Yeast strains producing high levels of isoamyl acetate

Abstract

The present invention relates to the field of fermented beverage, such as beer, production. More specifically, the invention provides yeast strains of the genus Starmera with one or more mutations in the gene LEU4, which are particularly useful in the production of beverages with enhanced levels isoamyl alcohol and isoamyl acetate.

Description

[0001] Yeast strains producing high levels of isoamyl acetate

[0002] Technical field

[0003] The present invention relates to the field of beverage production. More specifically, the invention provides yeast strains of the genus Starmera with one or more mutations in the gene LEU4, which are particularly useful in the production of beverages with enhanced levels of isoamyl acetate.

[0004] Background

[0005] The fermentation process for producing alcoholic beverages, such as beer, relies heavily on the metabolic activity of yeasts. Traditional yeast strains, such as those of the genus Saccharomyces, are extensively used in the brewing industry due to their efficiency in converting fermentable sugars into ethanol and various flavor compounds. However, there is an increasing demand for yeast strains capable of producing low or non-alcoholic beverages while maintaining desirable flavor profiles.

[0006] One of the key challenges in the production of non-alcoholic beverages is the reduction or elimination of ethanol production without compromising the sensory characteristics of the beverage. Isoamyl acetate is an important flavor compound that contributes to e.g. the characteristic fruity, sweet and banana-like flavors in beer. Isoamyl alcohol is likewise an important flavor compound in beer and contributes to e.g. the characteristic alcoholic flavor. Ethyl acetate, on the other hand, is generally considered an undesirable off-flavor when present in high concentrations.

[0007] Starmera is a genus of yeast often associated with necrotic lesions in cacti. One notable species, Starmera caribaea - formerly known as Pichia caribaea - is a naturally occurring auxotroph requiring an organic sulphur source like L-methionine or L-cysteine for optimal growth. The species produces low levels of ethanol during fermentation and is therefore suitable for the production of beverages with low alcohol content.

[0008] Summary

[0009] The present invention provides yeast strains of the genus Starmera with mutations in the gene encoding Leu4. The LEU4 gene in Saccharomyces cerevisiae encodes the enzyme alphaisopropylmalate synthase, which is a key enzyme in the biosynthesis of the amino acid leucine. This enzyme catalyses the conversion of a-ketoisovalerate to a- isopropylmalate, the first step in the leucine biosynthetic pathway. The activity of the Leu4 enzyme is subject to feedback inhibition by leucine, which regulates the production of this essential amino acid based on cellular demand. In Saccharomyces cerevisiae, some strains with reduced feedback inhibition have increased production of isoamyl acetate. The last step in the pathway leading to production of isoamyl acetate in Saccharomyces cerevisiae is the conversion of isoamyl alcohol to isoamyl acetate catalysed by Atf1 / 2 (see e.g. Fig. 1 in Takagi et al., 2022).

[0010] Starmera differs significantly from Saccharomyces cerevisiae in their ester production, because Starmera caribaea shows an extraordinary high synthesis of acetate esters. Thus, pure cultures of Starmera caribaea have been shown to produce 44-84-fold the levels of isoamyl acetate compared to a reference Saccharomyces cerevisiae strain (see Gamero et al., 2020). Furthermore, the Starmera caribaea protein with the highest sequence identity to Saccharomyces cerevisiae Atf 1 and Atf2 only has about 29% sequence identity to Atf 1 and Atf2 of Saccharomyces cerevisiae. The Starmera caribaea protein with the highest sequence identity to Saccharomyces cerevisiae Atf 1 and Atf2 has a sequence as set forth in SEQ ID NO: 3.

[0011] Despite the high endogenous production of isoamyl acetate in Starmera caribaea and the lack of any proteins with sequences with high % identity to Saccharomyces cerevisiae Atf 112, the present invention provides Starmera yeasts with increased production of isoamyl acetate.

[0012] The Leu4 mutant strains according to the present disclosure produce significantly higher levels of isoamyl acetate compared to wild type strains and they surprisingly produce over 60-fold the level of isoamyl acetate compared to Saccharomyces reference strains with similar mutations. At the same time, these mutants produce very little ethanol during fermentation and surprisingly produce lower levels of the off-flavour ethyl acetate. These yeast strains are therefore particularly useful in the production of low or non-alcoholic fermented beverages with enhanced flavour profiles, such as beers, including lagers and ales, as well as ciders, wines, juices or sake. In some aspects of the present disclosure is provided a yeast strain of the genus Starmera, wherein said yeast strain comprises a mutant LEU4 gene encoding a mutant Leu4 polypeptide, wherein the wild type LEU4 gene encodes wild type Leu4 as set forth in SEQ ID NO: 1 or a functional homologue of SEQ ID NO: 1 with at least 90%, such as at least 95%, such as at least 98% sequence identity to SEQ ID NO: 1.

[0013] In some aspects of the present disclosure is also provided a method of producing a fermented beverage base, such as a fermented aqueous extract of malt and / or cereal grains, said method comprising the steps of: i) providing a beverage base, such as an aqueous extract of malt and / or cereal grains; ii) providing a Starmera yeast strain, wherein said yeast strain is as described elsewhere herein; and iii) fermenting the beverage base, such as the aqueous extract of malt and / or cereal grains, provided in step i) with said yeast strain of step ii), thereby obtaining a fermented beverage base, such as a fermented aqueous extract of malt and / or cereal grains.

[0014] In some aspects of the present disclosure is also provided a fermented beverage base, such as a fermented aqueous extract of malt and / or cereal grains, prepared by the method as described elsewhere herein.

[0015] In some aspects of the present disclosure is provided a method for producing a beverage, such as a malt and / or cereal based beverage, said method comprising the steps of: a) preparing a fermented beverage base, such as a fermented aqueous extract of malt and / or cereal grains, by the method as described elsewhere herein, and b) processing said fermented beverage base into a beverage.

[0016] In some aspects of the present disclosure is also provided a beverage prepared by the method as described elsewhere herein. Description of Drawings

[0017] Figure 1 shows a visual representation of the breeding scheme performed to generate the yeast strains described in Example 1. “UV” denotes inducing mutagenesis using ultraviolet irradiation. “Cross” denotes the mating (crossing) of two haploid strains.

[0018] Figure 2 shows the measured levels of ethyl acetate, isoamyl acetate and isoamyl alcohol in selected yeast strains. The results are further described in Example 1.

[0019] Figure 3 shows levels of ethyl acetate and isoamyl alcohol in two selected yeast strains fermented in a 50 L trial at 9 “Plato. Pitching rate and fermentation temperatures are indicated in the graph legend. The results of this figure are further described in Example 4.

[0020] Figure 4 shows the measured levels of ethyl acetate, isoamyl acetate and isoamyl alcohol in selected yeast strains when fermenting a cider base. The results are further described in Example 6.

[0021] Detailed description

[0022] Definitions

[0023] As used herein, unless indicated otherwise, the gene “LEU4" and the protein “Leu4” refer to the Starmera caribaea gene and protein according to SEQ ID NO: 2 and SEQ ID NO: 1, respectively, as well homologs thereof. As such, the term for the gene “LEU4" may be used interchangeably with Saccharomyces cerevisiae LEU4, also known by the systematic name YNL104C.

[0024] The term “beer” as used herein refers to a beverage prepared by fermentation of wort. Preferably, said fermentation is done by yeast.

[0025] The terms “non-alcoholic beverage” and “alcohol-free beverage” are used interchangeably herein to denote a beverage with an alcohol content of less than 0.5% vol. In preferred embodiments, the alcohol content of an alcohol-free beverage or beer is 0.05% vol. or less, such as 0.049% or less, for example 0.047% or less, for example 0.0%. The beverage may in particular be beer, and thus the terms “non-alcoholic beer” or “alcohol-free beer” denotes beer having aforementioned alcohol content. As used herein, the term “0.0%” ethanol content refers to an ethanol content below 0.05% ABV.

[0026] The term “low-alcohol beverage”, such as “low-alcohol beer”, denotes a beverage, such as a beer, with an alcohol content from 0.5% vol. to 2.8% vol. In some embodiments, the alcohol content of a low-alcohol beverage or beer is from 0.5% vol. to 1.2% vol.

[0027] The term “debrewing” as used herein refers to dilution of a beverage or beverage base, e.g. beer with water. The water may e.g. be tap water, demineralised water or a mixture of both.

[0028] The term “cereal” as used herein refers to any plant of the grass family yielding an edible grain, such as wheat, millet, rice, barley, oats, rye, triticale, sorghum, and maize.

[0029] The term "grain" as used herein refers to seeds of a cereal comprising the cereal caryopsis, also denoted internal seed. In addition, the grain may comprise the lemma and palea. In most barley varieties, the lemma and palea adhere to the caryopsis and are a part of the grain following threshing. However, naked barley varieties also occur. In these, the caryopsis is free of the lemma and palea and threshes out free as in wheat. The terms "grain" and "kernel" are used interchangeably herein.

[0030] By the term "wort" is meant a liquid extract of malt and / or cereal grains and optionally additional adjuncts. Wort is in general obtained by mashing, optionally followed by "sparging". The mashing process typically involves mixing milled malt and / or grains with water and heating the mixture to predetermined temperatures to activate hydrolytic enzymes. Hydrolytic enzymes include amylases and glucanases, that break down the starches in the malt / grains into sugars. The temperatures and duration of the process are controlled to optimize enzyme activity and sugar extraction. Sparging is a process of extracting residual sugars and other compounds from spent grains after mashing with hot water. Sparging is typically conducted in a lauter tun, a mash filter, or another apparatus to allow separation of the extracted water from spent grains. The wort obtained after mashing is generally referred to as "first wort", while the wort obtained after sparging is generally referred to as the "second wort". If not specified, the term wort may be first wort, second wort, or a combination of both. During conventional beer production, wort is boiled together with hops. Wort without hops, may also be referred to as "sweet wort", whereas wort boiled with hops may be referred to as "boiled wort" or simply as wort.

[0031] The term ’’beverage base” as used herein refers to any beverage base, such as an aqueous extract of malt and / or cereal kernels, non-limiting examples hereof which can be wort with a given amount of fermentable sugars, or any other beverage base, such as fruits, such as apples, pears or grapes, or juice, e.g. grape, apple, pear or orange juice. The beverage base may also be made from steamed cereals, e.g rice, which optionally have been incubated with fungi, such as Aspergillus oryzae. For example, the beverage base may be shubo or moto.

[0032] The term “fermented beverage base” as used herein refers to any beverage base, such as any aqueous extract, incubated with a microorganism, such as a yeast strain. A fermented beverage base, may for example be a fermented malt and / or cereal based extract. Preferably, a fermented beverage base has been fermented for at least 2 days, such as at least 3 days, for example for 3 to 7 days, such as for 5 to 7 days.

[0033] The term “Alcohol by volume (ABV)” as used herein refers to the amount of alcohol (ethanol) in a given volume of an alcoholic beverage (expressed as a volume percent). It is defined as the number of milliliter of pure ethanol present in 100mL of solution at 20°C. ABV can be measured e.g. by gas chromatography or with an Alcolyzer.

[0034] The term “fermenting” as used herein refers to incubating a beverage base, such as an aqueous extract of malt and / or cereal grains, or another solution with a microorganism, such as a yeast strain.

[0035] The term "malt" as used herein refers to cereal kernels, which have been malted. The term “green malt” refers to germinated cereal kernels, which have not been subjected to a step of kiln drying. In some embodiments the green malt is milled green malt. The term "kiln dried malt" as used herein refers germinated cereal kernels, which have been dried by kiln drying. In some embodiments the kiln dried malt is milled kiln dried malt. In general, said cereal kernels have been germinated under controlled environmental conditions. Amino acids may be named herein using the IIIPAC one-letter and three-letter codes.

[0036] If not otherwise indicated the term “amino acid” refers to the standard amino acids.

[0037] The term ’’functional homologue” as used herein denotes a polypeptide sharing at least one biological function with a reference polypeptide. In general, said functional homologue also shares a significant sequence identity with the reference polypeptide. Preferably a functional homologue of a reference polypeptide is a polypeptide, which has the same biological function as the reference protein, and which shares a high level of sequence identity with the reference polypeptide. In some embodiments, of the present disclosure, if a yeast carries a gene encoding a functional homologue of Leu4 of SEQ ID NO: 1 , said yeast will have levels of isoamyl alcohol and / or isoamyl acetate comparable to wild type Starmera caribaea, preferably levels of isoamyl alcohol and / or isoamyl acetate + / - 10% of the level in wild type Starmera caribaea. In some embodiments, of the present disclosure, if a yeast carries a gene encoding a functional homologue of Leu4 of SEQ ID NO: 1, said yeast will have levels of isoamyl alcohol, isoamyl acetate, and / or ethyl acetate comparable to wild type Starmera caribaea, preferably levels of isoamyl alcohol, isoamyl acetate, and / or ethyl acetate + / - 10% of the level in wild type Starmera caribaea.

[0038] The term “sequence identity” as used herein describes the relatedness between two amino acid sequences or between two nucleotide sequences, i.e. a candidate sequence (e.g. a mutant sequence) and a reference sequence (such as a wild type sequence) based on their pairwise alignment. In some embodiments of the present invention, the sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mo / . Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277,), preferably version 5.0.0 or later (available at https: / / www.ebi.ac.uk / Tools / psa / emboss_needle / ). The parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of 30 BLOSUM62) substitution matrix. The output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows: (Identical Residues x 100) / (Length of Alignment - Total Number of Gaps in Alignment). The Needleman-Wunsch algorithm is also used to determine whether a given amino acid in a sequence other than the reference sequence corresponds to a given position of the reference sequence. For purposes of the present invention, the sequence identity between two nucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or later. The parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the DNAFULL (EMBOSS version of NCBI NLIC4.4) substitution matrix. The output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows: (Identical Deoxyribonucleotides x 100) / (Length of Alignment - Total Number of Gaps in Alignment). Sequence identity is always measured compared to the full-length reference sequence, i.e. truncated proteins with no gaps or mismatches are not considered 100% sequence identical to the reference sequence. In some embodiments of the present invention, the sequence identity between two amino acid sequences is determined using the BioPython implementation of BLAST found at https: / / biopython.Org / docs / 1.76 / api / Bio.Blast.Applications.html.

[0039] The term "mutations" as used herein include insertions, deletions, substitutions, transversions, and point mutations in the coding and noncoding regions of a gene. Point mutations may concern changes of one base pair, and may result in premature stop codons, frameshift mutations, mutation of a splice site or amino acid substitutions. A gene comprising a mutation may be referred to as a “mutant gene”. If said mutant gene encodes a polypeptide with a sequence different to the wild type, said polypeptide may be referred to as a “mutant polypeptide” and / or “mutant protein”. A mutant polypeptide may be described as carrying a mutation, when it comprises an amino acid sequence differing from the wild-type sequence.

[0040] Yeast strain

[0041] The present disclosure relates to a yeast strain of the genus Starmera, that surprisingly produces high levels of isoamyl acetate. Said yeast strain may further produce high levels of isoamyl alcohol, as well as lowered levels of ethyl acetate, during fermentation.

[0042] In some aspects of the present disclosure is provided a yeast strain of the genus

[0043] Starmera, wherein said yeast strain comprises a mutant LEU4 gene encoding a mutant Leu4 polypeptide, wherein the wild type LEU4 gene encodes wild type Leu4 as set forth in SEQ ID NO: 1 or a functional homologue of SEQ ID NO: 1 with at least 90%, such as at least 95%, such as at least 98% sequence identity to SEQ ID NO: 1.

[0044] In some embodiments, the mutant Leu4 protein is still capable of enzymatic activity but has lowered or abrogated feedback inhibition to its substrate, L-leucine.

[0045] In some embodiments, said mutant Leu4 polypeptide is capable, such as has retained the capability, of catalyzing the conversion of a-ketoisovalerate to a-isopropylmalate in the presence of L-leucine.

[0046] In some embodiments, the mutant Leu4 polypeptide has reduced sensitivity to L- leucine feedback inhibition. In some embodiments, the mutant Leu4 polypeptide is insensitive to L-leucine feedback inhibition.

[0047] Without being bound by theory, said loss of L-leucine feedback inhibition may be the result of mutations in, or loss of, the C-terminus of Leu4, such as Leu4 as set forth in SEQ ID NO: 1 or a functional homologue of SEQ ID NO: 1 with at least 90%, such as at least 95%, such as at least 98% sequence identity to SEQ ID NO: 1.

[0048] Thus, in some embodiments of the present disclosure, the mutant Leu4 polypeptide has a mutation in the C-terminus of SEQ ID NO: 1 or said functional homologue thereof.

[0049] The mutation in said mutant Leu4 polypeptide may be a substitution of one amino acid for another amino acid. In some embodiments of the present disclosure, the mutation in said mutant Leu4 polypeptide is a deletion of one or more amino acids, e.g. by introduction of a premature stop codon in the coding nucleic acid sequence.

[0050] In some embodiments of the present disclosure the mutant Leu4 polypeptide has a mutation in one or more of the 250 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a mutation in one or more of the 225 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a mutation in one or more of the 200 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a mutation in one or more of the 175 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a mutation in one or more of the 150 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a mutation in one of the 130 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a mutation in one of the 125 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a mutation in one of the 100 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof.

[0051] The amino acid mutation in the mutant Leu4 as described herein may be the deletion of one or more amino acids, e.g. by a premature STOP codon replacing a codon encoding a canonically encoded amino acid in Leu4. This may be the result of a premature stop codon being introduced in the gene encoding Leu4 of SEQ ID NO: 1 or a functional homologue thereof with at least 90%, such as at least 95%, such as at least 98% sequence identity thereto.

[0052] In some embodiments, the deletion is a deletion of at least 10 amino acids, such as at least 25 amino acids, such as at least 50 amino acids, such as at least 75 amino acids, such as at least 100 amino acids, such as at least 125 amino acids, such as at least 130 amino acids, such as at least 150 amino acids, such as at least 175 amino acids, or such as at least 200 amino acids.

[0053] In some embodiments of the present disclosure the mutant Leu4 polypeptide has a deletion of the 250 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a deletion of the 225 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a deletion of the 200 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a deletion of the 175 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a deletion of the 150 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a deletion of the 130 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a deletion of the 125 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a deletion of the 100 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof.

[0054] The mutation may also be a deletion that does not remove the entire C-terminus, but only a segment of the C-terminus of Leu4, e.g. amino acids 474 to 584 of SEQ ID NO: 1.

[0055] In some embodiments of the present disclosure the mutant Leu4 polypeptide has a deletion of from 150 to 200 amino acids in the 250 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a deletion of from 125 to 175 amino acids in the 225 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a deletion of from 100 to 150 amino acids in the 200 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a deletion of from 75 to 125 amino acids in the 175 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a deletion of from 50 to 100 amino acids in the 150 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a deletion of from 30 to 80 amino acids in the 130 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a deletion of from 25 to 75 amino acids in the 125 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a deletion of at least 50 amino acids in the 100 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof.

[0056] In some embodiments of the present disclosure the mutant Leu4 polypeptide has a deletion of from 150 to 250 amino acids in the 250 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a deletion of from 125 to 225 amino acids in the 225 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a deletion of from 100 to 200 amino acids in the 200 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a deletion of from 75 to 175 amino acids in the 175 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a deletion of from 50 to 150 amino acids in the 150 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a deletion of from 30 to 130 amino acids in the 130 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a deletion of from 25 to 125 amino acids in the 125 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof. In some embodiments of the present disclosure the mutant Leu4 polypeptide has a deletion of at least 50 amino acids in the 100 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof.

[0057] Without being bound by theory, the following positions in Leu4 may be relevant for mutation, or the following suggested specific mutations may be relevant, to obtain high production of isoamyl acetate and isoamyl alcohol as described herein, for reasons indicated in the columns “functional role” and “notes”. Thus, the mutant Leu4 polypeptide may preferably carry a mutation in any of the amino acids indicated in the column named “Corresponding Leu4 residue in in S. caribaea in the table below.

[0058]

[0059] Said mutations may be amino acid substitutions or deletions.

[0060] In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino acid mutation or substitution as described in Example 5, Table 9. In some embodiments, the mutant Leu4 polypeptide has an amino acid mutation or substitution of SEQ ID NO: 1 as described in Example 5, Table 9 or a corresponding amino acid mutation or substitution in a functional homologue of SEQ ID NO: 1 with at least 90%, such as at least 95%, such as at least 98% sequence identity to SEQ ID NO: 1.

[0061] In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino acid mutation, such as an amino acid substitution, at position 512, 508, 509, 533, 534, 535, 544 or 570 of SEQ ID NO: 1 , or an amino acid mutation, such as an amino acid substitution, in the corresponding position of a functional homologue thereof.

[0062] In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino acid mutation, such as an amino acid substitution, at position 512, 508, 509, 533, 534, 535, 544, 570, 474, 485, 488, 490, 506, 507, 510, 511 , 513, 531, 536, 539, 540, 546, 566, 569, 572, 575, or 584 of SEQ ID NO: 1, or an amino acid mutation, such as an amino acid substitution, in the corresponding position of said functional homologue thereof.

[0063] In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino acid mutation, such as an amino acid substitution, in an amino acid that is at the most 10 residues upstream or at the most 10 residues downstream of any one of positions 512, 508, 509, 533, 534, 535, 544, 570, 474, 485, 488, 490, 506, 507, 510, 511 , 513, 531 , 536, 539, 540, 546, 566, 569, 572, 575, or 584 of SEQ ID NO: 1, or an amino acid mutation, such as an amino acid substitution, in the corresponding position of said functional homologue thereof.

[0064] In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino acid mutation, such as an amino acid substitution, in an amino acid that is at the most 5 residues upstream or at the most 5 residues downstream of any one of positions 512, 508, 509, 533, 534, 535, 544, 570, 474, 485, 488, 490, 506, 507, 510, 511 , 513, 531 , 536, 539, 540, 546, 566, 569, 572, 575, or 584 of SEQ ID NO: 1, or an amino acid mutation, such as an amino acid substitution, in the corresponding position of said functional homologue thereof.

[0065] In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino acid mutation, such as an amino acid substitution, in an amino acid that is at the most 3 residues upstream or at the most 3 residues downstream of any one of positions 512, 508, 509, 533, 534, 535, 544, 570, 474, 485, 488, 490, 506, 507, 510, 511 , 513, 531 , 536, 539, 540, 546, 566, 569, 572, 575, or 584 of SEQ ID NO: 1, or an amino acid mutation, such as an amino acid substitution, in the corresponding position of said functional homologue thereof.

[0066] In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino acid mutation, such as an amino acid substitution, in an amino acid that is at the most 2 residues upstream or at the most 2 residues downstream of any one of positions 512, 508, 509, 533, 534, 535, 544, 570, 474, 485, 488, 490, 506, 507, 510,

[0067] 511 , 513, 531 , 536, 539, 540, 546, 566, 569, 572, 575, or 584 of SEQ ID NO: 1, or an amino acid mutation, such as an amino acid substitution, in the corresponding position of said functional homologue thereof.

[0068] In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino acid mutation, such as an amino acid substitution, in an amino acid that is at the most 1 residue upstream or at the most 1 residue downstream of any one of positions

[0069] 512, 508, 509, 533, 534, 535, 544, 570, 474, 485, 488, 490, 506, 507, 510, 511, 513, 531 , 536, 539, 540, 546, 566, 569, 572, 575, or 584 of SEQ ID NO: 1, or an amino acid mutation, such as an amino acid substitution, in the corresponding position of said functional homologue thereof.

[0070] In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino mutation in any one of amino acids 400 to 604 of SEQ ID NO: 1 or in any one of the corresponding positions of said functional homologue thereof. In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino mutation in any one of amino acids 425 to 604 of SEQ ID NO: 1 or in any one of the corresponding positions of said functional homologue thereof. In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino mutation in any one of amino acids 450 to 604 of SEQ ID NO: 1 or in any one of the corresponding positions of said functional homologue thereof. In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino mutation in any one of amino acids 460 to 604 of SEQ ID NO: 1 or in any one of the corresponding positions of said functional homologue thereof. In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino mutation in any one of amino acids 470 to 604 of SEQ ID NO: 1 or in any one of the corresponding positions of said functional homologue thereof. In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino mutation in any one of amino acids 474 to 604 of SEQ ID NO: 1 or in any one of the corresponding positions of said functional homologue thereof. In some embodiments, the amino mutation is an amino acid substitution.

[0071] In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino mutation in any one of amino acids 400 to 584 of SEQ ID NO: 1 or in any one of the corresponding positions of said functional homologue thereof. In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino mutation in any one of amino acids 425 to 584 of SEQ ID NO: 1 or in any one of the corresponding positions of said functional homologue thereof. In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino mutation in any one of amino acids 450 to 584 of SEQ ID NO: 1 or in any one of the corresponding positions of said functional homologue thereof. In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino mutation in any one of amino acids 460 to 584 of SEQ ID NO: 1 or in any one of the corresponding positions of said functional homologue thereof. In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino mutation in any one of amino acids 470 to 584 of SEQ ID NO: 1 or in any one of the corresponding positions of said functional homologue thereof. In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino mutation in any one of amino acids 474 to 584 of SEQ ID NO: 1 or in any one of the corresponding positions of said functional homologue thereof. In some embodiments, the amino mutation is an amino acid substitution.

[0072] The mutant Leu4 polypeptide may comprise more than one of the amino acid mutations as described herein, such as 2, 3, 4, 5, or more.

[0073] The term “corresponding amino acid” or “corresponding position”, as is generally understood in the art, refers to a residue on a second amino acid sequence which occupies the same (i.e. , equivalent) position as a residue on a first amino acid sequence, when the first and second sequences are optimally aligned for comparison purposes. The first amino acid sequence may be Leu4 as set forth in SEQ ID NO: 1, while the second amino acid sequence may be a variant of sequence. Thus, a residue at a first position in a first peptide sequence does not necessarily correspond to a residue in said same first position in a second peptide sequence, but may instead correspond to a residue at a second position in the second peptide sequence that optimally aligns with the residue in said first position of said first peptide sequence, when the first and second peptide sequences are optimally aligned. Said alignment may be performed by any method known in the art, such as by using the Needleman- Wunsch algorithm (Needleman and Wunsch, 1970, J. Mo / . Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or later (available at https: / / www.ebi.ac.uk / Tools / psa / emboss_needle / ). The parameters used may be a gap open penalty of 10, a gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of 30 BLOSUM62) substitution matrix. In some embodiments, said alignment is performed using the BioPython implementation of BLAST found at https: / / biopython.Org / docs / 1.76 / api / Bio.Blast.Applications.html.

[0074] Thus, corresponding amino acids may in some embodiments be identical amino acids. In other embodiments, corresponding amino acids are non-identical amino acids with appropriately similar structural and / or functional characteristics. As is well known by those of ordinary skill in the art, certain amino acids are typically classified as "hydrophobic" or "hydrophilic" amino acids, “charged” (either positive or negative) or “uncharged”, and / or as having "polar" or "non-polar" side chains.

[0075] Substitution of one amino acid for another of the same type may often be considered a homologous substitution. Typical amino acid categorizations are summarized in Table A, below.

[0076] Table A - Amino acid properties

[0077] Side Side chain

[0078] Amino AcidLetter Letterc^a‘nacidity or Charge Hydrophobic polarity basicity

[0079] Alanine Ala A nonpolar neutral Uncharged Yes

[0080] Arginine Arg R polar basic Positive No

[0081] Asparagine Asn N polar neutral Uncharged No

[0082] Aspartic acid Asp D polar acidic Negative No

[0083] Cysteine Cys C polar neutral Uncharged No

[0084] Glutamic acid Glu E polar acidic Negative No

[0085] Glutamine Gin Q polar neutral Uncharged No

[0086] Glycine Gly G nonpolar neutral Uncharged Yes

[0087] Histidine His H polar basic Positive No

[0088] Isoleucine lie I nonpolar neutral Uncharged Yes

[0089] Leucine Leu L nonpolar neutral Uncharged Yes

[0090] Lysine Lys K polar basic Positive No

[0091] Methionine Met M nonpolar neutral Uncharged Yes

[0092] Phenylalanine Phe F nonpolar neutral Uncharged Yes

[0093] Proline Pro P nonpolar neutral Uncharged Yes

[0094] Serine Ser S polar neutral Uncharged No

[0095] Threonine Thr T polar neutral Uncharged No

[0096] Tryptophan Trp W polar neutral Uncharged Yes

[0097] Tyrosine Tyr Y polar neutral Uncharged No

[0098] Valine Vai V nonpolar neutral Uncharged Yes

[0099] In some embodiments of the present disclosure, the mutation of the mutant Leu4 polypeptide as described herein is a non-conservative amino acid substitution.

[0100] A non-conservative amino acid substitution as used herein refers to the replacement of one amino acid residue with another that differs significantly in physicochemical properties, such that the substitution is likely to affect the structure, function, stability, or interactions of the polypeptide. These differences include: • Charge (e.g., substitution of a positively charged residue, such as lysine, with a negatively charged residue, such as glutamate, or with an uncharged residue, such as valine)

[0101] • Polarity (e.g., substitution of a polar residue, such as serine, to a non-polar residue, such as leucine)

[0102] • Size or steric bulk (e.g., substitution of residue small in size, such as glycine, with a bulky residue, such as tryptophan)

[0103] • Hydrophobicity (e.g., substitution of hydrophobic residue, such as valine, with a hydrophilic residue, such as asparagine)

[0104] • Aromaticity (e.g., substitution of an aromatic residue, such as phenylalanine, with a non-aromatic residue, such as threonine)

[0105] Various relevant properties of the 20 canonical amino acids are listed in Table A above, and may serve as a guide for which amino acid substitutions constitute nonconservative substitution. However, the skilled person is well aware of which amino acid substitutions classify as non-conservative amino acid substitutions.

[0106] In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino acid substitution at position 512 or an amino acid substitution in the corresponding position of said functional homologue thereof. In some embodiments, said substitution is substitution of serine (S) to any other amino acid. In some embodiments, said substitution is substitution of serine (S) to a hydrophobic amino acid. In some embodiments, the substitution is substitution of serine (S) to an amino acid comprising a side chain comprising an aromatic group. In some embodiments, the substitution is substitution of the serine (S) at position 512 of SEQ ID NO: 1 , or of a corresponding serine in said functional homologue thereof, to phenylalanine (F). In some embodiments, the mutant Leu4 polypeptide thus has an amino acid sequence as set forth in SEQ ID NO: 8.

[0107] In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino acid substitution at position 508 of SEQ ID NO: 1 , or an amino acid substitution in the corresponding position of said functional homologue thereof. In some embodiments, the substitution is substitution of asparagine (N) to any other amino acid. In some embodiments, the substitution is substitution of asparagine (N) to a charged amino acid, such as a negatively charged amino acid. In some embodiments, the substitution is substitution of asparagine (N) at position 508 of SEQ ID NO: 1 , or of a corresponding asparagine in said functional homologue thereof, to aspartic acid (D).

[0108] In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino acid substitution at position 509 of SEQ ID NO: 1 , or an amino acid substitution in the corresponding position of said functional homologue thereof. In some embodiments, said substitution is substitution of glycine (G) to any other amino acid. In some embodiments, said substitution is substitution of glycine (G) to a polar, uncharged amino acid. In some embodiments, the substitution is substitution of glycine (G) at position 509 of SEQ ID NO: 1 , or of a corresponding glycine in said functional homologue thereof, to serine (S).

[0109] In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino acid substitution at position 535 of SEQ ID NO: 1 , or an amino acid substitution in the corresponding position of said functional homologue thereof. In some embodiments, said substitution is substitution of serine (S) to any other amino acid. In some embodiments, said substitution is substitution of serine (S) to a hydrophobic amino acid. In some embodiments, said substitution is substitution of serine (S) to an amino acid comprising a side chain comprising an aromatic group. In some embodiments, the substitution is substitution of serine (S) at position 535 of SEQ ID NO: 1 , or of a corresponding serine in said functional homologue thereof, to phenylalanine (F).

[0110] In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino acid substitution at position 544 of SEQ ID NO: 1 , or an amino acid substitution in the corresponding position of said functional homologue thereof. In some embodiments, said substitution is substitution of alanine (A) to any other amino acid. In some embodiments, said substitution is substitution of alanine (A) to a different nonpolar, uncharged amino acid. In some embodiments, said substitution is substitution of alanine (A) to a charged amino acid, such as a negatively charged amino acid. In some embodiments, the substitution is substitution of alanine (A) at position 544 of SEQ ID NO: 1 , or of a corresponding alanine in said functional homologue thereof, to valine (V). In some embodiments, the substitution is substitution of alanine (A) at position 544 of SEQ ID NO: 1 , or of a corresponding alanine in said functional homologue thereof, to aspartic acid (D).

[0111] In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino acid substitution at position 570 of SEQ ID NO: 1 , or an amino acid substitution in the corresponding position of said functional homologue thereof. In some embodiments, said substitution is substitution of aspartic acid (D) to any other amino acid. In some embodiments, said substitution is substitution of aspartic acid (D) to a polar, uncharged amino acid. In some embodiments, the substitution is substitution of aspartic acid (D) at position 570 of SEQ ID NO: 1 , or of a corresponding aspartic acid in said functional homologue thereof, to asparagine (N).

[0112] In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino acid substitution at position 533 of SEQ ID NO: 1 , or an amino acid substitution in the corresponding position of said functional homologue thereof. In some embodiments, said substitution is substitution of glutamic acid (E) to any other amino acid. In some embodiments, said substitution is substitution of glutamic acid (E) to a charged amino acid, such as a positively charged amino acid. In some embodiments, the substitution is substitution of glutamic acid (E) at position 533 of SEQ ID NO: 1 , or of a corresponding glutamic acid in said functional homologue thereof, to lysine (K).

[0113] In some embodiments of the present disclosure, the mutant Leu4 polypeptide has an amino acid substitution at position 534 of SEQ ID NO: 1 , or an amino acid substitution in the corresponding position of said functional homologue thereof. In some embodiments, said substitution is substitution of histidine (H) to any other amino acid. In some embodiments, said substitution is substitution of histidine (H) to a hydrophobic amino acid. In some embodiments, the substitution is substitution of histidine (H) at position 534 of SEQ ID NO: 1, or of a corresponding histidine in said functional homologue thereof, to proline (P).

[0114] In some embodiments of the present disclosure, the mutant Leu4 polypeptide a. has an amino acid substitution of Leu (L) to Ser (S) at position 474 of SEQ ID NO: 1 , or a Leu (L) to Ser (S) amino acid substitution in the corresponding position of said functional homologue thereof; and / or b. has an amino acid substitution of Lys (K) to a STOP at position 485 of SEQ ID NO: 1 , or a Lys (K) to a STOP amino acid substitution in the corresponding position of said functional homologue thereof; and / or c. has an amino acid substitution of Lys (K) to Asn (N) at position 488 of SEQ ID NO: 1, or a Lys (K) to Asn (N) amino acid substitution in the corresponding position of said functional homologue thereof; and / or d. has an amino acid substitution of Cys (C) to Arg (R) at position 490 of SEQ ID NO: 1, or a Cys (C) to Arg (R) amino substitution in the corresponding position of said functional homologue thereof; and / or e. has an amino acid substitution of Leu (L) to a STOP at position 506 of SEQ ID NO: 1, or a Leu (L) to a STOP amino acid substitution in the corresponding position of said functional homologue thereof; and / or f. has an amino acid substitution of Gly (G) to Asp (D) at position 507 of SEQ ID NO: 1, or a Gly (G) to Asp (D) amino acid substitution in the corresponding position of said functional homologue thereof; and / or g. has an amino acid substitution of Asn (N) to Tyr (Y) at position 508 of SEQ ID NO: 1, or an Asn (N) to Tyr (Y) amino acid substitution in the corresponding position of said functional homologue thereof; and / or h. has an amino acid substitution of Pro (P) to Arg (R) at position 510 of SEQ ID NO: 1 , or a Pro (P) to Arg (R) amino acid substitution in the corresponding position of said functional homologue thereof; and / or i. has an amino acid substitution of lie (I) to Phe (F) at position 511 of SEQ ID NO: 1 , or an lie (I) to Phe (F) amino acid substitution in the corresponding position of said functional homologue thereof; and / or j. has an amino acid substitution of Ser (S) to Leu (L) at position 513 of SEQ ID NO: 1 , or a Ser (S) to Leu (L) amino acid substitution in the corresponding position of said functional homologue thereof; and / or k. has an amino acid substitution of Tyr (Y) to His (H) at position 531 of SEQ ID NO: 1 , or a Tyr (Y) to His (H) amino acid substitution in the corresponding position of said functional homologue thereof; and / or l. has an amino acid substitution of Glu (E) to Lys (K) at position 533 of SEQ ID NO: 1 , or a Glu (E) to Lys (K) amino acid substitution in the corresponding position of said functional homologue thereof; and / or m. has an amino acid substitution of His (H) to Leu (L) at position 534 of SEQ ID NO: 1 , or a His (H) to Leu (L) amino acid substitution in the corresponding position of said functional homologue thereof; and / or n. has an amino acid substitution of lie (I) to Phe (F) at position 536 of SEQ ID NO: 1 , or an lie (I) to Phe (F) amino acid substitution in the corresponding position of said functional homologue thereof; and / or o. has an amino acid substitution of Gly (G) to Arg (R) at position 539 of SEQ ID NO: 1 , or a Gly (G) to Arg (R) amino acid substitution in the corresponding position of said functional homologue thereof; and / or p. has an amino acid substitution of Ser (S) to Pro (P) at position 540 of SEQ ID NO: 1 , or a Ser (S) to Pro (P) amino acid substitution in the corresponding position of said functional homologue thereof; and / or q. has an amino acid substitution of Thr (T) to Phe (F) at position 546 of SEQ ID NO: 1 , or a Thr (T) to Phe (F) amino acid substitution in the corresponding position of said functional homologue thereof; and / or r. has an amino acid substitution of Gly (G) to Asp (D) at position 566 of SEQ ID NO: 1 , or a Gly (G) to Asp (D) amino acid substitution in the corresponding position of said functional homologue thereof; and / or s. has an amino acid substitution of Glu (E) to Lys (K) at position 569 of SEQ ID NO: 1 , or a Glu (E) to Lys (K) amino acid substitution in the corresponding position of said functional homologue thereof; and / or t. has an amino acid substitution of Ser (S) to Pro (P) at position 572 of SEQ ID NO: 1 , or a Ser (S) to Pro (P) amino acid substitution in the corresponding position of said functional homologue thereof; and / or u. has an amino acid substitution of Ala (A) to Pro (P) at position 575 of SEQ ID NO: 1 , or an Ala (A) to Pro (P) amino acid substitution in the corresponding position of said functional homologue thereof; and / or v. has an amino acid substitution of Asn (N) to Ser (S) at position 584 of SEQ ID NO: 1 , or an Asn (N) to Ser (S) amino acid substitution in the corresponding position of said functional homologue thereof.

[0115] In some embodiments, the wild type LEU4 gene comprises or consists of the sequence as set forth in SEQ ID NO: 2. In some embodiments, the wild type LEU4 gene comprises or consists of a homologous sequence of SEQ ID NO: 2, wherein said homologous sequence encodes a polypeptide with at least 80%, such as at least 81%, such as at least 82%, such as at least 83%, such as at least 84%, such as at least 85%, such as at least 86%, such as at least 87%, such as at least 88%, such as at least 89%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, or such as 100% sequence identity to the polypeptide encoded by SEQ ID NO: 1.

[0116] In some embodiments of the present disclosure, the mutant LEU4 gene has a C to T mutation in position 1535 of SEQ ID NO: 2, or has a corresponding mutation, such as a C to T mutation, in a corresponding position in said homologous sequence of SEQ ID NO: 2.

[0117] In some embodiments of the present disclosure, the mutant LEU4 gene has a nucleic acid mutation or substitution as described in Example 5, Table 9. In some embodiments, the mutant LEU4 gene has a nucleic acid mutation or substitution of SEQ ID NO: 2 as described in Example 5, Table 9 or a corresponding nucleic acid mutation or substitution in a corresponding position in a homologue of SEQ ID NO: 2 with at least 90%, such as at least 95%, such as at least 98% sequence identity to SEQ ID NO: 2.

[0118] The mutant LEU4 gene may comprise more than one of the nucleic acid mutations or substitutions as described herein, such as 2, 3, 4, 5, or more.

[0119] The Starmera yeast strains according to the present disclosure produce significantly higher levels of isoamyl alcohol and isoamyl acetate compared to wild type Starmera yeast strains. Additionally, the Starmera yeast strains according to the present disclosure produce lower amounts of the off-flavour ethyl acetate.

[0120] In some embodiments, said production of isoamyl alcohol and isoamyl acetate is determined after fermentation performed essentially as described in Example 1 , 2 or 4 (either Ankom fermentation or 50L fermentation). In preferred embodiments, said production of isoamyl acetate is determined after fermentation performed essentially as described in Example 1 or 2 (either Ankom fermentation or 50L fermentation).

[0121] The skilled person will be able to adjust the fermentation conditions according to needs, e.g. by upscaling. The level of isoamyl alcohol, isoamyl acetate and / or ethyl acetate may be measured after fermentation, e.g., essentially as described in Example 1 (section “Analysis of esters and isoamyl alcohol”).

[0122] In some embodiments of the present disclosure, the yeast strain as described herein produces at least 1.25 times, such as at least 1.5 times, such as at least 1.75 times, preferably at least 2 times, such as at least 2.25 times, such as at least 2.5 times the level of isoamyl acetate compared to a reference strain of the genus Starmera.

[0123] In some embodiments, the yeast strain as described herein produces at from 1.25 to 5 times, such as from 1.25 to 4 times such as from 1.25 to 3 times, such as from 1.5 to least 2.5 times, such as from 1.75 to 2.25 times the level of isoamyl acetate compared to a reference strain of the genus Starmera.

[0124] In some embodiments of the present disclosure, the yeast strain as described herein produces at least 1.25 times, such as at least 1.5 times, such as at least 1.75 times, preferably at least 2 times, such as at least 2.25 times, such as at least 2.5 times the level of isoamyl alcohol compared to a reference strain of the genus Starmera. In some embodiments, the yeast strain as described herein produces at from 1.25 to 5 times, such as from 1.25 to 4 times such as from 1.25 to 3 times, such as from 1.5 to least 2.5 times, such as from 1.75 to 2.25 times the level of isoamyl alcohol compared to a reference strain of the genus Starmera.

[0125] In some embodiments of the present disclosure, the yeast strain as described herein produces less than 95%, such as less than 90%, such as less than 85%, such as less than 80% of the level of ethyl acetate compared to a reference strain of the genus Starmera. In some embodiments, the yeast strain as described herein produces from 95% to 85%, such as from 90% to 80% of the level of ethyl acetate compared to a reference strain of the genus Starmera.

[0126] In some embodiments, the reference strain is a yeast strain of the species Starmera caribaea comprising a wild type LEU4 gene. In some embodiments, the reference strain as described above has an identical genotype to the yeast strain as described elsewhere herein except a. not comprising said mutant LEU4 gene; and b. comprising said wild type LEU4 gene.

[0127] The isoamyl acetate, isoamyl alcohol and ethyl acetate content of a yeast cell may be measured by any method known to the skilled person in the art suitable for measuring said content.

[0128] In some embodiments, the levels of isoamyl acetate, isoamyl alcohol and / or ethyl acetate are determined by gas chromatography-mass spectrometry (GC-MS), preferably as described in Example 1 .

[0129] Without being bound by theory, yeast production of specific esters, such as isoamyl acetate, may be increased by fermentation at higher temperatures. Thus, in preferred embodiments, the levels of isoamyl acetate are determined after fermentation with the yeast strain at 16°C. In preferred embodiments, the levels of isoamyl alcohol are determined after fermentation with the yeast strain at 16°C. In preferred embodiments, the levels of ethyl acetate are determined after fermentation with the yeast strain at 16°C.

[0130] In some embodiments, aforementioned levels of isoamyl acetate, isoamyl alcohol and / or ethyl acetate are determined after fermentation with said yeast strain in wort of 9° Plato for 5 days at 16°C.

[0131] In some embodiments of the present disclosure, the yeast strain produces at least 15ppm, such as at least 20 ppm, for example at least 23 ppm isoamyl acetate after fermentation in wort of 9° Plato for 5 days at 16°C.

[0132] In some embodiments of the present disclosure, the yeast strain produces at least 10 ppm, such as at least 15 ppm isoamyl alcohol after fermentation in wort of 9° Plato for 5 days at 16°C. In some embodiments of the present disclosure, the yeast strain produces at the most 130 ppm ethyl acetate after fermentation in wort of 9° Plato for 5 days at 16°C.

[0133] The yeast strains as disclosed herein are particularly suitable for producing beverages with low concentrations of alcohol, such as non-alcoholic beverages, due to their low production of ethanol during fermentation.

[0134] In some embodiments of the present disclosure, the yeast strain produces at the most 0.5%, for example at the most 0.47%, such as at the most 0.4%, such as at the most 0.3%, such as at the most 0.2%, such as at the most 0.1%, such as at the most 0.09%, such as at the most 0.08%, such as at the most 0.07%, such as at the most 0.06%, such as at the most 0.05%, such as at the most 0.047%, such as at the most 0.04%, such as at the most 0.03%, such as at the most 0.02%, such as at the most 0.01%, such as at the most 0.0% alcohol by volume (ABV) at the end of fermentation.

[0135] The end of fermentation may in some embodiments be after fermentation for at least 2 days, such as for at least 3 days, for example for in the range of 3 to 7 days, such as for in the range of 5 to 7 days. The end of fermentation may also be when the level of Strecker aldehydes, such as 2-methylpropanal (2-MePr), 2-methylbutanal (2-Me-Bu), 3-methylbutanal (3-MeBu), fufural, methional and phenylacetaldehyde (PheAcel) are below the taste perception threshold in the fermented beverage base, such as the taste perception thresholds defined in Gernat et al., 2019 and / or Piornos et al., 2020. The end of fermentation may in particular be the point in time when fermentation is complete as described below in the section “Fermented beverage base and methods of production thereof”.

[0136] In some embodiments of the present disclosure, the yeast strain produces at the most 0.5%, such as at the most 0.4%, for example at the most 0.47%, such as at the most 0.3%, such as at the most 0.2%, such as at the most 0.1%, such as at the most 0.09%, such as at the most 0.08%, such as at the most 0.07%, such as at the most 0.06%, such as at the most 0.05%, such as at the most 0.047%, such as at the most 0.04%, such as at the most 0.03%, such as at the most 0.02%, such as at the most 0.01%, such as at the most 0.0% alcohol by volume (ABV) after fermentation in wort of 9° Plato for 5 days at 16°C. The methods of producing a beverage may in some embodiments comprise a step of debrewing said fermented beverage base. The aforementioned levels alcohol and other compounds are preferably the levels obtained before debrewing.

[0137] The yeast strain of the invention is in general a yeast of the genus Starmera. In preferred embodiments, the yeast strain is of the species Starmera caribaea, also known as Pichia caribaea.

[0138] As is known to the skilled person in the art, a yeast species may also be taxonomically defined according to its internal transcribed spacer (ITS) region, see e.g. Vu et al., 2016. ITS regions in yeast are non-coding sequences located between the small subunit rRNA and large subunit rRNA genes within the rRNA gene cluster. These regions are transcribed along with the rRNA genes but are removed during rRNA maturation. ITS regions are highly variable in sequence among different yeast species, making them useful for phylogenetic studies and species identification.

[0139] In some embodiments, a yeast of the genus Starmera is defined as a yeast comprising an internal transcribed spacer (ITS) region comprising or consisting of a sequence with at least 80%, such as at least 81%, such as at least 82%, such as at least 83%, such as at least 84%, such as at least 85%, such as at least 86%, such as at least 87%, such as at least 88%, such as at least 89%, such as at least 90% sequence identity to SEQ ID NO: 4. In preferred embodiments, a yeast of the genus Starmera is defined as a yeast comprising an ITS region consisting of a sequence with at least 85% sequence identity to SEQ ID NO: 4.

[0140] In some embodiments, a yeast of the species Starmera caribaea is defined as a yeast comprising an internal transcribed spacer (ITS) region comprising or consisting of a sequence with at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as at least 100% sequence identity to SEQ ID NO: 4. In preferred embodiments, a yeast of the species Starmera caribaea is defined as a yeast comprising an ITS region consisting of a sequence with at least 99% sequence identity to SEQ ID NO: 4.

[0141] In some embodiments, the yeast strain is haploid. In some embodiments, the yeast strain is diploid. In some embodiments, the yeast strain is diploid and is homozygous for the mutation(s) in the LEU4 gene or homolog thereof as described elsewhere herein.

[0142] In some embodiments, the yeast strain is auxotrophic for L-methionine and / or L- cysteine. In some embodiments, the yeast strain is auxotrophic for L-methionine. In some embodiments, the yeast strain is auxotrophic for L-cysteine. In some embodiments, the yeast strain is auxotrophic for L-methionine and L-cysteine.

[0143] Fermented beverage base and methods of production thereof

[0144] The present disclosure also provides methods of preparing a fermented beverage base, such as a fermented aqueous extract, using the yeast strains as described elsewhere herein.

[0145] In one aspect of the present disclosure is therefore provided a method of producing a fermented beverage base, such as a fermented aqueous extract of malt and / or cereal grains, said method comprising the steps of: i) Providing a beverage base, such as an aqueous extract of malt and / or cereal grains of grains, such as malt and / or cereal grains; ii) providing a Starmera yeast strain, wherein said yeast strain is as described elsewhere herein; and iii) fermenting the beverage base, such as the aqueous extract of malt and / or cereal grains, provided in step i) with said yeast strain of step ii), thereby obtaining a fermented beverage base, such as a fermented aqueous extract of malt and / or cereal grains.

[0146] The beverage base may be any aqueous extract of kernels or any type of juice, such as apple, orange or grape juice, or any type of fruits, such as apples, pears or grapes, optionally in combination.

[0147] The juice may be any juice. In some embodiments, the juice is a pure fruit juice. The juice may also be provided in the form of a concentrate or as RTD (ready- to-d rink) juice. The juice may be the juice of any fruit, such as berries, orange, apple, banana, lemon, lime, passion fruit, mango, pineapple, pears, kumquats, pomelo, pomegranate, rhubarb and / or grape. Non-limiting examples of useful juice includes apple juice and orange juice. The juice may be the juice of any vegetable, such as carrot juice.

[0148] In some embodiments it may be preferred that the juice is free of solid particles, e.g. that the juice is a fruit juice essentially clear of solid materials, such as pulp.

[0149] The gravity of the juice may for example be between 5 and 15° Plato, such as in the range of 8 to 12° Plato. Another measure for sugar content of a beverage is the BRIX value. RTD juice to be used with the present invention typically has an RTD in the range of 60 to 80, such as in the range of 65 to 71 BRIX.

[0150] In embodiments of the invention, where the beverage is wine, the beverage base is preferably fruit juice, more preferably grape juice.

[0151] In embodiments of the invention, where the beverage is cider, the beverage base is preferably fruit juice, more preferably apple juice.

[0152] The beverage base may also be made from steamed cereals, e.g rice, which optionally have been incubated with fungi, such as Aspergillus oryzae. For example, the beverage base may be shubo or moto. This may in particular be the case in embodiments of the invention where the beverage is sake.

[0153] In some embodiments, the beverage base is an aqueous extract of malt and / or cereal grains. Thus, a non-limiting example hereof is wort. The aqueous extract may for example be prepared by preparing an extract of malt by mashing and optionally sparging as described herein in this section below.

[0154] Malt is cereal kernels, such as barley kernels, that have been malted. By the term "malting" is to be understood a process involving steeping and germination of kernels in a process taking place under controlled environmental conditions, optionally followed by a drying step. Said drying step may preferably be kiln drying of the germinated kernels at elevated temperatures. Green malt, which has not been subject to kilning may also be used, in particular malt obtained by the process described in WO 2018 / 001882 or WO 2019 / 129731.

[0155] Malting is important for the synthesis of numerous enzymes that cause kernel modification, processes that principally depolymerize starch and cell walls of the dead endosperm to mobilize the kernel nutrients and activate other depolymerases. In the subsequent drying process, flavor and color are generated at least partly due to chemical browning reactions.

[0156] Steeping may be performed by any conventional method known to the skilled person. One non-limiting example involves steeping at a temperature in the range of 10°C to 25°C with alternating dry and wet conditions. Germination may be performed by any conventional method known to the skilled person. One non-limiting example involves germination at a temperature in the range of 10 to 25°C, optionally with changing temperature, in the range of 1 to 4 h. Steeping and germination may also be performed in a combined method, e.g. as described in international patent application WO 2018 / 001882 or WO 2019 / 129731.

[0157] The kiln drying may be performed at conventional temperatures, such as at least 75°C, for example in the range of 80 to 90°C, such as in the range of 80 to 85°C. Thus, the malt may, for example be produced by any of the methods described by Briggs et al. (1981) and by Hough et al. (1982). However, any other suitable method for producing malt may also be used with the present invention, such as methods for production of specialty malts, including, but not limited to, methods of roasting the malt.

[0158] Malt may be further processed, for example by milling. Milling can be performed in a dry state, i.e. the malt is milled while dry or in a wet state if green malt is used.

[0159] The malt, e.g. the milled malt may be mashed to prepare an aqueous extract of said malt. The starting liquid for preparing the beverage may be an aqueous extract of malt, e.g. an aqueous extract of malt prepared by mashing.

[0160] Thus, the method for preparing a malt and / or cereal based fermented aqueous extract according to the invention may comprise a step of producing an aqueous extract, such as wort, by mashing malt and optionally additional adjuncts. Said mashing step may also optionally comprise sparging, and accordingly said mashing step may be a mashing step including a sparging step or a mashing step excluding a sparging step.

[0161] In general, the production of the aqueous extract is initiated by the milling of malt and / or kernels. If additional adjuncts are added, these may also be milled depending on their nature. If the adjunct is a cereal, it may for example be milled, whereas syrups, sugars and the like will generally not be milled. Milling will facilitate water access to kernel particles in the mashing phase. During mashing enzymatic depolymerization of substrates initiated during malting may be continued.

[0162] In general, the aqueous extract is prepared by combining and incubating milled malt and water, i.e. in a mashing process. During mashing, the malt / liquid composition may be supplemented with additional carbohydrate-rich adjunct compositions, for example milled barley, maize, or rice adjuncts. Unmalted cereal adjuncts usually contain little or no active enzymes, making it important to supplement with malt or exogenous enzymes to provide enzymes necessary for polysaccharide depolymerization etc.

[0163] During mashing, milled malt and / or milled grains - and optionally additional adjuncts are incubated with a liquid fraction, such as water. The incubation temperature is in general either kept constant (isothermal mashing), or gradually increased, for example increased in a sequential manner. In either case, soluble substances in the malt / kernel / adjuncts are liberated into said liquid fraction. A subsequent filtration confers separation of the aqueous extract and residual solid particles, the latter also denoted "spent kernel". The aqueous extract thus obtained may also be denoted "first wort". Additional liquid, such as water may be added to the spent kernels during a process also denoted sparging. After sparging and filtration, a "second wort" may be obtained. Further worts may be prepared by repeating the procedure. Non-limiting examples of suitable procedures for preparation of wort is described by Briggs et al. (1981) and Hough et al. (1982).

[0164] As mentioned above, the aqueous extract may also be prepared by mashing only unmalted kernels. Unmalted kernels lack or contain only a limited amount of enzymes beneficial for wort production, such as enzymes capable of degrading cell walls or enzymes capable of depolymerising starch into sugars. Thus, in embodiments of the invention where up to 80%, such as 90% or such as 100% of unmalted kernels, such as barley kernels, are used for mashing, it is preferred that one or more suitable, external brewing enzymes are added to the mash Suitable enzymes may be lipases, starch degrading enzymes (e.g. amylases), glucanases [preferably (1-4)- and / or (1-3,1- 4)-p-glucanase], and / or xylanases (such as arabinoxylanase), and / or proteases, or enzyme mixtures comprising one or more of the aforementioned enzymes, e.g. Cereflo, Ultraflo, or Ondea Pro (Novozymes). However, even if a lower amount of unmalted grains or no unmalted grains are used, enzymes may be added to the mash.

[0165] The aqueous extract may also be prepared by using a mixture of malted and unmalted kernels, in which case one or more suitable enzymes may be added during preparation. Even in embodiments, where malt is used enzymes may also be added. More specifically, kernels can be used together with malt in any combination for mashing - with or without external brewing enzymes - such as, but not limited to, the proportions of kernel: malt = approximately 100 : 0, or approximately 75 : 25, or approximately 50 : 50, or approximately 25 : 75.

[0166] The aqueous extract obtained after mashing may also be referred to as “sweet wort”. In conventional methods, the sweet wort is boiled with or without hops where after it may be referred to as boiled wort.

[0167] The beverage base, such as the aqueous extract of malt and / or cereal grains, may be heated or boiled before it is subjected to fermentation with the yeast of the invention. In one aspect of the invention, second and further worts may be combined, and thereafter subjected to heating or boiling. The beverage base, such as the aqueous extract of malt and / or cereal grains may be heated or boiled for any suitable amount of time, e.g. in the range of 60 min to 120 min. Said heating or boiling may preferably be performed in the presence of hops.

[0168] The outcome of the fermented beverage base, such as the malt and / or cereal based fermented aqueous extract, is highly dependent on the amount and type of fermentable sugars present in the beverage base, such as in the aqueous extract of malt and / or cereal kernels, as well as the characteristics of the yeast strain used during fermentation. Thus, the beverage base, such as the aqueous extract of malt and / or cereal grains, e.g. wort, may be prepared as described above. The fermented beverage base, such as the malt and / or cereal based fermented aqueous extract, may be prepared by fermentation of said beverage base, such as said aqueous extract of malt and / or cereal grains, with the yeast strain as described elsewhere herein.

[0169] In preferred embodiments, the fermented beverage base, such as the fermented aqueous extract of malt and / or cereal grains, is a green beer, more preferably a green non-alcoholic beer or low-alcohol beer.

[0170] In general terms, alcoholic or non-alcoholic fermented beverage bases, such as fermented aqueous extracts - such as beer - may be manufactured from malted and / or unmalted kernels. Malt, in addition to hops and yeast, contributes to flavor and color of the beverage, such as beer. Furthermore, malt functions as a source of fermentable sugar and enzymes. Non-limited descriptions of examples of suitable methods for malting and brewing can be found, for example, in publications by Briggs et al. (1981) and Hough et al. (1982). Numerous, regularly updated methods for analyses of kernel, malt and beer products are available, for example, but not limited to, American Association of Cereal Chemists (1995), American Society of Brewing Chemists (1992), European Brewery Convention (1998), and Institute of Brewing (1997). It is recognized that many specific procedures are employed for a given brewery, with the most significant variations relating to local consumer preferences. Any such method of producing beer may be used with the present invention.

[0171] The first step of producing beer from wort preferably involves heating said wort as described herein above, followed by a subsequent phase of wort cooling and optionally whirlpool rest.

[0172] The method of the invention comprises a step of fermenting a beverage base, such as an aqueous extract of malt and / or cereal kernels, such as malt and / or cereal kernels, with the yeast strain according to the invention. Said fermentation may be a fermentation of an unfermented beverage base, such as an unfermented aqueous extract, or a fermented beverage base, such as a fermented aqueous extract of malt and / or cereal grains, still containing fermentable sugars for the yeast. Thus, in some embodiments said fermentation may be performed essentially immediately after completion of mashing or after heating of wort.

[0173] Fermentation may be performed in fermentation tanks containing yeast according to the invention. During the several-day-long fermentation process, flavour substances are developed. If the yeast strain is not capable of converting specific compounds, these will still be present after the fermentation step iii).

[0174] In some embodiments, the pitching rate is about 3x106yeast cells / mL. In some embodiments, the pitching rate is about 6x106yeast cells / mL.

[0175] In some embodiments, fermentation is performed essentially as described in Example 2 or 4 (either Ankom fermentation or 50L fermentation). The skilled person will be able to adjust the fermentation conditions according to needs, e.g. by upscaling.

[0176] Fermentation with the yeast strains according to the present invention have the additional beneficial property of the fermented beverage base, such as the fermented aqueous extract of malt and / or cereal grains, being very low in alcohol already immediately at the end of fermentation. This enables further processing into a low- or non-alcoholic beverage without any additional steps to lower the alcohol content. Optionally, a step of debrewing may be included at the end of fermentation.

[0177] In some embodiments, fermentation is complete once the Strecker aldehydes, such as 2-methylpropanal (2-MePr), 2-methylbutanal (2-Me-Bu), 3-methylbutanal (3-MeBu), fufural, methional and phenylacetaldehyde (PheAcel) are below the taste perception threshold in the fermented beverage base, such as the taste perception thresholds defined in Gernat et al., 2019 and / or Piornos et al., 2020.

[0178] Strecker aldehydes in the beverage base may be measured by any method known to the skilled person in the art suitable for measuring said content. In some embodiments, said Strecker aldehyde levels are measured as described in Gernat et al., 2019 and / or Piornos et al., 2020. In preferred embodiments, said Strecker aldehydes are measured in fresh beer. In some embodiments, fermentation is complete once said Strecker aldehydes are at or below the concentrations listed in Table B, below.

[0179] Table B. Threshold values for Strecker aldehydes for fermentation to be considered complete.

[0180] In some embodiments, fermentation is complete once the fermented beverage base, such as the fermented malt and / or cereal based aqueous extract, comprises

[0181] • 0-100 pg / L of 2-methylpropanal;

[0182] • 0-50 pg / L of 2-methylbutanal;

[0183] • 0-60 pg / L of 3-methylbutanal;

[0184] • 0-20 pg / L of methional;

[0185] • optionally, 0-60 pg / L of furfural; and

[0186] • optionally, 0-25 pg / L of phenyl acetaldehyde.

[0187] In some embodiments, fermentation is complete once the fermented beverage base, such as the fermented malt and / or cereal based aqueous extract, comprises

[0188] • 0-100 pg / L of 2-methylpropanal;

[0189] • 0-50 pg / L of 2-methylbutanal;

[0190] • 0-60 pg / L of 3-methylbutanal;

[0191] • 0-20 pg / L of methional;

[0192] • 0-60 pg / L of furfural; and

[0193] • 0-25 pg / L of phenyl acetaldehyde.

[0194] In some embodiments, fermentation is complete once the fermented beverage base, such as the fermented malt and / or cereal based aqueous extract, comprises

[0195] • 0-20 pg / L of 2-methylpropanal;

[0196] • 0-10 pg / L of 2-methylbutanal;

[0197] • 0-20 pg / L of 3-methylbutanal;

[0198] • 0-50 pg / L of furfural.

[0199] • 0-20 pg / L of methional; and

[0200] • 0-20 pg / L of phenyl acetaldehyde. In some embodiments, fermentation is complete once the fermented beverage base, such as the fermented malt and / or cereal based aqueous extract, comprises

[0201] • 0-6 pg / L of 2-methylbutanal;

[0202] • 0-14 pg / L of 3-methylbutanal;

[0203] • 0-12 pg / L of 2-methylpropanal;

[0204] • 0-6 pg / L of methional;

[0205] • 8-100 pg / L of phenyl acetaldehyde; and

[0206] • 0-500 pg / L of furfural, such as 30-500 pg / L of furfural.

[0207] In some embodiments, fermentation is complete once the fermented beverage base, such as the fermented malt and / or cereal based aqueous extract, comprises

[0208] • 0-6 pg / L of 2-methylbutanal;

[0209] • 0-14 pg / L of 3-methylbutanal;

[0210] • 0-12 pg / L of 2-methylpropanal;

[0211] • 0-6 pg / L of methional;

[0212] • 8-100 pg / L of phenyl acetaldehyde; and

[0213] • 0-500 pg / L of furfural, such as 30-500 pg / L of furfural, wherein

[0214] • the combination of 2-methylbutanal, 3-methylbutanal, 2-methylpropanal and methional is present in a combined concentration of X pg / L;

[0215] • phenyl acetaldehyde is present in a concentration of Y pg / L; and

[0216] • furfural is present in a concentration of Z pg / L; and wherein:

[0217] X:Y < 1 :2; and / or

[0218] X:Z < 1:20.

[0219] In some embodiments, fermentation is complete after fermentation for at least 2 days, such as for at least 3 days, for example for in the range of 3 to 7 days, such as for in the range of 5 to 7 days. In some embodiments, fermentation is complete after a maximum of 7 days, such as a maximum of 6 days, such as a maximum of 5 days, such as a maximum of 4 days, such as a maximum of 3 days. In preferred embodiments, fermentation is complete after a maximum or 5 days, such as after a maximum of 3 days, such as after a maximum of from 3 to 5 days. In some embodiments, fermentation is complete after a maximum of 5 days, wherein the fermentation is performed as described in Example 2 (Ankom fermentation), i.e. with a 9° Plato Holsten Wort at 16°C.

[0220] In some embodiments, fermentation is complete after a maximum of 5 days wherein the fermentation is performed as described in Example 4 (Ankom fermentation or 50L fermentation). In some embodiments, fermentation is complete after a maximum of 4 days wherein the fermentation is performed as described in Example 4 (Ankom fermentation or 50L fermentation).

[0221] In some embodiments, fermentation is complete after a maximum of 7 days, wherein fermentation is performed at 16°C with a 9° Plato Holsten Wort at 16°C for 5 days followed by cooling to 1 ,5°C until day 7.

[0222] In some embodiments, the fermented beverage base, such as the fermented aqueous extract of malt and / or cereal grains, comprises at the most 0.5%, such as at the most 0.4%, such as at the most 0.3%, such as at the most 0.2%, such as at the most 0.1 %, such as at the most 0.0% alcohol by volume (ABV). Preferably, the fermented beverage base, such as the fermented aqueous extract of malt and / or cereal grains, comprises at the most 0.5%, for example at the most 0.47%, such as at the most 0.4%, such as at the most 0.3%, such as at the most 0.2%, such as at the most 0.1 %, such as at the most 0.09%, such as at the most 0.08%, such as at the most 0.07%, such as at the most 0.06%, such as at the most 0.05%, such as at the most 0.047%, such as at the most 0.04%, such as at the most 0.03%, such as at the most 0.02%, such as at the most 0.01%, such as at the most 0.0% alcohol by volume (ABV) immediately at the end of fermentation, i.e. immediately when fermentation is complete.

[0223] In some embodiments, the fermented beverage base, such as the fermented aqueous extract of malt and / or cereal grains, comprises from 0.5 to 0.0%, such as from 0.4 to 0.0%, such as from 0.3 to 0.0%, such as from 0.2 to 0.0%, such as from 0.1 to 0.0 alcohol by volume (ABV). Preferably, the fermented beverage base, such as the fermented aqueous extract of malt and / or cereal grains, comprises from 0.5 to 0.0%, such as from 0.4 to 0.0%, such as from 0.3 to 0.0%, such as from 0.2 to 0.0%, such as from 0.1 to 0.0 alcohol by volume (ABV) immediately at the end of fermentation, i.e. immediately when fermentation is complete. In some aspects of the present disclosure is also provided a fermented beverage base, such as a fermented aqueous extract of malt and / or cereal grains, prepared by the method as described herein above.

[0224] Beverage and methods of production thereof

[0225] The fermented beverage base, such as the fermented aqueous extract, such as the malt and / or cereal based fermented aqueous extract, described herein above may be further processed into a beverage.

[0226] It is therefore a further aspect of the present disclosure to provide a method of producing a beverage, such as a malt and / or cereal based beverage, said method comprising the steps of: i. preparing a fermented beverage base, such as a fermented aqueous extract of malt and / or cereal grains, by the method as described elsewhere herein, and ii. processing said fermented beverage base into a beverage.

[0227] In some embodiment of the present invention, the beverage, such as the malt and / or cereal based beverage, is diluted with a liquid, such as water.

[0228] Optionally, water can be used to dilute the beverage. In one embodiment of the present invention the proportions of water: beverage may be in the range of 0.1 to 5 parts water to 1 part beverage.

[0229] The further process may for example also include lagering, chilling and / or filtering of the beverage, such as the malt and / or cereal based beverage. In addition, additives may be added. Furthermore, CO2 may be added (carbonation). Finally, the beverage, such as the malt and / or cereal based beverage, such as a beer, may be pasteurized and / or filtered, before it is packaged (e.g. bottled or canned).

[0230] In some embodiments, the beverage has an ethanol content of 0.0%.

[0231] In some embodiments, the beverage comprises less than 2.00% ethanol. In some embodiments, the beverage comprises less than 1.75% ethanol. In some embodiments, the beverage comprises less than 1.50% ethanol. In some embodiments, the beverage comprises less than 1.25% ethanol. In some embodiments, the beverage comprises less than 1.00% ethanol. In some embodiments, the beverage comprises less than 0.75% ethanol. In some embodiments, the beverage comprises less than 0.50% ethanol. In some embodiments, the beverage comprises less than 0.47% ethanol. In some embodiments, the beverage comprises less than 0.40% ethanol. In some embodiments, the beverage comprises less than 0.30% ethanol. In some embodiments, the beverage comprises less than 0.20% ethanol. In some embodiments, the beverage comprises less than 0.10% ethanol. In some embodiments, the beverage comprises less than 0.09% ethanol. In some embodiments, the beverage comprises less than 0.08% ethanol. In some embodiments, the beverage comprises less than 0.07% ethanol. In some embodiments, the beverage comprises less than 0.06% ethanol. In some embodiments, the beverage comprises less than 0.05% ethanol. In some embodiments, the beverage comprises less than 0.04% ethanol. In some embodiments, the beverage comprises less than 0.03% ethanol. In some embodiments, the beverage comprises less than 0.02% ethanol. In some embodiments, the beverage comprises less than 0.01% ethanol. In some embodiments, the beverage comprises less than 0.0% ethanol.

[0232] In preferred embodiments, the beverage is a beer. In some embodiments, the beer is a low-alcoholic beer. In some embodiments, the beer is a non-alcoholic or alcohol-free beer. Said beer may be any kind of beer, for example an alcohol-free beer of the lager type or ale type.

[0233] It is an aspect of the present disclosure is provided, that the beverage, such as the malt and / or cereal based beverage, produced by fermenting the beverage base, such as the aqueous extract of malt and / or cereal grains, with the yeast strain according to the present disclosure has a pleasant taste.

[0234] The taste of the beverage, such as the malt and / or cereal based beverage, produced by fermentation with the yeasts according to the invention may be analyzed, for example, by a specialist beer taste panel. Preferably, said panel is trained in tasting and describing beer flavors, with special focus on aldehydes, diacetyl, esters, higher alcohols, fatty acids and sulphury components. In general, the taste panel will consist of in the range of 3 to 30 members, for example in the range of 5 to 15 members, preferably in the range of 8 to 12 members. The taste panel may evaluate the presence of various flavours, such as papery, oxidized, aged, and bready off-flavours as well as flavours of esters, higher alcohols, sulphur components and body of beer. The overall taste of the beer will generally be rated by the taste panel on several different characteristics on a scale from 1 to 9, where an average rating of over 5 signifies that the beer has an acceptable taste.

[0235] The present invention also provides beverages, such as malt and / or cereal based beverages, prepared by the methods described above.

[0236] In some embodiments, the beverage is a wine, such as a red wine or a white wine. In some embodiments, the beverage is a cider. In some embodiments, the beverage is a juice.

[0237] In preferred embodiments, the beverage is a beer. In some embodiments, the beer is a low-alcoholic beer. In some embodiments, the beer is a non-alcoholic or alcohol-free beer.

[0238] Items

[0239] 1. A yeast strain of the genus Starmera, wherein said yeast strain comprises a mutant LELI4 gene encoding a mutant Leu4 polypeptide, wherein the wild type LELI4 gene encodes wild type Leu4 as set forth in SEQ ID NO: 1 or a functional homologue of SEQ ID NO: 1 with at least 90%, such as at least 95%, such as at least 98% sequence identity to SEQ ID NO: 1.

[0240] 2. A yeast strain of the genus Starmera, wherein said yeast strain comprises a mutant LEU4 gene encoding a mutant Leu4 polypeptide, wherein the wild type LEU4 gene encodes wild type Leu4 as set forth in SEQ ID NO: 1 or a functional homologue of SEQ ID NO: 1 with at least 90%, such as at least 95%, such as at least 98% sequence identity to SEQ ID NO: 1, wherein a. said yeast strain produces at least 1.5 times, preferably at least 2 times the level of isoamyl acetate compared to a reference strain of the genus Starmera, optionally wherein the reference strain is a yeast strain of the species Starmera caribaea comprising a wild type LEU4 gene encoding said wild type Leu4 as set forth in SEQ ID NO: 1 ; and / or b. said yeast strain produces at least 1.5 times, preferably at least 2 times the level of isoamyl alcohol compared to a reference strain of the genus Starmera, optionally wherein the reference strain is a yeast strain of the species Starmera caribaea comprising a wild type LEU4 gene encoding said wild type Leu4 as set forth in SEQ ID NO: 1.

[0241] 3. The yeast strain according to any one of the preceding items, wherein said mutant Leu4 polypeptide is capable of catalyzing the conversion of a- ketoisovalerate to a-isopropylmalate in the presence of L-leucine.

[0242] 4. The yeast strain according to any one of the preceding items, wherein said mutant Leu4 polypeptide has reduced sensitivity to L-leucine feedback inhibition or is insensitive to L-leucine feedback inhibition.

[0243] 5. The yeast strain according to any one of the preceding items, wherein said mutant Leu4 polypeptide has a mutation in the C-terminus of SEQ ID NO: 1 or said functional homologue thereof, such as wherein said mutant Leu4 polypeptide has a mutation in one of the 250 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof, such as wherein said mutant Leu4 polypeptide has a mutation in one of the 150 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof, such as wherein said mutant Leu4 polypeptide has a mutation in one of the 130 most C- terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof.

[0244] 6. The yeast strain according to any one of the preceding items, such as wherein said mutant Leu4 polypeptide has a deletion of one or more amino acids of SEQ ID NO: 1 or said functional homologue thereof, such as a deletion of one or more amino acids or all of the amino acids of the 50, 75, 100, 125, or 130 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof.

[0245] 7. The yeast strain according to any one of the preceding items, wherein the mutant Leu4 polypeptide has an amino acid substitution at position 512, 508, 509, 533, 534, 535, 544 or 570 of SEQ ID NO: 1 , or an amino acid substitution in the corresponding position of said functional homologue thereof.

[0246] 8. The yeast strain according to any one of the preceding items, wherein the mutant Leu4 polypeptide has an amino acid substitution at position 474, 485, 488, 490, 506, 507, 510, 511 , 513, 531 , 536, 539, 540, 546, 566, 569, 572, 575, or 584 of SEQ ID NO: 1 , or an amino acid substitution in the corresponding position of said functional homologue thereof.

[0247] 9. The yeast strain according to any one of the preceding items, wherein the mutant Leu4 polypeptide has an amino acid substitution at position 512 of SEQ ID NO: 1 , or an amino acid substitution in the corresponding position of said functional homologue thereof.

[0248] 10. The yeast strain according to item 9, wherein said substitution is substitution of serine (S) to any other amino acid.

[0249] 11. The yeast strain according to item 9, wherein said substitution is substitution of serine (S) to a hydrophobic amino acid.

[0250] 12. The yeast strain according to item 9, wherein said substitution is substitution of serine (S) to an amino acid comprising a side chain comprising an aromatic group.

[0251] 13. The yeast strain according to item 9, wherein said substitution is substitution of serine (S) to phenylalanine (F).

[0252] 14. The yeast strain according to any one of the preceding items, wherein the mutant Leu4 polypeptide has an amino acid substitution at position 508 of SEQ ID NO: 1 , or an amino acid substitution in the corresponding position of said functional homologue thereof.

[0253] 15. The yeast strain according to item 14, wherein said substitution is substitution of asparagine (N) to any other amino acid. 16. The yeast strain according to item 14, wherein said substitution is substitution of asparagine (N) to a charged amino acid, such as a negatively charged amino acid.

[0254] 17. The yeast strain according to item 14, wherein said substitution is substitution of asparagine (N) to aspartic acid (D).

[0255] 18. The yeast strain according to any one of the preceding items, wherein the mutant Leu4 polypeptide has an amino acid substitution at position 509 of SEQ ID NO: 1 , or an amino acid substitution in the corresponding position of said functional homologue thereof.

[0256] 19. The yeast strain according to item 18, wherein said substitution is substitution of glycine (G) to any other amino acid.

[0257] 20. The yeast strain according to item 18, wherein said substitution is substitution of glycine (G) to a polar, uncharged amino acid.

[0258] 21. The yeast strain according to item 18, wherein said substitution is substitution of glycine (G) to serine (S).

[0259] 22. The yeast strain according to any one of the preceding items, wherein the mutant Leu4 polypeptide has an amino acid substitution at position 533 of SEQ ID NO: 1 , or an amino acid substitution in the corresponding position of said functional homologue thereof.

[0260] 23. The yeast strain according to item 22, wherein said substitution is substitution of glutamic acid (E) to any other amino acid.

[0261] 24. The yeast strain according to item 22, wherein said substitution is substitution of glutamic acid (E) to a charged amino acid, such as a positively charged amino acid.

[0262] 25. The yeast strain according to item 22, wherein said substitution is substitution of glutamic acid (E) to lysine (K). 26. The yeast strain according to any one of the preceding items, wherein the mutant Leu4 polypeptide has an amino acid substitution at position 534 of SEQ ID NO: 1 , or an amino acid substitution in the corresponding position of said functional homologue thereof.

[0263] 27. The yeast strain according to item 26, wherein said substitution is substitution of histidine (H) to any other amino acid.

[0264] 28. The yeast strain according to item 26, wherein said substitution is substitution of histidine (H) to a hydrophobic amino acid.

[0265] 29. The yeast strain according to item 26, wherein said substitution is substitution of histidine (H) to proline (P).

[0266] 30. The yeast strain according to any one of the preceding items, wherein the mutant Leu4 polypeptide has an amino acid substitution at position 535 of SEQ ID NO: 1 , or an amino acid substitution in the corresponding position of said functional homologue thereof.

[0267] 31. The yeast strain according to item 30, wherein said substitution is substitution of serine (S) to any other amino acid.

[0268] 32. The yeast strain according to item 30, wherein said substitution is substitution of serine (S) to a hydrophobic amino acid.

[0269] 33. The yeast strain according to item 30, wherein said substitution is substitution of serine (S) to an amino acid comprising a side chain comprising an aromatic group.

[0270] 34. The yeast strain according to item 30, wherein said substitution is substitution of serine (S) to phenylalanine (F).

[0271] 35. The yeast strain according to any one of the preceding items, wherein the mutant Leu4 polypeptide has an amino acid substitution at position 544 of SEQ ID NO: 1 , or an amino acid substitution in the corresponding position of said functional homologue thereof. 36. The yeast strain according to item 35, wherein said substitution is substitution of alanine (A) to any other amino acid.

[0272] 37. The yeast strain according to item 35, wherein said substitution is substitution of alanine (A) to a different non-polar, uncharged amino acid or to a charged amino acid, such as a negatively charged amino acid.

[0273] 38. The yeast strain according to item 35, wherein said substitution is substitution of alanine (A) to valine (V) or to aspartic acid (D).

[0274] 39. The yeast strain according to any one of the preceding items, wherein the mutant Leu4 polypeptide has an amino acid substitution at position 570 of SEQ ID NO: 1 , or an amino acid substitution in the corresponding position of said functional homologue thereof.

[0275] 40. The yeast strain according to item 39, wherein said substitution is substitution of aspartic acid (D) to any other amino acid.

[0276] 41. The yeast strain according to item 39, wherein said substitution is substitution of aspartic acid (D) to a polar, uncharged amino acid.

[0277] 42. The yeast strain according to item 39, wherein said substitution is substitution of aspartic acid (D) to asparagine (N).

[0278] 43. The yeast strain according to any one of the preceding items, wherein the wild type LEU4 gene comprises the sequence as set forth in SEQ ID NO: 2 or a homologous sequence thereof, wherein said homologous sequence encodes a polypeptide with at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 98%, such as 100% sequence identity to the polypeptide encoded by SEQ ID NO: 1.

[0279] 44. The yeast strain according to any one of the preceding items, wherein said mutant LEU4 gene has a C to T mutation in position 1535 of SEQ ID NO: 2, or in a corresponding position in said homologous sequence of SEQ ID NO: 2. The yeast strain according to any one of the preceding items, wherein the mutant Leu4 polypeptide a. has an amino acid substitution of Leu (L) to Ser (S) at position 474 of SEQ ID NO: 1 , or a Leu (L) to Ser (S) amino acid substitution in the corresponding position of said functional homologue thereof; and / or b. has an amino acid substitution of Lys (K) to a STOP at position 485 of SEQ ID NO: 1 , or a Lys (K) to a STOP amino acid substitution in the corresponding position of said functional homologue thereof; and / or c. has an amino acid substitution of Lys (K) to Asn (N) at position 488 of SEQ ID NO: 1, or a Lys (K) to Asn (N) amino acid substitution in the corresponding position of said functional homologue thereof; and / or d. has an amino acid substitution of Cys (C) to Arg (R) at position 490 of SEQ ID NO: 1, or a Cys (C) to Arg (R) amino substitution in the corresponding position of said functional homologue thereof; and / or e. has an amino acid substitution of Leu (L) to a STOP at position 506 of SEQ ID NO: 1, or a Leu (L) to a STOP amino acid substitution in the corresponding position of said functional homologue thereof; and / or f. has an amino acid substitution of Gly (G) to Asp (D) at position 507 of SEQ ID NO: 1, or a Gly (G) to Asp (D) amino acid substitution in the corresponding position of said functional homologue thereof; and / or g. has an amino acid substitution of Asn (N) to Tyr (Y) at position 508 of SEQ ID NO: 1, or an Asn (N) to Tyr (Y) amino acid substitution in the corresponding position of said functional homologue thereof; and / or h. has an amino acid substitution of Pro (P) to Arg (R) at position 510 of SEQ ID NO: 1 , or a Pro (P) to Arg (R) amino acid substitution in the corresponding position of said functional homologue thereof; and / or i. has an amino acid substitution of lie (I) to Phe (F) at position 511 of SEQ ID NO: 1 , or an lie (I) to Phe (F) amino acid substitution in the corresponding position of said functional homologue thereof; and / or j. has an amino acid substitution of Ser (S) to Leu (L) at position 513 of SEQ ID NO: 1 , or a Ser (S) to Leu (L) amino acid substitution in the corresponding position of said functional homologue thereof; and / or k. has an amino acid substitution of Tyr (Y) to His (H) at position 531 of SEQ ID NO: 1 , or a Tyr (Y) to His (H) amino acid substitution in the corresponding position of said functional homologue thereof; and / or l. has an amino acid substitution of Glu (E) to Lys (K) at position 533 of SEQ ID NO: 1 , or a Glu (E) to Lys (K) amino acid substitution in the corresponding position of said functional homologue thereof; and / or m. has an amino acid substitution of His (H) to Leu (L) at position 534 of SEQ ID NO: 1 , or a His (H) to Leu (L) amino acid substitution in the corresponding position of said functional homologue thereof; and / or n. has an amino acid substitution of lie (I) to Phe (F) at position 536 of SEQ ID NO: 1 , or an lie (I) to Phe (F) amino acid substitution in the corresponding position of said functional homologue thereof; and / or o. has an amino acid substitution of Gly (G) to Arg (R) at position 539 of SEQ ID NO: 1 , or a Gly (G) to Arg (R) amino acid substitution in the corresponding position of said functional homologue thereof; and / or p. has an amino acid substitution of Ser (S) to Pro (P) at position 540 of SEQ ID NO: 1 , or a Ser (S) to Pro (P) amino acid substitution in the corresponding position of said functional homologue thereof; and / or q. has an amino acid substitution of Thr (T) to Phe (F) at position 546 of SEQ ID NO: 1 , or a Thr (T) to Phe (F) amino acid substitution in the corresponding position of said functional homologue thereof; and / or r. has an amino acid substitution of Gly (G) to Asp (D) at position 566 of SEQ ID NO: 1 , or a Gly (G) to Asp (D) amino acid substitution in the corresponding position of said functional homologue thereof; and / or s. has an amino acid substitution of Glu (E) to Lys (K) at position 569 of SEQ ID NO: 1 , or a Glu (E) to Lys (K) amino acid substitution in the corresponding position of said functional homologue thereof; and / or t. has an amino acid substitution of Ser (S) to Pro (P) at position 572 of SEQ ID NO: 1 , or a Ser (S) to Pro (P) amino acid substitution in the corresponding position of said functional homologue thereof; and / or u. has an amino acid substitution of Ala (A) to Pro (P) at position 575 of SEQ ID NO: 1 , or an Ala (A) to Pro (P) amino acid substitution in the corresponding position of said functional homologue thereof; and / or v. has an amino acid substitution of Asn (N) to Ser (S) at position 584 of SEQ ID NO: 1 , or an Asn (N) to Ser (S) amino acid substitution in the corresponding position of said functional homologue thereof. 46. The yeast strain according to any one of the preceding items, wherein said mutation is a non-conservative amino acid substitution or a deletion of one or more amino acids.

[0280] 47. The yeast strain according to any one of the preceding items, wherein said yeast strain produces at least 1.5 times, preferably at least 2 times the level of isoamyl acetate compared to a reference strain of the genus Starmera.

[0281] 48. The yeast strain according to any one of the preceding items, wherein said yeast strain produces at least 1.5 times, preferably at least 2 times the level of isoamyl alcohol compared to a reference strain of the genus Starmera.

[0282] 49. The yeast strain according to any one of the preceding items, wherein said yeast strain produces less than 90% of the level of ethyl acetate compared to a reference strain of the genus Starmera.

[0283] 50. The yeast strain according to any one of items 47 to 49, wherein said levels of isoamyl acetate, isoamyl alcohol and / or ethyl acetate are measured after fermentation for 5 days at 16°C, such as after fermentation in wort of 9° Plato for 5 days at 16°C.

[0284] 51. The yeast strain according to any one of items 47 to 50, wherein the reference strain is a yeast strain of the species Starmera caribaea comprising a wild type LEU4 gene.

[0285] 52. The yeast strain according to any one of items 47 to 51 , wherein the reference strain has an identical genotype to said yeast strain except a. not comprising said mutant LEU4 gene; and b. comprising said wild type LEU4 gene.

[0286] 53. The yeast strain according to any one of the preceding items, wherein said yeast strain produces at least 15 ppm, such as at least 20 ppm, for example at least 23 ppm isoamyl acetate after fermentation in wort of 9° Plato for 5 days at 16°C. 54. The yeast strain according to any one of the preceding items, wherein said yeast strain produces at least 10 ppm, such as at least 15 ppm isoamyl alcohol after fermentation in wort of 9° Plato for 5 days at 16°C.

[0287] 55. The yeast strain according to any one of the preceding items, wherein said yeast strain produces at the most 130 ppm ethyl acetate after fermentation in wort of 9°Plato for 5 days at 16°C.

[0288] 56. The yeast strain according to any one of the preceding items, wherein said yeast strain produces at the most 0.5%, such as at the most 0.4%, such as at the most 0.3%, such as at the most 0.2%, such as at the most 0.1%, such as at the most 0.0% alcohol by volume (ABV) after fermentation in wort of 9° Plato for 5 days at 16°C.

[0289] 57. The yeast strain according to any one of the preceding items, wherein said yeast strain is of the species Starmera caribaea.

[0290] 58. The yeast strain according to any one of the preceding items, wherein said yeast strain is haploid or diploid.

[0291] 59. The yeast strain according to any one of the preceding items, wherein said yeast strain is diploid and is homozygous for said mutant LEU4 gene.

[0292] 60. The yeast strain according to any one of the preceding items, wherein said functional homologue of Leu4 of SEQ ID NO: 1 catalyzes production of isoamyl alcohol, isoamyl acetate, and / or ethyl acetate when expressed in said yeast strain, comparable to the levels of isoamyl alcohol, isoamyl acetate, and / or ethyl acetate produced when wild type Starmera caribaea Leu4 of SEQ ID NO: 1 is expressed in a wild type Starmera caribaea strain.

[0293] 61. The yeast strain according to item 60, wherein said functional homologue catalyzes production of levels of isoamyl alcohol, isoamyl acetate, and / or ethyl acetate when expressed in said strain that are + / - 10% of the levels of isoamyl alcohol, isoamyl acetate, and / or ethyl acetate produced in said wild type Starmera caribaea strain comprising said wild type Starmera caribaea Leu4 of SEQ ID NO: 1. A method of producing a fermented beverage base, such as a fermented aqueous extract of malt and / or cereal grains, said method comprising the steps of: i) Providing a beverage base, such as an aqueous extract of malt and / or cereal grains; ii) providing a Starmera yeast strain, wherein said yeast strain is according to any one of items 1 to 61 ; and iii) fermenting the beverage base, such as the aqueous extract of malt and / or cereal grains, provided in step i) with said yeast strain of step ii), thereby obtaining a fermented beverage base, such as a fermented aqueous extract of malt and / or cereal grains. The method according to item 62, wherein the beverage base, such as the aqueous extract of malt and / or cereal grains, is wort. The method according to any one of items 62 to 63, wherein said fermented beverage base, such as said fermented aqueous extract, comprises at the most 0.5%, such as at the most 0.4%, such as at the most 0.3%, such as at the most 0.2%, such as at the most 0.1%, such as at the most 0.0% alcohol by volume (ABV). A fermented beverage base, such as a fermented aqueous extract of malt and / or cereal grains, prepared by the method according to any one of items 62 to 64. A method for producing a beverage, such as a malt and / or cereal based beverage, said method comprising the steps of: i) preparing a fermented beverage base, such as a fermented aqueous extract of malt and / or cereal grains, by the method according to any one of items 62 to 64, and ii) processing said fermented beverage base into a beverage. The method according to item 66, wherein the steps of processing comprise one or more of the following: a) Filtration, b) Carbonation, c) Maturation, or d) Bottling A beverage prepared by the method according to any one of items 66 to 67. The method according to any one of items 66 to 67 or the beverage according to item 68, wherein said beverage comprises less than 2% ethanol, such as less than 1.5% ethanol, such as less than 1.0% ethanol, such as less than 0.5% ethanol, such as less than 0.3% ethanol, such as less than 0.1% ethanol, such as less than 0.08% ethanol, such as less than 0.05% ethanol, such as less than 0.03% ethanol, such as less than 0.01% ethanol. The method or beverage according to item 69, wherein said beverage is an alcohol-free beverage, such as wherein said beverage has an ethanol content of 0.5% or less, such as wherein said beverage has an ethanol content of 0.0%. The method or beverage according to any one of items 69 to 70, wherein said beverage is a beer, such as wherein said alcohol-free beverage is an alcohol- free beer.

[0294] Examples

[0295] Example 1 - Analysis of ethyl acetate, isoamyl acetate and isoamyl alcohol levels

[0296] Materials and methods

[0297] Microorganisms and Media

[0298] Starmera caribaea strain NRRL Y-17468 (IB0015) was obtained from the agricultural Research Service Culture Collection. The yeast was stored in a -80°C freezer in 20% (V / V) glycerol stock until used. Prior to fermentation the yeast cells were prepared by streaking the content of a 1 l inoculation needle of the yeast glycerol cryo mixture onto a YPD agar plate (Yeast extract 10g, Peptone 20g, Dextrose 20g) and incubating the plate for 48-72h at 30°C.

[0299] Fermentation Media

[0300] In the experiments of this example, the fermentation medium was 9° Plato Holsten Wort. The Holsten wort was prepared using standard 12° Plato wort prepared from a mixture of 87% Pilsner Malt and 13% Munich Malt using the mashing profile listed in table 1. After mashing wort was boiled. At the start of boiling bitter hops was added and boiling was achieved at 105°C for 50 minutes. The resulting 12° Plato wort was subsequently adjusted to 9° Plato by diluting with brewing water and adjusted to pH 4,4 using phosphoric acid to obtain the so-called AFB Holsten Wort with the following specifications: Original gravity: 9, 0-9, 5; pH: 4, 3-4,4; Color: 8,0-11,0; Bitterness Units: 33-39.

[0301] Table 1. Mashing profile for the preparation of 12° Plato wort before diluted to 9° Plato. Pre-Cultures, Inoculation & Propagation

[0302] Precultures for propagation and fermentations was prepared by dosing the content of 1 inoculation needle of the cells from several colonies of the YPD plate into 50ml of 9° Plato Holsten wort. The pre-cultures were cultivated for 24h at 30°C in a 100ml Erlenmeyer flask on a shaking table (120rpm). For ANKOM fermentation trials 10ml of the preculture was dosed into 150ml of 9° Plato Holsten wort in a 250ml DURAN® bottle.

[0303] Propagation for 50L fermentation trials were carried out in SB Carlsberg Flasks (AlphaLaval Nordics A / S) containing 10L 9 “Plato Holsten Wort sterilized by autoclavation at 100°C for 30 minutes and cooled down to RT before use. Aeration with sterile air were connected through a membrane sample valve with continuous moderate air flow of 5 L / min measured using a flowmeter (Brooks Instruments). 50ml of pre-cultured yeast were pitched to the Carlsberg flask. A content of 50ml yeast were pitched aseptically into the Carlsberg flask using a syringe through a membrane fitting. Propagation was carried out for 3 days at RT and transferred under aseptic conditions to the 50L fermentation vessels for brewing.

[0304] Strain Construction

[0305] Creating haploid derivatives of Starmera caribaea NRRL Y17468 by sporulation:

[0306] Starmera caribaea is a heterothallic yeast having two opposite mating types herein called MATa and MATalpha. Most natural isolates are diploids and to be able to breed in Starmera, haploid strains needed to be created. To that extent, the diploid S. caribaea strain NRRL Y-17468 (IB0015) was streaked onto a fresh YPD agar plate, and the plate was incubated overnight at 30°C. Using an inoculation loop, some of the growth was transferred onto a P-SPOR plate (see recipe below; Chen et al., 2012) the next day, and the plate was incubated for 5-7 days at RT. Periodically, the growth was microscopically checked for asci formation. Once enough asci have formed, a small amount of growth was transferred into 180 pl 100 mM phosphate buffer pH 7 in an Eppendorf tube, 20 pl of Zymolyase (10 mg / ml) were added and the cell suspension was incubated at 30°C for approx. 30min. Subsequently, 200pl 50mM EDTA and 200pl 0.9% saline containing 0.03% Triton X-100 were added, the tube was briefly vortexed, and the cells were spun down for 10 min in an Eppendorf tabletop centrifuge at full speed. After the supernatant was removed, the cells / spores were suspended in 200- 400pl sterile water. Approx. 10pl of the cell / spore suspension were used to pick spores on a Singer MSM 400 dissection microscope on a YPD plate according to the manufacturers Saccharomyces cerevisiae tetrade dissection protocol. The YPD plate was incubated at 30°C for 2 to 3 days until colonies showed up. The spore clones were finally analyzed for mating type using the sexual agglutination technique (see below) and one well growing spore clone of each mating type (IB0040 MATalpha / IB0041 MATa) was chosen for further breeding efforts with Starmera caribaea.

[0307] Sexual agglutination test: Starmera caribaea and its close relatives were found to show a strong sexual agglutination phenotype, where cells of opposite mating type clump together when mixed, but strains of the same mating type, or diploid strains mixed with a haploid strain of either mating type, stay in suspension. The sexual agglutination analysis was performed essentially as described in Mendonga-Previato et al., 1981. More specifically, to perform a sexual agglutination analysis, a strain of interest and the two haploid tester strains of opposite mating type IB0040 (MATalpha) and IB0041 (MATa) were grown up in liquid YPD at 30°C overnight. On the next day, 50pl of cells from the strain of interest were mixed separately with 50pl of cells of either of the two tester strains at an approximate 1 :1 cell ratio in a 250 pl PCR tube. In case the cell agglutination was not immediately visible after mixing, the PCR tubes were briefly spun (10-15sec) in a small tabletop centrifuge for PCR tubes. While cells that do NOT agglutinate would be collected at the bottom of the tube, agglutinated cells tend to stick to the wall of the tube. To countercheck, tubes can be vortexed after spinning, and cells that did NOT agglutinate will go back into suspension, while agglutinated cells will stick together. We have used this sexual agglutination technique to determine the mating type of haploid cells, but it is also a fast and easy way to confirm the diploid state of strains derived from mating experiments.

[0308] Mating reactions in S. caribaea and diploid strain identification: To mate two haploid S. caribaea strains of opposite mating type we made use of the sexual agglutination phenotype (see before). In principle, a sexual agglutination test reaction was set up and some of the cell clumps were transferred with an inoculation loop to a fresh YPD agar plate. The agar plate was subsequently incubated at 30°C at least overnight. With an inoculation loop a little bit of growth from the mating plate was transferred into saline containing 0.03% Triton X-100 and mixed well. The ODeoo of this cell suspension was determined, the cells were diluted to an ODeoo of -0.0001 and 10OpI were plated onto ploidy dye plates (PDP; see recipe below; Takagi et al., 1983; Yamazaki et al., 1979). The ploidy dye plates were incubated for 5-7 days at 30°C in the dark (Trypan Blue is light sensitive!). Diploid cells were found to be usually more “pale-looking” on PSPs and don’t show as bright a color as haploid cells do. The diploid nature of picked “pale-looking” colonies was initially confirmed running a standard propidium iodide stain-based ploidy analysis on an Agilent NovoCyte flow cytometer using the original diploid S. caribaea strain Y-17468 and the two haploid spore clones IB0040 and IB0041 as controls. In later breeding efforts the ploidy of picked colonies was analyzed out of convenience performing a sexual agglutination test with known haploid tester strains IB0040 and IB0041.

[0309] Mutagenesis of Starmera caribaea-. S. caribaea was mutagenized by either UV irradiation or DNA methylation with methylnitronitrosoguanidine (MNNG). For either technique, the strain of interest was first grown on YPD plates at 30°C for 2-3 days. Several uniform looking colonies were harvested with an inoculation loop and the cells were washed with sterile water containing 0.3% Triton X-100. A cell suspension was made with a cell titer of ODeoo of ~1. To perform an UV mutagenesis 5ml of this cell suspension was pipetted into a sterile petri dish, and the cells were exposed to UV light in a Stratagene UV Stratalinker 1800. The mutagenized cells were harvested by centrifugation and recovered in liquid YPD medium at 30°C for 1-2h. To run a MNNG mutagenesis 5pl MNNG (3mg / ml water) was added to 1ml of cells in a 2ml safe-lock Eppendorf tube, and the cells were incubated at 30°C and 1000rpm on an Eppendorf shaker. After 30min the reaction was stopped by spin / washing the cells three times with sterile water containing 0.3% Triton X-100. This procedure would result in a killing rate of approx. 50% for most S. caribaea strains used. After the final washing step, cells were recovered in YPD medium in analogy to the UV mutagenesis.

[0310] Selecting TFL resistant S. caribaea strains: S. caribaea strains resistant to the toxic leucine analog 5',5',5'-trifluoroleucine (TFL) were isolated by plating approx. 106UV mutagenized cells / plate of strain IB0040 onto standard SD agar plates supplemented with 20mg / l methionine and cysteine each and 750mg / l TFL (SD Met / Cys / TFL). The plates were incubated at 30°C until single colonies would appear. Selected colonies were re-streaked onto YPD agar plates to single colonies, and TFL resistance would subsequently be rechecked on SD Met / Cys / TFL plates. Analytical Methods

[0311] Analysis of esters and isoamyl alcohol: Gas Chromatograph Mass Spectrometry SCAN mode (GC-MS SCAN) was used to detect and quantify ester levels as well as the levels of isoamyl alcohol. The system used was Agilent technologies 7890B GC (Agilent Technologies Denmark ApS, Glostrup, Denmark) fitted with an Agilent J&W GC DB-wax column of 60m x 0,32mm x 0,5pm, connected to an Agilent technologies 5975C MSD (Agilent Technologies Denmark ApS, Glostrup, Denmark) coupled with a computer with the analytical software MassHunter (version B.10.00). The analytical conditions were as follows: constant helium flow of 1.5 mL / min, transfer line temp. 250°C, ion source temperature 230°C, MS quad temp. 150°C, injection temp. 250 °C. Samples were incubated for 10min at 60°C with agitation of 500rpm. The injection was performed with static headspace with a gas-tight syringe. The injection volume was 10OpI injected as a split 1 :10. The column temperature program was: 1 min at 60°C, from 60°C to 110°C at 10°C min-1 with a hold time of 4min, from 110°C to 175°C at 30°C min-1 with a hold time of 4min, from 175°C to 225°C at 30°C min-1 where the program finished upon reaching 240°C. Data was collected with a full scan from mz 30 to mz 450 at a threshold of 150.

[0312] Sequencing methods

[0313] DNA Extraction and Library Preparation: For DNA extraction, cells were grown overnight in 100ml shake flasks containing 25ml YPD medium. Biomass was collected through centrifugation for 10 minutes at 4000xg and 4°C, washed with sterile water and stored at -20°C until analysis. Genomic DNA was extracted using the DNeasy PowerSoil Pro kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Purity of the DNA was checked using a Nanodrop 1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, United States) was used to check for purity of the DNA and quantification was performed using a Qubit 4 Fluorometer (Thermo Fisher Scientific) with the dsDNA Quantification Broad Range Assay kit (Thermo Fisher Scientific). For Nanopore sequencing, the library was prepared using the SQK-NBD114-24 kit (Oxford Nanopore Technologies, Oxford, United Kingdom). The sequencing was performed on a Minion Mk1 B device (Oxford Nanopore Technologies) using a FLO-MIN114 flow cell (Oxford Nanopore Technologies) FAST5 file from the Nanopore sequencing were basecalled using Guppy version 6.5.7. For Illumina sequencing of the reference strain, the Illumina DNA PCR-free kit (Illumina, San Diego, CA, United States) was used using the IDT for Illumina DNA / RNA UD indexes Set A (Integrated DNA Technologies, Coralville, IA, United States) and the sequencing was performed on a MiniSeq system (Illumina) using the 300-cycle high output kit. FASTQ read files were generated using the Local Run Manager GenerateFastQ module version 2.5.56.9. For the remaining strains, cells were harvested as described above, and genomic DNA extraction, PCR free short insert library preparation (<800bp), 150bp paired-end sequencing on a DNBSEQ instrument was performed by BGI Genomics Global (Hong Kong).

[0314] RNA Sequencing: For RNA sequencing, cells were harvested by centrifugation at 3000xg for 5 minutes at 4°C, washed in ice-cold water, flash frozen in liquid nitrogen and stored at -80°C until analysis. mRNA extraction and strand specific, 100bp paired-end mRNA library preparation and sequencing on DNBSEQ was performed by BGI Genomics Global (Hong Kong).

[0315] Genome Assembly & Annotation: For the genome assembly adapters were removed from the raw basecalled Nanopore reads using porechop version 0.2.4, and the reads were filtered using filtlong version 0.2.1 , using a length cut-off of 1 kb. Genome was performed using Flye version 2.9 with parameters --keep-haplotypes and -nano-raw. After assembly, the genome was polished using Medaka version 1.6.0 using long reads, using pilon version 1.24 using short reads. The short reads were trimmed using trimmomatic version 0.39, using parameters SLIDINGWINDOW:4:20, and mapped to the assembly using bwa-mem version 0.7.17 and pilon was run with parameters -fix bases. Finally, Nanopore reads were mapped to the assembly using minimap2 version 2.24 and purge_dups version 1.2.5 was used to remove duplicate and artefactual contigs.

[0316] The genome assembly was annotated using funannotate version 1.8.15. To prepare the assembly for gene prediction and annotation, the genome assembly was filtered to retain only scaffolds above 1 kb in length using funannotate clean, sorted by length using funannotate sort and repeats were masked using RepeatMasker version 4.1.5. The resulting assembly was used for training a gene model using funannotate train, including stranded paired-end transcriptomics data as evidence. Next, gene prediction was performed using funannotate predict, using the assembled transcriptome from the previous step as transcript evidence, and all Saccharomycetes proteins available in the OrthoDb database version 11 (accessed 2023-01-17) and the UniProt-SwissProt database as protein evidence. Prior to functional annotation, a gene prediction was performed using InterProScan version 5.62-94.0 and secondary metabolite gene clusters were predicted using antiSMASH version 7.0.0 using parameters -taxon fungi, --fullhmmer, --clusterhmmer, --tigrfam, --asf, --cc-mbig, --cb-general, --cb-subclusters, -- cb-known-clusters, --pfam2go and -smcog-trees. Finally, gene annotation was performed using funannotate, incorporating the results from InterProScan and antiSMASH.

[0317] Variant Calling & Annotation: The variant calling was performed according to the GATK best practices workflow (https: / / gatk.broadinstitute.org / hc / en- us / sections / 360007226651-Best-Practices-Workflows) using gatk version 4.4.0.0. The trimmed reads were mapped to the genome assembly using bwa-mem version 0.7.17, and samtools sort version 1.15 was used to sort and generate a bam output file. The reference was indexed using samtools faidx version 1.15 and a sequence dictionary for the reference was generated using gatk CreateSequenceDictionary. Read group information for the mapping file was added using gatk AddOrReplaceReadGroups, followed by creating a bam index file using gatk MarkDuplicates, and removing duplicate reads using gatk MarkDuplicates. Variants were called using gatk HaplotypeCaller with parameters --emit-ref-confidence GVCF --min-base-quality-score 20, -standard-min- confidence-threshold-for-calling 50. The resulting gvcf files were combined using gatk CombineGVCFs and genotyped using gatk GenotypeGVCFs. Single nucleotide polymorphisms (SNPs) and insertions and deletions (indels) were filtered using gatk SelectVariants using parameters --select “QD >= 2.0 && FS >= 60.0 && MQ >= 40.0 && MQRankSum >= 12.5 && ReadPosRankSum >= -8.0” and --select-genotype-expression “DP >= 30 && GQ >= 30” for SNPs, and -select “QD >= 2.0 && FS >= 60.0 && ReadPosRankSum >= -20.0” and -select-genotype-expressions “DP >= 30.0 && GQ >= 30” for indels. The resulting files were merged using gatk MergeVcfs. Variants were annotated using snpEff version 5.2a using a custom database for Starmera caribaea.

[0318] Media recipes

[0319] Ploidy Dye Plates (PDP; based on Takagi et al., 1983 and Yamazaki et al., 1979)

[0320] 1 g / l yeast extract

[0321] 1 g / l peptone 1 ,5g / l KH2PO4 1 ,5g / l MgSO420g / l glucose pH was adjusted to pH5,6. 15g / l agar-agar After autoclaving, 15mg / l Trypan Blue and 10mg / l Phloxin B were added. Plates need to be stored in the dark since Trypan Blue is light sensitive.

[0322] Pichia pastoris sporulation plates (P-SPOR; Chen et al., 2012) 0,5% Na-acetate

[0323] 1% KCI

[0324] 1% glucoase

[0325] 2% agar-agar Results

[0326] Strains constructed

[0327] The strains as shown below in Table 2 were created as described in the section “Strain Construction” herein above and according to the breeding scheme outlined in Figure 1. Table 2. Yeast strains constructed in this example Analysis of levels of ethyl acetate, isoamyl acetate and isoamyl alcohol

[0328] As can be seen in Figure 2, both S. cerevisiae and S. pastorianus reference strains have comparable ethyl acetate and isoamyl acetate levels when comparing the wildtype strains with the LEUTFLmutants. In S. pastorianus, the LEUTFLmutant also does not exhibit increased isoamyl alcohol levels. In contrast, the LEUTFLS. cerevisiae mutant exhibits an approximately 2-fold increase in the level of isoamyl alcohol.

[0329] For Starmera caribaea, the ethyl acetate levels are slightly lowered between the homozygous wild type (IB0015), and the heterozygous (IB0026) and homozygous (IB0032) LEUTFLmutant strains, with the largest difference observed between the homozygous wild type and homozygous LEUTFLmutant strains. There is a significant increase in the levels of both isoamyl alcohol and isoamyl acetate in both of the mutant strains compared to the wild type. In particular, there is an approximate 2-fold increase in the level of isoamyl acetate in both mutants, while the heterozygous mutant exhibits a 2-fold increase and the homozygous mutant an almost 4-fold increase in isoamyl alcohol levels.

[0330] This increase in isoamyl acetate levels is particularly surprising, since the Starmera caribaea wild type strain already exhibits drastically elevated baseline levels of this compound, the wild-type strain having an over 35-fold increased level compared to S. cerevisiae and S. pastorianus.

[0331] Example 2 - Fermentation of wort with Starmera caribaea strains according to the invention

[0332] Materials and methods

[0333] Pre-Cultures, Inoculation & Propagation

[0334] Precultures for propagation and fermentations was prepared by dosing the content of 1 inoculation needle of the cells from several colonies of the YPD plate into 50ml of 9° Plato Holsten wort. The pre-cultures were cultivated for 24h at 30°C in a 100ml Erlenmeyer flask on a shaking table (120rpm).

[0335] For ANKOM fermentation trials 10ml of the preculture was dosed into 150ml of 9° Plato Holsten wort in a 250ml DURAN® bottle. Propagation for 50L fermentation trials were carried out in SB Carlsberg Flasks (AlphaLaval Nordics A / S) containing 10L 9° Plato Holsten Wort sterilized by autoclavation at 100°C for 30 minutes and cooled down to RT before use. Aeration with sterile air were connected through a membrane sample valve with continuous moderate air flow of 5L / min measured using a flowmeter (Brooks Instruments). 50ml of pre-cultured yeast were pitched to the Carlsberg flask. A content of 50ml yeast were pitched aseptically into the Carlsberg flask using a syringe through a membrane fitting. Propagation was carried out for 3 days at RT and transferred under aseptic conditions to the 50L fermentation vessels for brewing.

[0336] Fermentation Conditions

[0337] Ankom Fermentations: Initial fermentation trials were carried out in the ANKOM RF Gas Production System (ANKOM Technology). The working volume in each fermentation vessel was 150ml. The wort was prior to fermentation pasteurized in a 5L blue cap bottle at 80°C for 40 minutes before it was homogenized by gentle shaking and transferred into the autoclaved ANKOM fermenters. The fermentations were carried out at 16°C and continuously agitation utilizing at magnet stirrer at 130rpm. Monitoring and measuring of ambient pressure as a proxy of gas production was carried out using the ANKOM system. ANKOM fermentations were all run for a length of 5 days in biological triplicates and samples were harvested at the end of the fermentation. Pitching rate was 3x106yeast cells / mL. Sample preparation was carried out by centrifuging the harvested fermentation liquid at 6000x g for 10 minutes and stored at -21 °C until analysis.

[0338] 50 L fermentations: Fermentations were performed in 50L scale as described in patent application WO 2022 / 002960, section Materials and Methods.

[0339] Analysis of ethanol content

[0340] Gas Chromatograph Mass Spectrometry SIM mode (GC-MS SIM) was used to detect and quantify ethanol levels by comparison to a standard curve. The system used was Agilent technologies 7890B GC (Agilent Technologies Denmark ApS, Glostrup, Denmark) fitted with an Agilent J&W GC DB-wax column, coupled with a computer with the analytical software MassHunter (version B.08.00). The analytical conditions were as follows: constant helium flow of 1.5ml / min, transfer line temp. 250°C, ion source temperature 230°C, MS quad temp. 150 °C, injection temp. 250°C. Samples were incubated for 10min at 60°C with agitation of 500rpm. The injection was performed with static headspace with a gas-tight syringe. The injection volume was 100pL. The column temperature program was: 7min at 50°C, from 50°C to 240°C at 30°C min"1. The program was finished upon reaching 240°C.

[0341] Results

[0342] Analysis of levels of ethanol at end of fermentation

[0343] Ankom trials

[0344] Results from Ankom fermentations with strains IB0015, IB0026 and IB0032 (further described in Example 1), and reference S. pastorianus strain 1 comprising a wild type LELI4 gene are shown in Table 5, below:

[0345] Table 5. Alcohol levels et end of Ankom fermentations (day 5)

[0346] As is clear from table 5, Starmera caribaea strains IB0015 (expressing wild type LEU4), IB0026 (expressing LEU4 / LEU4TFL) and IB0032 (expressing LEU4TFL / LEU4TFL) show significantly reduced alcohol levels at the end of fermentation compared to the reference S. pastorianus strain.

[0347] 50 L trials

[0348] Results from fermentations in 50L scale with strains IB0015 and IB0045 (further described in Example 1), and reference S. pastorianus strain 1 comprising a wild type LEU4 gene are shown in Table 6, below: Table 6. Alcohol levels et end of 50L fermentations (day 7 for IB0015 and IB0026, day 5 for IB0032)

[0349] As is clear from Table 6, Starmera caribaea strains IB0015 (expressing wild type LEU 4), IB0026 (expressing LEU4 / LEU4TFL) and IB0032 (expressing LEU4TFL / LEU4TFL) show significantly reduced alcohol levels at the end of fermentation compared to the reference S. pastorianus strain.

[0350] Example 3 - Analysis of sequence identities for Starmera caribaea genes of relevance for isoamyl acetate production

[0351] Materials and methods

[0352] Determining homology to ester forming enzymes in Saccharomyces cerevisiae The homology of ester forming enzymes in S. caribaea and S. cerevisiae was determined by performing a homology search comparing the protein sequences from S. cerevisiae against the proteome of S. caribaea. The protein sequences were from S. cerevisiae S288C were downloaded from the UniProt protein database and each of the sequences was compared to the S. caribaea proteome using BlastP, executed through the NcbiblastpCommandline module of BioPython (v1.79). For the proteins where no homolog was found, the conclusion that the proteins are missing in S. caribaea was drawn.

[0353] Seguence alignment

[0354] Protein sequences in fasta format were aligned using clustalo version 1.2.4 with arguments --full and --outfmt clu to generate an output file in clustal format Results

[0355] Comparisons of sequence identities of Starmera caribaea genes of relevance forester production with Saccharomyces cerevisiae homologs

[0356] Table 7, below, shows the sequence identities between the most relevant proteins known to be involved in the production of esters in S. cerevisiae with their identified corresponding homologs in S. caribaea.

[0357] Table 7. Sequence identities between S. cerevisiae and S. caribaea proteins relevant for ester production

[0358] As is clear from the above table, one important homolog of a protein important in the production of ester in Saccharomyces cerevisiae is completely absent in Starmera caribaea (lah 1 ). Additionally, a substantial number of other homologs of relevance show low sequence identities of under 50% with the S. cerevisiae proteins. Particularly, the homologs Atf 1 , Atf2 and Eat1 in S. caribaea display less than 30% sequence identity compared to the S. cerevisiae proteins. Finally, Atf1 and Atf2 in S. cerevisiae correspond to only a single homolog in S. caribaea: Atf2.

[0359] Taken together, these results highlight the substantial differences in ester metabolism between S. caribaea and S. cerevisiae.

[0360] Example 4 - Alternative fermentation process in wort with Starmera caribaea strains

[0361] Materials and methods

[0362] Pre-Cultures, Inoculation & Propagation

[0363] Precultures, inoculation and propagation carried out as described in Example 2.

[0364] Fermentation Conditions Ankom Fermentations: Initial fermentation trials were carried out in the ANKOM RF Gas Production System (ANKOM Technology). The working volume in each fermentation vessel was 150ml. The wort was prior to fermentation pasteurized in a 5L blue cap bottle at 80°C for 40 minutes before it was homogenized by gentle shaking and transferred into the autoclaved ANKOM fermenters. The fermentations were carried out at 14°C and continuously agitation utilizing at magnet stirrer at 130rpm. The pitching rate was 6x106yeast cells / mL. Monitoring and measuring of ambient pressure as a proxy of gas production was carried out using the ANKOM system. ANKOM fermentations were all run for a length of 4 days in biological triplicates and samples were harvested at the end of the fermentation. Sample preparation was carried out by centrifuging the harvested fermentation liquid at 6000x g for 10 minutes and stored at - 21°C until analysis.

[0365] 50 L fermentations: Fermentations were performed in 50L scale as described in patent application WO 2022 / 002960, section Materials and Methods. However, the pitching rate was 6x106yeast cells / mL and the fermentations were carried out at 14 °C and run for a length of 4 days.

[0366] Analysis of ethanol and ester content

[0367] Analysis of ethanol content and ester content carried out as described in Example 2.

[0368] Results

[0369] While the main purpose of this experiment was optimization of ABV by fermentation for only 4 days at a lower temperature of 14°C, the levels of ethyl acetate and isoamyl alcohol were also measured.

[0370] Figure 3 shows the results from 50L trials of fermentation of 9° Plato wort (pitch rate 6*106cells / mL and temperature 14°C) compared to the results obtained by fermentation according to the method of Example 2 (pitch rate 3*106cells / mL and temperature 16°C) for the levels of ethyl acetate and isoamyl alcohol.

[0371] The strains used for fermentation were the following:

[0372] IB0045: Starmera caribaea Leu4 wild type

[0373] IB0032: Starmera caribaea Ieu4 homozygous mutant (S512F) As is from Figure 3, the Ieu4 homozygous mutant also under these fermentation conditions shows a significant increase in the level of isoamyl alcohol compared to the Leu4 wild type strain. The Ieu4 mutant also exhibits decreased production of ethyl acetate compared to wildtype when fermentations are performed under these conditions.

[0374] The presently obtained results regarding increased levels of isoamyl alcohol and decreased levels of ethyl acetate in the disclosed Ieu4 mutants corroborate the results of the previous Examples, and thus substantiates that these results are thus not necessarily confined to the specific fermentation conditions used.

[0375] Example 5 - Validation of Ieu4 mutations in S. caribaea:

[0376] Materials and methods

[0377] Strains resistant to TFL, which had been validated for cross resistance to fluconazole was subject to genomic DNA extractions. Genomic DNA was obtained by utilizing the MasterPure DNA purification kit (BioSearch Technologies) where 500 pl saturated cells grown in YPD O / N was pelleted (13.000 rpm, 1 min) and resuspended in 300 pl cell Lysis solution, mixed thoroughly, incubated at 65°C for 15 minutes and subsequently placed on ice for 5 minutes. 150 pl MPC protein precipitation reagent was afterwards added, and the solution was vortexed vigorously for 10 seconds. The mixture was afterwards pelleted for (13.000 rpm, 10 minutes) and supernatant was transferred to a clean Eppendorf tube. 500 pl isopropanol was added to the mixture, spun down (13.000 rpm, 10 minutes) and isopropanol was afterwards removed without disrupting the pellet. Lastly the pellet was rinsed with 70% ethanol and remaining ethanol was evaporated by drying the tubes at 60°C prior to resuspending the pellet in 35 pl MQ H2O.

[0378] Amplifications of fragments for genotyping were conducted with 10 pl of the 2x DreamTaq PGR Master Mix, 1 pl of each primer (10 pM, Forward primer: AATCAGGTAAAGGTGGTGCCG (SEQ ID NO: 5), Reverse primer: TTCGATTTCACCAGCAGCAA (SEQ ID NO: 6)), template DNA in amounts resembling a final concentration of 1 ng / pl genomic DNA and lastly MQ H2O adding up to a reaction mixture of 20 pl in total. The reaction mixture was subsequently subject to PCR amplification (program specifications listed in Table 8, below) and gel electrophoresis to determine the size of the amplicons.

[0379] The amplicons were run on a 1% agarose gel of tris-acetate-EDTA (TAE) buffer supplied with 1x SYBR Safe DNA gel staining solution and run at 100V for 30 min. A 1kb plus DNA ladder (Thermo Scientific) was run next to the amplicons to determine their size. Amplicons were extracted directly from the gel and purified using the Nucleospin Gel and PCR Clean-up kit (Macherey-Nagel) according to the manufacturer instructions.

[0380] Identification of Ieu4 mutations were done by sequencing the amplicons using the TubeSeq Supreme services (Eurofins Genomics) employing sanger sequencing using the following primer seqP: TGCCGCTTGGGTCGTTTTA (SEQ ID NO: 7).

[0381] A total of 100 strains were validated and 23 strains were subsequently chosen based on their LELI4 genotypes to be tested in ANKOM fermentations to verify their phenotypes. Fermentations were carried out according to the method described in Example 2.

[0382] The 23 chosen strains had the mutations in Leu4 as shown in Table 9, below.

[0383] Table 9. LEU4 mutant genotypes of 23 haploid TFL resistant strains + wild type

[0384] All strains were assayed for their levels of ethyl acetate, isoamyl acetate, and isoamyl alcohol as described in Example 1. The results are shown in Tables 10-12, below. Results

[0385] Table 10. Ethyl acetate production of selected Ieu4 mutant strains. Ester titers represents the average of triplicates, and their associated standard deviation and fold-change values compared to wild-type strain IB0040 (top). All quantitative data is given in ppm. Table 11. Isoamyl acetate production of selected Ieu4 mutant strains. Ester titers represents the average of triplicates, and their associated standard deviation and fold-change values compared to wild-type strain IB0040 (top). All quantitative data is given in ppm. Table 12. Isoamyl alcohol production of selected Ieu4 mutant strains. Ester titers represents the average of triplicates, and their associated standard deviation and fold-change values compared to wild-type strain IB0040 (top). All quantitative data is given in ppm. As clear from the above tables, all tested Starmera caribaea Ieu4 mutants have significant increases in the levels of both isoamyl alcohol and isoamyl acetate compared to the wild type, supporting the data of Example 1. There is also a trend of slightly decreased ethyl acetate levels in the mutants compared to wildtype, as also demonstrated in Example 1.

[0386] This increase in isoamyl acetate levels is particularly surprising, since the Starmera caribaea wild type strain already exhibits drastically elevated baseline levels of this compound, the wild-type strain having an over 35-fold increased level compared to S. cerevisiae and S. pastorianus, as seen in Figure 2.

[0387] As is clear from the above data, it is highly likely that any non-conservative mutations or disruptions in the C-terminus of Leu4 in Starmera caribaea will result in the above- mentioned beneficial phenotype with high production of isoamyl alcohol and isoamyl acetate. This is also strongly supported by the two STOP mutants (L506STOP and K485STOP), which lack the 98 and 119 most C-terminal amino acids of Leu4, respectively.

[0388] Example 6 - Cider base fermentation

[0389] Materials and methods

[0390] Fermentation Media:

[0391] The fermentation media utilized was cider base. The cider base was prepared using 42,8 ml Apple Juice Concentrate (Dohler), 109,95 ml 72 brix sugar syrup made with dextrose, 1 g Diammonium phosphate, 0,0017 g Vitamin B, 0,53 g Fermaid K and brewing water adding up to a total volume of 1 L. The base was subsequently autoclaved at 100°C for 30 minutes. The resulting cider base had a brix of 13,4. Pre-cultures, inoculation & propagation was prepared as described in Example 2, however precultures was inoculated in YPD and the fermentation base for ANKOMs were cider base.

[0392] The following strains were used for fermentation:

[0393] Results

[0394] The results of the cider base fermentations with regard to isoamyl alcohol, isoamyl acetate, and ethyl acetate levels of the tested strains are shown in Figure 4.

[0395] The following conclusions can be made:

[0396] • S. cerevisiae controls display the same data pattern as when fermented in Holstein wort (see Example 1) - despite different fermentation base. • Almost the same fold increase in isoamyl acetate and isoamyl alcohol levels are observed when fermenting a cider base.

[0397] • A decrease in ethyl acetate is also observed when fermenting a cider base, and the level of the decrease is greater than when fermenting Holstein wort. The Ieu4 mutant Starmera caribaea strains according to the present disclosure therefore display equally beneficial properties as demonstrated in the previous Examples when used for cider production.

[0398] Sequence overview

[0399] References

[0400] Chen MT, Lin S, Shandil I, Andrews D, Stadheim TA, Choi BK. Generation of diploid Pichia pastoris strains by mating and their application for recombinant protein production. Microb Cell Fact. (2012) 11 :91. doi: 10.1186 / 1475- 2859-11-91.

[0401] Amparo Gamero, Annereinou Dijkstra, Bart Smit and Catrienus de Jong, Aromatic Potential of Diverse Non-Conventional Yeast Species for Winemaking and Brewing, Fermentation 2020, 6, 50; doi:10.3390 / fermentation6020050

[0402] Gernat, Deborah & Brouwer, Eric & Ottens, M.. (2019). Aldehydes as Wort Off-Flavours in Alcohol-Free Beers — Origin and Control. Food and Bioprocess Technology. 13. 10.1007 / s11947-019-02374-z.

[0403] Mendonga-Previato L, Burke D, Ballou CE. Sexual agglutination factors from the yeast Pichia amethionina. J Cell Biochem. (1982) 19 (2): 171-178. doi: 10.1002 / jcb.240190207. Takagi A, Harashima S, Oshima Y. Construction and characterization of isogenic series of Saccharomyces cerevisiae polyploid strains. Appl Environ Microbiol. (1983) 45 (3): 1034-1040. doi: 10.1128 / aem.45.3.1034-1040.1983.

[0404] Hironobu Takagi, Kazuki Yamamoto, Yoshifumi Matsuo, Miki Furuie, Yasuha Kasayuki, Rina Ohtani, Mizuki Shiotani, Tetsuya Hasegawa, Toru Ohnishi, Masataka Ohashi et al., Influence of mutation in the regulatory domain of cr-isopropylmalate synthase from Saccharomyces cerevisiae on its activity and feedback inhibition Bioscience, Biotechnology, and Biochemistry, 2022, Vol. 86, No. 6, 755-762

[0405] Piornos, Jose & Balagiannis, Dimitrios & Methven, Lisa & Koussissi, Elisabeth & Brouwer, Eric & Parker, Jane. (2020). Elucidating the Odor-Active Aroma Compounds in Alcohol-Free Beer and Their Contribution to the Worty Flavor. Journal of Agricultural and Food Chemistry. 10.1021 / acs.jafc.0c03902.

[0406] Vu D, Groenewald M, Szdke S, Cardinali G, Eberhardt II, Stielow B, de Vries M, Verkleij GJ, Crous PW, Boekhout T, Robert V. DNA barcoding analysis of more than 9 000 yeast isolates contributes to quantitative thresholds for yeast species and genera delimitation. Stud Mycol. 2016 Sep;85:91-105. doi: 10.1016 / j.simyco.2016.11.007. Epub 2016 Nov 27. PMID: 28050055; PMCID: PMC5192050.

[0407] Yamazaki, T and Oshima, Y. Direct diploidization and occurrence of polyploidy in Saccharomycodes ludwigii. Journal of General Microbiology (1979) 111 (2): 271-281. doi: 10.1099 / 00221287-111-2-271.

Claims

Claims1. A yeast strain of the genus Starmera, wherein said yeast strain comprises a mutant LEU4 gene encoding a mutant Leu4 polypeptide, wherein the wild type LEU4 gene encodes wild type Leu4 as set forth in SEQ ID NO: 1 or a functional homologue of SEQ ID NO: 1 with at least 90%, such as at least 95%, such as at least 98% sequence identity to SEQ ID NO: 1 , wherein a. said yeast strain produces at least 1.5 times, preferably at least 2 times the level of isoamyl acetate compared to a reference strain of the genus Starmera, optionally wherein the reference strain is a yeast strain of the species Starmera caribaea comprising a wild type LEU4 gene encoding said wild type Leu4 as set forth in SEQ ID NO: 1 ; and / or b. said yeast strain produces at least 1.5 times, preferably at least 2 times the level of isoamyl alcohol compared to a reference strain of the genus Starmera, optionally wherein the reference strain is a yeast strain of the species Starmera caribaea comprising a wild type LEU4 gene encoding said wild type Leu4 as set forth in SEQ ID NO: 1.

2. The yeast strain according to claim 1 , wherein said mutant Leu4 polypeptide has a mutation in the C-terminus of SEQ ID NO: 1 or said functional homologue thereof, such as wherein said mutant Leu4 polypeptide has a mutation in one of the 150 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof, such as wherein said mutant Leu4 polypeptide has a mutation in one of the 130 most C-terminal amino acids of SEQ ID NO: 1 or said functional homologue thereof.

3. The yeast strain according to any one of the preceding claims, wherein the mutant Leu4 polypeptide has an amino acid substitution at position 512, 508, 509, 533, 534, 535, 544 or 570 of SEQ ID NO: 1 , or an amino acid substitution in the corresponding position of said functional homologue thereof.

4. The yeast strain according to any one of the preceding claims, wherein the mutant Leu4 polypeptide has an amino acid substitution at position 474, 485, 488, 490, 506, 507, 510, 511, 513, 531, 536, 539, 540, 546, 566, 569, 572, 575, or 584 of SEQ ID NO: 1 , or an amino acid substitution in the correspondingposition of said functional homologue thereof.

5. The yeast strain according to any one of claims 2 to 4, wherein said mutation is a non-conservative amino acid substitution or a deletion of one or more amino acids.

6. The yeast strain according to any one of the preceding claims, wherein the mutant Leu4 polypeptide a. has an amino acid substitution of serine (S) to phenylalanine (F) at position 512 of SEQ ID NO: 1 , or serine (S) to phenylalanine (F) amino acid substitution in the corresponding position of said functional homologue thereof; and / or b. has an amino acid substitution of asparagine (N) to aspartic acid (D) at position 508 of SEQ ID NO: 1 , or an asparagine (N) to aspartic acid (D) amino acid substitution in the corresponding position of said functional homologue thereof; and / or c. has an amino acid substitution of glycine (G) to serine (S) at position 509 of SEQ ID NO: 1, or a glycine (G) to serine (S) amino acid substitution in the corresponding position of said functional homologue thereof; and / or d. has an amino acid substitution of glutamic acid (E) to lysine (K) at position 533 of SEQ ID NO: 1 , or a glutamic acid (E) to lysine (K) amino substitution in the corresponding position of said functional homologue thereof; and / or e. has an amino acid substitution of histidine (H) to proline (P) at position 534 of SEQ ID NO: 1, or a histidine (H) to proline (P) amino acid substitution in the corresponding position of said functional homologue thereof; and / or f. has an amino acid substitution of serine (S) to phenylalanine (F) at position 535 of SEQ ID NO: 1, or a serine (S) to phenylalanine (F) amino acid substitution in the corresponding position of said functional homologue thereof; and / or g. has an amino acid substitution of alanine (A) to valine (V) or to aspartic acid (D) at position 544 of SEQ ID NO: 1, or an alanine (A) to valine (V)or to aspartic acid (D) amino acid substitution in the corresponding position of said functional homologue thereof; and / or h. has an amino acid substitution of aspartic acid (D) to asparagine (N) at position 570 of SEQ ID NO: 1 , or an aspartic acid (D) to asparagine (N) amino acid substitution in the corresponding position of said functional homologue thereof.

7. The yeast strain according to any one of the preceding claims, wherein the mutant Leu4 polypeptide a. has an amino acid substitution of Leu (L) to Ser (S) at position 474 of SEQ ID NO: 1 , or a Leu (L) to Ser (S) amino acid substitution in the corresponding position of said functional homologue thereof; and / or b. has an amino acid substitution of Lys (K) to a STOP at position 485 of SEQ ID NO: 1 , or a Lys (K) to a STOP amino acid substitution in the corresponding position of said functional homologue thereof; and / or c. has an amino acid substitution of Lys (K) to Asn (N) at position 488 of SEQ ID NO: 1, or a Lys (K) to Asn (N) amino acid substitution in the corresponding position of said functional homologue thereof; and / or d. has an amino acid substitution of Cys (C) to Arg (R) at position 490 of SEQ ID NO: 1, or a Cys (C) to Arg (R) amino substitution in the corresponding position of said functional homologue thereof; and / or e. has an amino acid substitution of Leu (L) to a STOP at position 506 of SEQ ID NO: 1, or a Leu (L) to a STOP amino acid substitution in the corresponding position of said functional homologue thereof; and / or f. has an amino acid substitution of Gly (G) to Asp (D) at position 507 of SEQ ID NO: 1, or a Gly (G) to Asp (D) amino acid substitution in the corresponding position of said functional homologue thereof; and / or g. has an amino acid substitution of Asn (N) to Tyr (Y) at position 508 of SEQ ID NO: 1, or an Asn (N) to Tyr (Y) amino acid substitution in the corresponding position of said functional homologue thereof; and / or h. has an amino acid substitution of Pro (P) to Arg (R) at position 510 of SEQ ID NO: 1 , or a Pro (P) to Arg (R) amino acid substitution in the corresponding position of said functional homologue thereof; and / ori. has an amino acid substitution of lie (I) to Phe (F) at position 511 of SEQ ID NO: 1 , or an lie (I) to Phe (F) amino acid substitution in the corresponding position of said functional homologue thereof; and / or j. has an amino acid substitution of Ser (S) to Leu (L) at position 513 of SEQ ID NO: 1 , or a Ser (S) to Leu (L) amino acid substitution in the corresponding position of said functional homologue thereof; and / or k. has an amino acid substitution of Tyr (Y) to His (H) at position 531 of SEQ ID NO: 1 , or a Tyr (Y) to His (H) amino acid substitution in the corresponding position of said functional homologue thereof; and / or l. has an amino acid substitution of Glu (E) to Lys (K) at position 533 of SEQ ID NO: 1 , or a Glu (E) to Lys (K) amino acid substitution in the corresponding position of said functional homologue thereof; and / or m. has an amino acid substitution of His (H) to Leu (L) at position 534 of SEQ ID NO: 1 , or a His (H) to Leu (L) amino acid substitution in the corresponding position of said functional homologue thereof; and / or n. has an amino acid substitution of lie (I) to Phe (F) at position 536 of SEQ ID NO: 1 , or an lie (I) to Phe (F) amino acid substitution in the corresponding position of said functional homologue thereof; and / or o. has an amino acid substitution of Gly (G) to Arg (R) at position 539 of SEQ ID NO: 1 , or a Gly (G) to Arg (R) amino acid substitution in the corresponding position of said functional homologue thereof; and / or p. has an amino acid substitution of Ser (S) to Pro (P) at position 540 of SEQ ID NO: 1 , or a Ser (S) to Pro (P) amino acid substitution in the corresponding position of said functional homologue thereof; and / or q. has an amino acid substitution of Thr (T) to Phe (F) at position 546 of SEQ ID NO: 1 , or a Thr (T) to Phe (F) amino acid substitution in the corresponding position of said functional homologue thereof; and / or r. has an amino acid substitution of Gly (G) to Asp (D) at position 566 of SEQ ID NO: 1 , or a Gly (G) to Asp (D) amino acid substitution in the corresponding position of said functional homologue thereof; and / or s. has an amino acid substitution of Glu (E) to Lys (K) at position 569 of SEQ ID NO: 1 , or a Glu (E) to Lys (K) amino acid substitution in the corresponding position of said functional homologue thereof; and / ort. has an amino acid substitution of Ser (S) to Pro (P) at position 572 of SEQ ID NO: 1 , or a Ser (S) to Pro (P) amino acid substitution in the corresponding position of said functional homologue thereof; and / or u. has an amino acid substitution of Ala (A) to Pro (P) at position 575 of SEQ ID NO: 1 , or an Ala (A) to Pro (P) amino acid substitution in the corresponding position of said functional homologue thereof; and / or v. has an amino acid substitution of Asn (N) to Ser (S) at position 584 of SEQ ID NO: 1 , or an Asn (N) to Ser (S) amino acid substitution in the corresponding position of said functional homologue thereof.

8. The yeast strain according to any one of the preceding claims, wherein the wild type LEU4 gene comprises the sequence as set forth in SEQ ID NO: 2 or a homologous sequence thereof, wherein said homologous sequence encodes a polypeptide with at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 98%, such as 100% sequence identity to the polypeptide encoded by SEQ ID NO: 1.

9. The yeast strain according to any one of the preceding claims, wherein said yeast strain produces less than 90% of the level of ethyl acetate compared to a reference strain of the genus Starmera, optionally wherein the reference strain is a yeast strain of the species Starmera caribaea comprising a wild type LEU4 gene.

10. The yeast strain according to any one of the preceding claims, wherein said yeast strain produces at the most 0.5%, such as at the most 0.4%, such as at the most 0.3%, such as at the most 0.2%, such as at the most 0.1%, such as at the most 0.08%, such as at the most 0.05%, such as at the most 0.03%, such as at the most 0.01%, such as at the most 0.0% alcohol by volume (ABV) at the end of fermentation, such as after fermentation in wort of 9° Plato for 5 days at 16°C.

11. The yeast strain according to any one of the preceding claims, wherein said yeast strain is of the species Starmera caribaea.

12. A method of producing a fermented beverage base, such as a fermented aqueous extract of malt and / or cereal grains, said method comprising the steps of: i) Providing a beverage base, such as an aqueous extract of malt and / or cereal grains; ii) providing a Starmera yeast strain, wherein said yeast strain is according to any one of claims 1 to 11 ; and iii) fermenting the beverage base, such as the aqueous extract of malt and / or cereal grains, provided in step i) with said yeast strain of step ii), thereby obtaining a fermented beverage base, such as a fermented aqueous extract of malt and / or cereal grains.

13. The method according to claim 12, wherein said fermented beverage base, such as said fermented aqueous extract, comprises at the most 0.5%, such as at the most 0.4%, such as at the most 0.3%, such as at the most 0.2%, such as at the most 0.1%, such as at the most 0.08%, such as at the most 0.05%, such as at the most 0.03%, such as at the most 0.01%, such as at the most 0.0% alcohol by volume (ABV).

14. A fermented beverage base, such as a fermented aqueous extract of malt and / or cereal grains, prepared by the method according to any one of claims 12 to 13.

15. A method for producing a beverage, such as a malt and / or cereal based beverage, said method comprising the steps of: i) preparing a fermented beverage base, such as a fermented aqueous extract of malt and / or cereal grains, by the method according to any one of claims 12 to 13, and ii) processing said fermented beverage base into a beverage, optionally wherein the steps of processing comprise one or more of the following: a) Filtration, b) Carbonation, c) Maturation, or d) Bottling16. A beverage, such as a beer, prepared by the method according claim 15.

17. The method according to claim 15 or the beverage according to claim 16, wherein said beverage comprises less than 2% ethanol, such as less than 1.5% ethanol, such as less than 1.0% ethanol, such as less than 0.5% ethanol, such as less than 0.3% ethanol, such as less than 0.1% ethanol, such as less than 0.08% ethanol, such as less than 0.05% ethanol, such as less than 0.03% ethanol, such as less than 0.01% ethanol, such as wherein said beverage has an ethanol content of 0.0%.

Images