Composition for preventing or treating nematode diseases, comprising DPY-13 and CALU-1 inhibitor

Abstract

The present invention relates to a composition for preventing or treating nematode diseases, the composition comprising a DPY-13 and CALU-1 inhibitor. The inhibitor according to the present invention modifies collagen and delays development in nematodes, and reduces the fertility of adults, thus having increased epidermal permeability and able to effectively increase drug delivery efficiency for nematode diseases. Accordingly, the present invention provides a use of the composition for treating nematode diseases, and thus can be effectively used in studies of not only filaricides but also control agents for various nematodes such as soil nematodes and pine wood nematodes.

Description

Composition for preventing or treating nematode diseases comprising DPY-13 and CALU-1 inhibitors

[0001] The present invention relates to a composition for preventing or treating nematode diseases comprising a DPY-13 and CALU-1 inhibitor.

[0002] Caenorhabditis elegans, a nematode, serves as a model for studies of multicellular organism development, cell biology, neurobiology, and aging. Epidermal development in nematodes is essential for growth and survival. The nematode epidermis serves as a key drug delivery pathway. Defects in the epidermis enhance drug absorption, even in adult worms, making it a valuable therapeutic target for nematode diseases.

[0003] The above nematode diseases are of various types, including river blindness, which is one of the neglected tropical diseases intensively managed by the World Health Organization. The mosquitoes that transmit the nematodes inhabit Korea, and the nematodes can be brought into Korea from overseas through various routes, so there is a high possibility of their re-emergence in Korea, and the possibility of diseases caused by them is also not small.

[0004] However, the benefits of anti-filariasis drugs are not guaranteed, so active research and development in large pharmaceutical companies and academic fields is insufficient, and most research relies on support from the World Health Organization or the Bill & Melinda Gates Foundation.

[0005] Accordingly, the inventors of the present invention established the mechanism of nematode epidermal development and confirmed the use of DPY-13 and CALU-1 inhibitors, which are most effective in drug delivery, for preventing or treating nematode diseases, thereby completing the present invention.

[0006] Accordingly, the inventor of the present invention confirmed that collagen of nematodes can be destroyed using DPY-13 and CALU-1 inhibitors, thereby completing the present invention.

[0007] Accordingly, the present invention aims to provide a composition for preventing or treating nematode diseases comprising a DPY-13 and CALU-1 inhibitor.

[0008] In addition, the present invention aims to provide a method for increasing drug delivery efficiency for nematode diseases, comprising a step of administering the inhibitor.

[0009] In addition, the present invention aims to provide a method for producing the inhibitor.

[0010] To achieve the above purpose, the present invention provides a composition for preventing or treating nematode diseases comprising a DPY-13 and CALU-1 inhibitor.

[0011] In addition, the present invention provides a method for increasing drug delivery efficiency for nematode diseases, comprising a step of administering the inhibitor.

[0012] In addition, the present invention provides a method for producing the inhibitor.

[0013] The composition for preventing or treating nematode diseases comprising the DPY-13 and CALU-1 inhibitors of the present invention can be effectively used for preventing and treating nematode diseases by significantly reducing developmental delay and fertility of nematodes.

[0014] Accordingly, the composition of the present invention can be usefully used in research for developing a therapeutic agent for nematode diseases.

[0015] Figure 1 is a diagram confirming the effect of DPY-13 on the development of the nematode's epidermis.

[0016] FIG. 2 is a diagram confirming the effect of a dpy-13;calu-1 double mutant manufactured according to one embodiment of the present invention on the development and fertility of nematodes.

[0017] Figure 3 is a diagram confirming increased epidermal permeability due to the occurrence of epidermal defects in the dpy-13;calu-1 double mutant.

[0018] Figure 4 is a diagram confirming that the expression of stress-related genes is regulated in the calu-1 mutant.

[0019] Hereinafter, embodiments of the present invention will be described in detail with reference to the attached drawings. In the following description, detailed descriptions of well-known technologies well known to those skilled in the art may be omitted. Furthermore, in describing the present invention, detailed descriptions of related known functions or configurations may be omitted if it is determined that such detailed descriptions may unnecessarily obscure the gist of the present invention. Furthermore, the terminology used in this specification is intended to appropriately express preferred embodiments of the present invention, and may vary depending on the intentions of the user or operator, or customary practices in the field to which the present invention pertains.

[0020] Therefore, definitions of these terms should be based on the overall content of this specification. Throughout this specification, whenever a part is said to "include" a component, this does not exclude other components, but rather implies the inclusion of additional components, unless otherwise specifically stated.

[0021]

[0022] The present invention relates to a composition for preventing or treating nematode diseases comprising a DPY-13 and CALU-1 inhibitor.

[0023] In addition, the present invention relates to a method for increasing drug delivery efficiency for nematode diseases, comprising a step of administering the inhibitor.

[0024] In addition, the present invention relates to a method for producing the inhibitor.

[0025] The term "DPY-13" of the present invention is a collagen gene that affects the epidermis of nematodes. The epidermis of nematodes is an exoskeleton that serves as a protective layer and maintains the normal shape of the nematode, and collagen plays a role in maintaining the structure and shape of the epidermal cuticle. In particular, the DPY-13 gene of the present invention encodes cuticle collagen and plays an important role in cuticle formation.

[0026] The term "CALU-1" of the present invention refers to ER (endoplasmic reticulum) resident Ca 2+ As a binding protein, it is involved in dauer formation in nematodes, various malignant diseases in vertebrates, and muscle contraction-relaxation processes.

[0027] The term "DPY-13 and CALU-1 inhibitor" of the present invention refers to an inhibitor of the dpy-13 gene and calu-1 gene, which may be administered in the form of siRNA, shRNA, miRNA, and antisense oligonucleotides, or may be administered in the form of an expression cassette comprising a nucleic acid encoding a CRISPR-associated Cas protein, but is not limited thereto.

[0028] The above expression cassette may further comprise one or more guide RNAs or an expression cassette encoding one or more guide RNAs, each of which can form a complex with a Cas protein to guide it to a target sequence within a target gene.

[0029] The term "dpy-13;calu-1 mutant" of the present invention refers to a type of double mutant produced using a DPY-13 mutant and a caluminin mutant, and unlike the DPY-13 mutant, which is a collagen mutant known to have no epidermal defects, an epidermal defect occurs. The present inventors confirmed that the dpy-13;calu-1 mutant exhibits remarkable epidermal permeability compared to other collagen-caluminin double mutants.

[0030] The mutant of the present invention can be produced using possible methods known in the art, such as transposon insertion, gene editing, etc. Specifically, it can be produced by a method that induces loss of function of a specific gene, and the mutant produced by this method can preferably be a Loss-of-Function mutant in which the function of the gene is reduced or completely lost by a method such as deletion, insertion, nonsense, etc., or a Functionally null mutant in which the function of the gene is completely lost by a similar method, but is not limited thereto.

[0031] The term "Calumenin" of the present invention refers to a protein encoded by the human Calu gene, which is a calcium-binding protein localized to the endoplasmic reticulum (ER) and is involved in functions such as protein folding and sorting. Calumenin has high genetic homology only among nematodes that parasitize humans, and thus can be used as a nematode-specific target.

[0032] The term "nematode disease" of the present invention refers to a disease caused by nematodes, which can infect not only humans but also animals, and the disease can appear as an acute or chronic disease, and examples thereof include filariasis.

[0033] The term "collagen" of the present invention is a representative component protein that constitutes the cuticle of Caenorhabditis elegans or the tissues (skin or bone) of higher animals. If there is a problem with collagen synthesis, problems such as osteogenesis imperfect and Ehlers-Danlos syndrome may occur. The cuticle of nematodes covers the entire body, so direct observation of the cuticle is possible. Through analysis of body length, etc. due to underdevelopment of the cuticle, it is possible to confirm at the individual level whether there is a problem with the synthesis of collagen, a component. The nematode cuticle is a major channel for drug delivery, and if a defect occurs in the cuticle, the absorption of drugs increases even in adult worms.

[0034] The term "drug permeability" in the present invention refers to the ability of a drug to pass through specific tissues or cells within a living body and reach its target site. This property serves as a key characteristic that determines how a drug moves and distributes within the body. Drug permeability is related to numerous factors, including the chemical properties of the drug, the characteristics of the biological membrane, the drug formulation, and drug-protein binding. As a crucial factor in determining the efficacy and safety of a drug, it must be optimized during the new drug development process.

[0035] The term “gene editing” of the present invention refers to a technology capable of introducing or inducing a targeted mutation in the genome sequence of animal and plant cells, including human cells, and is a technology capable of eliminating or reducing the function of a specific gene or introducing a mutation into a non-coding DNA sequence that does not produce a protein by deletion, insertion, substitution, etc. of one or more nucleic acid molecules by DNA cleavage. For the purpose of the present application, the gene editing may be, in particular, introducing a mutation into an animal gene using a Cas9 protein and gRNA, and may be used interchangeably with the term gene editing.

[0036] The term "target gene" in the present invention refers to a portion of DNA within the genome of an animal to be corrected through the present invention. The gene type is not limited and may include both coding and non-coding regions. Those skilled in the art can select the target gene based on the desired mutation for the genome-edited animal to be produced, depending on the purpose.

[0037] The present invention will now be described in more detail through examples. However, these examples are intended only to clearly illustrate the technical features of the present invention and do not limit the scope of protection of the present invention. They are provided to more fully explain the present invention to those of average skill in the industry.

[0038]

[0039] <Example 1> Production of dpy-13;calu-1 mutant

[0040] <1.1> Confirmation of nematode cuticle deformation caused by CALU-1 mutation

[0041] To determine whether CALU-1 directly affects the modification of collagen proteins in the endoplasmic reticulum (ER), double mutants between three collagen mutants known to form annulus normally (dpy-4, dpy-5, and dpy-13 mutants) and a calu-1 mutant were generated in C. elegans purchased from the Caenorhabditis Genetics Center (CGC) in the United States and the National BioResource Project (NBRP) in Japan. The epidermal structures (annulus and alae) on the body surface were analyzed. The body surfaces were analyzed using scanning electron microscopy after pretreatment, including fixation, by collecting mutants matched to the developmental stage.

[0042] As a result, the normally formed annulus structure was severely destroyed in all double mutants, and as shown in Fig. 1, it was confirmed that DPY-13 had the greatest effect on the transformation of the nematode's epidermis.

[0043]

[0044] <1.2> Production of double mutants

[0045] For the three collagen mutants of Example 1.1, calu-1 double mutants were produced. The dpy-4 mutant is a mutant in which a frame shift occurred due to the insertion of one nucleotide, the dpy-5 mutant is a mutant in which a stop codon was created due to the substitution of one nucleotide, and the dpy-13 and calu-1 mutants are mutants with deletions of some genes, and the base sequences of the genes before and after mutation are as shown in Table 1 below. The sequences after deletion of dpy-13 and calu-1 are indicated by SEQ ID NOs: 1 and 2, respectively, and in Table 1 below, exons are indicated in capital letters, and the deleted portion is indicated by underlining the sequence before deletion.

[0046]

[0047] Double mutants were produced by first producing calu-1 males and then crossing them with collagen mutants. The genotypes of the dpy-4 and dpy-5 mutants were confirmed by reading the base sequence after performing PCR with primers manufactured to have specificity for the corresponding insertion and substitution sites. The genotypes of the dpy-13 and calu-1 mutants were confirmed by performing PCR with primers manufactured to have specificity for the corresponding deletion sites, and target DNA that was smaller than that of the wild type was confirmed through electrophoresis. Primers for confirming the genotypes of the above genes are as shown in Table 2 below.

[0048] GeneAlleleSEQ ID NumberPrimers(5'→3')Amplicon (bp)Wild typeMutantdpy-4e11663CCAATGGTGTACAACTATGTGCAA7307314CAACATACTTTGGACAGATTCCCTdpy-5e615AGGAGGCACTGGACCAGACGGAAA5125126TCTCTGGGCATGGGCAGTATTC GGdpy-13e1847CGTTCCTACTCGGCAGTCGTCTTCT6806448TCCCTTTTGGACTGGCTCGCAGACcalu-1tm17839AGTATCCTGAACTGCATAGGTAGCC94547610ATGTGATCCTTGAGCTCGTTCTC

[0049] All three double mutants produced using the above-described manufacturing method were confirmed to have impaired development, resulting in a shortened body length, a characteristic epidermal phenotype. Body length was analyzed by photographing mutants at different developmental stages using a high-resolution upright microscope at a fixed magnification, and measuring the entire body length from head to tail.

[0050] All three double mutants produced using the above manufacturing method were confirmed to have reduced fertility. Fertility was determined by analyzing the population patterns formed after culturing equal numbers of adult worms on a culture medium for four days under normal culture conditions (20°C). If fertility is reduced, resulting in insufficient offspring production or developmental delays that slow growth, the population density will be low, and the bacteria on the culture medium provided as food will not be fully consumed.

[0051] As a result, as shown in Fig. 2, it was confirmed that the developmental delay and reduced fertility of the dpy-13;calu-1 double mutant were most noticeable.

[0052]

[0053] <Example 2> Confirmation of epidermal permeability of dpy-13;calu-1 mutant

[0054] To confirm the cuticle permeability of the dpy-13;calu-1 mutant in Example 1.2, Hoechst 33258 dye was used. This dye is a water-soluble staining reagent with a molecular weight of 553 Da that does not penetrate the normal cuticle, but penetrates it when there is a cuticle defect and stains the nuclei of cells constituting the head of the nematode. Cuticle permeability was determined by immersing mutants of the same developmental stage in a Hoechst 33258 solution prepared at a specific concentration (10 μg / ml) for 30 minutes, staining them, and then taking pictures under an upright fluorescence microscope with the same fluorescence exposure time, and counting the number of stained nuclei for analysis.

[0055] Through this, as shown in FIG. 3, it was confirmed that the dpy-13;calu-1 mutant of the present invention has increased epidermal permeability compared to the existing caluminin mutant, and thus the permeability of a drug for treating nematode diseases can be increased.

[0056]

[0057] <Example 3> Transcriptome analysis of calu-1 mutant

[0058] To determine the effect of the calu-1 mutant on nematode survival, a cDNA library (transcriptome) was prepared by isolating total RNA from a population of calu-1 mutants containing all generations (eggs, larvae, and adults). The transcriptome of the wild type was prepared using the same method, and the transcriptomes of the two populations were compared to each other to analyze genes (differentially expressed genes, DEGs) whose expression levels were different in the calu-1 mutant compared to the wild type.

[0059] As a result, as shown in Fig. 4, it was confirmed that the expression of various stress-related genes (Antimicrobial peptides, Osmotic stress responsive genes, Detoxification-related genes) increased in the calu-1 mutant.

[0060]

[0061] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than restrictive. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.

Claims

1. A composition for preventing or treating nematode diseases comprising a DPY-13 and CALU-1 inhibitor.

2. In paragraph 1, A composition wherein the inhibitor causes deletion of the DPY-13 and CALU-1 genes.

3. In paragraph 1, A composition wherein the inhibitor delays the development of nematodes and reduces their fertility.

4. In paragraph 1, A composition wherein the inhibitor increases drug permeability for nematode diseases.

5. In paragraph 4, A composition wherein the inhibitor increases the permeability of the nematode's epidermis, thereby increasing drug permeability.

6. In paragraph 1, A composition wherein the above nematode disease is filariasis.

7. A step of administering DPY-13 and CALU-1 inhibitors; comprising; A method for improving the delivery efficiency of a drug for treating nematode diseases.

8. A step of administering DPY-13 and CALU-1 inhibitors; comprising; A method for destroying collagen in nematodes.

9. A step of administering DPY-13 and CALU-1 inhibitors; comprising; A method for delaying the development of nematodes.

10. A step of administering DPY-13 and CALU-1 inhibitors; comprising; A method for reducing the fertility of adult nematodes.

11. A step of deleting the DPY-13 and CALU-1 genes; comprising; Method for producing dpy-13;calu-1 mutant.

12. A step for causing dpy-13;calu-1 mutation in nematodes; including; How to destroy collagen in nematodes.

13. A step for causing dpy-13;calu-1 mutation in nematodes; including; A method for delaying the development of nematodes.

14. A step for causing dpy-13;calu-1 mutation in nematodes; including; A method for reducing the fertility of nematodes.

15. A step for causing dpy-13;calu-1 mutation in nematodes; including; A method for increasing the permeability of the cuticle of a nematode.

Images