Cells capable of secreting factor viii by driving of f8 gene with exogenous promoter

Abstract

The present disclosure provides isolated induced pluripotent stem cells (iPSCs) having an exogenous promoter operably inserted upstream of a translation initiation region of a gene encoding Factor VIII (FVIII) on genomic DNA, the exogenous promoter being capable of driving the gene to secrete FVIII; a composition comprising the cells; and a pharmaceutical composition comprising FVIII-secreting cells induced from the composition.

Description

Cells capable of secreting factor VIII by driving the F8 gene with an exogenous promoter

[0001] The present disclosure relates to isolated induced pluripotent stem cells (iPSCs), which have an exogenous promoter operably inserted upstream of the translation initiation region of a gene encoding factor VIII (FVIII) on genomic DNA, where the exogenous promoter is capable of driving the gene to secrete FVIII, and to compositions comprising the cells, as well as to FVIII-secreting cells (e.g., vascular endothelial progenitor cells) induced from the compositions, and to pharmaceutical compositions comprising the cells.

[0002] Hemophilia A is a congenital bleeding disorder caused by a deficiency of the coagulation factor factor VIII (FVIII) protein, which is involved in blood clotting. The gene is called F8, and the protein is called FVIII. It is estimated that there are approximately 650,000 patients worldwide. Standard treatments for hemophilia A include FVIII replacement therapy and administration of antibody drugs that mimic FVIII function (e.g., Hemlibra), but these are symptomatic treatments and no fundamental cure has been established.

[0003] Gene therapy using adeno-associated virus vectors has also been attempted, in which an attempt has been made to generate cells in which a B domain-deleted F8 (BDD) is operably linked to the native F8 promoter sequence (see Patent Document 1).

[0004] Non-Patent Document 1 discloses a technique for replacing the native F8 promoter sequence with EF1α in order to examine F8 mutations in cells. However, although this document uses iPS cells, the iPS cells do not produce FVIII.

[0005] WO2017 / 075619

[0006] Blood Adv., 7(22):7017-7027, 2023

[0007] The present disclosure provides cells (particularly pluripotent stem cells) suitable for testing FVIII secretion and functionality, the cells having an exogenous promoter operably linked upstream of F8 on their genomic DNA. The cells are preferably endothelial progenitor cells or endothelial cells, or have the ability to differentiate into endothelial progenitor cells or endothelial cells.

[0008] The present invention provides the following: (1) A composition comprising isolated pluripotent stem cells, the pluripotent stem cells having an exogenous promoter operably inserted upstream of the translation initiation region of a gene (F8) encoding factor VIII (FVIII) on their genomic DNA, the exogenous promoter being capable of driving the gene, thereby allowing the cells to secrete FVIII. (2) The composition according to (1), wherein the upstream region of the translation initiation region is 1 bp to 1,000 bp upstream from the translation initiation site. (3) The composition according to (1) or (2), wherein the exogenous promoter is a constitutive promoter. (4) The composition according to any one of (1) to (3), wherein the isolated pluripotent stem cells have been cloned. (5) The composition according to any one of (1) to (4), wherein the composition is in a frozen state. (6) The composition according to any one of (1) to (5), for use in inducing vascular endothelial progenitor cells. (7) A method for producing vascular endothelial progenitor cells, comprising culturing the composition according to any one of (1) to (6) above under conditions suitable for culture, and differentiating pluripotent stem cells contained in the composition into vascular endothelial progenitor cells under conditions suitable for differentiation to obtain vascular endothelial progenitor cells. (8) The method according to (7) above, further comprising confirming that the pluripotent stem cells in the composition according to any one of (1) to (6) above produce FVIII before culturing. (9) A pharmaceutical composition comprising vascular endothelial progenitor cells obtained by the method according to (7) or (8) above, or comprising vascular endothelial progenitor cells having an exogenous promoter operably inserted upstream of the translation initiation region of a gene encoding factor VIII (FVIII) in genomic DNA, the exogenous promoter driving the gene to secrete FVIII. (10) The pharmaceutical composition according to (9) above, for use in treating patients with hemophilia A.

[0009] 1 shows an example of an experimental system in the present disclosure, the expression of factor VIII in promoter-modified induced pluripotent stem cells (iPSCs) and endothelial progenitor cells (iEPCs), and the engraftment of iEPCs in iEPC-transplanted mice.

[0010] As used herein, the term "cell" refers to a basic unit of life that contains at least genomic DNA, cytoplasm, and a membrane structure that encases these. Examples of cells include, but are not limited to, prokaryotic cells and eukaryotic cells. Genomic DNA includes endogenous DNA of the cell, but is not necessarily composed solely of endogenous factors of the cell.

[0011] As used herein, a "cell population" refers to a composition comprising a plurality of cells.

[0012] As used herein, "isolation" refers to the separation of a cell of interest from at least one other component. Isolation can be performed, for example, by separating and removing a cell in its natural state from other components with which it exists in its natural state. Isolation can be performed, for example, by separating and removing a portion of cells from a multicellular organism. Techniques that involve isolated cells are referred to herein as in vitro techniques.

[0013] As used herein, the terms "genome modification" and "genome editing" are used interchangeably and refer to the introduction of mutations at desired locations (target regions) in a genome. Genome modification may involve the use of sequence-specific nucleic acid cleaving molecules (e.g., sequence-specific or sequence-dependent endonucleases) designed to cleave target sites. In a preferred embodiment, genome modification may involve the use of nucleases engineered to cleave DNA in the target region. In a preferred embodiment, genome modification may involve the use of nucleases engineered to cleave target sequences with specific base sequences in the target region (e.g., TALENs or zinc finger nucleases (ZFNs)). In a particularly preferred embodiment, genome modification may involve the use of nucleases engineered to cleave target sequences with specific base sequences in the target region (e.g., CRISPR-Cas systems). Typically, a double-strand break (DSB) is induced in the target sequence using a site-specific nuclease, and the genome is then repaired by endogenous cellular processes such as homology-directed repair (HDR) and non-homologous end-joining repair (NHEJ). NHEJ is a repair method that joins the ends of double-strand breaks without using donor DNA, and insertions and / or deletions (indels) are frequently induced during repair. HDR is a repair mechanism that uses donor DNA and can also introduce desired mutations into the target region. A preferred example of a genome modification technique is the CRISPR / Cas system (more preferably the CRISPR / Cas9 system).

[0014] The term "target sequence" refers to a DNA sequence in a genome that is the target of cleavage by a sequence-specific nucleic acid cleaving molecule. When the sequence-specific nucleic acid cleaving molecule is a Cas protein, the target sequence refers to a DNA sequence in a genome that is the target of cleavage by the Cas protein. When a Cas9 protein is used as the Cas protein, the target sequence must be a sequence adjacent to the 5' side of a protospacer adjacent motif (PAM). The target sequence is typically selected as a sequence of 17 to 30 bases (preferably 18 to 25 bases, more preferably 19 to 22 bases, and even more preferably 20 bases) immediately adjacent to the 5' side of the PAM. Known design tools such as CRISPR DESIGN (crispr.mit.edu / ) can be used to design the target sequence.

[0015] As used herein, the terms "exogenous" and "exogenous" are used interchangeably to refer to the artificial introduction of a gene or nucleic acid into a target cell by genetic engineering, gene transfer, or other manipulation, as well as the gene or nucleic acid artificially introduced into a target cell and the protein expressed therefrom. An exogenous gene may be operably linked to a promoter sequence that drives expression of the gene.

[0016] As used herein, "endogenous" or "intrinsic" means something that is naturally present in a cell.

[0017] As used herein, the term "derived" refers to the animal species from which the cells are obtained. For example, human-derived cells refer to cells obtained from a human or a cell line obtained by subculturing the cells, e.g., human cells.

[0018] As used herein, "FVIII" refers to an important cofactor for blood coagulation. It functions in the circulating blood by forming a complex with von Willebrand factor (vWF). The gene encoding FVIII is F8, which is located on the X chromosome in humans. The blood concentration of FVIII is approximately 100-250 ng / mL (approximately 1 nM), with a half-life of approximately 12 hours. A deficiency or reduced activity of FVIII leads to a blood coagulation disorder called hemophilia A. While FVIII-encoding mRNA has been identified in various tissues, the primary site of FVIII production is believed to be the sinusoidal endothelial cells of the liver. FVIII has 2,351 amino acids, including the signal peptide. For example, human FVIII may have the amino acid sequence registered under NCBI Reference Sequence: NP_000123.1. Upon reaching the endoplasmic reticulum lumen, the 19-amino acid signal peptide is cleaved, and asparagine residues are glycosylated. The resulting FVIII, consisting of 2332 amino acids, has the A1, a1, A2, a2, B, a3, A3, C1, and C2 domains in that order. Furthermore, FVIII interacts with the chaperone proteins calnexin, calreticulin, and immunoglobulin-binding protein (BiP) in the endoplasmic reticulum lumen to form a higher-order structure. FVIII binds to ERGIC-53 / MCFD2 and is transported from the endoplasmic reticulum to the Golgi apparatus. In the Golgi apparatus, FVIII undergoes O-glycosylation, mannose modification of asparagine residues, and sulfation of tyrosine residues. It is then cleaved at Arg1313 or Arg1648 in the B domain of FVIII, resulting in a heavy and light chain duplex, which is then transported to the Cu complex. 2+FVIII forms a heterodimer through ionic bonds via α-thrombin. It is then secreted extracellularly and stabilized by binding to vWF in the circulating blood. Thus, FVIII is secreted extracellularly via a complex intracellular mechanism. α-thrombin cleaves FVIII at the a1-A2, a2-B, and a3-A3 boundaries. Cleavage at the a3-A3 boundary dissociates FVIII from vWF. Cleavage at the a1-A2 boundary exposes the FIXa-binding site of FVIII. These cleavages result in the formation of FVIIIa, a heterotrimer of A1, A2, and A3-C1-C2. FVIIIa binds to activated FIXa and FX, promoting FX activation. This results in a thrombin burst, leading to the formation of a fibrin clot and hemostasis. FVIIIa is inactivated by activated protein C via cleavage between the A1 and a1 regions and within the A2 region. It is thought that the time from activation to inactivation of FVIIIa is about one minute. Emicizumab is a bispecific antibody that binds to FIXa and FX, which can activate FX even in the absence of FVIIIa, and is used as a treatment for hemophilia A. Thus, the role of FVIIIa in the blood coagulation reaction is thought to be to bind to FIXa and FX and activate FX.

[0019] As used herein, "hemophilia A" refers to a disorder characterized by impaired blood coagulation due to quantitative and / or qualitative abnormalities in blood coagulation factor VIII, resulting in bleeding tendency. Hemophilia A is a congenital disorder with X-linked recessive inheritance, and bleeding symptoms are present from early childhood. Females are usually carriers, and hemophilia is rare, whereas hemophilia A occurs primarily in males. Hemophilia A is characterized by a wide range of mutations, including deletions, point mutations, insertions, and inversions. Intron 22 inversions are found in approximately 40% of severe cases. Clinical severity correlates with FVIII activity levels, with FVIII levels classified as severe (<1%), moderate (1% to <5%), and mild (5% to <40%) compared to normal FVIII levels. When FVIII inhibitors are expressed in the body, hemostasis management with FVIII replacement alone becomes difficult, and inhibitor neutralization therapy or bypass hemostatic therapy may be performed. Hemophilia A also includes acquired hemophilia, a condition in which the immune system recognizes FVIII as a foreign substance and eliminates it, resulting in hemostatic failure. Von Willebrand disease, a hereditary bleeding disorder caused by a deficiency of von Willebrand factor, exhibits a similar bleeding tendency, but is diagnostically distinct from hemophilia A. Hemophilia A is typically diagnosed by testing platelet count, activated partial thromboplastin time (APTT), prothrombin time (PT), and fibrinogen levels. Hemophilia A is suspected if only the APTT is prolonged above the reference range. Hemophilia A can be diagnosed by testing coagulation factor activity levels below 40% of the normal range. In 20% to 30% of hemophilia A patients receiving FVIII replacement therapy develop antibodies (FVIII inhibitors) that eliminate FVIII. Therefore, FVIII inhibitor titration is performed in patients undergoing replacement therapy.

[0020] <Cells of the Present Disclosure> The present disclosure relates to cells that contain an F8 gene operably linked to an exogenous promoter (preferably a constitutive promoter) upstream of the F8 gene and express FVIII. The F8 gene encodes functional FVIII, and under appropriate circumstances, functional FVIII is produced from the gene and secreted from the cell. The F8 gene is preferably located on chromosome X q28. More specifically, the F8 gene is located at chrX:154835788-155022753 on the genomic reference sequence GRCh38 / hg38.

[0021] The cell may be a pluripotent stem cell. The pluripotent stem cell may be, for example, an induced pluripotent stem cell (iPS cell). The cell may also be a cell committed to a mesodermal lineage (e.g., a mesodermal cell). The cell may also be an endothelial progenitor cell or a vascular endothelial cell.

[0022] From the perspective of use in human medicine, the cells of the present disclosure are preferably human cells and cloned. Accordingly, in one aspect, the cells are cloned human cells, such as cloned human pluripotent stem cells, preferably cloned human induced pluripotent stem cells (iPS cells). iPS cells can be derived from fibroblasts, peripheral blood mononuclear cells, or the like. In one aspect, iPS cells are derived from non-hematological cells. In one aspect, iPS cells are derived from vascular endothelial cells. In one aspect, iPS cells are derived from fibroblasts. In the present disclosure, human pluripotent stem cells capable of secreting active FVIII are used. Being able to assess the presence and / or activity of FVIII secreted into the culture supernatant can facilitate cell quality control.

[0023] In the case of allogeneic transplantation, the cells are low-immunogenic cells. For example, cells in which HLA class I and II or their production have been disrupted are low-immunogenic to adaptive immunity. More specifically, cells in which β2-microglobulin has been disrupted no longer express HLA class I and do not activate adaptive immunity. Furthermore, cells in which CIITA has been disrupted no longer express HLA class II and do not activate adaptive immunity. Examples of such modifications include cell surface expression of immune checkpoint molecules and molecules that emit "don't eat me" signals, such as CD47. Cells that are suitable for allogeneic transplantation due to such modifications are called low-immunogenic cells, and cells that can be administered to various other individuals are called universal donor cells. In the present disclosure, the cells are preferably low-immunogenic cells, and more preferably universal donor cells.

[0024] In the present disclosure, the cells are preferably pluripotent stem cells, more preferably iPS cells, and preferably have the ability to differentiate into vascular endothelial progenitor cells. In the present disclosure, the cells contain an F8 gene operably linked to an exogenous constitutive promoter upstream of the F8 gene and express (particularly secrete) FVIII. Therefore, cells can be selected as therapeutically advantageous cells by selecting cells based on FVIII expression or FVIII coagulation activity. When producing a cell preparation containing vascular endothelial progenitor cells, preferably, pluripotent stem cells are grown and maintained, and the cells are differentiated into vascular endothelial progenitor cells during preparation. This is because vascular endothelial progenitor cells have a lower proliferation capacity than pluripotent stem cells, and it is advantageous to grow and maintain pluripotent stem cells.

[0025] In view of the above, the cells are preferably vascular endothelial cells or vascular endothelial progenitor cells, or have the ability to differentiate into vascular endothelial cells or vascular endothelial progenitor cells. As long as the cells are capable of secreting FVIII, they do not necessarily need to be vascular endothelial cells or vascular endothelial progenitor cells or have the ability to differentiate into such cells. However, by being vascular endothelial cells or vascular endothelial progenitor cells, or having the ability to differentiate into vascular endothelial cells or vascular endothelial progenitor cells, the in vivo environment can be more closely mimicked. When it is not necessary to mimic the in vivo environment, the cells may be appropriately induced to differentiate into cells suitable for engraftment and then administered. Pluripotent stem cells and mesodermal cells typically have the ability to differentiate into vascular endothelial cells or vascular endothelial progenitor cells.

[0026] Induction of differentiation of pluripotent stem cells into vascular endothelial cells includes, for example, induction of mesodermal cells from pluripotent stem cells, induction of vascular endothelial progenitor cells from mesodermal cells, and induction of vascular endothelial cells from vascular endothelial progenitor cells. Vascular endothelial progenitor cells and vascular endothelial cells can be induced from pluripotent stem cells by the method disclosed in Nat Cell Biol. 2015, 17, 994-1003. Pluripotent stem cells are cultured under conditions suitable for their culture (e.g., in the presence of TeSR and Y-27632). Induction of mesodermal cells from pluripotent stem cells can also be achieved by culturing the pluripotent stem cells in the presence of mesodermal induction factors. Examples of mesodermal induction factors include GSK3 inhibitors (e.g., CHIR99021, CP21) and bone morphogenetic proteins (e.g., BMP4). Vascular endothelial progenitor cells can be induced from mesodermal cells by culturing the mesodermal cells in the presence of vascular endothelial progenitor cell-inducing factors, such as vascular endothelial growth factor (VEGF) and a cyclic AMP inducer or protein kinase A activator (e.g., forskolin and cyclic AMP).

[0027] In the present disclosure, for clinical use, it is preferable to administer cells after differentiation into, for example, vascular endothelial progenitor cells or vascular endothelial cells. Differentiation into vascular endothelial progenitor cells or vascular endothelial cells can be examined by the expression of vascular endothelial cell markers. Vascular endothelial cell markers are not particularly limited, but may include one or more or all selected from the group consisting of CD31, CD34, CD105, CD144, CD309, Tie2, PECAM1, and von Willebrand factor (vWF). Vascular endothelial progenitor cell markers are not particularly limited, but may include one or more or all selected from the group consisting of CD34, CD133, and CD309. Vascular endothelial progenitor cells are broadly classified into early endothelial progenitor cells and late endothelial progenitor cells, with early endothelial progenitor cells expressing CD133 and late endothelial progenitor cells being CD133-negative. CD133-positive early endothelial progenitor cells are present in a low proportion. Vascular endothelial cells and vascular endothelial progenitor cells may be negative for one or more markers selected from the group consisting of CD43 and CD45. In the method disclosed in Nat Cell Biol. 2015, 17, 994-1003, vascular endothelial progenitor cells may be obtained as CD34-positive cells, and vascular endothelial cells may be obtained as CD34-positive / CD31-positive cells.

[0028] The promoter may be either a constitutive promoter or a promoter induced by a drug (e.g., tetracycline, doxycycline, etc.). Examples of constitutive promoters include virus-derived promoters such as CMV (cytomegalovirus), RSV (respiratory synchronous virus), and SV40 (simian virus 40), ubiquitous promoters such as actin promoters (e.g., β-actin promoter), PGK promoter, CAG promoter, ubiquitin promoter, and EF (elongation factor) 1α promoter, and promoters that drive gene expression in vascular endothelial cells such as CD144 promoter, CD309 promoter, Tie2 promoter, and plasminogen activator inhibitor 1 (PAI-1) promoter. Constitutive promoters may be promoters (e.g., Tie2 promoters) that constitutively express an operably linked gene in endothelial progenitor cells or vascular endothelial cells. Furthermore, any promoter that constitutively expresses an operably linked gene in the cell type to which the compound is administered may be used, and those skilled in the art can appropriately select and use such promoters. Examples of inducible promoters include tetracycline response elements (TRE3G promoters), Cumate operator sequences, λ operator sequences (12×λOp), and heat shock promoters. In the present disclosure, the promoter is preferably a constitutive promoter. A constitutive promoter is a promoter that is active in most tissues or organs under physiological conditions. A constitutive promoter is also called a ubiquitous promoter. A constitutive promoter may be, for example, a promoter for a housekeeping gene. While there are no particular limitations on the promoter, as long as transcription is not significantly inhibited in endothelial progenitor cells and / or vascular endothelial cells, it is preferred that the cells constitutively produce FVIII in vivo, and the promoter is preferably a constitutive promoter.

[0029] The promoter is operably inserted upstream of the translation initiation region of the gene (F8) encoding FVIII, and can drive mRNA expression from F8. Intracellular translation of FVIII proprotein from the mRNA, followed by post-translational modification and cleavage, results in extracellular secretion of heterodimeric FVIII. Thus, cells possess the ability to execute a series of steps, from translation of FVIII from the mRNA to post-translational modification and cleavage, and extracellular secretion of heterodimeric FVIII with heavy and light chains. While endothelial progenitor cells and endothelial cells are believed to possess this ability, the present disclosure also demonstrates that pluripotent stem cells, such as iPS cells, possess this ability. This discovery is significant.

[0030] The promoter can be introduced into an appropriate location upstream of the translation initiation region of the gene (F8) encoding FVIII so that it can operably drive mRNA expression from F8. The insertion position can typically be within about 1 kbp upstream of the translation initiation site. In this specification, the term "about" is used to mean a range of ±50% of the following numerical value. In a preferred embodiment, the upstream of the translation initiation region may be, for example, a region 1 to 500 bp upstream of the translation initiation region, for example, a region 50 to 300 bp upstream, or for example, a region 100 to 200 bp upstream, such as a region 110 to 190 bp upstream, 120 to 180 bp upstream, 130 to 170 bp upstream, a region 140 to 160 bp upstream, a region 50 to 160 bp upstream, a region 80 to 160 bp upstream, a region 120 to 160 bp upstream, or a site about 150 bp upstream (e.g., 148 bp upstream). In one embodiment, the upstream of the translation initiation region is, for example, not 140 to 147 bp upstream, but 142 to 145 bp upstream, or 143 to 144 bp upstream, or not 144 bp upstream.

[0031] <Composition Comprising Cells of the Present Disclosure> The present disclosure provides a composition comprising cells of the present disclosure. Preferred cells in this composition are as described above. As described above, it is desirable to maintain the cells as cells suitable for proliferation and maintenance. Therefore, the cells are, for example, pluripotent stem cells. A cell preparation is prepared in a timely manner from a master cell bank and a working cell bank comprising the cells. When the cell preparation is prepared from pluripotent stem cells, the master cell bank and the working cell bank comprise pluripotent stem cells. The master cell bank and the working cell bank can be cryopreserved. Therefore, the present disclosure provides a frozen composition comprising cells of the present disclosure (or a composition comprising cells of the present disclosure in a frozen state). The present disclosure also provides the use of a frozen composition comprising cells of the present disclosure (or a composition comprising cells of the present disclosure in a frozen state) as a master cell bank and a working cell bank.

[0032] In the production of cell products, a cell bank created from cells close to the original with a low passage number is typically called a master cell bank. Master cell banks are typically produced in 200 to 400 volumes. Cell products are typically produced from working cell banks, which are further created from the master cell bank. Working cell banks are typically produced in 200 to 400 volumes from a single master cell bank. Characterization of master cell banks and working cell banks increases the likelihood of providing cells of equivalent quality as cell products. In addition to general safety testing of master cell banks and working cells, testing for extracellular secretion of FVIII and the clotting activity of secreted FVIII can further enhance quality control of master cell banks and working cells. From this perspective, for master cell banks and working cells containing pluripotent stem cells, the extracellular secretion of FVIII, which can express clotting activity, and quality control through testing this secretion are important for cell preservation and quality control.

[0033] As described above, such compositions are used to induce FVIII-expressing cells suitable for transplantation, such as tissue stem cells, progenitor cells, or somatic cells, preferably vascular endothelial precursor cells (or vascular endothelial cells). Examples of FVIII-expressing cells include, but are not limited to, mesenchymal stem cells, as well as vascular endothelial precursor cells and vascular endothelial cells. Since vascular endothelial cells can be induced after the induction of vascular endothelial precursor cells, the induction of vascular endothelial cells is encompassed by the induction of vascular endothelial precursor cells. Cells suitable for transplantation preferably have the ability to engraft in vivo after administration.

[0034] From the master cell bank and working cell bank containing the pluripotent stem cells of the present disclosure, vascular endothelial progenitor cells or vascular endothelial cells can be derived, isolated or purified, and formulated with pharmaceutically acceptable carriers and / or additives. Thus, according to the present disclosure, there is provided a pharmaceutical composition comprising vascular endothelial progenitor cells or vascular endothelial cells having an exogenous promoter operably inserted upstream of the translation initiation region of a gene encoding factor VIII (FVIII) in genomic DNA, the exogenous promoter driving the gene to secrete FVIII. This pharmaceutical composition can be used to treat hemophilia A patients or hemophilia A.

[0035] In patients with hemophilia A who have FVIII inhibitors (e.g., FVIII inhibitor levels of 5 BU / mL or higher), the pharmaceutical composition of the present disclosure can be used in combination with FVIII inhibitor neutralization therapy or hemostatic therapy using bypassing agents. Neutralization therapy aims to neutralize the inhibitor by providing or administering large amounts of FVIII to the patient. Bypassing agents are preparations containing factors that bypass the FVIII pathway and promote hemostasis. Examples of bypassing agents include platelet-derived activated prothrombin complex concentrate (aPCC), recombinant activated FVII (rFVIIa), or crystal-derived FX-activated FVII (FVIIa / FX). Platelet-derived activated prothrombin complex concentrates typically contain prothrombin, FVI, FIX, and FX, as well as thrombin, FVIIa, FIXa, and FXa.

[0036] Example 1: Incorporation of a promoter upstream of an F8 element In this example, a promoter is incorporated upstream of an F8 element to enhance expression of the F8 element. In this example, an inducible promoter is used as the promoter, but a constitutive promoter may also be used.

[0037] Methods Cell Culture Human KOLF2-C1 iPSCs were cultured in StemFit AK02N medium (REPROCELL, Yokohama, Kanagawa, Japan; RCAK02N) on iMatrix-511 (Laminin511E8; Matrixome, Suita, Osaka, Japan; 892011)-coated dishes according to the manufacturer's protocol. When subculturing iPSCs, 10 μM of ROCK inhibitor Y-27632 (Fujifilm Wako Pure Chemical Industries, Osaka, Japan; 036-24023) was added to the medium for 1 day after passaging. Doxycycline was used at 0.5 μg / ml when necessary.

[0038] Construction of knock-in targeting vector: A Tet-cassette was knocked into the X chromosome (hg19) at coordinate 154250974, located 148 bases upstream of the translation start site of the F8 gene. To generate the knock-in targeting vector, 1 kb genomic fragments upstream (X chromosome: 154250980-154251979, hg19) and downstream (X chromosome: 154249975-154250974, hg19) of the knock-in site were synthesized. A fragment containing a bidirectional tetracycline response element (TRE) and a Tet-controlled transactivator expression cassette (see Figure 1A) was inserted between the two genomic fragments in pUC57 (GenScript Biotech Corp.), yielding phF8-HA-TetEm. When Venus was used as a reporter for Tet-dependent induction, Venus was inserted between the TRE and the upstream genomic fragment, yielding phF8-HA-TetVenus. It should be noted that Figures 1A and 1B are provided only for the purpose of illustrating this experimental system, and the invention in this disclosure is not limited thereto.

[0039] Transfection and screening of targeted clones. The oligonucleotide sequences used for crRNA and PCR primers are shown in Table 1. For knock-in of the targeting vector into iPSCs, 1.5 μl of 62 μM Alt-R Sp Cas9 Nuclease V3 (Integrated DNA Technologies, Coralvill, IA, USA; 108158), 1.1 μl of 100 μM tracrRNA (Integrated DNA Technologies; 1072532), and 1.1 μl of 100 μM crRNA (Integrated DNA Technologies) were mixed at 1 × 10 6The iPSCs were mixed with 20 μg of targeting vector and electroporated using the Neon transfection system (Thermo Fisher Scientific, Waltham, MA, USA) at 1,400 V, 20 ms, and one pulse. iPSCs were plated on iMatrix-511-coated dishes in the presence of 10 μM ROCK inhibitor Y-27632 and selected with 0.25 μg / ml puromycin. Puromycin-resistant iPSC colonies were isolated, expanded, and genomic DNA was extracted by phenol / chloroform extraction and ethanol precipitation. Targeted clones were screened by PCR using KOD-FX polymerase (Toyobo, Osaka, Japan; KFX-101). To screen for upstream and downstream recombination (primer sets I and II in Figures 1B and 1C), the PCR conditions were as follows: 1 cycle at 94°C for 2 min, followed by 35 cycles of denaturation at 98°C for 10 s, annealing at 55°C for 30 s, and extension at 68°C for 2 min, followed by a final extension at 68°C for 3 min. To amplify the full-length knock-in sequence (primer set III in Figures 1B and 1C), the same conditions were used, except that the extension time between PCR cycles was 8 min and the final extension time after PCR cycles was 5 min.

[0040] The nucleotide sequences used were as follows:

[0041] Result 1: Whether the donor DNA sequence contained in the targeting vector had been integrated into the gRNA target site upstream of F8 was determined by the presence and size of amplification products obtained by PCR using Venus-derived fluorescence and primer sets I to III. As shown in Figure 1C, Venus-positive clones of control iPS cells derived from healthy individuals were found to yield amplification products with nucleic acid lengths suggesting that the Venus gene was present. These clones also emitted Venus-derived fluorescence in the presence of Dox (see Figure 1D). In this way, modified iPSCs capable of overexpressing F8 were obtained. The resulting clones were cryopreserved until use.

[0042] Example 2: Expression of F8 Next, the expression of F8 was confirmed. In this example, unmodified endothelial progenitor cells (iEPCs) and modified endothelial progenitor cells were induced from unmodified iPSCs (iPSCs) and the modified iPSCs described above, and the expression and activity of F8 were measured.

[0043] iEPCs were induced from iPSCs according to Cowen et al., Nat Cell Biol. 2015, 17, 994-1003. Specifically, iEPCs were cultured on Matrigel (Corning)-coated dishes at a density of 17,000 cells / cm in AK02N (Ajinomoto) medium containing 10 μM Y-27632 (Fujifilm). 2 iPSCs were seeded at a density of 1000 μg / ml. The next day, the medium was replaced with N2B27 medium (Life Technologies, similar to that described by Cowen et al.) containing 1 μM CP21R7 (Selleck) and 25 ng / ml BMP4 (R&D Systems). After 3 days, the medium was replaced with StemPro-34 SFM medium (Thermo Fisher Scientific) supplemented with 50 ng / ml VEGF (PeproTech) and 2 μM forskolin (Sigma-Aldrich), and the cells were cultured for 2 days (with medium changes every other day). The resulting endothelial progenitor cells (EPCs) were purified by MACS using a CD34 Microbead Kit, human (Milteny Biotech) and an LS column (Milteny Biotech) according to the Milteny Biotech protocol. (In this specification, EPCs derived from iPSCs are sometimes referred to as iEPCs.) iEPCs were suspended in STEM-CELL BANKER (Zenogen Pharma) for 10 min. 6 The iEPCs were cryopreserved at cells / tube. The purity of the iEPCs was confirmed using a flow cytometer (SONY Cell Sorter SH800S) to calculate the percentage of CD34- and CD144-positive cells using CD34-FITC antibodies (BioLegend) and CD144-PE antibodies (BD Bioscience). EPCs induced from modified iPSCs are called modified iEPCs.

[0044] F8 expression was quantified using quantitative PCR. Specifically, cells were lysed in Trizol (Invitrogen), and mRNA was recovered by chloroform extraction and ethanol precipitation. High-Capacity RNA-to-cDNA TM The cDNA was then reverse transcribed using the StepOne Plus Kit (Thermo Fisher Scientific). * qPCR was performed using a PCR kit (Applied Biosystems). The relative expression levels of each gene were quantified using the ΔΔCt method, with the expression of F8 in unmodified iPS cells set at 1. PPIA was used as the housekeeping gene. Fast SYBR was used as the qPCR reagent. TM Green Master Mix (Thermo Fisher Scientific) was used with the following primers: PPIA (housekeeping gene) (5'→3') Fw: CCCACCGTGTTCTTCGACATT Rv: GGACCCGTATGCTTTAGGATGA F8 (5'→3') Fw: GCATTCGCAGCACTCTTCG Rv: GAGGTGAAGTCGAGCTTTTGAA The average mRNA expression level in unmodified iPSCs was set to 1, and the mRNA expression level was calculated (n = 3).

[0045]

[0046] As a result, as shown in Table 2 and Figure 2, it was revealed that the expression level of mRNA encoding FVIII was significantly improved in the modified iPSCs and modified iEPCs.

[0047] Next, the FVIII protein concentration in the culture supernatant was quantified by ELISA. The amount of FVIII protein in the culture supernatant was calculated as a ratio to the amount of FVIII protein in Coagutrol N (Sysmex), which is plasma from a healthy donor. 6 The amount of FVIII was normalized to be 1 / 2 of the total FVIII.

[0048] Furthermore, the protein concentration of unsecreted FVIII present in the cells was quantified by FVIII ELISA. Specifically, the cell pellet was suspended in RIPA buffer (Fujifilm) containing 1x100 Protease Inhibitor Cocktail (Fujifilm) and 1M DTT (Fujifilm) and left to stand for 30 minutes at 4°C. After centrifugation at 16,800 xg for 5 minutes, the supernatant was collected as a lysate and subjected to ELISA. Simultaneously, the total protein content of the lysate was quantified using a TaKaRa BCA Protein Assay Kit (Takara Bio) and normalized to 1 mg of total protein and the amount of FVIII per 24 hours of culture.

[0049]

[0050] As shown in Table 3 and Figure 2, FVIII was barely detectable in unmodified iPSCs and unmodified iEPCs, but was strongly expressed in modified iPSCs and modified iEPCs. FVIII was also detected in the cell lysate (see Figure 2).

[0051] Furthermore, the activity of the produced FVIII was quantified. Specifically, the FVIII activity in the culture supernatant was quantified using a fully automated blood coagulation analyzer (CA-600). ACTIN FSL (APTT reagent, Sysmex) and FVIII-deficient plasma (Sysmex) were used as measurement reagents. Normal human plasma, Coagutrol N, was used as the standard, and the FVIII concentration in normal human plasma was set at 100%. 6 The values ​​were normalized to be per unit area.

[0052]

[0053] As shown in Table 4, blood coagulation activity was observed in FVIII produced from modified iPSCs and modified iEPCs. Secretion of active FVIII requires multiple steps, and it is interesting that iPSCs are capable of producing active FVIII and secreting it into the culture supernatant.

[0054] Example 3: Transplantation of modified human iEPCs into mice In this example, modified human iEPCs were transplanted into mice, and the blood FVIII substance concentration and engraftment of modified human iEPCs into liver tissue were examined. The mice were immunodeficient (NOG) mice.

[0055] 1 x 10 6 Frozen modified human iEPC cells were thawed and suspended in approximately 30 μL of culture medium to prepare a cell suspension. The resulting cell suspension was injected into the splenic parenchyma of mice. Blood samples were then collected at various time points from 4 to 8 weeks, and the amount of human FVIII protein in mouse plasma was quantified by ELISA, with the FVIII concentration in normal human plasma set at 100%. Livers were also removed from mice at 4 and 8 weeks, and liver sections were prepared. Human CD31 expression in the liver sections was confirmed by immunohistochemical staining.

[0056]

[0057] As shown in Table 5, FVIII protein was detected in the blood of NOG mice transplanted with modified human iEPCs from 6 weeks after transplantation, and F8 protein maintained a stable concentration over the long term.

[0058] Furthermore, as shown in Figure 3, human CD31-positive cells were observed in liver sections, suggesting that modified human iEPCs had engrafted into the liver as vascular endothelial cells. However, no human CD31-positive cells were observed in liver sections from the group without iEPC transplantation.

[0059] Discussion: iPSCs have high proliferation potential, making it advantageous to modify and maintain them. By confirming the production of functional FVIII in iPSCs and maintaining iPSC clones that produce functional FVIII, they can be used as a long-term cell source for iEPCs. Therefore, obtaining iPSCs that produce functional FVIII is important. In this example, we successfully obtained human iPSCs that produce functional FVIII even after differentiation into iEPCs (endothelial progenitor cells) and are capable of engrafting in the liver. Therefore, such human iPSCs may be clinically useful for treating hemophilia patients and as a therapeutic cell source. Master cell banks and working cell banks containing modified iPSCs may also be useful as therapeutic cell sources.

[0060] The F8 promoter can be changed to another constitutive promoter as appropriate. Furthermore, patients with F8 mutations can be administered iEPCs or vascular endothelial cells (iECs) with functional F8 derived from low-immunogenic universal donor iPSCs, or F8 can be restored in the patient's own iPSCs using techniques such as genome editing, followed by knock-in of the constitutive promoter, followed by administration of iEPCs or iECs. In this way, the disclosed invention may be widely useful in the treatment of hemophilia patients.

Claims

1. A composition comprising isolated pluripotent stem cells, which have an exogenous promoter operably inserted upstream of the translation initiation region of a gene (F8) encoding factor VIII (FVIII) on their genomic DNA, and which is capable of driving the gene, thereby enabling the cells to secrete FVIII.

2. The composition according to claim 1, wherein the upstream of the translation initiation region is 1 bp to 1,000 bp upstream from the translation initiation site.

3. The composition of claim 1 or 2, wherein the exogenous promoter is a constitutive promoter.

4. The composition of any one of claims 1 to 3, wherein the isolated pluripotent stem cells are cloned.

5. The composition according to any one of claims 1 to 4, which is in a frozen form.

6. A composition according to any one of claims 1 to 5 for use in inducing vascular endothelial progenitor cells.

7. A method for producing vascular endothelial precursor cells or vascular endothelial cells, comprising: culturing the composition according to any one of claims 1 to 6 under conditions suitable for culture; and differentiating pluripotent stem cells contained in the composition into vascular endothelial precursor cells or vascular endothelial cells under conditions suitable for differentiation, thereby obtaining vascular endothelial precursor cells or vascular endothelial cells.

8. The method according to claim 7, further comprising confirming that the pluripotent stem cells in the composition according to any one of claims 1 to 6 produce FVIII before culturing.

9. A pharmaceutical composition comprising vascular endothelial progenitor cells or vascular endothelial cells obtained by the method of claim 7 or 8, or comprising vascular endothelial progenitor cells or vascular endothelial cells having an exogenous promoter operably inserted upstream of the translation initiation region of a gene encoding factor VIII (FVIII) on genomic DNA, the exogenous promoter driving the gene to secrete FVIII.

10. The pharmaceutical composition of claim 9 for use in treating patients with hemophilia A.

Images