function in the heart of the zebrafish or zebrafish embryo.
23. The method of any one of claims 19-22, wherein the increase in the cardiac voltage-gated sodium channel function is an increase in heart rate, maximal action potential upstroke velocity (maximum dV / dt or Vmax), cardiac conduction velocity (CV), or sodium current (INa).
24. The method of any one of claims 20-23, wherein the candidate therapeutic agent is administered to a zebrafish.PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 25. The method of any one of claims 20-23, wherein the candidate therapeutic agent is administered to a zebrafish embryo.
26. A therapeutic agent identified by the method of any one of claims 20-25.
27. A zebrafish whose genome comprises a heterozygous or homozygous disruption in a gene encoding a cardiac voltage-gated sodium channel.
28. The zebrafish of claim 27, wherein the genome disruption comprises a heterozygous or homozygous disruption in scn12ab.
29. The zebrafish of claim 28, which does not comprise a genomic disruption in scn12aa.
30. A zebrafish embryo whose genome comprises a heterozygous or homozygous disruption in a gene encoding a cardiac voltage-gated sodium channel.
31. The zebrafish embryo of claim 30, wherein the genome disruption comprises a heterozygous or homozygous disruption in scn12ab.
32. The zebrafish embryo of claim 31, which does not comprise a genomic disruption in scn12aa.
33. A method of editing scn12ab sequence in a zebrafish cell by introducing into the zebrafish cell guide a guide RNA comprising the nucleic acid sequence of CAATGCCAAACGCTACCAGG(SEQ ID NO: 1), GCAGCCATACTGTTTCCACC(SEQ ID NO: 2), AGGTCTGCGCGGGGTTTAGG (SEQ ID NO: 3), or GGGACGCCCACCAGTGCTGA (SEQ ID NO: 4), and an RNA-guided endonuclease, wherein the guide RNA forms a complex with the RNA-guided endonuclease and the endonuclease cleaves the zebrafish cell’s chromosomal DNA in a site-specific manner, thereby editing the scn12ab sequence in the zebrafish cell.
34. The method of claim 33, wherein the RNA-guided endonuclease is a Cas9 protein or a Cas12 protein.
35. A guide RNA molecule comprising the nucleic acid sequence of CAATGCCAAACGCTACCAGG (SEQ ID NO: 1), GCAGCCATACTGTTTCCACC (SEQ ID NO: 2), AGGTCTGCGCGGGGTTTAGG (SEQ ID NO: 3), or GGGACGCCCACCAGTGCTGA (SEQ ID NO: 4).PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 36. A zebrafish cell comprising the guide RNA molecule of claim 35 and an RNA-guided endonuclease.
37. The zebrafish cell of claim 36, wherein the RNA-guided endonuclease is a Cas9 protein or a Cas12 protein.
38. A method of identifying a therapeutic agent for treating arrhythmogenic cardiomyopathy (ACM), comprising: (a) administering a candidate therapeutic agent to a zebrafish or zebrafish embryo whose genome has a heterozygous or homozygous disruption in a gene encoding a cardiac voltage-gated sodium channel, wherein the zebrafish or zebrafish embryo has a sign of ACM, and (b) monitoring the zebrafish or zebrafish embryo for the sign of ACM, wherein detection of improvement in a sign of ACM indicates the identification of a therapeutic agent for treating ACM.
39. The method of claim 38, wherein the gene is scn12ab.
40. The method of claim 38, wherein the gene is scn12aa.
41. A method of identifying a therapeutic agent for treating ACM, comprising: (a) administering a candidate therapeutic agent to a zebrafish or zebrafish embryo whose genome comprises a transgenic human JUP, wherein the zebrafish or zebrafish embryo has a sign of ACM, and (b) monitoring the zebrafish or zebrafish embryo for the sign of ACM, wherein detection of improvement in the sign of ACM indicates the identification of a therapeutic agent for treating ACM.
42. The method of claim 41, wherein the JUP gene is a mutant JUP harboring a pathogenic variant associated with Naxos disease.
43. A method of identifying a therapeutic agent for treating ACM, comprising: (a) administering a candidate therapeutic agent to a zebrafish or zebrafish embryo whose genome has a heterozygous or homozygous disruption in lmna, wherein the zebrafish or zebrafish embryo has a sign of ACM, and (b) monitoring the zebrafish or zebrafish embryo for the sign of ACM, wherein detection of improvement in the sign of ACM indicates the identification of a therapeutic agent for treating ACM.PATENT Attorney Docket Number: 51836-002WO2 BWH2024-320.02 44. The method of claim 9, wherein contractile function comprises abnormalities of ventricular volumes, ejection fraction, myocardial shortening, or cardiac output.
45. The method of any one of claims 1-11, wherein the cardiac disease comprises a loss of sodium channel function.
Citation Information
Patent Citations
Small molecule inducers of cardiomyocytes to improve cardiac structure and function
WO2023205099A2