Rnai preparation inhibiting XDH gene expression and use thereof

Abstract

An RNA inhibitor inhibiting XDH gene expression, which comprises an antisense strand, the antisense strand comprising a complementary region complementary to at least a portion of mRNA encoding XDH, the length of the complementary region being 17-23 nucleotides, and the antisense strand comprising any one of the nucleotide sequences of SEQ ID NO.: 277-552 and 836-896, or a sequence differing by no more than 3 nucleotides therefrom. Also provided is a pharmaceutical composition comprising the described RNA inhibitor inhibiting XDH gene expression, and further comprising a delivery vehicle, and / or a physiologically acceptable excipient and / or carrier and / or diluent.

Description

RNAi preparation for inhibiting XDH gene expression and application thereof TECHNICAL FIELD

[0001] The present application belongs to the field of molecular biology, and relates to a modified double-stranded RNAi preparation and application thereof, in particular to a double-stranded RNAi agent for inhibiting XDH gene expression and a pharmaceutical composition thereof, and application of the double-stranded RNAi preparation or the pharmaceutical composition thereof for treating diseases caused by XDH expression. BACKGROUND

[0002] The phenomenon of RNA interference (RNAi) exists widely in various species in nature. Andrew Fire and Craig Mello et al. first discovered the phenomenon of RNAi in Caenorhabditis elegans (C. elegans) in 1998, and Tuschl and Phil Sharp et al. confirmed the existence of RNAi in mammals in 2001. Subsequently, a series of progress has been made in the mechanism, gene function and clinical application of RNAi. RNAi plays a key role in various body protection mechanisms such as defense against viral infection and transposon jumping (Hutvágner et al., 2001; Elbashir et al., 2001; Zamore 2001). The product developed based on the mechanism of RNAi is a promising candidate drug. Small interfering RNA (siRNA) can exert the effect of RNA interference and is the main tool for realizing RNAi.

[0003] Uric acid (UA) is biosynthesized in the liver and is a byproduct of purine, xanthine and other related compounds metabolism, which is mainly excreted through urine and a small amount through blood and other body fluids (Baker, et al., The American journal of medicine, 2005, 118(8): 816-826.). Normal uric acid level is beneficial to human health, but excessive uric acid synthesis can cause hyperuricemia, which can lead to uric acid crystallization in the form of monosodium urate monohydrate microcrystals. These crystals can deposit in various parts of the body, but mainly in the joints. Excessive deposition of urate crystals in joints or other tissues further triggers the occurrence of gout, metabolic syndrome, kidney and cardiovascular diseases (Becker, et al., Rheumatic Disease Clinics, 2006, 32(2): 275-293.). Therefore, for patients with hyperuricemia, gout, etc., the blood uric acid level must be strictly managed and monitored in the clinic to maintain it at a normal level, i.e., less than 6 mg / dL. Uric acid is converted from purine compounds catalyzed by xanthine oxidase (XDH / XO) and then excreted through urine, so the mainstream uric acid-lowering drugs are XDH / XO inhibitors or uric acid excretion promoters, and the marketed drugs are represented by febuxostat and benzbromarone, respectively. Benzbromarone does not change the biosynthesis of uric acid, but only promotes the excretion of uric acid by inhibiting the reabsorption of uric acid, but has a contraindication for patients with kidney damage (such as kidney stones) and has been withdrawn from the first-line uric acid-lowering drug category (Schlesinger et al., Drugs, 2004, 64: 2399-2416.). XDH / XO inhibitors block the biosynthesis of uric acid by inhibiting the catalytic activity of uric acid synthesis enzyme, which has a significant effect in some patients. However, recent clinical studies have shown that about 30% of patients cannot reduce blood uric acid to normal levels after high-dose administration of 80 mg of febuxostat per day (Schumacher, et al., Rheumatology, 2009, 48(2): 188-194.). In addition, some clinical studies have also observed that febuxostat causes patient deaths related to cardiovascular diseases (White, et al., N Engl J Med 378(13): 1200-1210). In summary, the existing uric acid-lowering drugs still cannot fully meet the needs of patients with hyperuricemia and gout in terms of efficacy and safety, and other alternative therapies need to be developed urgently.

[0004] The main stream of uric acid lowering drugs includes XDH / XO inhibitors and urate excretion enhancers. The first-line drugs on the market are allopurinol, febuxostat and benzbromarone. Benzbromarone is a small molecule inhibitor of urate transporter URAT1, which promotes the excretion of uric acid by inhibiting the reabsorption of uric acid in the kidney to achieve the goal of lowering blood uric acid. After the marketing of benzbromarone, cases of fulminant hepatic necrosis have been reported, and there is a contraindication for patients with kidney damage (such as kidney stones), so it has been withdrawn from the list of first-line uric acid lowering drugs in some countries (Schlesinger et al., Drugs, 2004, 64: 2399-2416.). XDH / XO inhibitors block the biosynthesis of uric acid by inhibiting the catalytic activity of uric acid synthetase, which has a significant effect in some patients, and the typical representatives are allopurinol and febuxostat. Febuxostat is a selective small molecule inhibitor of xanthine oxidase, which is rapidly absorbed and has a significant effect. However, recent clinical studies have shown that about 30% of patients cannot reduce blood uric acid to normal levels after taking 80 mg of febuxostat per day at a high dose (Schumacher, et al., Rheumatology, 2009, 48(2): 188-194.). In addition, some clinical studies have observed that febuxostat causes patient deaths related to cardiovascular disease (White, et al., N Engl J Med 378(13): 1200-1210), so FDA added a "black box warning" of increased risk of death with febuxostat in 2019, and recommended it only for patients who are ineffective or intolerant to allopurinol. Allopurinol is a competitive small molecule inhibitor of xanthine oxidase, and drug allergy is particularly serious, with a fatality rate of hypersensitivity reactions of 20-30%. Studies have shown that its hypersensitivity reactions are closely related to the genotype HLA-Bx5801, and the proportion of Han population carrying this gene is higher, so the risk of drug safety is higher (Huang, et al., J Form Med Assoc, 2018, 118(1): 371-377.).

[0005] Therefore, the existing treatment regimen for XDH-related diseases or disorders cannot fully meet the needs of patients, and there is still a need to develop new, XDH-targeted treatment regimens for diseases that would benefit from a reduction in XDH expression, such as gout. SUMMARY

[0006] According to an aspect of the present application, there is provided an RNA inhibitor for inhibiting XDH gene expression, comprising an antisense strand comprising a complementary region complementary to at least a portion of mRNA encoding XDH, the complementary region having a length of 17-23 nucleotides, wherein the antisense strand comprises a nucleotide sequence of any one of SEQ ID NOs.: 277-552, 836-896 or a sequence of no more than 3 nucleotides different therefrom.

[0007] In some embodiments, the RNA inhibitor is characterized in that it further comprises a sense strand, wherein there is at least 80% base complementarity between the sense strand and the antisense strand.

[0008] In some embodiments, the sense nucleic acid strand and the antisense nucleic acid strand are present on two different nucleic acid strands.

[0009] In some embodiments, the sense nucleic acid segment and the antisense nucleic acid segment are present on the same nucleic acid strand, wherein the complementary region of the sense nucleic acid segment and the antisense nucleic acid segment forms a double-stranded nucleic acid structure.

[0010] In some embodiments, the RNA inhibitor is characterized in that at least one strand has a 3' overhang of 0-6 nucleotides in length.

[0011] In some embodiments, the RNA inhibitor is characterized in that both strands have a 3' overhang of 2-3 nucleotides in length, or the sense strand has a 3' overhang of 2-3 nucleotides in length, or the antisense strand has a 3' overhang of 2-3 nucleotides in length.

[0012] In some embodiments, the RNA inhibitor is characterized in that the sense nucleic acid strand and the antisense nucleic acid strand have a length of 16-35 nucleotides, respectively.

[0013] In some embodiments, the RNA inhibitor is characterized in that one strand of the RNA inhibitor for inhibiting XDH gene expression has at least 75% homology or complementarity to a nucleotide sequence selected from any one of SEQ ID NOs: 553-828.

[0014] In some embodiments, the RNA inhibitor is characterized in that its sense strand is selected from any one of SEQ ID NOs: 1-276, 829-835 or a sequence of no more than 3 nucleotides different therefrom.

[0015] In some embodiments, the RNA inhibitor for inhibiting XDH gene expression, wherein at least one nucleotide is a chemically modified nucleotide.

[0016] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the chemical modification is at least one of the following modifications:

[0017] (1) modification of the phosphodiester linkage connecting the nucleotides in the nucleotide sequence of the RNA inhibitor of XDH gene expression;

[0018] (2) modification of the 2’-OH of ribose in the nucleotide sequence of the RNA inhibitor of XDH gene expression;

[0019] (3) modification of the base in the nucleotide sequence of the RNA inhibitor of XDH gene expression.

[0020] In some embodiments, the RNA inhibitor of XDH gene expression, wherein there are at least two consecutive phosphorothioate linkages between the nucleotides of the sense strand and / or the antisense strand.

[0021] In some embodiments, the RNA inhibitor of XDH gene expression, wherein there are at least two consecutive phosphorothioate linkages between the three consecutive nucleotides at the 3’ end of the sense strand and / or the 5’ end of the antisense strand. In some embodiments, the RNA inhibitor of XDH gene expression, wherein the -OH at the 2’ position of the sugar group of the 7th, 9th, 10th, 11th nucleotide from the 5’ end of the sense strand is replaced by fluorine.

[0022] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the -OH at the 2’ position of the sugar group of the 14th, 16th nucleotide from the 5’ end of the antisense strand is replaced by fluorine.

[0023] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the -OH at the 2’ position of the sugar group of the 2nd, 14th, 16th nucleotide from the 5’ end of the antisense strand is replaced by fluorine.

[0024] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the -OH at the 2’ position of the sugar group of the 6th, 14th, 16th nucleotide from the 5’ end of the antisense strand is replaced by fluorine.

[0025] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the -OH at the 2’ position of the sugar group of the 2nd, 6th, 14th, 16th nucleotide from the 5’ end of the antisense strand is replaced by fluorine.

[0026] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the -OH at the 2’ position of the sugar group of the 2nd, 3rd, 4th, 5th, 6th, 7th, or 8th nucleotide from the 5’ end of the antisense strand is replaced by deoxy.

[0027] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the -OH on the 2' of the 2nd, 3rd, sugar of the 5' terminal nucleotide of the antisense strand is deoxy.

[0028] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the -OH on the 2' of the 2nd, 4th, sugar of the 5' terminal nucleotide of the antisense strand is deoxy.

[0029] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the -OH on the 2' of the 2nd, 5th, sugar of the 5' terminal nucleotide of the antisense strand is deoxy.

[0030] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the -OH on the 2' of the 2nd, 6th, sugar of the 5' terminal nucleotide of the antisense strand is deoxy.

[0031] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the -OH on the 2' of the 2nd, 7th, sugar of the 5' terminal nucleotide of the antisense strand is deoxy.

[0032] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the -OH on the 2' of the 2nd, 8th, sugar of the 5' terminal nucleotide of the antisense strand is deoxy.

[0033] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the -OH on the 2' of the 3rd, 7th, sugar of the 5' terminal nucleotide of the antisense strand is deoxy.

[0034] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the -OH on the 2' of the 5th, 6th, sugar of the 5' terminal nucleotide of the antisense strand is deoxy.

[0035] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the -OH on the 2' of the 5th, 8th, sugar of the 5' terminal nucleotide of the antisense strand is deoxy.

[0036] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the -OH on the 2' of the 7th, 8th, sugar of the 5' terminal nucleotide of the antisense strand is deoxy.

[0037] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the -OH on the 2' of the 2nd, 3rd, 6th, sugar of the 5' terminal nucleotide of the antisense strand is deoxy.

[0038] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the -OH on the 2' position of the sugar of the 2nd, 3rd, 7thnucleotide, counting from the 5' end of the antisense strand, is replaced with deoxy.

[0039] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the -OH on the 2' position of the sugar of the 2nd, 3rd, 8thnucleotide, counting from the 5' end of the antisense strand, is replaced with deoxy.

[0040] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the -OH on the 2' position of the sugar of the 4th, 5th, 6thnucleotide, counting from the 5' end of the antisense strand, is replaced with deoxy.

[0041] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the -OH on the 2' position of the sugar of the 2nd, 3rd, 4th, 8thnucleotide, counting from the 5' end of the antisense strand, is replaced with deoxy.

[0042] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the -OH on the 2' position of the sugar of the 2nd, 3rd, 4th, 6thnucleotide, counting from the 5' end of the antisense strand, is replaced with deoxy.

[0043] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the -OH on the 2' position of the sugar of the 4th, 5th, 6th, 7thnucleotide, counting from the 5' end of the antisense strand, is replaced with deoxy.

[0044] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the -OH on the 2' position of the sugar of the 4th, 5th, 6th, 8thnucleotide, counting from the 5' end of the antisense strand, is replaced with deoxy.

[0045] In some embodiments, the RNA inhibitor of XDH gene expression, comprises a combination of the following sense strand and antisense strand

[0046] X2702: the sense strand as shown in SEQ ID NO 78 and the antisense strand as shown in SEQ ID NO: 354;

[0047] X3089: the sense strand as shown in SEQ ID NO 93 and the antisense strand as shown in SEQ ID NO: 369;

[0048] X4299: the sense strand as shown in SEQ ID NO 142 and the antisense strand as shown in SEQ ID NO: 418;

[0049] SX551: the sense strand as shown in SEQ ID NO 216 and the antisense strand as shown in SEQ ID NO: 492;

[0050] SX582: the sense strand as shown in SEQ ID NO 228 and the antisense strand as shown in SEQ ID NO: 504;

[0051] SX592: the sense strand as shown in SEQ ID NO 234 and the antisense strand as shown in SEQ ID NO: 510; or,

[0052] SX762: the sense strand as shown in SEQ ID NO 272 and the antisense strand as shown in SEQ ID NO: 548.

[0053] In some embodiments, the RNA inhibitor that inhibits expression of a XDH gene comprises a combination of the following sense strands and antisense strands:

[0054] SX1555: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 836;

[0055] SX1556: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 837;

[0056] SX1557: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 838;

[0057] SX1558: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 839;

[0058] SX1559: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 840;

[0059] SX1560: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 841;

[0060] SX1561: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 842;

[0061] SX1562: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 843;

[0062] SX1563: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 844;

[0063] SX1564: a sense strand as set forth in SEQ ID NO: 829 and an antisense strand as set forth in SEQ ID NO: 845;

[0064] SX1565: a sense strand as set forth in SEQ ID NO: 829 and an antisense strand as set forth in SEQ ID NO: 846;

[0065] SX1566: a sense strand as set forth in SEQ ID NO: 829 and an antisense strand as set forth in SEQ ID NO: 847;

[0066] SX1567: a sense strand as set forth in SEQ ID NO: 829 and an antisense strand as set forth in SEQ ID NO: 848;

[0067] SX1568: a sense strand as set forth in SEQ ID NO: 829 and an antisense strand as set forth in SEQ ID NO: 849;

[0068] SX1569: a sense strand as set forth in SEQ ID NO: 829 and an antisense strand as set forth in SEQ ID NO: 850;

[0069] SX1570: a sense strand as set forth in SEQ ID NO: 829 and an antisense strand as set forth in SEQ ID NO: 851;

[0070] SX1571: a sense strand as set forth in SEQ ID NO: 829 and an antisense strand as set forth in SEQ ID NO: 852;

[0071] SX1572: a sense strand as set forth in SEQ ID NO: 829 and an antisense strand as set forth in SEQ ID NO: 853;

[0072] SX1573: a sense strand as set forth in SEQ ID NO: 829 and an antisense strand as set forth in SEQ ID NO: 854;

[0073] SX1574: a sense strand as set forth in SEQ ID NO: 829 and an antisense strand as set forth in SEQ ID NO: 855;

[0074] SX1575: a sense strand as set forth in SEQ ID NO: 829 and an antisense strand as set forth in SEQ ID NO: 856;

[0075] SX1576: a sense strand as set forth in SEQ ID NO: 829 and an antisense strand as set forth in SEQ ID NO: 857;

[0076] SX1577: a sense strand as shown in SEQ ID NO: 829 and an antisense strand as shown in SEQ ID NO: 858;

[0077] SX1578: a sense strand as shown in SEQ ID NO: 829 and an antisense strand as shown in SEQ ID NO: 859;

[0078] SX1579: a sense strand as shown in SEQ ID NO: 829 and an antisense strand as shown in SEQ ID NO: 860;

[0079] SX1580: a sense strand as shown in SEQ ID NO: 829 and an antisense strand as shown in SEQ ID NO: 861;

[0080] SX1581: a sense strand as shown in SEQ ID NO: 829 and an antisense strand as shown in SEQ ID NO: 862;

[0081] SX5552: a sense strand as shown in SEQ ID NO: 829 and an antisense strand as shown in SEQ ID NO: 863;

[0082] SX5553: a sense strand as shown in SEQ ID NO: 829 and an antisense strand as shown in SEQ ID NO: 864;

[0083] SX5554: a sense strand as shown in SEQ ID NO: 829 and an antisense strand as shown in SEQ ID NO: 865;

[0084] SX5555: a sense strand as shown in SEQ ID NO: 829 and an antisense strand as shown in SEQ ID NO: 866;

[0085] SX5556: a sense strand as shown in SEQ ID NO: 829 and an antisense strand as shown in SEQ ID NO: 867;

[0086] SX5557: a sense strand as shown in SEQ ID NO: 829 and an antisense strand as shown in SEQ ID NO: 868;

[0087] SX5558: a sense strand as shown in SEQ ID NO: 829 and an antisense strand as shown in SEQ ID NO: 869;

[0088] SX5559: a sense strand as shown in SEQ ID NO: 829 and an antisense strand as shown in SEQ ID NO: 870;

[0089] SX5560: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 871 ;

[0090] SX5561 : the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 872;

[0091] SX5562: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 873;

[0092] SX5563: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 874;

[0093] SX5564: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 875;

[0094] SX5565: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 876;

[0095] SX5566: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 877;

[0096] SX5567: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 878;

[0097] SX5568: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 879;

[0098] SX5569: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 880;

[0099] SX5570: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 881 ;

[0100] SX5571 : the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 882;

[0101] SX5572: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 883;

[0102] SX5573: a sense strand as shown in SEQ ID NO: 829 and an antisense strand as shown in SEQ ID NO: 884;

[0103] SX5574: a sense strand as shown in SEQ ID NO: 829 and an antisense strand as shown in SEQ ID NO: 885;

[0104] SX5575: a sense strand as shown in SEQ ID NO: 829 and an antisense strand as shown in SEQ ID NO: 886;

[0105] SX5576: a sense strand as shown in SEQ ID NO: 829 and an antisense strand as shown in SEQ ID NO: 887;

[0106] SX5577: a sense strand as shown in SEQ ID NO: 829 and an antisense strand as shown in SEQ ID NO: 888;

[0107] SX5578: a sense strand as shown in SEQ ID NO: 829 and an antisense strand as shown in SEQ ID NO: 889;

[0108] X2702MW02: a sense strand as shown in SEQ ID NO: 830 and an antisense strand as shown in SEQ ID NO: 890;

[0109] X3089MW02: a sense strand as shown in SEQ ID NO: 831 and an antisense strand as shown in SEQ ID NO: 891;

[0110] X4299MW02: a sense strand as shown in SEQ ID NO: 832 and an antisense strand as shown in SEQ ID NO: 892;

[0111] SX551MW02: a sense strand as shown in SEQ ID NO: 829 and an antisense strand as shown in SEQ ID NO: 893;

[0112] SX582MW02: a sense strand as shown in SEQ ID NO: 833 and an antisense strand as shown in SEQ ID NO: 894;

[0113] SX592MW02: a sense strand as shown in SEQ ID NO: 834 and an antisense strand as shown in SEQ ID NO: 895; or

[0114] SX762MW02: a sense strand as shown in SEQ ID NO: 835 and an antisense strand as shown in SEQ ID NO: 896.

[0115] In some embodiments, the RNA inhibitor of XDH gene expression further comprises a ligand, wherein the ligand is conjugated to the sense strand and / or the antisense strand.

[0116] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the ligand is conjugated to the 5' end and / or the 3' end of the antisense strand.

[0117] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the ligand is conjugated to the 5' end and / or the 3' end of the sense strand.

[0118] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the ligand is conjugated to the 5' end of the antisense strand and the ligand is conjugated to the 3' end of the sense strand.

[0119] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the ligand is conjugated to the 3' end of the sense strand.

[0120] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the ligand is conjugated to the 3' end of the antisense strand and the ligand is conjugated to the 5' end of the sense strand.

[0121] In some embodiments, the RNA inhibitor of XDH gene expression, wherein the ligand is conjugated to the 5' end and the 3' end of the sense strand.

[0122] In some embodiments, the RNA inhibitor of XDH gene expression, the ligand further comprises a targeting unit for enhancing the uptake of the RNA inhibitor by hepatocytes.

[0123] In some embodiments, the targeting unit is selected from monosaccharides and derivatives thereof.

[0124] In some embodiments, the RNA inhibitor of XDH gene expression, the monosaccharide is selected from one or more of the following structures: mannose, galactose, D-arabinose, glucose, fructose, xylose, glucosamine, ribose.

[0125] In some embodiments, the RNA inhibitor of XDH gene expression, the monosaccharide derivative is selected from a mannose derivative, a galactose derivative, a glucose derivative, a ribose derivative, and other derivatives.

[0126] In some embodiments, the RNA inhibitor of XDH gene expression, the targeting unit is selected from galactose, galactosamine, N-acetylgalactosamine, and derivatives thereof.

[0127] In some embodiments, the RNA inhibitor of XDH gene expression, the targeting unit is N-acetylgalactosamine and derivatives thereof.

[0128] In another aspect, the present application further provides a pharmaceutical composition comprising the RNA inhibitor of XDH gene expression, and further comprising a delivery vehicle, and / or a physiologically acceptable excipient and / or carrier and / or diluent.

[0129] In some embodiments, the delivery vehicle comprises a liposome.

[0130] In some embodiments, the delivery vehicle comprises a nanolipid.

[0131] In another aspect, the present application further provides the use of the RNA inhibitor of XDH gene expression and the pharmaceutical composition in the manufacture of a medicament for preventing or treating, or reducing the risk of, a disease or pathology.

[0132] In some embodiments, the disease or pathology comprises a disease or pathology associated with elevated XDH levels.

[0133] In some embodiments, the disease or pathology comprises hyperuricemia.

[0134] In some embodiments, the disease or pathology comprises gout, metabolic syndrome, kidney and cardiovascular diseases.

[0135] In some embodiments, the cardiovascular and cerebrovascular diseases comprise hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary heart disease, or aortic valve stenosis.

[0136] In some embodiments, the method comprises administering to a subject in need thereof an effective amount of the RNA inhibitor of XDH gene expression, a pharmaceutically acceptable salt thereof, or the pharmaceutical composition.

[0137] In some embodiments, the RNA inhibitor of XDH gene expression, a pharmaceutically acceptable salt thereof, or the pharmaceutical composition is administered to the subject subcutaneously, intravenously, orally, rectally, or intraperitoneally.

[0138] In another aspect, the present application further provides a method comprising administering to a cell, tissue, or subject an effective amount of the RNA inhibitor of XDH gene expression, a pharmaceutically acceptable salt thereof, or the pharmaceutical composition.

[0139] In some embodiments, the cell is a hepatocyte.

[0140] In some embodiments, the tissue is a liver tissue.

[0141] In some embodiments, the cells and tissues are ex vivo.

[0142] Other aspects and advantages of the present application will become apparent to those skilled in the art from the following detailed description, which shows and describes illustrative embodiments of the application. As will be realized, the application is capable of modifications in various obvious aspects, all without departing from the spirit and scope of the inventive concepts presented herein. Accordingly, the drawings and description are to be regarded as illustrative in nature, and not as restrictive. BRIEF DESCRIPTION OF DRAWINGS

[0143] Figure 1 shows the molecular structure of L96 as described herein;

[0144] Figure 2 shows the conjugation of L96 and siRNA as described herein;

[0145] Figure 3 shows the knockdown of human XDH expression in transient mouse in vivo at 3mpk dose of 7 pairs of GalNac conjugated siRNA as described herein;

[0146] Figure 4 shows the knockdown of mouse XDH expression in transient mouse in vivo at multiple doses of 5 pairs of GalNac conjugated siRNA as described herein;

[0147] Figure 5 shows the in vivo inhibition effect detection of duplex siRNA in XDH gene humanized mouse model as described herein. DETAILED DESCRIPTION

[0148] The following examples are provided to further illustrate the application. Other advantages and effects of the application will be readily appreciated by those skilled in the art from the following detailed description, taken in conjunction with the accompanying drawings.

[0149] TERMS

[0150] In the present application, the terms "iRNA," "RNAi agent," "iRNA agent," "RNA interference agent," "RNA inhibitor" are used interchangeably and generally refer to an agent comprising RNA as defined by the terms herein, and which can mediate the targeted cleavage of RNA transcripts through the RNA-induced silencing complex (RISC) pathway. iRNAs direct the sequence-specific degradation of mRNA via a process known as RNA interference (RNAi). iRNAs modulate (e.g., inhibit) expression of the XDH gene (NM_000379.4 Homo sapiens xanthine dehydrogenase (XDH), e.g., the mRNA sequence as set forth in SEQ ID NO: 920) in a cell (e.g., a cell in a subject such as a mammalian subject).

[0151] In certain embodiments, the RNAi agent can be a single-stranded siRNA (ssRNAi) introduced into a cell or organism to inhibit a target mRNA. Single-stranded RNAi agents bind the endonuclease Argonaute 2 within RISC, which then cleaves the target mRNA. Single-stranded siRNAs are generally 15 to 30 nucleotides and are chemically modified. Design and testing of single-stranded siRNAs are described in U.S. Patent No. 8,101,348 and Lima et al. (2012) Cell 150:883-894, the entire contents of each of which are incorporated herein by reference. Any of the antisense nucleotide sequences described herein can be used as a single-stranded siRNA described herein or chemically modified by the methods described in Lima et al. (2012) Cell 150:883-894.

[0152] In certain embodiments, "iRNA" as used in the present application is a double-stranded RNA, and is referred to herein as a "double-stranded RNAi agent," "double-stranded RNA (dsRNA) molecule," "dsRNA agent," or "dsRNA." The term "dsRNA" refers to a complex of ribonucleic acid molecules having a duplex structure comprising two antiparallel and substantially complementary nucleic acid strands, referred to as having "sense" and "antisense" orientation with respect to a target RNA (i.e., the XDH gene). In some embodiments of the present application, double-stranded RNA (dsRNA) triggers the degradation of a target RNA (e.g., mRNA) through a post-transcriptional gene-silencing mechanism referred to herein as RNA interference or RNAi.

[0153] Duplex structures can be of any length that allows for the specific degradation of the desired target RNA by the RISC pathway, and can range in length from about 19 to 36 base pairs, e.g., about 19-30 base pairs in length, e.g., about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length. Ranges and lengths intermediate to the above ranges and lengths are also intended to be part of this application. In certain embodiments, the iRNA agents of the application are dsRNAs comprising 15-23 nucleotides per strand that interact with a target RNA sequence (e.g., an XDH gene) to direct cleavage of the target RNA. In certain embodiments, the iRNAs of the application are 24-30 nucleotide dsRNAs that interact with a target RNA sequence (e.g., an XDH target mRNA sequence) to direct cleavage of the target RNA.

[0154] In the present application, the terms "nucleic acid" and "polynucleotide" are used interchangeably and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides or their analogs. Polynucleotides can have any three-dimensional structure and can perform any function. The following are non-limiting examples of polynucleotides: a gene or gene fragment, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, siRNA, miRNA, shRNA, RNAi agents, and primers. A polynucleotide can be modified at one or more bases, sugars, and / or phosphates to include any of a variety of modifications or substitutions known in the art or described herein. A polynucleotide can comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure can be made before or after assembly of the polymer. The sequence of nucleotides can be interrupted by non-nucleotide components. A polynucleotide can be modified after polymerization, such as by conjugation with a labeling component. The term encompasses single- and double- stranded forms.

[0155] In the present application, the term "target nucleic acid" or "target sequence" generally refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during transcription of an XDH gene, including mRNA that is a processing product of the primary transcription product. The target portion of the sequence should be at least long enough to be a substrate for iRNA-directed cleavage at or near the position of the portion of the nucleotide sequence of the mRNA molecule formed during transcription of an XDH gene. In one embodiment, the target sequence is within the protein coding region of XDH. The target sequence can be about 19-36 nucleotides in length, e.g., preferably about 19-30 nucleotides in length. Ranges and lengths intermediate to the above ranges and lengths are also intended to be part of the present application.

[0156] In the present application, the term "nucleotide sequence" generally refers to a string or order of nucleobases, nucleotides, and / or nucleosides, whether modified or unmodified, described by a string of letters using the standard nucleotide nomenclature and the symbol table for modified nucleotides described herein.

[0157] In the present application, the term "oligonucleotide" generally refers to a polymer composed of a series of nucleotide residues (deoxyribonucleotides or ribonucleotides, or related structural variants or synthetic analogs thereof) linked by phosphodiester bonds (or related structural variants or synthetic analogs thereof). Thus, although the term "oligonucleotide" generally refers to a nucleotide polymer in which the nucleotide residues and their linkages are naturally occurring, it is understood that the scope of the term includes various analogs, including but not limited to: peptide nucleic acids (PNAs), phosphoramidates, phosphorothioates, methylphosphonates, 2-O-methyl ribonucleic acids, and the like. The exact size of the molecule can depend on the particular application. Oligonucleotides are generally short in length, typically about 10-30 nucleotide residues, but the term can refer to molecules of any length, although the terms "polynucleotide" or "nucleic acid" are generally used for larger oligonucleotides.

[0158] In certain embodiments, an oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleosides. The term "modified oligonucleotide" generally means an oligonucleotide comprising at least one modified nucleoside and / or at least one modified internucleoside linkage.

[0159] In the present application, the term "modified nucleoside" generally means a nucleoside comprising at least one chemical modification compared to a naturally occurring RNA or DNA nucleoside. A modified nucleoside comprises a modified sugar moiety and / or a modified nucleobase.

[0160] In the present application, the term "nucleobase" generally means a heterocyclic pyrimidine or purine compound that is a component of all nucleic acids and includes adenine (a), guanine (g), cytosine (c), thymine (t), and uracil (u). A nucleotide can include a modified nucleotide or nucleotide mimic, an abasic site (Ab or X), or a surrogate moiety. As used herein, "nucleobase sequence" generally means the order of consecutive nucleobases independent of any sugar, linkage, or nucleobase modification. The term "unmodified nucleobase" or "naturally occurring nucleobase" generally means the naturally occurring heterocyclic nucleobases of RNA or DNA: the purine bases adenine (a) and guanine (g); and the pyrimidine bases thymine (t), cytosine (c) (including 5-methyl c), and uracil (u). "Modified nucleobase" generally means any nucleobase that is not naturally occurring.

[0161] In the present application, the term "sugar moiety" generally means a naturally occurring sugar moiety or a modified sugar moiety of a nucleoside. The term "naturally occurring sugar moiety" generally means a furanoribosyl group as found in naturally occurring RNA or a deoxyfuranoribosyl group as found in naturally occurring DNA. "Modified sugar moiety" means a substituted sugar moiety or sugar surrogate.

[0162] In the present application, the term "internucleoside linkage" generally means a covalent linkage between adjacent nucleosides in an oligonucleotide. "Naturally occurring internucleoside linkage" means a 3' to 5' phosphodiester linkage. "Modified internucleoside linkage" means any internucleoside linkage other than a naturally occurring internucleoside linkage.

[0163] In the present application, the term "antisense oligonucleotide" refers to a single-stranded oligonucleotide molecule having a nucleobase sequence complementary to a corresponding segment of a target nucleic acid (e.g., a genomic sequence of interest, an mRNA precursor, or an mRNA molecule). In certain embodiments, an antisense oligonucleotide is 12 to 30 nucleobases in length. In certain embodiments, an antisense oligonucleotide is an unmodified or modified nucleic acid having a nucleotide sequence complementary to a sequence of a target nucleic acid, such as an XDH polynucleotide.

[0164] In the present application, the term "antisense strand" generally refers to a strand of an RNA inhibitor (e.g., a dsRNA) that includes a region of substantial complementarity to a target sequence. As used herein, the term "region of complementarity" generally refers to a region on an antisense strand that is substantially complementary to a sequence defined herein (e.g., a target sequence). When the region of complementarity is not perfectly complementary to the target sequence, mismatches can be internal or at the terminal regions of the molecule. Generally, the most tolerated mismatches are at the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5' terminus and / or the 3' terminus.

[0165] In the present application, the term "sense strand" (S) generally refers to the strand of an RNA inhibitor that includes a region that is substantially complementary to a region that is the anti sense strand as that term is defined herein. The "sense" strand is sometimes referred to as the "sense" strand, the "passenger" strand, or the "anti-guide" strand. By virtue of their sequences, the anti sense strand targets the desired mRNA, while the sense strand targets a different target. Thus, if the anti sense strand is incorporated into RISC, the correct target is targeted. Incorporation of the sense strand can result in off-target effects. These off-target effects can be limited by using modifications on the sense strand or using a 5' end cap.

[0166] In the present application, the term "complementary" when used to describe a first nucleotide sequence (such as a sense strand of an RNAi agent) with respect to a second nucleotide sequence (such as an anti sense strand of an RNAi agent) refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (form base pair hydrogen bonds) and form a duplex or double helix structure with an oligonucleotide or polynucleotide comprising the second nucleotide sequence under certain conditions. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics, as long as the above requirements with respect to their hybridization ability are met. "Complementary" does not necessarily have nucleobase complementarity at every nucleoside. Rather, some mismatches can be tolerated.

[0167] In the present application, the term "fully complementary" generally means that all (100%) of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. The contiguous sequence can comprise all or a portion of the first or second nucleotide sequence. As used herein, "partially complementary" generally means that in a pair of hybridized nucleobase sequences, at least about 70% of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. As used herein, "substantially complementary" generally means that in a pair of hybridized nucleobase sequences, at least about 90% of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. The terms "complementary," "fully complementary," and "substantially complementary" as used herein can be used with respect to base pairing between a sense strand and an anti sense strand of an RNA inhibitor or between an anti sense strand of an RNA inhibitor and a sequence of an XDH mRNA. Sequence identity or complementarity is independent of modification. For purposes of determining identity or complementarity, for example, a and Af are complementary to U (or T) and identical to A.

[0168] In the present application, the term "homologous" or "homology" generally refers to the number of nucleotides of a subject nucleic acid sequence that have matched the same nucleotides of a reference nucleic acid sequence, typically determined by a sequence analysis program (e.g., Karlin and Altschul, 1990, PNAS 87:2264-2268; Karlin and Altschul, 1993, PNAS 90:5873-5877), or by visual inspection. As used herein, the term "complete homology" or "completely homologous" generally refers to complete (100%) homology or "identity" between a reference sequence and a subject nucleic acid sequence. As used herein, the term "substantially homologous" or "substantial homology" generally refers to a subject sequence sharing at least 50% (e.g., at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%) of the homologous nucleotides at the same nucleotide positions in a reference sequence.

[0169] In the present application, the term "ligand" generally refers to any compound or molecule capable of covalently or otherwise binding to a biologically active substance, such as an oligonucleotide. In certain embodiments, a ligand is capable of directly or indirectly interacting with another compound, e.g., a receptor, which can be present on the surface of a cell, or alternatively can be an intracellular and / or intercellular receptor, the interaction of the ligand with the receptor can result in a biochemical reaction, or can simply be a physical interaction or binding.

[0170] In the present application, the terms "induce," "inhibit," "enhance," "elevate," "increase," "decrease," "reduce," and the like generally indicate a quantitative difference between two states. For example, "an amount effective to inhibit the activity or expression of XDH" means that the level of XDH activity or expression in a treated sample will be lower than the level of XDH activity or expression in an untreated sample. The terms are applicable, for example, to expression levels and activity levels. The terms "decrease" and "reduce" are used interchangeably and generally mean any change that is less than the original. "Decrease" and "reduce" are relative terms, requiring a comparison between before and after measurements. "Decrease" and "reduce" include complete depletion.

[0171] In certain embodiments, the term "decrease" can be an overall decrease of about 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 100% in the expression level / amount of a gene, gene product, e.g., a protein, or a biomarker in a first sample as compared to the expression level / amount of the corresponding gene, gene product, e.g., a protein, or a biomarker in a second sample, as detected by standard methods known in the art, such as those described in the present application. In certain embodiments, the term "decrease" refers to a decrease in the expression level / amount of a gene or biomarker in a first sample, wherein the decrease is at least about 0.9-fold, 0.8-fold, 0.7-fold, 0.6-fold, 0.5-fold, 0.4-fold, 0.3-fold, 0.2-fold, 0.1-fold, 0.05-fold, or 0.01-fold of the expression level / amount of the corresponding gene or biomarker in a second sample. In certain embodiments, the first sample is a sample obtained from a subject, and the second sample is a reference sample.

[0172] In the present application, the term "expression" generally means the process by which a gene ultimately produces a protein. Expression includes, but is not limited to, transcription, post-transcriptional modification (e.g., splicing, polyadenylation, addition of a 5'-cap), and translation.

[0173] In the present application, the term "pharmaceutically acceptable" generally refers to a nontoxic material that does not interfere with the effectiveness of the biological activity of the active ingredients. Such formulations can typically contain salts, excipients, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. Such pharmaceutically acceptable formulations can also typically include compatible solid or liquid fillers, diluents, or encapsulating material that are suitable for administration to humans. When used in medicine, salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts can conveniently be used to prepare pharmaceutically acceptable salts, and are not excluded from the scope of the present application. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts derived from hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, boric acid, formic acid, malonic acid, succinic acid, and the like. Pharmaceutically acceptable salts can also be prepared as alkali metal salts or alkaline earth metal salts, such as sodium salts, potassium salts, or calcium salts.

[0174] In the present application, the term "lipid nanoparticle" or "LNP" generally refers to a vesicle comprising a lipid layer that encapsulates a pharmacologically active molecule, such as a nucleic acid molecule, e.g., an iRNA or a plasmid from which an iRNA is transcribed. LNPs are described, for example, in Chinese Patent No. CN103189057B, the entire contents of which are incorporated herein by reference.

[0175] In the present application, the term "preventing and / or treating" includes not only preventing and / or treating a disease, but also generally includes preventing the onset of a disease, slowing or reversing the progression of a disease, preventing or slowing the onset of one or more symptoms associated with a disease, reducing and / or alleviating one or more symptoms associated with a disease, reducing the severity and / or duration of a disease and / or any symptoms associated therewith and / or preventing further increases in the severity of a disease and / or any symptoms associated therewith, preventing, reducing or reversing any physiological damage caused by a disease, and generally any pharmacological effect that is beneficial to the patient being treated. The RNAi agent or pharmaceutical composition of the present application forms a viable therapeutic agent need not achieve a complete cure or eradication of any symptom or manifestation of a disease. As recognized in the relevant art, a drug used as a therapeutic agent can reduce the severity of a given disease state, but need not eliminate every manifestation of a disease to be considered a useful therapeutic agent. Similarly, a therapeutic agent prophylactically administered forms a viable prophylactic agent need not be completely effective in preventing the onset of a disorder. It is sufficient to simply reduce the impact of a disease in a subject (e.g., by reducing the number or severity of its symptoms, or by increasing the effectiveness of another therapy, or by producing another beneficial effect), or to reduce the likelihood of a disease occurring or worsening.

[0176] In the present application, the terms "disease" or "disorder" are used interchangeably and generally refer to any deviation from the normal state of a subject, for example, any change in the state of the body or of some of its organs, impairs or interferes with the performance of the functions, and / or causes symptoms such as discomfort, dysfunction, pain, or even death in a person affected or exposed to it. A disease or disorder can also be referred to as a distemper, an ailing, an ailment, a malady, a disorder, a sickness, an illness, a complaint.

[0177] In the present application, the term "administering" generally refers to introducing a pharmaceutical preparation of the present application into the body of a subject by any route of introduction or delivery. Any method known to those skilled in the art for contacting a cell, organ or tissue with the drug can be employed. The administration can include, without limitation, intravenous, intra-arterial, intranasal, intra-abdominal, intramuscular, subcutaneous transdermal or oral. The daily dose can be divided into one, two or more doses of a suitable form for administration at one, two or more times during a certain period of time.

[0178] In the present application, the term "contacting" generally refers to the bringing together of two or more different types of substances in any order, in any manner, and for any length of time. Contacting can occur in vivo, ex vivo, or in vitro. In certain embodiments, it can refer to the direct contacting of a cell or tissue with an RNAi agent or composition of the present application. In other embodiments, the term refers to the indirect contacting of a cell or tissue with an RNAi agent or composition of the present application. For example, the methods of the present application include those in which a subject is contacted with an RNAi agent or composition of the present application, and the RNAi agent or composition then contacts the cell or tissue by diffusion or any other active or passive transport process known in the art by which the compound circulates in the body.

[0179] In the present application, the term "effective amount" or "effective dose" generally refers to the amount that is sufficient to achieve, or at least partially achieve, the desired effect. A "therapeutically effective amount" or "therapeutically effective dose" of a pharmaceutical or therapeutic agent is generally any amount of the agent that, when used alone or in combination with another therapeutic agent, promotes disease regression as evidenced by a decrease in the severity of disease symptoms, an increase in the frequency and duration of disease symptom-free periods, or the prevention of impairment or disability due to the disease. A "prophylactically effective amount" or "prophylactically effective dose" of a pharmaceutical is generally an amount of the agent that, when administered alone or in combination with another therapeutic agent to a subject at risk of developing a disease or of experiencing a recurrence of disease, inhibits the development or recurrence of the disease. The ability of a therapeutic or prophylactic agent to promote disease regression or inhibit disease development or recurrence can be assessed using a variety of methods known to the skilled artisan, such as predicting efficacy in humans in human subjects during clinical trials, in animal model systems, or by assaying the activity of the agent in in vitro assays. In certain embodiments, an "effective amount" refers to the amount of an RNAi agent that produces the intended pharmacological, therapeutic, or prophylactic result.

[0180] In the present application, the term "subject" generally refers to a human or non-human animal (including mammals), such as a human, non-human primate (apes, gibbons, gorillas, chimpanzees, orangutans, macaques), a domestic animal (dogs and cats), a farm animal (poultry such as chickens and ducks, horses, cows, goats, sheep, pigs), and a laboratory animal (mice, rats, rabbits, guinea pigs) in need of diagnosis, prognosis, amelioration, prevention, and / or treatment of a disease. Human subjects include fetal, neonatal, infant, adolescent, and adult human subjects. Subjects include animal models of disease.

[0181] In this application, the terms "comprise", "comprising", "having", "include", "including", "contain", "containing", "may", "might", "have", "including", "contain", "containing" and variants thereof are generally intended to be open-ended transitional phrases, terms or words that do not preclude the possibility of additional acts or structures. The term "consisting of is generally intended to mean that no additional components (or likewise, features, integers, steps, etc.) can be present. The singular forms "a", "an" and "the" are generally intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0182] In this application, the term "about" is generally intended to mean roughly, approximately, or around. When the term "about" is used in reference to a numerical value, the term is used to indicate that the recited numerical value can differ from the recited value by up to 10%. Thus, the term "about" can be used to encompass variation of ±10% or less, ±5% or less, ±1% or less, ±0.5% or less, or ±0.1% or less from a particular value.

[0183] It should be understood that the term "at least" preceding a number or series of numbers includes the number adjacent to the term "at least" and all subsequent numbers or integers logically included therein, as is clear from the context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 19 of the 21 nucleotides of a nucleic acid molecule" means that 19, 20, or 21 nucleotides have the indicated property. When "at least" precedes a series of numbers or a range, it should be understood that "at least" can modify each number in the series or range.

[0184] It should be understood that "no more than" or "less than" as used herein refers to the value or integer adjacent to the phrase and logically lower, as is clear from the context. For example, a duplex having "no more than 3 nucleotides" of overhang has 3, 2, 1, or 0 nucleotides of overhang. When "no more than" precedes a series of numbers or a range, it should be understood that "no more than" can modify each number in the series or range. Ranges as used herein are inclusive of both the lower and upper limits.

[0185] DETAILED DESCRIPTION

[0186] Antisense strand and sense strand

[0187] In one aspect, the application provides an RNA inhibitor that inhibits expression of an XDH gene.

[0188] In certain embodiments, the RNA inhibitor comprises a single-stranded oligonucleotide or a double-stranded ribonucleic acid (dsRNA) molecule for inhibiting expression of an XDH gene in a cell, such as a cell of a subject (e.g., a mammal). The dsRNA comprises an antisense strand having a region of complementarity that is complementary to at least a portion of an mRNA formed during expression of the XDH gene. The region of complementarity is about 12-30 nucleotides in length (e.g., about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, or 12 nucleotides in length).

[0189] The dsRNA comprises two RNA strands that are complementary and hybridize to form a duplex structure (region of complementarity) under conditions in which the dsRNA is used. One strand of the dsRNA (the antisense strand) comprises a region of complementarity that is substantially complementary, and usually completely complementary, to a target sequence. The target sequence can be derived from a sequence of an mRNA formed during expression of the XDH gene. The other strand (the sense strand) comprises a region that is complementary to the antisense strand, such that when combined under suitable conditions, the two strands can hybridize and form a duplex structure. Typically, the duplex structure is 12 to 30 base pairs in length. Similarly, the region of complementarity to the target sequence is 12 to 30 nucleotides in length.

[0190] In certain embodiments, the dsRNA is about 19 to about 23 nucleotides in length, or about 24 to about 30 nucleotides in length. Typically, the dsRNA is of sufficient length to serve as a substrate for Dicer enzyme. For example, it is well known in the art that dsRNAs greater than about 21-23 nucleotides in length can serve as substrates for Dicer. Those skilled in the art will also appreciate that the region of an RNA that is targeted for cleavage is typically a portion of a larger RNA molecule (usually an mRNA molecule). A "portion" of an mRNA target is a contiguous nucleotide of the mRNA target that is of sufficient length to allow it to serve as a substrate for RNAi directed cleavage (i.e., cleavage via the RISC pathway).

[0191] Those skilled in the art will also appreciate that the duplex region is the primary functional portion of the dsRNA, e.g., a duplex region of about 19 to about 30 base pairs, e.g., about 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20 base pairs. Thus, in one embodiment, an RNA molecule or complex of RNA molecules having a duplex region in excess of 30 base pairs is a dsRNA to the extent that it is a functional duplex (e.g., 15-30 base pairs) that is targeted for cleavage of the desired RNA.

[0192] In certain embodiments, there is at least about 80% base complementarity between the sense and antisense strands.

[0193] In certain embodiments, wherein the sense and antisense strands are each independently 15-30 nucleotides.

[0194] In certain embodiments, wherein the sense and antisense strands are each independently 17-25 nucleotides.

[0195] In certain embodiments, wherein the sense and antisense strands are each independently 19-23 nucleotides.

[0196] In some embodiments, the sense strand is selected from any one of SEQ ID NOs: 1-276, 829-835, or a sequence differing by no more than 3 nucleotides therefrom.

[0197] In some embodiments, the sense strand of the RNA inhibitor is selected from Table 1 or a sequence differing by one, two, or three nucleotides from each sequence in Table 1.

[0198] In some embodiments, the antisense strand is selected from any one of SEQ ID NOs: 277-552, 836-896, or a sequence differing by no more than 3 nucleotides therefrom.

[0199] In some embodiments, the antisense strand of the RNA inhibitor is selected from Table 1 or a sequence differing by one, two, or three nucleotides from each sequence in Table 1.

[0200] In some embodiments, both strands of the RNA inhibitor have 3’ overhangs of 2-3 nucleotides in length, or the sense strand has a 3’ overhang of 2-3 nucleotides in length, or the antisense strand has a 3’ overhang of 2-3 nucleotides in length.

[0201] In some embodiments, the RNA inhibitor has a 3’ overhang of 2 nucleotides in length only on the antisense strand.

[0202] In some embodiments, the sense and antisense strands of the RNA inhibitor are selected from the sequences in Table 1 or a sequence differing by one, two, or three nucleotides from each sequence in Table 1.

[0203] Table 1 Sense and Antisense Strands of RNA Inhibitors

[0204] wherein the capital letters "G", "C", "A", "T" and "U" each generally represent a nucleotide containing guanine, cytosine, adenine, thymine and uracil as the base, respectively; Am, Gm, Cm, Tm, Um represent 2'-methoxy modified nucleotides; Af, Gf, Cf, Uf represent 2'-fluoro modified nucleotides; the lower case letter s represents a phosphorothioate linkage between the two nucleotides immediately adjacent to the left and right of the letter s, and dA, dC, dT, dG represent 2'-hydroxyl deoxy modified nucleotides.

[0205] Modified nucleotides

[0206] To enhance the stability of the above-mentioned RNA inhibitors in vivo, the sense strand and the antisense strand of the above-mentioned RNA inhibitors can be modified without affecting or even enhancing their activity, wherein the nucleotides can have a modification group, and the whole chain or part of the chain can be modified. In some embodiments, one or more nucleotides in the sense strand and / or the antisense strand are modified to form modified nucleotides.

[0207] All the nucleotides in the small activating nucleic acid molecules described herein can be natural or unmodified nucleotides, or at least one nucleotide can be a chemically modified nucleotide, and the chemical modification is one or a combination of the following modifications:

[0208] (1) modification of the phosphodiester bond of the nucleotides in the nucleotide sequence of the small activating nucleic acid molecule;

[0209] (2) modification of the 2'-OH of the ribose in the nucleotide sequence of the small activating nucleic acid molecule;

[0210] (3) modification of the base in the nucleotide sequence of the small activating nucleic acid molecule.

[0211] The chemical modification of the present application is well known to those skilled in the art, and the modification of the phosphodiester bond refers to the modification of the oxygen in the phosphodiester bond, including phosphorothioate modification and boranated phosphate modification. Both modifications can stabilize the siRNA structure, maintain high specificity and high affinity of base pairing.

[0212] The ribose modification refers to the modification of 2'-OH in the pentose of nucleotide, that is, introducing certain substituents at the hydroxyl position of ribose, for example, 2'-fluorine modification, 2'-oxymethyl modification, 2'-oxyethylene methoxy modification, 2,4'-dinitrophenol modification, locked nucleic acid (LNA), 2'-amino modification, 2'-deoxy modification.

[0213] The base modification refers to the modification of the base of nucleotide, for example, 5'-bromouracil modification, 5'-iodouracil modification, N-methyl uracil modification, 2,6-diaminopurine modification.

[0214] These modifications can increase the bioavailability of the small activating nucleic acid molecule, improve the affinity with the target sequence, and enhance the ability to resist nuclease hydrolysis in cells.

[0215] The sense strand and the antisense strand in the structure of the RNA inhibitor provided by the present application have a length of 15-30, preferably 19-23, and are at least 85% base complementary to each other. In order to enhance the stability of the sense strand and the antisense strand in vivo, the sense strand and the antisense strand of the RNA inhibitor can be modified without affecting the activity or even enhancing the activity, and the nucleotides therein can have a modification group, and the whole chain or part of the chain can be modified, preferably all modified.

[0216] Part or all of the sense strand and the antisense strand of the RNA inhibitor of the present application are 2'-O-methyl nucleotides and / or 2'-deoxy-2'-fluoro nucleotides, and at least two consecutive phosphorothioate bonds exist between the nucleotides at the 5' end of the sense strand and the 3' end of the antisense strand, preferably the phosphate bonds between the last 3 consecutive nucleotides. For example, the phosphate bonds between the last 3 consecutive nucleotides at the 5' end of the sense strand are thio. For another example, the phosphate bonds between the last 3 consecutive nucleotides at the 5' end of the antisense strand are thio. For another example, the phosphate bonds between the last 3 consecutive nucleotides at the 3' end of the antisense strand are thio.

[0217] In certain embodiments, wherein the modified nucleotide is selected from the group consisting of: a deoxyribonucleotide, a nucleotide mimic, an abasic nucleotide, a 2'-modified nucleotide, a 3' to 3' linkage (inverted) nucleotide, a non-natural base containing nucleotide, a bridged nucleotide, a peptide nucleic acid (PNA), an unlocked nucleobase analog, a locked nucleotide, a 3'-0-methoxy (2' internucleosidic linkage) nucleotide, a 2'-F-arabino nucleotide, a 5'-Me / 2'-fluoro bearing nucleotide, a morpholino nucleotide, a vinylphosphonate deoxyribonucleotide, a vinylphosphonate containing nucleotide, and a cyclopropylphosphonate containing nucleotide.

[0218] In some screening embodiments, the sense and antisense strands of the RNAi agent are selected from the group consisting of the sequences in Table 1 or differ from each sequence in Table 1 by one, two, or three nucleotides.

[0219] In some embodiments, at least one of the -OH groups at the 2', 6', 14', and 16' positions of the sugar of the nucleotide at the 2nd, 6th, 14th, and 16th positions from the 5' end of the antisense strand can be replaced with fluorine. Further, at least one of the remaining -OH groups at the 2' position of the sugar of the nucleotide can be replaced with methoxy. Further still, at least one of the remaining -OH groups at the 2' position of the nucleotide can be deoxy.

[0220] In some embodiments, the RNAi agent that inhibits expression of the XDH gene, wherein the -OH groups at the 2', 6', 14', and 16' positions of the sugar of the nucleotide at the 14th and 16th positions from the 5' end of the antisense strand are replaced with fluorine. Further, the -OH groups at the 2' position of the sugar of the nucleotide at the 2nd and 6th positions from the 5' end of the antisense strand are not replaced with fluorine.

[0221] In some embodiments, the -OH groups at the 2', 6', 14', and 16' positions of the sugar of the nucleotide at the 2nd, 14th, and 16th positions from the 5' end of the antisense strand can be replaced with fluorine. Further, at least one of the remaining -OH groups at the 2' position of the sugar of the nucleotide can be replaced with methoxy. Further still, at least one of the remaining -OH groups at the 2' position of the nucleotide can be deoxy. Further, the -OH groups at the 6' position of the sugar of the nucleotide at the 6th position from the 5' end of the antisense strand are not replaced with fluorine.

[0222] In some embodiments, the -OH groups at the 2', 6', 14', and 16' positions of the sugar of the nucleotide at the 6th, 14th, and 16th positions from the 5' end of the antisense strand can be replaced with fluorine. Further, at least one of the remaining -OH groups at the 2' position of the sugar of the nucleotide can be replaced with methoxy. Further still, at least one of the remaining -OH groups at the 2' position of the nucleotide can be deoxy. Further, the -OH groups at the 2' and 6' positions of the sugar of the nucleotide at the 2nd and 6th positions from the 5' end of the antisense strand are not replaced with fluorine.

[0223] In some embodiments, at least one of the -OH groups at the 2', 6', 14', 16' positions of the nucleotide sugar groups starting at the 2nd, 6th, 14th, 16th nucleotide from the 5' end of the antisense strand is substituted with a fluoro. Further, at least one of the remaining -OH groups at the 2' position of the nucleotide sugar groups can be substituted with a methoxy. Further still, at least one of the remaining -OH groups at the 2' position of the nucleotide sugar groups can be deoxy. Further, there is no fluoro substitution at other positions.

[0224] In some embodiments, at least one of the -OH groups at the 2', 3', 4', 5', 6', 7', 8' positions of the nucleotide sugar groups starting at the 2nd, 3rd, 4th, 5th, 6th, 7th, 8th nucleotide from the 5' end of the antisense strand is deoxy. Further, at least one of the remaining -OH groups at the 2' position of the nucleotide sugar groups can be substituted with a methoxy. Further still, at least one of the remaining -OH groups at the 2' position of the nucleotide sugar groups can be fluoro. Further, there is no fluoro substitution at other positions.

[0225] For example, the -OH on the 2' position of the sugar of the 2nd, 3rdposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For another example, the -OH on the 2' position of the sugar of the 2nd, 4thposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For another example, the -OH on the 2' position of the sugar of the 2nd, 5thposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For another example, the -OH on the 2' position of the sugar of the 2nd, 6thposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For another example, the -OH on the 2' position of the sugar of the 2nd, 7thposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For another example, the -OH on the 2' position of the sugar of the 2nd, 8thposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For another example, the -OH on the 2' position of the sugar of the 3rd, 4thposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For another example, the -OH on the 2' position of the sugar of the 3rd, 5thposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For another example, the -OH on the 2' position of the sugar of the 3rd, 6thposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For another example, the -OH on the 2' position of the sugar of the 3rd, 7thposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For another example, the -OH on the 2' position of the sugar of the 3rd, 8thposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For another example, the -OH on the 2' position of the sugar of the 4th, 5thposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For another example, the -OH on the 2' position of the sugar of the 4th, 6thposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For another example, the -OH on the 2' position of the sugar of the 4th, 7thposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For another example, the -OH on the 2' position of the sugar of the 4th, 8thposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For another example, the -OH on the 2' position of the sugar of the 5th, 6thposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For another example, the -OH on the 2' position of the sugar of the 5th, 7thposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For another example, the -OH on the 2' position of the sugar of the 5th, 8thposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For another example, the -OH on the 2' position of the sugar of the 6th, 7thposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For another example, the -OH on the 2' position of the sugar of the 6th, 8thposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For another example, the -OH on the 2' position of the sugar of the 7th, 8thposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For example, the -OH on the 2' position of the sugar of the 2nd, 3rd, 6thposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For example, the -OH on the 2' position of the sugar of the 2nd, 3rd, 7thposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For example, the -OH on the 2' position of the sugar of the 2nd, 3rd, 8thposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For example, the -OH on the 2' position of the sugar of the 4th, 5th, 6thposition nucleotide counting from the 5' end of the antisense strand can be deoxy. For example, the -OH on the 2' position of the sugar of the 2nd, 3rd, 4th, 8thposition nucleotide counting from the 5' end of the antisense strand can be deoxy.For example, the -OH at the 2', 3', 4', 6' position of the sugar of the nucleotide at the 2nd, 3rd, 4th, 6th position from the 5' end of the antisense strand can be deoxy. For example, the -OH at the 2', 3', 4', 6' position of the sugar of the nucleotide at the 4th, 5th, 6th, 7th position from the 5' end of the antisense strand can be deoxy. For example, the -OH at the 2', 3', 4', 6' position of the sugar of the nucleotide at the 4th, 5th, 6th, 8th position from the 5' end of the antisense strand can be deoxy. Further, in the above examples, the other positions are not deoxy. Further, at least one of the -OH at the 2' position of the remaining sugar of the nucleotide can be substituted with methoxy. Further still, at least one of the -OH at the 2' position of the remaining nucleotides can be fluoro.

[0226] At least one of the -OH at the 2', 3', 4', 6' position of the sugar of the nucleotide at the 7th, 9th, 10th, 11th position from the 5' end of the sense strand can be fluoro.

[0227] In some embodiments, at least one of the -OH at the 2' position of the remaining sugar of the nucleotide of the sense strand, other than the nucleotide at the 7th, 9th, 10th, 11th position from the 5' end, can be substituted with methoxy.

[0228] In some embodiments, the -OH at the 2', 3', 4', 6' position of the sugar of the nucleotide at the 7th, 9th, 10th, 11th position from the 5' end of the sense strand is fluoro, and the -OH at the 2' position of the remaining sugar of the nucleotide of the sense strand is substituted with methoxy.

[0229] There are at least two consecutive phosphorothioate linkages between the nucleotides of the sense strand and / or the antisense strand.

[0230] Modified RNA inhibitors can include SX1555, SX1556, SX1557, SX1558, SX1559, SX1560, SX1561, SX1562, SX1563, SX1564, SX1565, SX1566, SX1567, SX1568, SX1569, SX1570, SX1571, SX1572, SX1573, SX1574, SX1575, SX1576, SX1577, SX1578, SX1579, SX1580, SX1581, SX5551, SX5552, SX5553, SX5554, SX5555, SX5556, SX5557, SX5558, SX5559, SX5560, SX5561, SX5562, SX5563, SX5564, SX5565, SX5566, SX5567, SX5568, SX5569, SX5570, SX5571, SX5572, SX5573, SX5574, SX5575, SX5576, SX5577, SX5578, X2702MW02, X3089MW02, X4299MW02, SX551MW02, SX582MW02, SX592MW02, or SX762MW02 as shown in Table 1.

[0231] RNA inhibitors conjugated to ligands

[0232] Another aspect of the RNA inhibitors of the application relates to the manner in which the interfering nucleic acid is conjugated to a ligand to enhance the stability, activity, cellular distribution, or cellular uptake of the RNAi agent.

[0233] In certain embodiments, the distribution, targeting, or stability of the RNA inhibitor is altered by the introduction of a ligand for a target tissue receptor. For example, a specific ligand can provide enhanced affinity for a selected target (e.g., a molecule, cell or cell type, compartment (e.g., a cellular or organ compartment, body tissue, organ, or region)) compared to the species in the absence of the ligand.

[0234] The ligand can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low density lipoprotein (LDL), or globulin); a carbohydrate (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactosamine, or hyaluronic acid); or a lipid. The ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid.

[0235] The ligand can also include a targeting group, such as a cell or tissue targeting agent that binds to a specified cell type, such as a kidney cell, for example, a lectin, glycoprotein, lipid, or protein, such as an antibody. The targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, multivalent fucose, glycosylated polyamino acid, multivalent galactose, transferrin, bisphosphate, polyglutamic acid, polyaspartic acid, lipid, cholesterol, steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic. In certain embodiments, the ligand is multivalent galactose, such as N-acetyl-galactosamine.

[0236] The sense and antisense strands of the RNA inhibitors of the application can be conveniently and routinely made by the techniques of solid-phase synthesis. Any other means for such synthesis known in the art, such as liquid phase synthesis or fermentation, can additionally or alternatively be used. The preparation of other oligonucleotides, such as phosphorothioates and alkylated derivatives, using similar techniques is known.

[0237] In certain embodiments, the oligonucleotides or linked nucleotides of the application can be synthesized by automated synthesizer using the phosphoramidite method derived from ligand-nucleoside phosphoramidite monomers, in addition to standard nucleoside phosphoramidite monomers and non-standard nucleoside phosphoramidite monomers that are commercially available and routinely used in oligonucleotide synthesis.

[0238] In certain embodiments, the ligand conjugation of the application is at the 5' end and / or 3' end of the antisense strand, and / or the 5' end and / or 3' end of the sense strand.

[0239] For example, the ligand structure can be coupled to the 5' end and / or 3' end of the sense strand; or the ligand structure can be coupled to the 5' end of the antisense strand and the ligand structure is coupled to the 3' end of the sense strand; or the ligand structure can be coupled to the 3' end of the antisense strand and the ligand is coupled to the 5' end of the sense strand; or the ligand structure is coupled to the 5' end and 3' end of the sense strand; or the ligand structure is coupled to the 3' end of the sense strand.

[0240] In certain embodiments, the ligand of the application comprises a L96 structure, such as shown in the following structural formula:

[0241] Pharmaceutical compositions

[0242] The application also includes pharmaceutical compositions comprising the RNA inhibitors of the application or a pharmaceutically acceptable salt thereof.

[0243] In one embodiment, this document provides pharmaceutical compositions comprising the RNA inhibitor described herein and pharmaceutically acceptable excipients. Pharmaceutical compositions comprising RNA inhibitors can be used for the prevention and / or treatment of XDH-related disorders, such as hyperuricemia. These pharmaceutical compositions are formulated according to a delivery mode. One example formulation is a composition for systemic administration via parenteral delivery, such as subcutaneous (SC), intramuscular (IM), or intravenous (IV) delivery. The pharmaceutical compositions of this application can be administered at doses sufficient to inhibit XDH gene expression.

[0244] Pharmaceutically acceptable "excipients" or "components" are pharmaceutically acceptable solvents, suspending agents, or any other pharmaceutically inert media for delivering one or more nucleic acids to animals. Excipients may be liquids or solids and are selected with consideration for the planned administration method to provide the required volume, consistency, etc., when combined with the nucleic acid and other components in a given pharmaceutical composition. RNA inhibitors may be delivered in a manner that targets specific tissues (e.g., hepatocytes).

[0245] In some embodiments, the pharmaceutical composition further comprises a delivery medium (such as nanoparticles, dendritic polymers, polymers, liposomes, or cationic delivery systems).

[0246] In some embodiments, the delivery medium includes liposomes.

[0247] In some embodiments, the delivery medium includes nanolipids capable of forming liposome-nucleic acid nanoparticles with nucleic acid molecules.

[0248] use

[0249] On the other hand, this application provides the use of the aforementioned RNA inhibitor that inhibits XDH gene expression or a pharmaceutically acceptable salt thereof in the preparation of a pharmaceutical composition thereof, wherein the pharmaceutical composition is used to prevent or treat a disease or pathology or to reduce the risk of a disease or pathology.

[0250] In some embodiments, the disease or pathology includes diseases or pathologies associated with elevated XDH levels.

[0251] In some embodiments, the disease or pathology includes hyperuricemia.

[0252] In some embodiments, the disease or pathology described includes gout, metabolic syndrome, kidney and cardiovascular diseases.

[0253] In some embodiments, the cardiovascular and cerebrovascular diseases include hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary heart disease, or aortic stenosis.

[0254] In another aspect, the present application provides a method of preventing or treating a disease, disorder, or syndrome, comprising administering to a subject in need thereof an effective amount of the aforementioned RNA inhibitor of XDH gene expression, pharmaceutically acceptable salt thereof, or the aforementioned pharmaceutical composition.

[0255] In certain embodiments, wherein the RNA inhibitor of XDH gene expression, pharmaceutically acceptable salt thereof, or the pharmaceutical composition is administered to the subject by subcutaneous, intravenous, oral, rectal, or intraperitoneal routes of administration.

[0256] In another aspect, the present application provides a method for inhibiting XDH mRNA or protein expression in a cell, tissue, or subject, comprising administering to a subject in need thereof an effective amount of the aforementioned RNA inhibitor of XDH gene expression, pharmaceutically acceptable salt thereof, or the aforementioned pharmaceutical composition.

[0257] In certain embodiments, wherein the cell is a liver cell.

[0258] In certain embodiments, wherein the tissue is liver tissue.

[0259] In certain embodiments, wherein the cell and tissue are ex vivo.

[0260] The cells suitable for treatment using the methods of the present application can be any cell that expresses an XDH gene, for example, a liver cell, a brain cell, a gall bladder cell, a heart cell, or a kidney cell, but preferably a liver cell. The cells suitable for use in the methods of the present application can be mammalian cells that, when contacted with a cell expressing an XDH gene, inhibit expression of the XDH gene (e.g., a human, primate, non-primate, or rat XDH gene) by at least about 50%, for example, as determined by PCR or branched DNA (bDNA)-based methods, or by protein-based methods, such as immunofluorescence assays, Western blotting, or flow cytometric techniques.

[0261] The term "inhibit" as used herein is used interchangeably with "reduce," "lower," "silence," "down-regulate," "suppress," and other similar terms, and includes any level of inhibition. XDH gene expression can be evaluated in terms of the level or change in level of any variable associated with XDH gene expression, e.g., XDH mRNA level or XDH protein level. This level can be analyzed in individual cells or in a population of cells, including, e.g., a sample derived from a subject. Inhibition can be evaluated by a decrease in the absolute or relative level of one or more variables associated with XDH expression as compared to a control level. The control level can be any type of control level employed in the art, e.g., a pre-dose baseline level or a level measured from a similar subject, cell or sample that has never been treated or treated with a control, such as, e.g., a buffer only control or an inactive agent control.

[0262] Inhibition of XDH gene expression can be manifested by a decrease in the amount of mRNA expressed by a first cell or population of cells in which the XDH gene is transcribed and which has been treated (e.g., by contacting one or more cells with an RNA inhibitor of the application, or by administering an RNA inhibitor of the application to a subject in which the cells are present) such that XDH gene expression is inhibited, as compared to a second cell or population of cells that is essentially identical to the first cell or population of cells but which has not been so treated (a control cell that has not been treated with an RNA inhibitor or has not been treated with an RNA inhibitor targeting the gene of interest). In preferred embodiments, inhibition is evaluated in a cell line that highly expresses XDH using the appropriate concentration of siRNA provided in Example 2, and the mRNA level in the intervened cell is expressed as a percentage of the mRNA level in the non-intervened control cell.

[0263] In other embodiments, inhibition of XDH gene expression can be evaluated by a decrease in a parameter that is functionally associated with XDH gene expression, e.g., XDH protein level in the blood or serum of a subject. XDH gene silencing can be determined in any cell that expresses XDH (endogenous or exogenous from an expression construct) and by any assay known in the art.

[0264] Inhibition of XDH protein expression can be manifested by a decrease in the level of XDH protein expressed by a cell or population of cells or a sample from a subject (e.g., the level of protein in a blood sample derived from a subject). As described above for evaluation of mRNA inhibition, inhibition of the protein expression level of a treated cell or population of cells can similarly be expressed as a percentage of the protein level of a control cell or population of cells, or a change in the level of protein in a sample from a subject (e.g., blood or serum derived therefrom).

[0265] Control cells, cell populations, or subject samples that can be used to assess XDH gene inhibition include cells, cell populations, or subject samples that have not been contacted with an RNAi agent of the application. For example, control cells, cell populations, or subject samples can be derived from an individual subject (e.g., a human or animal subject) or an appropriately matched population control prior to treatment with an RNAi agent.

[0266] XDH mRNA levels expressed by a cell or cell population can be determined using any method known in the art for assessing mRNA expression. For example, qRT-PCR can be used to assess a reduction in gene expression. A reduction in protein production can be assessed by any method known in the art, e.g., ELISA. In certain embodiments, a liver biopsy sample is used as tissue material to monitor a reduction in XDH gene or protein expression. In other embodiments, a blood sample is used as a subject sample to monitor a reduction in XDH protein expression.

[0267] Without wishing to be bound by any theory, the following examples are merely intended to illustrate the various technical solutions of the application, and are not intended to limit the scope of the application.

[0268] The application further provides the following embodiments:

[0269] 1. An RNA inhibitor for inhibiting expression of a XDH gene, comprising an antisense strand comprising a complementary region complementary to at least a portion of a mRNA encoding XDH, the complementary region having a length of 17-23 nucleotides, wherein the antisense strand comprises a nucleotide sequence of any one of SEQ ID NOs.: 277-552, 836-896, or a sequence differing by no more than 3 nucleotides therefrom.

[0270] 2. The RNA inhibitor for inhibiting expression of a XDH gene according to any one of embodiments 1, further comprising a sense strand, wherein the sense strand and the antisense strand have at least 80% base complementarity.

[0271] 3. The RNA inhibitor for inhibiting expression of a XDH gene according to any one of embodiments 1-2, wherein the sense nucleic acid strand and the antisense nucleic acid strand are present on two different nucleic acid strands.

[0272] 4. The RNA inhibitor for inhibiting expression of a XDH gene according to any one of embodiments 1-2, wherein the sense nucleic acid segment and the antisense nucleic acid segment are present on the same nucleic acid strand, wherein the complementary region of the sense nucleic acid segment and the antisense nucleic acid segment forms a double-stranded nucleic acid structure.

[0273] 5. The RNA inhibitor for inhibiting expression of a XDH gene according to any one of embodiments 1-4, wherein at least one strand has a 3' overhang of 0 to 6 nucleotides in length.

[0274] 6. The RNA suppressor of XDH gene expression according to any one of Embodiments 1-5, wherein both strands have 3' overhangs of 2-3 nucleotides in length, or the sense strand has a 3' overhang of 2-3 nucleotides in length, or the antisense strand has a 3' overhang of 2-3 nucleotides in length.

[0275] 7. The RNA suppressor of XDH gene expression according to any one of Embodiments 1-6, wherein the sense nucleic acid strand and the antisense nucleic acid strand are 16 to 35 nucleotides in length, respectively.

[0276] 8. The RNA suppressor of XDH gene expression according to any one of Embodiments 1-7, wherein one strand of the RNA suppressor of XDH gene expression has at least 75% homology or complementarity to any one of the nucleotide sequences selected from the group consisting of SEQ ID NOs: 553-828.

[0277] 9. The RNA suppressor of XDH gene expression according to any one of Embodiments 1-8, wherein the sense strand thereof is selected from any one of SEQ ID NOs: 1-276, 829-835 or a sequence that differs by no more than 3 nucleotides therefrom.

[0278] 10. The RNA suppressor of XDH gene expression according to any one of Embodiments 1-9, wherein at least one nucleotide is a chemically modified nucleotide.

[0279] 11. The RNA suppressor of XDH gene expression according to any one of Embodiments 1-10, wherein the chemical modification is at least one of the following modifications:

[0280] (1) modification of the phosphodiester linkage connecting the nucleotides in the nucleotide sequence of the RNA suppressor of XDH gene expression;

[0281] (2) modification of the 2'-OH of the ribose in the nucleotide sequence of the RNA suppressor of XDH gene expression;

[0282] (3) modification of the base in the nucleotide sequence of the RNA suppressor of XDH gene expression.

[0283] 12. The RNA suppressor of XDH gene expression according to any one of Embodiments 1-11, wherein there are at least two consecutive phosphorothioate linkages between the nucleotides of the sense strand and / or the antisense strand.

[0284] 13. The RNA suppressor of XDH gene expression of any one of embodiments 1-12, wherein there are at least two consecutive phosphorothioate linkages between three consecutive nucleotides at the 5' end of the sense strand and / or the 5' end of the antisense strand.

[0285] 14. The RNA suppressor of XDH gene expression of any one of embodiments 1-13, wherein the -OH at the 2' position of the sugar group of the 7th, 9th, 10th, 11th nucleotide from the 5' end of the sense strand is substituted with fluorine.

[0286] 15. The RNA suppressor of XDH gene expression of any one of embodiments 1-14, wherein the -OH at the 2' position of the sugar group of the 2nd, 14th, 16th nucleotide from the 5' end of the antisense strand is substituted with fluorine, or the -OH at the 2' position of the sugar group of the 14th, 16th nucleotide from the 5' end of the antisense strand is substituted with fluorine.

[0287] 16. The RNA suppressor of XDH gene expression of any one of embodiments 1-14, wherein the -OH at the 2' position of the sugar group of the 6th, 14th, 16th nucleotide from the 5' end of the antisense strand is substituted with fluorine.

[0288] 17. The RNA suppressor of XDH gene expression of any one of embodiments 1-14, wherein the -OH at the 2' position of the sugar group of the 2nd, 6th, 14th, 16th nucleotide from the 5' end of the antisense strand is substituted with fluorine.

[0289] 18. The RNA suppressor of XDH gene expression of any one of embodiments 1-17, wherein the -OH at the 2', 3', 4', 5', 6', 7', or 8' position of the sugar group of the 2nd, 3rd, 4th, 5th, 6th, 7th, or 8th nucleotide from the 5' end of the antisense strand is deoxy.

[0290] 19. The RNA suppressor of XDH gene expression of any one of embodiments 1-17, wherein the -OH at the 2', 3' position of the sugar group of the 2nd, 3rd nucleotide from the 5' end of the antisense strand is deoxy.

[0291] 20. The RNA suppressor of XDH gene expression of any one of embodiments 1-17, wherein the -OH at the 2', 4' position of the sugar group of the 2nd, 4th nucleotide from the 5' end of the antisense strand is deoxy.

[0292] 21. The RNA suppressor of XDH gene expression of any one of embodiments 1-17, wherein the -OH at the 2', 5' position of the sugar group of the 2nd, 5th nucleotide from the 5' end of the antisense strand is deoxy.

[0293] 22. The RNA suppressor of XDH gene expression of any one of embodiments 1-17, wherein the -OH at the 2'-position of the sugar of the 2nd, 6th nucleotide from the 5' end of the antisense strand is deoxy.

[0294] 23. The RNA suppressor of XDH gene expression of any one of embodiments 1-17, wherein the -OH at the 2'-position of the sugar of the 2nd, 7th nucleotide from the 5' end of the antisense strand is deoxy.

[0295] 24. The RNA suppressor of XDH gene expression of any one of embodiments 1-17, wherein the -OH at the 2'-position of the sugar of the 2nd, 8th nucleotide from the 5' end of the antisense strand is deoxy.

[0296] 25. The RNA suppressor of XDH gene expression of any one of embodiments 1-17, wherein the -OH at the 2'-position of the sugar of the 3rd, 7th nucleotide from the 5' end of the antisense strand is deoxy.

[0297] 26. The RNA suppressor of XDH gene expression of any one of embodiments 1-17, wherein the -OH at the 2'-position of the sugar of the 5th, 6th nucleotide from the 5' end of the antisense strand is deoxy.

[0298] 27. The RNA suppressor of XDH gene expression of any one of embodiments 1-17, wherein the -OH at the 2'-position of the sugar of the 5th, 8th nucleotide from the 5' end of the antisense strand is deoxy.

[0299] 28. The RNA suppressor of XDH gene expression of any one of embodiments 1-17, wherein the -OH at the 2'-position of the sugar of the 7th, 8th nucleotide from the 5' end of the antisense strand is deoxy.

[0300] 29. The RNA suppressor of XDH gene expression of any one of embodiments 1-17, wherein the -OH at the 2'-position of the sugar of the 2nd, 3rd, 6th nucleotide from the 5' end of the antisense strand is deoxy.

[0301] 30. The RNA suppressor of XDH gene expression of any one of embodiments 1-17, wherein the -OH at the 2'-position of the sugar of the 2nd, 3rd, 7th nucleotide from the 5' end of the antisense strand is deoxy.

[0302] 31. The RNA suppressor of XDH gene expression of any one of embodiments 1-17, wherein the -OH at the 2'-position of the sugar of the 2nd, 3rd, 8th nucleotide from the 5' end of the antisense strand is deoxy.

[0303] 32. The RNA inhibitor of XDH gene expression of any one of embodiments 1-17, wherein the -OH at the 2' position of the sugar of the 4th, 5th, 6th nucleotide from the 5' end of the antisense strand is deoxy.

[0304] 33. The RNA inhibitor of XDH gene expression of any one of embodiments 1-17, wherein the -OH at the 2' position of the sugar of the 2nd, 3rd, 4th, 8th nucleotide from the 5' end of the antisense strand is deoxy.

[0305] 34. The RNA inhibitor of XDH gene expression of any one of embodiments 1-17, wherein the -OH at the 2' position of the sugar of the 2nd, 3rd, 4th, 6th nucleotide from the 5' end of the antisense strand is deoxy.

[0306] 35. The RNA inhibitor of XDH gene expression of any one of embodiments 1-17, wherein the -OH at the 2' position of the sugar of the 4th, 5th, 6th, 7th nucleotide from the 5' end of the antisense strand is deoxy.

[0307] 36. The RNA inhibitor of XDH gene expression of any one of embodiments 1-17, wherein the -OH at the 2' position of the sugar of the 4th, 5th, 6th, 8th nucleotide from the 5' end of the antisense strand is deoxy.

[0308] 37. The RNA inhibitor of XDH gene expression according to any one of embodiments 1-36, comprising: X2702, X3089, X4299, SX551, SX582, SX592, SX762.

[0309] 38. The RNA inhibitor of XDH gene expression of any one of embodiments 1-37, comprising: SX1555, SX1556, SX1557, SX1558, SX1559, SX1560, SX1561, SX1562, SX1563, SX1564, SX1565, SX1566, SX1567, SX1568, SX1569, SX1570, SX1571, SX1572, SX1573, SX1574, SX1575, SX1576, SX1577, SX1578, SX1579, SX1580, SX1581, SX5551, SX5552, SX5553, SX5554, SX5555, SX5556, SX5557, SX5558, SX5559, SX5560, SX5561, SX5562, SX5563, SX5564, SX5565, SX5566, SX5567, SX5568, SX5569, SX5570, SX5571, SX5572, SX5573, SX5574, SX5575, SX5576, SX5577, SX5578, X2702MW02, X3089MW02, X4299MW02, SX551MW02, SX582MW02, SX592MW02, or SX762MW02.

[0310] 39. The RNA inhibitor of XDH gene expression of any one of embodiments 1-38, further comprising a ligand, wherein the ligand is conjugated to the sense strand and / or the antisense strand.

[0311] 40. The RNA inhibitor of XDH gene expression of embodiment 39, wherein the ligand is conjugated to the 5' end and / or the 3' end of the antisense strand.

[0312] 41. The RNA inhibitor of XDH gene expression of any one of embodiments 39-40, wherein the ligand is conjugated to the 5' end and / or the 3' end of the sense strand.

[0313] 42. The RNA inhibitor of XDH gene expression of any one of embodiments 39-41, wherein the ligand is conjugated to the 5' end of the antisense strand and the ligand is conjugated to the 3' end of the sense strand.

[0314] 43. The RNA inhibitor of XDH gene expression of any one of embodiments 39-42, wherein the ligand is conjugated to the 3' end of the antisense strand and the ligand is conjugated to the 5' end of the sense strand.

[0315] 44. The RNA suppressor of XDH gene expression according to any one of embodiments 39-42, wherein the ligand is conjugated to the 5' end and 3' end of the sense strand.

[0316] 45. The RNA suppressor of XDH gene expression according to any one of embodiments 39-44, the ligand further comprising a targeting unit for a structure to enhance uptake of the RNA suppressor by hepatocytes.

[0317] 46. The RNA suppressor of XDH gene expression according to embodiment 45, the targeting unit is selected from the group consisting of monosaccharides and derivatives thereof.

[0318] 47. The RNA suppressor of XDH gene expression according to embodiment 46, the monosaccharide is selected from one or more of the following structures: mannose, galactose, D-arabinose, glucose, fructose, xylose, glucosamine, ribose.

[0319] 48. The RNA suppressor of XDH gene expression according to any one of embodiments 46-47, the monosaccharide derivative is selected from the group consisting of mannose derivatives, galactose derivatives, glucose derivatives, ribose derivatives and other derivatives.

[0320] 49. The RNA suppressor of XDH gene expression according to any one of embodiments 46-48, the targeting unit is selected from the group consisting of galactose, galactosamine, N-acetylgalactosamine and derivatives thereof.

[0321] 50. The RNA suppressor of XDH gene expression according to any one of embodiments 46-49, the targeting unit is N-acetylgalactosamine and derivatives thereof.

[0322] 51. A pharmaceutical composition comprising the RNA suppressor of XDH gene expression according to any one of embodiments 1-50, and further comprising a delivery vehicle, and / or a physiologically acceptable excipient and / or carrier and / or diluent.

[0323] 52. The pharmaceutical composition according to embodiment 51, wherein the delivery vehicle comprises a liposome.

[0324] 53. The pharmaceutical composition according to embodiment 51, wherein the delivery vehicle comprises a nanolipid.

[0325] 54. Use of the RNA suppressor of XDH gene expression according to any one of embodiments 1-50, and the pharmaceutical composition according to any one of embodiments 51-53, in the manufacture of a medicament for preventing or treating, or reducing the risk of, a disease or pathology.

[0326] 55. The use according to embodiment 54, wherein the disease or pathology comprises a disease or pathology associated with elevated levels of XDH.

[0327] 56. The use according to any one of embodiments 54-55, wherein the disease or pathology comprises hyperuricemia.

[0328] 57. The use according to any one of embodiments 54-55, wherein the disease or pathology comprises gout, metabolic syndrome, renal and cardiovascular diseases.

[0329] 58. The use according to embodiment 57, wherein the cardiovascular and cerebrovascular diseases comprise hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary heart disease or aortic valve stenosis.

[0330] 59. A method of preventing or treating a disease, disorder or syndrome, the method comprising administering to a subject in need thereof an effective amount of the RNA inhibitor of XDH gene expression according to any one of embodiments 1-50, a pharmaceutically acceptable salt thereof or the pharmaceutical composition according to any one of embodiments 51-53.

[0331] 60. The method according to embodiment 59, wherein the RNA inhibitor of XDH gene expression, the pharmaceutically acceptable salt thereof or the pharmaceutical composition is administered to the subject by subcutaneous, intravenous, oral, rectal or intraperitoneal administration routes.

[0332] 61. A method for inhibiting XDH expression in a cell, tissue or subject, the method comprising administering to the cell, tissue or subject an effective amount of the RNA inhibitor of XDH gene expression according to any one of embodiments 1-50, a pharmaceutically acceptable salt thereof or the pharmaceutical composition according to any one of embodiments 51-53.

[0333] 62. The method according to embodiment 61, wherein the cell is a hepatocyte.

[0334] 63. The method according to any one of embodiments 61-62, wherein the tissue is a liver tissue.

[0335] 64. The method according to any one of embodiments 61-63, wherein the cell and tissue are ex vivo.

[0336] EXAMPLE

[0337] Example 1 Design and synthesis of unmodified sequences of xanthine dehydrogenase (XDH) siRNA

[0338] According to the XDH gene human transcript (from NCBI website, transcript number: NM_000379.4), the full-length region of human XDH mRNA (including 5'-UTR, CDS, 3'-UTR) was introduced into the custom-designed R and Python script to design the original sequence of siRNA targeting the xanthine dehydrogenase (XDH) gene, and artificial rational screening was performed to improve the success rate of screening.

[0339] The synthesis of the sense strand and the antisense strand of the siRNA duplex was performed by the classical solid-phase synthesis method of oligonucleotides. The starting cycle was to connect the solid-phase carrier, and then the nucleotide monomers were connected one by one from the 3'-5' direction according to the nucleotide arrangement order. Each nucleotide included four reactions of deprotection, coupling, capping, oxidation or thio, and finally the siRNA duplex sense strand or antisense strand molecule with a solid-phase carrier was obtained. The conditions of each step are as follows:

[0340] (1) Nucleotide monomer: dissolved in acetonitrile solution with a concentration of 0.1 mol / L.

[0341] (2) Deprotection: add 3% dichloroacetic acid-dichloromethane solution.

[0342] (3) Coupling reaction: add 0.3 mol / L ETT acetonitrile solution.

[0343] (4) Oxidation reaction: add 0.05 mol / L iodine tetrahydrofuran / pyridine / water (70 / 20 / 10, v / v / v) solution.

[0344] (5) Thio reaction: add 0.2 mol / L hydrogenated xanthan pyridine solution.

[0345] (6) Capping reaction: add 20% acetic anhydride-acetonitrile and pyridine / N-methyl imidazole / acetonitrile (10 / 14 / 76, v / v / v) solution.

[0346] The synthesized siRNA duplex sense strand or antisense strand with a solid-phase carrier was added to a 2ml centrifuge tube, 25-28% ammonia water was added, and the reaction was carried out at 55 degrees for 16 hours. After filtration, the solid-phase carrier was removed by washing with 1mL of 50% ethanol aqueous solution for 3 times. The filtrate was concentrated and dried to obtain the siRNA duplex sense strand or antisense strand crude product, which was purified. The siRNA duplex sense strand or antisense strand crude product was dissolved in 1ml of RNAase-free water, and then purified by ion pair reverse phase chromatography or ion exchange chromatography. The collected samples were detected, and the qualified samples were combined for desalination to obtain the siRNA duplex sense strand or antisense strand pure product containing amino modification.

[0347] The sense strand and antisense strand of the siRNA duplex were mixed according to a certain molar ratio, denatured at 90 degrees for 3 minutes, then cooled to room temperature, and finally freeze-dried to obtain the siRNA duplex pure product.

[0348] Example 2 Dual luciferase reporter gene system (DLR) screening of xanthine dehydrogenase (XDH) siRNA duplex

[0349] After trypsin digestion of Cos-7 cells at 2.5%, 3x10 4 cells were seeded into a 96-well plate, and after overnight culture in a 37°C incubator, they were used for siRNA transfection. The psiCHECK-2 plasmid containing the XDH mRNA sequence (Promega, C8021) was transfected into the well plate using Lipofectamine 2000 at a dose of 10 ng per well. At the same time, the siRNA to be tested was co-transfected into the above-mentioned well plate with the plasmid using Lipofectamine RNAiMax at a dose of 1 μl per well (final concentration 100 nM). The siRNA to be tested includes the siRNA of Table 2 and the nonsense control, wherein the sequence of the nonsense control is, sense strand (5'-3') UUCUCCGAACGUGUCACGUTT, antisense strand (5'-3') ACGUGACACGUUCGGAGAATT. The nonsense control serves as a negative control. Wherein XPC1 and XPC2 are positive sequences, the sequences and modifications of which are synthesized according to TW202214856A and WO2022271573A1, respectively.

[0350] Table 2 siRNA duplex sequence information for DLR screening

[0351] After 24 hours of transfection, the medium in the well plate was carefully aspirated, and the cells were washed with 50 μl of pre-warmed PBS. Then the Dual Luciferase Reporter Assay System (Promega, E1910) was used to detect the activity of the luciferase. According to the instructions of the kit, first, one volume of 5x passive lysis buffer was added to four volumes of distilled water, mixed well to make 1x passive lysis buffer, then 30 μl of the prepared 1x passive lysis buffer was added to each well, and the plate was shaken at low speed for 5 minutes to ensure complete lysis. After lysis, 20 μl of the lysate was added to a white 96-well non-enzyme labeled plate, and then 50 μl of LAR2 solution was added to the well plate. The plate was placed in a luminometer to read the fluorescence intensity of Renilla reniformis luciferase. Immediately after reading, 50 μl of StoP&Glo solution was added to the well plate, and the fluorescence intensity of Photinus pyralis luciferase was read again. The ratio of Renilla reniformis luciferase to Photinus pyralis luciferase fluorescence intensity was calculated and normalized to the nonsense control group to determine the knockdown level of the target gene. The calculation process is as follows:

[0352] Uniform Ren / Fir ratio: Ratio = Renilla (Renilla reniformis luciferase) / Firefly (Photinus pyralis luciferase).

[0353] The knockdown results of the genes are shown in Table 3. The siRNAs corresponding to X2702, X3071, X3089, X4199, X4299, SX152, SX156, SX158, SX295, SX322, SX348, SX349, SX352, SX551, SX582, SX583, SX589, SX591, SX592, SX595, SX596, SX597, SX598, SX755, SX761, SX762, SX763, and SX764, which have significant knockdown effects, were selected for further study.

[0354] Table 3 In vitro inhibition effect of duplex siRNA described in Table 2 DLR screening results

[0355] Example 3 Detection of the inhibition effect of duplex siRNA on human XDH gene overexpressed SKHep-1 cells

[0356] According to the embodiment 2, 28 pairs of siRNAs were selected to further verify their in vitro knockdown effect. Since the expression of XDH gene in most cell lines is low, the XDH gene overexpression cell line was used for testing. SKHep-1 cells were cultured in DMEM medium containing 10% fetal bovine serum in a 5% CO2, 37°C constant temperature incubator. When the cells were in the logarithmic growth phase and in good condition (70% confluence), transfection was performed. 5 μg of pcDNA3.1 TM 3.1 (+) (Invitrogen, V79020) plasmid containing human XDH mRNA sequence was transfected into SKHep-1 cells cultured in a 10 cm culture plate according to the instructions. After 24 hours of transfection, the cells were digested and collected, and 3.5 x 10 5 cells per well were plated into a 12-well plate. Then, the siRNAs to be tested and the nonsense control were transfected into the above-mentioned well plate using Lipofectamine RNAiMax at 1 μl per well (final concentration 1 nM). After 24 hours of transfection, the cells were lysed, and total RNA was extracted from the cells using a column extraction kit (Novozyme) for qPCR detection.

[0357] qPCR detection used human GAPDH gene as the housekeeping gene, and real-time fluorescent quantitative PCR reaction was performed using Taqman probe method in 7500 FAST fluorescent quantitative PCR instrument (ABI). The primer probe information is shown in Table 4, wherein the internal reference probe is labeled with VIC, and the target probe is labeled with FAM.

[0358] Table 4 Human XDH and GAPDH primer sequence information

[0359] After the PCR reaction, the 2-ΔΔCt (Livak) method was used to perform relative quantitative analysis and normalization to the control group to determine the knockdown level of the target gene using the housekeeping gene as the standard. The results are shown in Table 5. From the 28 pairs of siRNA sequences, X2702, X3071, X3089, X4199, X4299, SX352, SX551, SX582, SX592, SX597, SX755, SX761 and SX762 were further selected as siRNA molecules with better knockdown ability.

[0360] Table 5 Knockdown results of duplex siRNA on human XDH gene overexpression SKHep-1 cell line

[0361] Example 4 Inhibition effect detection of chemically modified duplex siRNA on monkey liver primary cells (PCH)

[0362] After screening 28 pairs of siRNA sequences in SKHep-1 overexpression cell lines, in order to further screen high-activity siRNA molecules, we optimized the sequences of the best 13 pairs of siRNA. The modified siRNA sequences are shown in Table 6. Among them, the capital letters "G", "C", "A", "T" and "U" each generally represent nucleotides containing guanine, cytosine, adenine, thymine and uracil as bases, respectively; Am, Gm, Cm, Tm, Um represent 2'-methoxy modified nucleotides; Af, Gf, Cf, Uf represent 2'-fluorine modified nucleotides; The lowercase letter s represents a phosphorothioate group between the two nucleotides adjacent to the letter s on the left and right. Among them, XPC1 and XPC2 are positive reference sequences, and their sequences and modifications are synthesized according to TW202214856A and WO2022271573A1, respectively.

[0363] Table 6 Modification sequences of 13 pairs of duplex siRNA

[0364] The application further tests the inhibitory effect of the above modified double-stranded siRNA sequences on monkey liver primary cells. After thawing, the thawing medium is immediately poured into the thawing medium, mixed evenly, centrifuged to collect the cells, and the collected cells are resuspended in the inoculation medium, and the cell density is adjusted to 3.5x10 5 cells per well in a 12-well plate, and 13 pairs of siRNAs to be tested and nonsense controls are transfected into the above-mentioned well plates using Lipofectamine RNAiMax at an amount of 1 μl per well (final concentration 10 nM and 0.1 nM). After 4-6 hours of transfection, replace with maintenance medium, continue to culture to 48 hours after transfection, lyse the cells, and use the column extraction kit (Novozyme) to extract total RNA from the cells for qPCR detection. The qPCR detection uses monkey GAPDH gene as the housekeeping gene, and uses Taqman probe method to perform real-time fluorescent quantitative PCR reaction in 7500 FAST fluorescent quantitative PCR instrument (ABI), and the primer probe information is shown in Table 7. Among them, the internal reference probe is labeled with VIC, and the target probe is labeled with FAM.

[0365] Table 7 Monkey XDH and GAPDH primer sequence information

[0366] After the PCR reaction, the relative quantitative analysis was performed using the 2- AACt (Livak) method with the housekeeping gene as a standard and normalized to the control group to determine the knockdown level of the target gene. The results are shown in Table 8. The results show that the above siRNA molecules can also significantly knock down the expression level of monkey XDH gene, and the highest knockdown level can reach 85%. The siRNA molecules corresponding to SX551MW02, SX582MW02, X4299MW02, SX592MW02 and SX762MW02 have a significant knockdown effect.

[0367] Table 8 Knockdown results of chemically modified duplex siRNA in monkey liver primary cells

[0368] Example 5 IC50 detection of chemically modified duplex siRNA in NCB-1 cell line

[0369] Based on the results of the above examples, we selected the top 5 sequences for testing the IC50 values of these siRNAs for target gene inhibition in the NCB-1 cell line. NCB-1 cells were cultured in DMEM medium containing 10% fetal bovine serum in a 5% CO2, 37°C constant temperature incubator, and when the cells were in the logarithmic growth phase and in good condition (70% confluence), the cells were digested and plated into 12-well plates at 3.5 x 105 cells per well. Five pairs of siRNAs to be tested and a nonsense control were transfected into the above-mentioned well plates using Lipofectamine RNAiMax at 1 μl per well (the final concentration is shown in Table 9). After 24 hours of transfection, the cells were lysed and total RNA was extracted using a column extraction kit (Novozyme) for qPCR detection.

[0370] The qPCR detection used human GAPDH as the housekeeping gene, and the Taqman probe method was used for real-time fluorescent quantitative PCR reaction in a 7500 FAST fluorescent quantitative PCR instrument (ABI). The primer probe information is shown in Table 3 above, wherein the internal reference probe is labeled with VIC and the target probe is labeled with FAM. After the PCR reaction, the relative quantitative analysis was performed using the 2- AACt (Livak) method with the housekeeping gene as a standard and normalized to the control group to determine the knockdown level of the target gene. The results in Table 9 show that the five pairs of siRNAs can knock down the expression level of human XDH in a dose-dependent manner.

[0371] Table 9 Knockdown effect of eight different concentrations of chemically modified duplex siRNA molecules on target genes

[0372] Example 6 In vivo inhibition effect detection of duplex siRNA single dose in HDI mouse model

[0373] To further verify the knockdown effect of siRNAs screened in vitro, we coupled GalNac monomers to the 3' end of the sense strand of 7 pairs of siRNAs (Table 10) and tested their knockdown effect in vivo. The structure of GalNac monomer L96 and the structure of siRNA coupled with L96 are shown in Figures 1 and 2, respectively. Among them, the capital letters "G", "C", "A", "T" and "U" each generally represent nucleotides containing guanine, cytosine, adenine, thymine and uracil as bases, respectively; Am, Gm, Cm, Tm, Um represent 2'-methoxy modified nucleotides; Af, Gf, Cf, Uf represent 2'-fluorine modified nucleotides; the lowercase letter s represents a phosphorothioate group between the two nucleotides adjacent to the letter s on the left and right.

[0374] Firstly, the present application constructs a mouse model transiently expressing human XDH gene to test the change of human XDH expression level in mice. Three days before administration, male NOD SCID mice are injected with PCDNA3.1 plasmid containing human XDH mRNA sequence through high-pressure injection in the tail vein to construct a mouse model transiently expressing human XDH gene, which are referred to as hXDH HDI mice. On day 0, the mice are injected intravenously with 3 mg / kg of the above siRNA solution or phosphate buffer (control group), and the injection volume is 10 ml / kg. The mice are sacrificed on day 7, and the liver tissue is taken for qPCR detection of human XDH mRNA expression. After tissue lysis, total RNA is extracted using a column extraction kit (Novozyme) for qPCR detection. The housekeeping gene is selected as the KanR gene expressed by the PCDNA3.1 plasmid, and the primer probe sequence is as follows:

[0375] F primer sequence (5'-3'): CGTTGGCTACCCGTGATATT (SEQ ID NO: 909);

[0376] R primer sequence (5'-3'): CTCGTCAAGAAGGCGATAGAAG (SEQ ID NO: 910);

[0377] Probe sequence (5'-3'): CCGCTTCCTCGTGCTTTACGGTAT (SEQ ID NO: 911).

[0378] The qPCR detection results (Figure 3) show that the 7 pairs of siRNA molecules coupled with GalNac significantly knock down the expression of human XDH mRNA in mice, and the optimal sequence can achieve a knockdown effect of 82%.

[0379] Table 10 Sequence information of 7 pairs of duplex siRNA conjugated GalNac molecules

[0380] Example 7 In vivo inhibition effect detection of duplex siRNA in transient human XDH gene mouse model

[0381] To further screen siRNAs with excellent in vivo effect, the present application selected 5 pairs of siRNA conjugated molecules (X4299MW02, SX551MW02, SX582MW026, SX592MW026 and SX762MW02) with the best performance from 7 pairs of siRNA molecules conjugated with GalNac, and administered multiple doses in a transient mouse model to detect their in vivo knockdown effect. Consistent with the model of Example 5, we used a transient human XDH gene mouse model, and intravenously injected these mice with 0.3 mg / kg and 1 mg / kg of the above siRNA solution or phosphate buffer (control group) on day 0, with an injection volume of 10 ml / kg. The mice were sacrificed on day 7, and the liver tissue was qPCR detected for human XDH mRNA expression. The qPCR detection results (Figure 4) showed that the 5 pairs of siRNA conjugated with GalNac knocked down the expression of human XDH mRNA in mice in a dose-dependent manner. At a dose of 1 mg / kg, the best sequence still achieved a knockdown effect of more than 50%.

[0382] Example 8 In vivo inhibition effect detection of duplex siRNA in XDH gene humanized mouse model

[0383] To further confirm the effectiveness of the screened sequences, we used an XDH gene humanized mouse model to test the in vivo efficacy of 2 pairs of GalNac conjugated siRNAs (SX551MW02 and SX592MW02 and X4299MW02). Through CRISPR-Cas9 technology, a human XDH mRNA full-length sequence was inserted destructively at the second exon of the mouse XDH gene to obtain an XDH gene humanized mouse. After one week of adaptation, the mice were subcutaneously injected with 3 mg / kg of the above siRNA solution or phosphate buffer (control group) on day 0, with an injection volume of 10 ml / kg. The mice were sacrificed on days 7, 14, 21 and 28, and the liver tissue was qPCR detected for human XDH mRNA expression. The housekeeping gene was selected as mouse GAPDH gene, and the primer probe sequence was as follows:

[0384] F primer sequence (5'-3'): GAACGGATTTGGCCGTATTG (SEQ ID NO: 912);

[0385] R primer sequence (5'-3'): GTGAGTGGAGTCATACTGGAAC (SEQ ID NO: 913);

[0386] Probe sequence (5'-3'): AGTGGCAAAGTGGAGATTGTTGCC (SEQ ID NO: 914).

[0387] The results of qPCR detection show (Figure 5) that the two pairs of siRNAs coupled with GalNac, SX551MW02 and SX592MW02, significantly knocked down the expression of human XDH mRNA in the humanized transgenic mice, and still maintained about 80% mRNA knockdown effect on the 21st day after administration, and performed better than that of the Yangshen PC1. Therefore, the siRNAs provided in the present application have the effect of long-term inhibition of the target sequence.

[0388] Example 9. Screening of modified sequences on JIMT cells

[0389] The modified sequences in Table 11 were screened for in vitro activity. JIMT cells were cultured in DMEM medium containing 10% fetal bovine serum in a 5% CO2, 37°C constant temperature incubator, and when the cells were in the logarithmic growth phase and in good condition (70% confluence), the cells were digested and plated into 12-well plates at 3.5x105 cells per well. Five pairs of siRNAs to be tested and a nonsense control were transfected into the above-mentioned well plates using Lipofectamine RNAiMax at 1 μl per well (the final concentration is shown in Table 12). The cells were lysed 24 hours after transfection, and total RNA was extracted from the cells using a column extraction kit (Novozyme) for qPCR detection. The structure of GalNac monomer L96 and the structure of the coupled L96 siRNA molecule are shown in Figures 1 and 2, respectively. Among them, the capital letters "G", "C", "A", "T" and "U" each generally represent nucleotides containing guanine, cytosine, adenine, thymine and uracil as bases, respectively; Am, Gm, Cm, Tm, Um represent 2'-methoxy modified nucleotides; Af, Gf, Cf, Uf represent 2'-fluorine modified nucleotides; the lowercase letter s represents a phosphorothioate group between the two nucleotides adjacent to the letter s on the left and right; dT is a thymine deoxynucleotide.

[0390] qPCR detection with human GAPDH gene as housekeeping gene, using Taqman probe method in 7500 FAST fluorescence quantitative PCR instrument (ABI) to carry out real-time fluorescence quantitative PCR reaction, primer probe information as shown in Table 3, wherein the internal reference probe is labeled with VIC, and the target probe is labeled with FAM. After the PCR reaction, the 2-ΔΔCt (Livak) method was used to carry out relative quantitative analysis and normalization to the control group to determine the knockdown level of the target gene with the housekeeping gene as the standard.

[0391] Table 11. Modified duplex RNA sequence information

[0392] Table 12. In vitro effect of modified duplex RNA

[0393] The foregoing detailed description has been presented for purposes of illustration and description. It is not intended to be exhaustive or to limit the claims to the precise form disclosed. Various modifications are possible in light of the foregoing detailed description, as can be apparent to those of ordinary skill in the art. The disclosure and its attendant claims are to be accorded the scope of the appended claims and their equivalents.

Claims

1. An RNA inhibitor of XDH gene expression comprising an antisense strand comprising a complementary region complementary to at least a portion of a mRNA encoding XDH, the complementary region being 17-23 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence of any one of SEQ ID NOs.: 277-552, 836-896 or a sequence differing by no more than 3 nucleotides therefrom.

2. The RNA inhibitor of XDH gene expression according to claim 1, characterized in that: It further comprises a sense strand, wherein there is at least 80% base complementarity between the sense strand and the antisense strand.

3. The RNA inhibitor of XDH gene expression according to any one of claims 1-2, wherein the sense nucleic acid strand and the antisense nucleic acid strand are present on two different nucleic acid strands.

4. The RNA inhibitor of XDH gene expression according to any one of claims 1-2, wherein the sense nucleic acid segment and the antisense nucleic acid segment are present on the same nucleic acid strand, wherein the complementary region of the sense nucleic acid segment and the antisense nucleic acid segment forms a double-stranded nucleic acid structure.

5. The RNA suppressor of XDH gene expression according to any one of claims 1 to 4, characterized in that At least one strand has a 3' overhang of 0 to 6 nucleotides in length.

6. The RNA suppressor of XDH gene expression according to any one of claims 1 to 5, wherein Both strands have a 3' overhang of 2-3 nucleotides in length, or the sense strand has a 3' overhang of 2-3 nucleotides in length, or the antisense strand has a 3' overhang of 2-3 nucleotides in length.

7. The RNA suppressor of XDH gene expression according to any one of claims 1 to 6, wherein The sense nucleic acid strand and the antisense nucleic acid strand are 16 to 35 nucleotides in length, respectively.

8. The RNA inhibitor for inhibiting XDH gene expression according to any one of claims 1-7, characterized in that, One strand of the RNA inhibitor of XDH gene expression has at least 75% homology or complementarity to a nucleotide sequence selected from any one of SEQ ID NOs: 553-828.

9. The RNA inhibitor for inhibiting XDH gene expression according to any one of claims 1-8, characterized in that, The sense strand thereof is selected from any one of SEQ ID NOs: 1-276, 829-835 or a sequence differing by no more than 3 nucleotides therefrom.

10. The RNA inhibitor of XDH gene expression according to any one of claims 1-9, wherein at least one nucleotide is a chemically modified nucleotide.

11. The RNA inhibitor of XDH gene expression according to any one of claims 1-10, wherein the chemical modification is at least one of the following: (1) a modification to the phosphodiester linkage connecting the nucleotides in the nucleotide sequence of the RNA inhibitor of XDH gene expression; (2) a modification to the 2'-OH of the ribose in the nucleotide sequence of the RNA inhibitor of XDH gene expression; (3) a modification to the base in the nucleotide sequence of the RNA inhibitor of XDH gene expression.

12. The RNA inhibitor of XDH gene expression according to any one of claims 1-11, wherein there are at least two consecutive phosphorothioate linkages between the nucleotides of the sense strand and / or the antisense strand.

13. The RNA inhibitor of XDH gene expression according to any one of claims 1-12, wherein there are at least two consecutive phosphorothioate linkages between the three consecutive nucleotides at the end of the sense strand and / or the end of the antisense strand.

14. The RNA inhibitor of XDH gene expression of any one of claims 1-13, wherein the -OH at the 2' position of the sugar of the 7th, 9th, 10th, 11th nucleotide from the 5' end of the sense strand is substituted with fluorine.

15. The RNA inhibitor of XDH gene expression of any one of claims 1-14, wherein the -OH at the 2' position of the sugar of the 2nd, 14th, 16th nucleotide from the 5' end of the antisense strand is substituted with fluorine, or the -OH at the 2' position of the sugar of the 14th, 16th nucleotide from the 5' end of the antisense strand is substituted with fluorine.

16. The RNA inhibitor of XDH gene expression of any one of claims 1-14, wherein the -OH at the 2' position of the sugar of the 6th, 14th, 16th nucleotide from the 5' end of the antisense strand is substituted with fluorine.

17. The RNA inhibitor of XDH gene expression of any one of claims 1-14, wherein the -OH at the 2' position of the sugar of the 2nd, 6th, 14th, 16th nucleotide from the 5' end of the antisense strand is substituted with fluorine.

18. The RNA inhibitor of XDH gene expression of any one of claims 1-17, wherein the -OH at the 2' position of the sugar of the 2nd, 3rd, 4th, 5th, 6th, 7th, or 8th nucleotide from the 5' end of the antisense strand is deoxy.

19. The RNA inhibitor of XDH gene expression of any one of claims 1-17, wherein the -OH at the 2' position of the sugar of the 2nd, 3rd nucleotide from the 5' end of the antisense strand is deoxy.

20. The RNA inhibitor of XDH gene expression of any one of claims 1-17, wherein the -OH at the 2' position of the sugar of the 2nd, 4th nucleotide from the 5' end of the antisense strand is deoxy.

21. The RNA inhibitor of XDH gene expression of any one of claims 1-17, wherein the -OH at the 2' position of the sugar of the 2nd, 5th nucleotide from the 5' end of the antisense strand is deoxy.

22. The RNA inhibitor of XDH gene expression of any one of claims 1-17, wherein the -OH at the 2' position of the sugar of the 2nd, 6th nucleotide from the 5' end of the antisense strand is deoxy.

23. The RNA inhibitor of XDH gene expression of any one of claims 1-17, wherein the -OH at the 2' position of the sugar of the 2nd, 7th nucleotide from the 5' end of the antisense strand is deoxy.

24. The RNA inhibitor of XDH gene expression of any one of claims 1-17, wherein the -OH at the 2' position of the sugar of the 2nd, 8th nucleotide from the 5' end of the antisense strand is deoxy.

25. The RNA inhibitor of XDH gene expression of any one of claims 1-17, wherein the -OH at the 2' position of the sugar of the 3rd, 7th nucleotide from the 5' end of the antisense strand is deoxy.

26. The RNA suppressor of XDH gene expression according to any one of claims 1-17, wherein the -OH group at the 2' position of the sugar of the 5th, 6th nucleotide from the 5' end of the antisense strand is replaced by deoxy.

27. The RNA suppressor of XDH gene expression according to any one of claims 1-17, wherein the -OH group at the 2' position of the sugar of the 5th, 8th nucleotide from the 5' end of the antisense strand is replaced by deoxy.

28. The RNA suppressor of XDH gene expression according to any one of claims 1-17, wherein the -OH group at the 2' position of the sugar of the 7th, 8th nucleotide from the 5' end of the antisense strand is replaced by deoxy.

29. The RNA suppressor of XDH gene expression according to any one of claims 1-17, wherein the -OH group at the 2' position of the sugar of the 2nd, 3rd, 6th nucleotide from the 5' end of the antisense strand is replaced by deoxy.

30. The RNA suppressor of XDH gene expression according to any one of claims 1-17, wherein the -OH group at the 2' position of the sugar of the 2nd, 3rd, 7th nucleotide from the 5' end of the antisense strand is replaced by deoxy.

31. The RNA suppressor of XDH gene expression according to any one of claims 1-17, wherein the -OH group at the 2' position of the sugar of the 2nd, 3rd, 8th nucleotide from the 5' end of the antisense strand is replaced by deoxy.

32. The RNA suppressor of XDH gene expression according to any one of claims 1-17, wherein the -OH group at the 2' position of the sugar of the 4th, 5th, 6th nucleotide from the 5' end of the antisense strand is replaced by deoxy.

33. The RNA suppressor of XDH gene expression according to any one of claims 1-17, wherein the -OH group at the 2' position of the sugar of the 2nd, 3rd, 4th, 8th nucleotide from the 5' end of the antisense strand is replaced by deoxy.

34. The RNA suppressor of XDH gene expression according to any one of claims 1-17, wherein the -OH group at the 2' position of the sugar of the 2nd, 3rd, 4th, 6th nucleotide from the 5' end of the antisense strand is replaced by deoxy.

35. The RNA suppressor of XDH gene expression according to any one of claims 1-17, wherein the -OH group at the 2' position of the sugar of the 4th, 5th, 6th, 7th nucleotide from the 5' end of the antisense strand is replaced by deoxy.

36. The RNA suppressor of XDH gene expression according to any one of claims 1-17, wherein the -OH group at the 2' position of the sugar of the 4th, 5th, 6th, 8th nucleotide from the 5' end of the antisense strand is replaced by deoxy.

37. The RNA suppressor of XDH gene expression according to any one of claims 1-36, comprising the following sense and antisense strand combination: X2702: a sense strand as shown in SEQ ID NO 78 and an antisense strand as shown in SEQ ID NO: 354; X3089: a sense strand as shown in SEQ ID NO 93 and an antisense strand as shown in SEQ ID NO: 369; ​ ​ X4299: the sense strand as shown in SEQ ID NO 142 and the antisense strand as shown in SEQ ID NO: 418; SX551 : the sense strand as shown in SEQ ID NO 216 and the antisense strand as shown in SEQ ID NO: 492; SX582: the sense strand as shown in SEQ ID NO 228 and the antisense strand as shown in SEQ ID NO: 504; SX592: the sense strand as shown in SEQ ID NO 234 and the antisense strand as shown in SEQ ID NO: 510; or, SX762: the sense strand as shown in SEQ ID NO 272 and the antisense strand as shown in SEQ ID NO:

548.

38. The RNA inhibitor of XDH gene expression of claims 1-36, comprising a combination of the following sense strand and antisense strand: SX1555: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 836; SX1556: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 837; SX1557: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 838; SX1558: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 839; SX1559: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 840; SX1560: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 841; SX1561 : the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 842; SX1562: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 843; SX1563: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 844; SX1564: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 845; SX1565: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 846; SX1566: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 847; SX1567: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 848; SX1568: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 849; SX1569: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 850; SX1570: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 851 ; SX1571 : the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 852; SX1572: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 853; SX1573: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 854; SX1574: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 855; SX1575: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 856; SX1576: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 857; SX1577: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 858; SX1578: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 859; SX1579: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 860; SX1580: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 861 ; SX1581 : the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 862; SX5552: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 863; SX5553: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 864; SX5554: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 865; SX5555: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 866; SX5556: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 867; SX5557: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 868; SX5558: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 869; SX5559: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 870; SX5560: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 871 ; SX5561 : the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 872; SX5562: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 873; SX5563: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 874; SX5564: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 875; SX5565: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 876; SX5566: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 877; SX5567: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 878; SX5568: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 879; SX5569: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 880; SX5570: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 881 ; SX5571 : the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 882; SX5572: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 883; SX5573: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 884; SX5574: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 885; SX5575: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 886; SX5576: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 887; SX5577: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 888; SX5578: the sense strand as shown in SEQ ID NO: 829 and the antisense strand as shown in SEQ ID NO: 889; X2702MW02: a sense strand as shown in SEQ ID NO: 830 and an antisense strand as shown in SEQ ID NO: 890; X3089MW02: a sense strand as shown in SEQ ID NO: 831 and an antisense strand as shown in SEQ ID NO: 891 ; X4299MW02: a sense strand as shown in SEQ ID NO: 832 and an antisense strand as shown in SEQ ID NO: 892; SX551MW02: a sense strand as shown in SEQ ID NO: 829 and an antisense strand as shown in SEQ ID NO: 893; SX582MW02: a sense strand as shown in SEQ ID NO: 833 and an antisense strand as shown in SEQ ID NO: 894; SX592MW02: a sense strand as shown in SEQ ID NO: 834 and an antisense strand as shown in SEQ ID NO: 895; or SX762MW02: a sense strand as shown in SEQ ID NO: 835 and an antisense strand as shown in SEQ ID NO:

896.

39. The RNA inhibitor of XDH gene expression of any one of claims 1-38, further comprising a ligand, wherein the ligand is conjugated to the sense strand and / or the antisense strand.

40. The RNA inhibitor of XDH gene expression of claim 39, wherein the ligand is conjugated to the 5' end and / or the 3' end of the antisense strand.

41. The RNA inhibitor of XDH gene expression of any one of claims 39-40, wherein the ligand is conjugated to the 5' end and / or the 3' end of the sense strand.

42. The RNA inhibitor of XDH gene expression of any one of claims 39-41, wherein the ligand is conjugated to the 5' end of the antisense strand and the ligand is conjugated to the 3' end of the sense strand.

43. The RNA inhibitor of XDH gene expression of any one of claims 39-42, wherein the ligand is conjugated to the 3' end of the antisense strand and the ligand is conjugated to the 5' end of the sense strand.

44. The RNA inhibitor of XDH gene expression of any one of claims 39-42, wherein the ligand is conjugated to the 5' end and the 3' end of the sense strand.

45. The RNA inhibitor of XDH gene expression of any one of claims 39-44, the ligand further comprising a targeting unit for a structure that enhances uptake of the RNA inhibitor by hepatocytes.

46. The RNA inhibitor of XDH gene expression of claim 45, the targeting unit selected from the group consisting of monosaccharides and derivatives thereof.

47. The RNA inhibitor of XDH gene expression of claim 46, the monosaccharide selected from one or more of the following structures: mannose, galactose, D-arabinose, glucose, fructose, xylose, glucosamine, ribose.

48. The RNA inhibitor of XDH gene expression according to any one of claims 46-47, wherein the monosaccharide derivative is selected from the group consisting of mannose derivatives, galactose derivatives, glucose derivatives, ribose derivatives and other derivatives.

49. The RNA inhibitor of XDH gene expression according to any one of claims 46-48, wherein the targeting unit is selected from the group consisting of galactose, galactosamine, N-acetylgalactosamine and derivatives thereof.

50. The RNA inhibitor of XDH gene expression according to any one of claims 46-49, wherein the targeting unit is N-acetylgalactosamine and derivatives thereof.

51. A pharmaceutical composition comprising the RNA inhibitor of XDH gene expression according to any one of claims 1-50, and further comprising a delivery vehicle, and / or a physiologically acceptable excipient and / or carrier and / or diluent.

52. The pharmaceutical composition according to claim 51, wherein the delivery vehicle comprises a liposome.

53. The pharmaceutical composition according to claim 51, wherein the delivery vehicle comprises a nanolipid.

54. Use of the RNA inhibitor of XDH gene expression according to any one of claims 1-50 and of the pharmaceutical composition according to any one of claims 51-53 for the manufacture of a medicament for preventing or treating, or reducing the risk of, a disease or pathology.

55. The use according to claim 54, wherein the disease or pathology comprises a disease or pathology associated with elevated levels of XDH.

56. The use according to any one of claims 54-55, wherein the disease or pathology comprises hyperuricemia.

57. The use according to any one of claims 54-55, wherein the disease or pathology comprises gout, metabolic syndrome, renal and cardiovascular diseases.

58. The use according to claim 57, wherein the cardiovascular disease comprises hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary heart disease or aortic valve stenosis.

59. A method for preventing or treating a disease, disorder or syndrome, the method comprising administering to a subject in need thereof an effective amount of the RNA inhibitor of XDH gene expression according to any one of claims 1-50, a pharmaceutically acceptable salt thereof or the pharmaceutical composition according to any one of claims 51-53.

60. The method according to claim 59, wherein the RNA inhibitor of XDH gene expression, the pharmaceutically acceptable salt thereof or the pharmaceutical composition is administered to the subject in a subcutaneous, intravenous, oral, rectal or intraperitoneal administration route.

61. A method for inhibiting XDH expression in a cell, tissue or subject, the method comprising administering to the cell, tissue or subject an effective amount of the RNA inhibitor of XDH gene expression according to any one of claims 1-50, a pharmaceutically acceptable salt thereof or the pharmaceutical composition according to any one of claims 51-53.

62. The method according to claim 61, wherein the cell is a hepatocyte.

63. The method of any one of claims 61-62, wherein the tissue is liver tissue.

64. The method of any one of claims 61-63, wherein the cells and tissue are ex vivo.

Images