Compositions and methods for making circular RNA

Abstract

The present invention provides nucleic acids and methods for making circular RNAs (circRNAs), compositions comprising circular RNAs, and methods of use thereof. The present invention uses optimized self-splicing T4 bacteriophage td gene (T4td) intron sequences to produce circular RNAs. The optimized T4td intron sequences described herein mediate efficient circularization of a linear RNA sequence.

Description

Attorney Docket No: ORB-014WO1 COMPOSITIONS AND METHODS FOR MAKING CIRCULAR RNA CROSS REFERENCE TO RELATED APPLICATIONS

[0001] The present application claims priority to, and the benefit of U.S. Provisional Application Number 63 / 663,418, filed on June 24, 2024, the contents of which are incorporated herein by reference in its entirety. INCORPORATION BY REFERENCE OF SEQUENCE LISTING

[0002] The present application is being filed with an electronically filed Sequence Listing in XML format. The sequence listing file entitled ORB-014WO1_SL.XML was created on April 25, 2025, and is 43,602 bytes in size; the information in electronic format of the Sequence Listing is incorporated herein by reference in its entirety. BACKGROUND

[0003] Unlike canonical linear RNAs, circular RNAs form covalently closed, continuous stable loops. Therefore, circular RNAs are resistant to exonuclease digestion, making them more stable as compared to linear RNA. The circular form makes the RNA molecule more stable and results in the circular RNA having increased protein production capabilities and increased efficacy as therapeutics.

[0004] There are numerous challenges for efficiently circularizing RNA, including long protein-coding RNA sequences. Thus, there is a need for more efficient RNA circularization techniques. SUMMARY OF THE INVENTION

[0005] The present invention provides nucleic acids and methods for making circular RNAs (circRNAs), and circular RNAs, compositions and methods of use thereof. The present invention utilizes permuted intronic sequences derived from self-splicing Group I intron, td intron of T4 bacteriophage (T4td intron) to produce circular RNAs. The permuted intron sequences described herein mediate efficient self-splicing to circularize an RNA sequence. In accordance, the present disclosure provides optimized T4 bacteriophage td gene (T4td) intron fragments for more efficient RNA circularization.

[0006] In some embodiments, the precursor nucleic acid molecule, that is, the nucleic acid molecule for making a circular RNA (for example, a linear precursor RNA) comprises in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragmentAttorney Docket No: ORB-014WO1 comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is between 220-230 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is between 170-190 nucleotides in length. In some embodiments, the precursor nucleic acid molecule is linear precursor RNA.

[0007] In some embodiments, the precursor nucleic acid molecule comprises, in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 244 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is between 170-190 nucleotides in length.

[0008] In some embodiments, the precursor nucleic acid molecule comprises, in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 225 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is between 170-190 nucleotides in length.

[0009] In some embodiments, the precursor nucleic acid molecule comprises, in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is between 200-250 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 189 nucleotides in length.

[0010] In some embodiments, the precursor nucleic acid molecule comprises, in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is between 200-250 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 176 nucleotides in length.

[0011] In one embodiment, the precursor nucleic acid molecule comprises, in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 244 nucleotides in length, and a downstream T4td Group I self-splicing intron fragmentAttorney Docket No: ORB-014WO1 comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 189 nucleotides in length.

[0012] In one embodiment, the precursor nucleic acid molecule comprises, in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 226 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 189 nucleotides in length.

[0013] In one embodiment, the precursor nucleic acid molecule comprises, in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 227 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 176 nucleotides in length.

[0014] In one embodiment, the precursor nucleic acid molecule comprises, in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 225 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 176 nucleotides in length.

[0015] In one embodiment, the precursor nucleic acid molecule comprises, in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 244 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 176 nucleotides in length.

[0016] In one embodiment, the precursor nucleic acid molecule comprises, in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 225 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 189 nucleotides in length.

[0017] In one embodiment, the precursor nucleic acid molecule comprises, in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragmentAttorney Docket No: ORB-014WO1 comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 185 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 165 nucleotides in length.

[0018] In one embodiment, the precursor nucleic acid molecule comprises, in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 183 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 112 nucleotides in length.

[0019] In one embodiment, the precursor nucleic acid molecule comprises, in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 183 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 104 nucleotides in length.

[0020] In one embodiment, the precursor nucleic acid molecule comprises, in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 244 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 182 nucleotides in length.

[0021] In some embodiments, the precursor nucleic acid molecule comprises an upstream T4td Group I self-splicing intron fragment comprising a 3’ splice site and the nucleotide positions 850 to +7 of SEQ ID NO: 1, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site and the nucleotide positions -5 to 99 of SEQ ID NO: 1.

[0022] In some embodiments, the precursor nucleic acid molecule comprises an upstream T4td Group I self-splicing intron fragment comprising a 3’ splice site and the nucleotide positions 800 to +26 of SEQ ID NO: 1, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site and the nucleotide positions -20 to 169 of SEQ ID NO: 1.

[0023] In some embodiments, the precursor nucleic acid molecule comprises an upstream T4td Group I self-splicing intron fragment comprising a 3’ splice site and the nucleotide positions 850 to +17 of SEQ ID NO: 1, and a downstream T4td Group I self-splicing intronAttorney Docket No: ORB-014WO1 fragment comprising a 5’ splice site and the nucleotide positions -20 to 169 of SEQ ID NO: 1.

[0024] In some embodiments, the precursor nucleic acid molecule comprises an upstream T4td Group I self-splicing intron fragment comprising a 3’ splice site and the nucleotide positions 800 to +8 of SEQ ID NO: 1, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site and the nucleotide positions -20 to 169 of SEQ ID NO: 1.

[0025] In some embodiments, the precursor nucleic acid molecule comprises an upstream T4td Group I self-splicing intron fragment comprising a 3’ splice site and the nucleotide positions 852 to +17 of SEQ ID NO: 1, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site and the nucleotide positions -13 to 99 of SEQ ID NO: 1.

[0026] In some embodiments, the precursor nucleic acid molecule comprises an upstream T4td Group I self-splicing intron fragment comprising a 3’ splice site and the nucleotide positions 852 to +17 of SEQ ID NO: 1, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site and the nucleotide positions -5 to 99 of SEQ ID NO: 1.

[0027] In some embodiments, the precursor nucleic acid molecule comprises an upstream T4td Group I self-splicing intron fragment comprising a 3’ splice site and the nucleotide positions 800 to +9 of SEQ ID NO: 1, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site and the nucleotide positions -7 to 169 of SEQ ID NO: 1.

[0028] In some embodiments, the precursor nucleic acid molecule comprises an upstream T4td Group I self-splicing intron fragment comprising a 3’ splice site and the nucleotide positions 800 to +26 of SEQ ID NO: 1, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site and the nucleotide positions -13 to 169 of SEQ ID NO: 1.

[0029] In some embodiments, precursor nucleic acid molecule comprises an upstream T4td Group I self-splicing intron fragment comprising a 3’ splice site and the nucleotide positions 800 to +7 of SEQ ID NO: 1, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site and the nucleotide positions -7 to 169 of SEQ ID NO: 1.

[0030] In some embodiments, precursor nucleic acid molecule comprises an upstream T4td Group I self-splicing intron fragment comprising a 3’ splice site and the nucleotide positions 800 to +26 of SEQ ID NO: 1, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site and the nucleotide positions -7 to 169 of SEQ ID NO: 1.

[0031] In some embodiments, the precursor nucleic acid molecule comprises an upstream T4td Group I self-splicing intron fragment comprising a 3’ splice site and the nucleotideAttorney Docket No: ORB-014WO1 positions 800 to +7 of SEQ ID NO: 1, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site and the nucleotide positions -20 to 169 of SEQ ID NO: 1.

[0032] In some embodiments, the precursor nucleic acid molecule does not include 5’ or 3’ homology arms (i.e., outer homology arms).

[0033] In some embodiments, the precursor nucleic acid molecule further comprises a 5’ spacer sequence between the upstream intron sequence and the sequence to be circularized (i.e., the sequence of interest). In some embodiments, the 5’ spacer sequence is close (i.e., directly downstream) to the upstream intron sequence.

[0034] In some embodiments, the 5’ spacer sequence comprises a 5’ inner homology element. The 5’ inner homology element, in some cases, is located at the 5’ end of the 5’ spacer sequence. In this context, the precursor nucleic acid molecule further comprises a 3’ inner homology element at the 5’ end of the downstream intron sequence.

[0035] In other embodiments, the 5’ spacer sequence does not comprise a 5’ inner homology element. In this context, the precursor nucleic acid molecule does not comprise a 3’ inner homology element at the 5’ end of the downstream intron sequence.

[0036] In other embodiments, the precursor nucleic acid molecule does not include the 5’ spacer sequence.

[0037] In some embodiments, the precursor nucleic acid molecule further comprises a 3’spacer sequence between the sequence of interest (i.e., to be circularized) and the downstream intron sequence. In some embodiments, the 3’ spacer sequence is a 3’ untranslated region (3’ UTR) between the sequence of interest and the downstream intron sequence.

[0038] In some embodiments, the sequence of interest (i.e., to be circularized) is an RNA sequence encoding a polypeptide of interest. In other embodiments, the sequence of interest (i.e., to be circularized) is a non-coding sequence. The sequence of interest encodes for a therapeutic protein (e.g., a chimeric antigen receptor, an enzyme replacement protein, a cytokine, a chemokine, an antibody), or an antigen (e.g, a tumor antigen and a pathogen antigen).

[0039] In some embodiments, the precursor nucleic acid molecule further comprises an internal ribosome entry site (IRES). The IRES may be operably linked to the RNA sequence of interest that encodes a polypeptide of interest.

[0040] In one embodiment, the precursor nucleic acid molecule comprises, in 5’ to 3’ order, (A) an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragmentAttorney Docket No: ORB-014WO1 comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is between 180-260 nucleotides in length, (B) 5’ spacer, (C) optionally an IRES, (D) a sequence of interest, (E) 3’ UTR, and (F) a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is between 110-210 nucleotides in length. In some embodiments, the precursor nucleic acid molecule does not include a 5’ or 3’ homology arm.

[0041] In one embodiment, the precursor nucleic acid molecule comprises, in 5’ to 3’ order, (A) an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is between 180-260 nucleotides in length, (B) 5’ spacer comprising a 5’ inner homology element, (C) optionally an IRES, (D) a sequence of interest, (E) 3’ UTR, (F) a 3’ inner homology element and (G) a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is between 110-210 nucleotides in length. In some embodiments, the precursor RNA does not include 5’ or 3’ homology arm.

[0042] In one embodiment, the precursor nucleic acid molecule comprises, in 5’ to 3’ order, (A) an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 244 nucleotides in length, (B) a 5’ spacer sequence, (C) optionally, an internal ribosome entry site (IRES), (D) a sequence of interest, (E) a 3’ spacer sequence, and (F) a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 189 nucleotides in length.

[0043] In one embodiment, the precursor nucleic acid molecule comprises, in 5’ to 3’ order, (A) an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 244 nucleotides in length, (B) a 5’ spacer sequence comprising a 5’ inner homology element, (C) optionally, an internal ribosome entry site (IRES), (D) a sequence of interest, (E) a 3’ spacer sequence, (F) a 3’ inner homology element, and (G) a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 189 nucleotides in length, wherein the precursor nucleic acid molecule does not include 5’ or 3’ homology arm.

[0044] In one embodiment, the precursor nucleic acid molecule comprises, in 5’ to 3’ order, (A) an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragmentAttorney Docket No: ORB-014WO1 is 226 nucleotides in length, (B) a 5’ spacer sequence, (C) optionally, an internal ribosome entry site (IRES), (D) a sequence of interest, (E) a 3’ spacer sequence, and (F) a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 189 nucleotides in length.

[0045] In one embodiment, the precursor nucleic acid molecule comprises in 5’ to 3’ order, (A) an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 226 nucleotides in length, (B) a 5’ spacer sequence comprising a 5’ inner homology element, (C) optionally, an internal ribosome entry site (IRES), (D) a sequence of interest, (E) a 3’ spacer sequence, (F) a 3’ inner homology element, and (G) a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 189 nucleotides in length, wherein the nucleic acid molecule does not include 5’ or 3’ homology arm.

[0046] In some embodiments, the sequence of interest (i.e., sequence to be circularized) is a coding sequence. In other embodiments, the sequence of interest (i.e., sequence to be circularized) is a non-coding sequence. In some embodiments, the sequence of interest comprises a protein coding sequence. In some embodiments, the sequence of interest encodes a therapeutic protein. In other embodiments, the sequence of interest encodes an antigen, e.g., a tumor antigen and an antigen derived from a pathogen (e.g., a microorganism such as a virus, a bacterium, a fungus and a protozoa). In some embodiments, the sequence of interest encodes a chimeric antigen receptor (CAR). As a non-limiting example, the sequence of interest expresses a CAR in vivo.

[0047] In some embodiments, the sequence of interest comprises one or more non-coding functional sequence, including but not limited to an aptamer, microRNA, miRNA sponge, an antisense RNA and a long non-coding RNA.

[0048] In some embodiments, the precursor nucleic acid molecule, i.e., the nucleic acid molecule for making a circular RNA, is a DNA construct. The DNA construct can be packaged into a viral vector. In other embodiments, the DNA construct for making a circular RNA is a non-viral vector, e.g., a plasmid. In some embodiments, the nucleic acid molecule for making a circular RNA is a linear RNA. The linear RNA can be synthesized by in vitro transcription of a DNA construct of the present disclosure.

[0049] In another aspect, the present invention provides a circular RNA molecule that is transcribed from a nucleic acid described herein.Attorney Docket No: ORB-014WO1

[0050] In another aspect, the present invention provides a method for making a circular RNA using permuted self-splicing T4td intron fragments described herein. In some embodiments, the method comprises co-transcriptional circularization, in which transcription of a linear precursor RNA from the nucleic acid and circularization of the precursor RNA into a circular RNA occur in one reaction. In some embodiments, the method comprises transcribing the nucleic acid template in the presence of agents for the circularization reaction. The agents for such reaction include, for example, magnesium cation (Mg2+) and guanosine (GMP, GDP and / or GTP).

[0051] In one embodiment, the present invention provides a method for making a circular RNA comprises (a) providing an RNA precursor polynucleotide, wherein the precursor polynucleotide comprises, in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment of greater than 180 nucleotides in length, i. an internal ribosome entry site (IRES), ii. a nucleic acid sequence of the RNA to be made circular, and iii. a downstream T4td Group I self-splicing intron fragment of greater than 95 nucleotides in length, (b) allowing splicing of the T4 bacteriophage Td self-splicing intron from the circular RNA precursor polynucleotide, thereby circularizing the RNA.

[0052] In another aspect, the present invention provides a circular RNA. The circular RNA is made from the precursor nucleic acid molecule, including linear RNA, or by the methods described herein.

[0053] In some embodiments, the circular RNA comprises unmodified nucleotides.

[0054] In some embodiments, the circular RNA comprises modified nucleotides. In some embodiments, the circular RNA comprises one or more modified nucleotides N1- methylpseudouridine. In other embodiments, the circular RNA comprises one or more modified nucleotides 5-methoxyuridine. In yet other embodiments, the circular RNA comprises one or more modified nucleotides m5C. In yet other embodiments, the circular RNA comprises one or more modified nucleotides m6A.

[0055] In some embodiments, the circular RNA encodes a chimeric antigen receptor (CAR), a therapeutic protein, a replacement enzyme, an antigen, an antibody and variants thereof.

[0056] In some embodiments, the present invention provides a composition comprising the circular RNA described herein. In some embodiments, the circular RNA is encapsulatedAttorney Docket No: ORB-014WO1 in a lipid nanoparticle (LNP). In other embodiments, the circular RNA is encapsulated in a virus like particle (VLP).

[0057] In yet another aspect, the present invention provides a method for expressing a protein of interest in a cell comprising delivering to the cell the circular RNA described herein.

[0058] In another aspect, the present invention provides a method for treating a disease in a subject, the method comprising administering to the subject a linear precursor polynucleotide, including a linear precursor RNA, or the circular RNA described herein.

[0059] In some embodiments of the compositions and methods disclosed herein, the sequence of interest in the RNA encodes a chimeric antigen receptor (CAR), a therapeutic protein, an enzyme replacement protein, an antigen, or an antibody.

[0060] In some embodiments, the linear RNA is unmodified.

[0061] In some embodiments, the linear RNA is modified.

[0062] In some embodiments, the linear RNA comprises one or more modified nucleotides selected from N1-methylpseudouridine and / or 5-methoxyuridine.

[0063] In some embodiments, the method makes intact circular RNA.

[0064] In some embodiments, the circular RNA is formulated in a delivery vehicle.

[0065] In some embodiments, the delivery vehicle is a lipid nanoparticle.

[0066] In some embodiments, the lipid nanoparticle is conjugated to a targeting moiety.

[0067] In some embodiments, provided herein is a circular RNA produced from the precursor nucleic acid molecule of the present disclosure.

[0068] In some embodiments, provided herein is a circular RNA produced by the method of the present disclosure. BRIEF DESCRIPTION OF THE DRAWINGS

[0069] FIG. 1 is a diagram showing the structure and sequence of T4td intron.

[0070] FIG. 2 is a representative diagram of a nucleic acid construct for making a circular RNA. It demonstrates the upstream intron fragment (“US intron”) derived from Group I T4td intron and the downstream intron fragment (“DS intron”) derived from the Group I T4td intron flanking an RNA sequence (e.g., an open reading frame (ORF) or gene coding sequence). In some embodiments, as shown in FIG. 2, the RNA transcript further comprises a 5’ spacer, an Internal Ribosome Entry Site (IRES), and a 3’ UTR. Splicing of the US and DS intron fragments generates a circular RNA sequence.Attorney Docket No: ORB-014WO1

[0071] FIG. 3A – FIG. 3D illustrate four different embodiments of constructs for making circular RNAs. FIG. 3A shows an RNA transcript construct comprising inner homology elements (i.e., IHE) and 5’ and 3’ homology arms (i.e., outer homology arms)(OHE / IHE). FIG. 3B shows an RNA transcript construct including inner homology elements (i.e., IHE) only (- / IHE), without outer homology arms. FIG. 3C shows an RNA transcript construct that lacks both inner homology elements, and 5’ and 3’ homology arms (- / -). FIG. 3D shows an RNA transcript construct including 5’ and 3’ homology arms only, without inner homology elements (OHE / -).

[0072] FIG. 4 shows diagrams of “DS” and “US” intron fragments split at different exemplary positions of the T4td intron. In some embodiments, the DS and US intron fragments are cut or split or permuted (the terms “cut”, “split”, and “permutated” are used interchangeably herein) at a site such that the catalytic core of the T4td intron is retained. In some embodiments, the DS and US intron fragments are cut such that an internal guide sequence of the T4td intron is retained. In some embodiments, the DS and US intron fragments are cut so that the self-splicing activity of the T4td intron is retained.

[0073] FIG. 5A shows an exemplary gel image of T4td-v2 , as compared to the legacy split (labeled as T4td). The T4td-v2 introns resulted in less accumulation of nicked circRNAs during in vitro transcription and post refolding (e.g., linear RNA, nicked circRNA) (the bands above “circle” in FIG. 5A). FIG. 5B shows circularization efficiency. By initial co- transcriptional circularization reaction, T4td-v2 and T4td-v3 circularized RNA, and generated about over 50% circular RNA over total RNAs (including circular RNAs and linear RNAs) (FIG. 5B). After folding and ribozyme activation, the T4td-v2 and T4td-v3 constructs generate over 80% circular RNA over total RNAs (including circular RNAs and linear RNAs) (FIG. 5C).

[0074] FIG. 6 is a representative gel image showing circularization of T4td-v1 and T4td- v2 at different temperatures. The results showed that T4td intron sequences were used to circularize an RNA sequence at temperatures ranging from 37°C to 61°C. Use of the T4td-v1 and T4td-v2 intron fragments at 56°C and 52°C, respectively, had moderately increased circularization efficiency.

[0075] FIGs. 7A-7D show circularization using T4td-v1 intron sequences in combination with different parts in the RNA construct: FIG. 7A: T4td-v1and different 5’ spacer sequences; FIG. 7B: T4td-v1and different coding sequences (CDS); FIG. 7C: T4td-v1and different IRES; FIG. 7D: T4td-v1and different 3’UTR sequences.Attorney Docket No: ORB-014WO1 DETAILED DESCRIPTION

[0076] The present disclosure provides nucleic acid molecules useful in the generation of circular RNAs containing a sequence of interest, as well as methods of generating circular RNAs. In particular, the present disclosure provides optimized intron fragments derived from T4td intron (a self-splicing Group I intron). Accordingly, in certain embodiments, the present disclosure is directed to nucleic acid molecules comprising permuted T4td intron sequences that facilitate the efficient production of circularized RNA containing a sequence of interest. A. Definitions

[0077] To facilitate an understanding of the present invention, a number of terms and phrases are defined below.

[0078] About: As used herein, the term “about” is understood as within a range of normal tolerance in the art, for example, within two standard deviations of the mean. About can be understood as within 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value.

[0079] Associated: As used herein, the terms “associated with,” “conjugated,” “linked,” “attached,” and “tethered,” when used with respect to two or more moieties, means that the moieties are physically associated or connected with one another, either directly or via one or more additional moieties that serves as a linking agent, to form a structure that is sufficiently stable so that the moieties remain physically associated under the conditions in which the structure is used, e.g., physiological conditions. An “association” need not be strictly through direct covalent chemical bonding. It may also be through ionic or hydrogen bonding or a hybridization-based connectivity sufficiently stable such that the “associated” entities remain physically associated.

[0080] Circular RNA: As used herein, the term “circular RNA” or “circRNA” refers to an RNA that forms a circular structure through covalent or non-covalent bonds. The terms “circRNA” or “circular polyribonucleotide” or “circular RNA” are used interchangeably. In some embodiments, circRNAs are covalently closed, single stranded RNA molecules. A circular RNA can be produced by back-splicing of a linear precursor RNA, by chemical ligation and / or enzymatic ligation. Circular RNAs (circRNAs) can be endogenous or synthetic. Synthetically created and exogenously delivered circRNAs can be synthesized in vitro using self-splicing permuted introns (e.g., self-splicing Group I or Group II intron) from in vitro transcribed constructs. Unlike linear RNAs, circular RNAs are more resistant to the degradation by exonuclease and have a longer half-life than their corresponding linearAttorney Docket No: ORB-014WO1 counterparts. A circular RNA can be a circular mRNA that encodes a polypeptide of interest (e.g., an immunogen and a therapeutic polypeptide). In some embodiments, circular RNAs incorporating the introns disclosed herein have significantly improved drug like properties compared to linear mRNA therapeutics, including enhanced longevity as protein production vectors.

[0081] Circularization efficiency: As used herein, the term “circularization efficiency” refers to a measurement of resultant circular RNA versus its non-circular starting material (e.g., a linear precursor RNA).

[0082] Corresponding to: As used herein, the term “corresponding to” refers to a nucleic acid sequence or an amino acid sequence at particular positions of an intron, or the corresponding positions in another intron. A sequence corresponding to the sequence at particular positions of an intron may comprise a corresponding substitution or a variant, e.g., the substituted nucleotides or amino acids do not naturally occur at the corresponding positions. The substituted nucleotides or amino acids may be the corresponding residues in another intron (e.g., Group I or II intron).

[0083] Delivery: As used herein, “delivery” refers to the act or manner of delivering a circular RNA, a construct, a linear RNA precursor, a cell comprising a circular RNA, a construct or a linear RNA precursor, or a composition comprising a circular RNA, a construct or a linear RNA precursor, a protein, cargo and / or payload.

[0084] Downstream: As used herein, the term “downstream” refers to sequence that is 3’ to a particular sequence.

[0085] Encapsulate: As used herein, the term “encapsulate” means to enclose, surround, or encase. As it relates to the formulation of the compositions of the disclosure, encapsulation may be substantial, complete or partial. The term “substantially encapsulated” means that at least greater than 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.9% or greater than 99.999% of the pharmaceutical composition of the disclosure may be enclosed, surrounded or encased within the delivery agent. “Partially encapsulated” means that less than 10%, 20%, 30%, 40%, 50%, or less of the pharmaceutical composition or compound of the disclosure may be enclosed, surrounded or encased within the delivery agent. In some embodiments, at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99%, or greater than 99.99% of the pharmaceutical composition of the present disclosure are encapsulated in the delivery vehicle (e.g., a lipid nanoparticle (LNP)).Attorney Docket No: ORB-014WO1

[0086] Encode: As used herein, the term “encode” or “encoding” refers broadly to any process whereby the information in a polymeric macromolecule is used to direct the production of a second molecule that is different from the first. The second molecule may have a chemical structure that is different from the chemical nature of the first molecule.

[0087] Enhance: As used herein, the terms “enhance” and “enhancement” refers to an increase of at least about 5%, 10%, 20%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400%, 500% or more of a reference; the reference may be a biological function of a nucleic acid or protein and a gene expression level, etc.

[0088] Expression: As used herein, “expression” of a nucleic acid sequence refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, 5’ cap formation, and / or 3’ end processing); (3) translation of an RNA into a polypeptide or protein; and (4) post-translational modification of a polypeptide or protein.

[0089] Feature: As used herein, a “feature” refers to a characteristic, a property, or a distinctive element. Features of the polypeptides encoded by the present circular polynucleotide, such as surface manifestations, local conformational shape, folds, loops, half- loops, domains, half-domains, sites, termini or any combination thereof.

[0090] Formulation: As used herein, a “formulation” includes at least one compound, substance, entity, moiety, cargo or payload, and a delivery agent.

[0091] Fragment: A “fragment,” as used herein, refers to a portion. For example, an intron fragment may comprise a portion of the full intron sequence. Fragments of proteins may comprise polypeptides obtained by digesting full-length protein isolated from cultured cells.

[0092] Homology: As used herein, the term “homology” refers to the overall relatedness between polymeric molecules, e.g., between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. In some embodiments, polymeric molecules are considered to be “homologous” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical or similar. The term “homologous” necessarily refers to a comparison between at least two sequences (polynucleotide or polypeptide sequences). In accordance with the disclosure, two polynucleotide sequences are considered to be homologous if the polypeptides they encode are at least about 50%, 60%, 70%, 80%, 90%, 95%, or even 99% for at least one stretch of at least about 20 amino acids. In some embodiments, homologous polynucleotide sequences are characterized by the ability to encode a stretch of at least 4–5 uniquely specified amino acids. For polynucleotide sequences less than 60 nucleotides inAttorney Docket No: ORB-014WO1 length, homology is determined by the ability to encode a stretch of at least 4–5 uniquely specified amino acids. In accordance with the disclosure, two protein sequences are considered to be homologous if the proteins are at least about 50%, 60%, 70%, 80%, or 90% identical for at least one stretch of at least about 20 amino acids.

[0093] Identity: As used herein, the term “identity” refers to the overall relatedness between polymeric molecules, e.g., between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Calculation of the percent identity of two polynucleotide sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second nucleic acid sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). A sequence can be at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical to a reference sequence. In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence. The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using methods such as those described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; each of which is incorporated herein by reference. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4:11-17), which has been incorporated into the ALIGN program (version 2.0) using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. The percent identity between two nucleotide sequences can,Attorney Docket No: ORB-014WO1 alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna.CMP matrix. Methods commonly employed to determine percent identity between sequences include, but are not limited to those disclosed in Carillo, H. and Lipman, D., SIAM J Applied Math., 48:1073 (1988); incorporated herein by reference. Techniques for determining identity are codified in publicly available computer programs. Exemplary computer software to determine homology between two sequences include, but are not limited to, GCG program package, Devereux, J., et al., Nucleic Acids Research, 12(1), 387 (1984)), BLASTP, BLASTN, and FASTA Altschul, S. F. et al., J. Molec. Biol., 215, 403 (1990)).

[0094] Intron: Introns are non-coding sequences of DNA or RNA. Following transcription, new, immature strands of messenger RNA, called pre-mRNA, may contain both introns and exons (exons are any sequence of DNA or RNA that encode for proteins). The pre-mRNA molecule goes through a modification process called splicing during which the noncoding introns are cut out, and only the coding exons remain. Splicing produces a mature messenger RNA molecule that is then translated into a protein. In the context of the present invention, the Group I or Group II introns are self-splicing introns. As used herein, the term “self-splicing intron” refers to introns that can act as ribozymes to autocatalytically splice them out from the parent RNA in the absence of any added protein or RNA. An autocatalytic intron can be a Group I intron or a Group II intron.

[0095] Ionizable Lipid: As used herein, “ionizable lipid” refers to any of a number of lipid species that carry a net positive charge at a selected pH.

[0096] Lipid Nanoparticle: As used herein, “lipid nanoparticle” or “LNP” refers to a delivery vehicle comprising one or more lipids (e.g., cationic lipids, non-cationic lipids, PEG- modified lipids).

[0097] Liposome: As used herein, “liposome” generally refers to a vesicle composed of lipids (e.g., amphiphilic lipids) arranged in one or more spherical bilayers or bilayers.

[0098] Modified: As used herein, “modified” or, as appropriate “modification” refers to a changed state or structure of a molecule. Molecules may be modified in many ways including chemically, structurally, and / or functionally. With respect to nucleic acid molecules (e.g., DNA and RNA), the A, G, C, T (if DNA), or U (if RNA) nucleotides are modified. With respect to polypeptides, the term “modification” refers to a modification as compared to the canonical set of 20 amino acids.Attorney Docket No: ORB-014WO1

[0099] mRNA: As used herein, the term “messenger RNA” (mRNA) means a polynucleotide which encodes a polypeptide of interest and which is capable of being translated to produce the encoded polypeptide of interest in vitro, in vivo, in situ or ex vivo.

[0100] Non-Cationic Lipid: As used herein, “non-cationic lipid” refers to any neutral, zwitterionic or anionic lipid.

[0101] Nucleic acid molecule: As used herein, the term “nucleic acid molecule" refers to a polymeric form of nucleotides, either deoxyribonucleotides (DNAs) or ribonucleotides (RNAs), or analogs thereof. The terms include single stranded or double-stranded molecules comprised of nucleic acid bases. As such, the term includes, and may be used interchangeably with “plasmids”, “constructs”, or “vectors.” In the present disclosure, the terms “polynucleotide” and “nucleic acid” are used interchangeably.

[0102] Pharmaceutical Composition: As used herein, the term “pharmaceutical composition” refers to compositions comprising at least one active ingredient and optionally one or more pharmaceutically acceptable excipients.

[0103] PEG: As used herein “PEG” means any polyethylene glycol or other polyalkylene ether polymer.

[0104] Spacer: As used herein, the term “spacer” refers to any contiguous nucleotide sequence (e.g., of one or more nucleotides) that provides distance or flexibility between two adjacent polynucleotide regions. The spacer can be a 5’ spacer or 3’ spacer. In some embodiments, the nucleic acid for making a circular RNA of the present invention comprises a 5’ spacer that is located between the upstream intron fragment and a sequence of interest (i.e., to be circularized). In some embodiments, the 5’ spacer can be inserted between the upstream intron fragment and the IRES. In some embodiments, the nucleic acid for making a circular RNA of the present invention comprises a 3’ spacer that is located between a sequence of interest (to be circularized) and the downstream intron fragment. The 5’ and 3’ spacer sequences may be 10 nucleotides to 100 nucleotides in length, or 20 nucleotides to 50 nucleotides in length. In some embodiments, the 5’ spacer is at least 10 nucleotides in length. In some embodiments, the 5’ spacer sequence is at least 15 nucleotides in length. In some embodiments, the 5’ spacer is at least 20 nucleotides in length. In some embodiments, the 5’ spacer sequence is at least 30 nucleotides in length. In some embodiments, a 3’ spacer is located between a sequence to be circularized and the downstream intron sequence.

[0105] Sterol: As used herein, “sterol” is a subgroup of steroids consisting of steroid alcohols.Attorney Docket No: ORB-014WO1

[0106] Structural Lipid: As used herein, “structural lipid” refers to sterols and lipids containing sterol moieties.

[0107] Transcription: As used herein, the term “transcription” refers to the formation or synthesis of an RNA molecule by an RNA polymerase using a DNA molecule as a template.

[0108] Translation: As used herein, the term “translation” refers to the formation of a polypeptide molecule by a ribosome based upon an RNA template.

[0109] Treat: As used herein, the term “treat,” or “treating,” refers to a prophylactic or therapeutic treatment of a disease or disorder (e.g., an infectious disease, a cancer, an autoimmune disorder, a genetic disease) in a subject, including a human subject. The effect of treatment can include reversing, alleviating, reducing the severity of, curing, inhibiting the progression of, reducing the likelihood of recurrence of the disease or one or more symptoms or manifestations of the disease or disorder, stabilizing (i.e., not worsening) the state of the disease or disorder, or preventing the spread of the disease or disorder as compared to the state or the condition of the disease or disorder in the absence of the therapeutic treatment.

[0110] Unmodified: As used herein, “unmodified” refers to any substance, compound or molecule prior to being changed in any way. Unmodified may, but does not always, refer to the wild type or native form of a biomolecule. Molecules may undergo a series of modifications whereby each modified molecule may serve as the “unmodified” starting molecule for a subsequent modification.

[0111] Upstream: As used herein, the term “upstream” refers to sequence that is 5’ to a particular sequence.

[0112] Vector: As used herein, a “vector” is any molecule or moiety which transports, transduces or otherwise acts as a carrier of a heterologous molecule. Vectors of the present disclosure may be produced recombinantly and may be based on and / or may comprise viral parent or reference sequences. Such parent or reference viral sequences may serve as an original, second, third, or subsequent sequence for engineering vectors. In non-limiting examples, such parent or reference viral sequences may comprise any one or more of the following sequences: a polynucleotide sequence encoding a polypeptide or multi-polypeptide, which sequence may be wild-type or modified from wild-type and which sequence may encode full-length or partial sequence of a protein, protein domain, or one or more subunits of a protein; a polynucleotide comprising a modulatory or regulatory nucleic acid which sequence may be wild-type or modified from wild-type; and a transgene that may or may not be modified from wild-type sequence.Attorney Docket No: ORB-014WO1 B. Nucleic Acid Molecules and Circular RNAs

[0113] The present invention provides nucleic acid molecules and methods for synthesizing circular RNAs. In some embodiments, the circular RNA comprises a sequence of interest. The nucleic acid molecules described herein are synthetic and / or recombinant. Synthetic and / or recombinant nucleic acid molecules are made by any known method in the art. For example, recombinant nucleic acid molecules, such as constructs described herein, are generated using standard molecular biology techniques. In particular, a nucleic acid molecule for generating a circular RNA described herein comprises an upstream intron sequence corresponding to the 3’ splicing fragment of the T4td intron and a downstream intron sequence corresponding to the 5’ splicing fragment of the T4td intron. The nucleic acid construct comprising intron sequences of the T4td intron is optimized to increase circularization efficiency. A nucleic acid molecule for generating a circular RNA described herein comprises, from 5’ to 3’ end, an upstream intron sequence corresponding to the 3’ splicing fragment of the T4td intron, a sequence of interest, and a downstream intron sequence corresponding to the 5’ splicing fragment of the T4td intron. As used herein, the terms “nucleic acid molecule” or “construct” are used interchangeably. As used herein, a “precursor RNA” is a linear precursor RNA that may be circularized to make circular RNA.

[0114] Accordingly, the present invention also provides circular RNAs synthesized using the nucleic acid molecules and methods disclosed herein and methods of use of circular RNAs.

[0115] The circular RNAs are distinguished from linear polynucleotides (e.g., mRNA) in their functional and / or structural design features which serve to, as evidenced herein, overcome existing problems of effective polypeptide production using nucleic acid-based methodologies.

[0116] In some embodiments, the circular RNAs described herein comprise additional features to improve one or more of the stability and / or clearance in tissues, receptor uptake and / or kinetics, cellular access by the compositions, engagement with translational machinery, half-life, translation efficiency, immune evasion, and other functions and / or activities.

[0117] In one aspect, the present invention provides a precursor nucleic acid molecule for making a circular RNA. In some embodiments, the nucleic acid molecule is a DNA construct (e.g., a vector) that is transcribed into precursor RNA, and the precursor RNA circularizes into a circular RNA. In some embodiments, the nucleic acid molecule is a linear precursorAttorney Docket No: ORB-014WO1 RNA (e.g., a linear mRNA) that circularizes into a circular RNA. The precursor nucleic acid molecule described herein comprises different elements essential for circular RNA synthesis and function.

[0118] In some embodiments, the nucleic acid molecule for making a circular RNA comprises self-splicing intron sequences derived from T4td intron and a sequence of interest (i.e., to be circularized). In some embodiments, the sequence of interest encodes a chimeric antigen receptor (CAR). A rational design of a synthetic circular RNA polynucleotide cassette includes at least two self-splicing intron sequences flanking the sequence to be circularized. The upstream and downstream intron sequences are self-spliced to generate a circular RNA comprising the RNA sequence of interest. In some embodiments, the nucleic acid molecule comprises one or more additional sequences that facilitate circularization and functions of circular RNA. For example, a 5’ spacer and / or 3’ spacer (e.g., 3’ untranslated region (UTR)) sequences are included between the intron sequences and the sequence of interest (i.e., to be circularized). In some embodiments, one or more homology elements are included. In some embodiments, a 5’ inner homology element and a 3’ homology element are included between the intron sequences and the sequence of interest (i.e., to be circularized). In some embodiments, at least one internal ribosome entry site (IRES) is included within the construct and linked to the sequence of interest, for example, a coding sequence.

[0119] In some embodiments, the present invention provides a circular RNA that is made from a precursor nucleic acid molecule or by a method described herein. T4td Intron

[0120] T4td intron is a self-splicing Group I intron. Bacteriophage T4 contains a self- splicing Group I intron in the gene (Td) coding for thymidylate synthase. The T4td intron also contains an open reading frame encoding a homing endonuclease. It has been known that Group I introns have autocatalytic activity (acting as ribozymes), i.e., are self-splicing. Group I introns splice themselves out without assistance from the spliceosome or other proteins, and the splicing results in joining of the flanking exons and circularization of the intervening intron to produce an intronic circRNA. Group I introns can be found naturally within the rRNA, tRNA, and mRNA genes of bacteria and non-metazoan eukaryotes. A general discussion of the catalytic activity of Group I introns can be found in the review article by Hausner et al., (Mobile DNA, vol 5(8)(2014)).Attorney Docket No: ORB-014WO1

[0121] Similar to other Group I introns, naturally, the T4td intron is autocatalytically excised from linear RNA precursors and the flanking exons ligated in tandem transesterification reactions.

[0122] Permuting the T4td intron to generate circular exon has been used. For circularizing a RNA sequence, the intron is genetically permuted (i.e., split) into 5’ and 3’ portion fragments and assembled with the DNA equivalent of the RNA of interest (i.e., to be circularized) in a circularization construct (the nucleic acid molecule described herein), in an order that promotes backsplicing and circularization. The order within the nucleic acid construct is, from the 5’ to 3’ end, an upstream intron sequence corresponding to a 3’ splicing fragment of T4td intron, a sequence of interest, and a downstream intron sequence corresponding to a 5’ splicing fragment of T4td intron.

[0123] In some embodiments, the “upstream intron fragment sequence” or “US” and “downstream intron fragment sequence” or “DS” derived from the T4td intron optionally comprise exon fragment and in this context, are also referred to as “upstream intron-exon fragment sequence” and “downstream intron-exon fragment sequence,” respectively. In some embodiments, the nucleic acid molecule for making a circular RNA comprises an upstream intron sequence and a downstream intron sequence generated from a cut site or splitting position (the terms “cut site”, “permutation site”, and “splitting position” are used interchangeably herein), wherein the cut site retains the structural integrity of the intron. As used herein, the term “catalytic core” refers to an intron region (e.g., the internal stem structure, or internal guide sequence) needed for the intron to self-splice, which is well- understood in the art. Typically, the catalytic core of an intron, particularly, a Group I intron, including for example, T4td intron, is a highly conserved small region of about 70 nucleotides composed of paired regions (e.g., P1-P6) that form elongated domains (e.g., helical domains). More detailed description of the catalytic core of an intron can be found in, e.g., Michel and Westhof, J. Mol. Bio., 1990, 216: 585-610, Luptak and Doudna, Nucleic Acids Research, 2004, 32(7): 2272-80, the contents of which are incorporated by reference herein. In some embodiments, the cut site is designed to retain the catalytic core of the intron, which is a region of nucleotides containing sequences and structures needed for the intron to self-splice. In some embodiments, a suitable cut site is chosen outside the catalytic core of the intron such that the structural integrity of the intron is retained, and the resulting upper intron fragments and lower intron fragments allows for RNA circularization. In some embodiments, a cut site of the T4Td intron is chosen such that an “internal guide” sequence is retained that comprises base pairing association of the distal exons to the P1-P10 helixAttorney Docket No: ORB-014WO1 formed by the intron’s secondary structure as described in e.g., Rausch, J.W. et al., Nucleic Acids Research, 6 Jan 2021; 49(6):e35; and Chu, F.K. et al., Cell, 25 April 1986, 45(2): 157- 166, the contents of which are incorporated by reference herein. In some embodiments, the T4td intron comprises a sequence in SEQ ID NO: 1. GGTATCAACGCTCAGTAGATGTTTTCTTGGGTTAATTGAGGCCTGAGTATAAGGTGACTTATACTTGT AATCTATCTAAACGGGGAACCTCTCTAGTAGACAATCCCGTGCTAAATTGTAGGACTTGCCCTTTAAT AAATACTTCTATATTTAAAGAGGTATTTATGAAAAGCGGAATTTATCAGATTAAAAATACTTTAAACA ATAAAGTATATGTAGGAAGTGCTAAAGATTTTGAAAAGAGATGGAAGAGGCATTTTAAAGATTTAGAA AAAGGATGCCATTCTTCTATAAAACTTCAGAGGTCTTTTAACAAACATGGTAATGTGTTTGAATGTTC TATTTTGGAAGAAATTCCATATGAGAAAGATTTGATTATTGAACGAGAAAATTTTTGGATTAAAGAGC TTAATTCTAAAATTAATGGATACAATATTGCTGATGCAACGTTTGGTGATACATGTTCTACGCATCCA TTAAAAGAAGAAATTATTAAGAAACGTTCTGAAACTGTTAAAGCTAAGATGCTTAAACTTGGACCTGA TGGTCGGAAAGCTCTTTACAGTAAACCCGGAAGTAAAAACGGGCGTTGGAATCCAGAAACCCATAAGT TTTGTAAGTGCGGTGTTCGCATACAAACTTCTGCTTATACTTGTAGTAAATGCAGAAATCGTTCAGGT GAAAATAATTCATTCTTTAATCATAAGCATTCAGACATAACTAAATCTAAAATATCAGAAAAGATGAA AGGTAAAAAGCCTAGTAATATTAAAAAGATTTCATGTGATGGGGTTATTTTTGATTGTGCAGCAGATG CAGCTAGACATTTTAAAATTTCGTCTGGATTAGTTACTTATCGTGTAAAATCTGATAAATGGAATTGG TTCTACATAAATGCCTAACGACTATCCCTTTGGGGAGTAGGGTCAAGTGACTCGAAACGATAGACAAC TTGCTTTAACAAGTTGGAGATATAGTCTGCTCTGCATGGTGACATGCAGCTGGATATAATTCCGGGGT AAGATTAACGACCTTATCTGAACATAATGCTACCGTTTAATATTGCGTCATATGCTA (SEQ ID NO: 1) The first 30 nucleic acid sequences at the 5’ end of SEQ ID NO: 1 (position -30 to 0; ggtatcaacgctcagtagatgttttcttgg, bolded above) are E2 sequence at the 5’ end of T4td intron. The last 30 nucleic acid residues at the 3’ end of SEQ ID NO 1 (position 1-30, tgctaccgtttaatattgcgtcatatgcta, bolded above) are E1 sequence at the 3’ end of T4td intron. The sequence at positions 133-872 encodes a homing endonuclease (Tevl CDS), which intervenes the T4td intron). Exemplary Upstream and Downstream Intron Sequences from T4td Intron

[0124] In accordance with the present invention, the nucleic acid molecules described herein comprises permuted intron sequences derived from the T4td intron. In some embodiments, the nucleic acid molecule for making a circular RNA comprises upstream and downstream intron sequences corresponding to a 3’ splicing fragment and a 5’ splicing fragment of the T4td intron, respectively.Attorney Docket No: ORB-014WO1

[0125] In some embodiments, the precursor RNA comprises in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is between 180-260 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is between 110-210 nucleotides in length.

[0126] In some embodiments, the upstream T4td self-splicing intron fragment is between 180-240 nucleotides, 200-260 nucleotides, 220-240 nucleotides, or 230-250 nucleotides in length. In some embodiments, the upstream T4td self-splicing intron fragment is 180 nucleotides, 181 nucleotides, 182 nucleotides, 183 nucleotides, 184 nucleotides, 185 nucleotides, 186 nucleotides, 187 nucleotides, 188 nucleotides, 189 nucleotides, 190 nucleotides, 191 nucleotides, 192 nucleotides, 193 nucleotides, 194 nucleotides, 195 nucleotides, 196 nucleotides, 197 nucleotides, 198 nucleotides, 199 nucleotides, 200 nucleotides, 201 nucleotides, 202 nucleotides, 203 nucleotides, 204 nucleotides, 205 nucleotides, 206 nucleotides, 207 nucleotides, 208 nucleotides, 209 nucleotides, 210 nucleotides, 211 nucleotides, 212 nucleotides, 213 nucleotides, 214 nucleotides, 215 nucleotides, 216 nucleotides, 217 nucleotides, 218 nucleotides, 219 nucleotides, 220 nucleotides, 221 nucleotides, 222 nucleotides, 223 nucleotides, 224 nucleotides, 225 nucleotides, 226 nucleotides, 227 nucleotides, 228 nucleotides, 229 nucleotides, 230 nucleotides, 231 nucleotides, 232 nucleotides, 233 nucleotides, 234 nucleotides, 235 nucleotides, 236 nucleotides, 237 nucleotides, 238 nucleotides, 239 nucleotides, 240 nucleotides, 241 nucleotides, 242 nucleotides, 243 nucleotides, 244 nucleotides, 245 nucleotides, 246 nucleotides, 247 nucleotides, 248 nucleotides, 249 nucleotides, 250 nucleotides, 251 nucleotides, 252 nucleotides, 253 nucleotides, 254 nucleotides, 255 nucleotides, 256 nucleotides, 257 nucleotides, 258 nucleotides, 259 nucleotides, or 260 nucleotides in length.

[0127] In some embodiments, the downstream T4td self-splicing intron fragment is between 110-200 nucleotides, 110-160 nucleotides, 120-180 nucleotides, 140-210 nucleotides, 150-200 nucleotides, or 160-210 nucleotides in length. In some embodiments, the downstream T4td self-splicing intron fragment is 110 nucleotides, 111 nucleotides, 112 nucleotides, 113 nucleotides, 114 nucleotides, 115 nucleotides, 116 nucleotides, 117 nucleotides, 118 nucleotides, 119 nucleotides, 120 nucleotides, 121 nucleotides, 122 nucleotides, 123 nucleotides, 124 nucleotides, 125 nucleotides, 126 nucleotides, 127 nucleotides, 128 nucleotides, 129 nucleotides, 130 nucleotides, 131 nucleotides, 132Attorney Docket No: ORB-014WO1 nucleotides, 133 nucleotides, 134 nucleotides, 135 nucleotides, 136 nucleotides, 137 nucleotides, 138 nucleotides, 139 nucleotides, 140 nucleotides, 141 nucleotides, 142 nucleotides, 143 nucleotides, 144 nucleotides, 145 nucleotides, 146 nucleotides, 147 nucleotides, 148 nucleotides, 149 nucleotides, 150 nucleotides, 151 nucleotides, 152 nucleotides, 153 nucleotides, 154 nucleotides, 155 nucleotides, 156 nucleotides, 157 nucleotides, 157 nucleotides, 159 nucleotides, 160 nucleotides, 161 nucleotides, 162 nucleotides, 163 nucleotides, 164 nucleotides, 165 nucleotides, 166 nucleotides, 167 nucleotides, 168 nucleotides, 169 nucleotides, 170 nucleotides, 175 nucleotides, 180 nucleotides, 185 nucleotides, 190 nucleotides, 195 nucleotides, 200 nucleotides, 205 nucleotides, or 210 nucleotides in length.

[0128] In some embodiments, the precursor RNA comprises in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is between 220-230 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is between 170-190 nucleotides in length.

[0129] In some embodiments, the precursor RNA comprises in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment 244 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is between 170-190 nucleotides in length.

[0130] In some embodiments, the precursor RNA comprises in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 225 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is between 170-190 nucleotides in length.

[0131] In some embodiments, the precursor RNA comprises in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is between 200-250 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 189 nucleotides in length.Attorney Docket No: ORB-014WO1

[0132] In some embodiments, the precursor RNA comprises in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is between 200-250 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 176 nucleotides in length.

[0133] In one embodiment, the precursor RNA comprises in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 244 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 189 nucleotides in length.

[0134] In one embodiment, the precursor RNA comprises in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 226 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 189 nucleotides in length.

[0135] In one embodiment, the precursor RNA comprises in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 227 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 176 nucleotides in length.

[0136] In one embodiment, precursor RNA comprises in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 225 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 176 nucleotides in length.

[0137] In one embodiment, the precursor RNA comprises in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 244 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site,Attorney Docket No: ORB-014WO1 wherein the downstream T4td Group I self-splicing intron fragment is 176 nucleotides in length.

[0138] In one embodiment, the precursor RNA comprises in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 225 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 189 nucleotides in length.

[0139] In one embodiment, the precursor RNA comprises in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 185 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 165 nucleotides in length.

[0140] In one embodiment, the precursor RNA comprises in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 183 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 112 nucleotides in length.

[0141] In one embodiment, the precursor RNA comprises in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 183 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 104 nucleotides in length.

[0142] In one embodiment, the precursor RNA comprises in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 244 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 182 nucleotides in length.

[0143] In some embodiments, the precursor RNA comprises an upstream T4td Group I self-splicing intron fragment comprising a 3’ splice site and the nucleotide positions 850 toAttorney Docket No: ORB-014WO1 +7 of SEQ ID NO: 1, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site and the nucleotide positions -5 to 99 of SEQ ID NO: 1.

[0144] In some embodiments, the precursor RNA comprises an upstream T4td Group I self-splicing intron fragment comprising a 3’ splice site and the nucleotide positions 800 to +26 of SEQ ID NO: 1, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site and the nucleotide positions -20 to 169 of SEQ ID NO: 1.

[0145] In some embodiments, the precursor RNA comprises an upstream T4td Group I self-splicing intron fragment comprising a 3’ splice site and the nucleotide positions 850 to +17 of SEQ ID NO: 1, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site and the nucleotide positions -20 to 169 of SEQ ID NO: 1.

[0146] In some embodiments, the precursor RNA comprises an upstream T4td Group I self-splicing intron fragment comprising a 3’ splice site and the nucleotide positions 800 to +8 of SEQ ID NO: 1, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site and the nucleotide positions -20 to 169 of SEQ ID NO: 1.

[0147] In some embodiments, the precursor RNA comprises an upstream T4td Group I self-splicing intron fragment comprising a 3’ splice site and the nucleotide positions 852 to +17 of SEQ ID NO: 1, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site and the nucleotide positions -13 to 99 of SEQ ID NO: 1.

[0148] In some embodiments, the precursor RNA comprises an upstream T4td Group I self-splicing intron fragment comprising a 3’ splice site and the nucleotide positions 852 to +17 of SEQ ID NO: 1, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site and the nucleotide positions -5 to 99 of SEQ ID NO: 1.

[0149] In some embodiments, the precursor RNA comprises an upstream T4td Group I self-splicing intron fragment comprising a 3’ splice site and the nucleotide positions 800 to +9 of SEQ ID NO: 1, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site and the nucleotide positions -7 to 169 of SEQ ID NO: 1.

[0150] In some embodiments, the precursor RNA comprises an upstream T4td Group I self-splicing intron fragment comprising a 3’ splice site and the nucleotide positions 800 to +26 of SEQ ID NO: 1, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site and the nucleotide positions -13 to 169 of SEQ ID NO: 1.

[0151] In some embodiments, the precursor RNA comprises an upstream T4td Group I self-splicing intron fragment comprising a 3’ splice site and the nucleotide positions 800 to +7 of SEQ ID NO: 1, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site and the nucleotide positions -7 to 169 of SEQ ID NO: 1.Attorney Docket No: ORB-014WO1

[0152] In some embodiments, the precursor RNA comprises an upstream T4td Group I self-splicing intron fragment comprising a 3’ splice site and the nucleotide positions 800 to +26 of SEQ ID NO: 1, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site and the nucleotide positions -7 to 169 of SEQ ID NO: 1.

[0153] In some embodiments, precursor RNA comprises an upstream T4td Group I self- splicing intron fragment comprising a 3’ splice site and the nucleotide positions 800 to +7 of SEQ ID NO: 1, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site and the nucleotide positions -20 to 169 of SEQ ID NO: 1. 5’ Spacer

[0154] In some embodiments, the nucleic acid molecule for making a circular RNA comprises a 5’ spacer between the upstream intron fragment and the sequence of interest (i.e., to be circularized), or the IRES.

[0155] The 5’spacer sequence comprises a random sequence that increases circularization efficiency.

[0156] The 5’ spacer sequence may be of any length (e.g., 10 to 100 nucleotides, 10 to 90 nucleotides, 10 to 80 nucleotides, 10 to 70 nucleotides, 10 to 60 nucleotides, 10 to 50 nucleotides, 10 to 40 nucleotides, 10 to 30 nucleotides, 10 to 20 nucleotides, 20 to 100 nucleotides, 20 to 90 nucleotides, 20 to 80 nucleotides, 20 to 70 nucleotides, 20 to 60 nucleotides, 20 to 50 nucleotides, 20 to 40 nucleotides, 20 to 30 nucleotides, 30 to 100 nucleotides, 30 to 90 nucleotides, 30 to 80 nucleotides, 30 to 70 nucleotides, 30 to 60 nucleotides, 30 to 50 nucleotides, 30 to 40 nucleotides, 40 to 100 nucleotides, 40 to 90 nucleotides, 40 to 80 nucleotides, 40 to 70 nucleotides, 40 to 60 nucleotides, 40 to 50 nucleotides, 50 to 100 nucleotides, 50 to 90 nucleotides, 50 to 80 nucleotides, 50 to 70 nucleotides, 50 to 60 nucleotides, 60 to 100 nucleotides, 60 to 90 nucleotides, 60 to 80 nucleotides, 60 to 70 nucleotides, or 50 nucleotides). For example, in some embodiments, the length of the 5’ spacer is selected to optimize translation of the protein-coding nucleic acid sequence.

[0157] In some embodiments, the 5’ spacer sequence is between 20 and 50 nucleotides in length. In some embodiments, the 5’ spacer sequence is between 30 and 100 nucleotides in length. In certain embodiments, the 5’ spacer sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49,50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides in length.Attorney Docket No: ORB-014WO1

[0158] In some embodiments, the 5’ spacer sequence includes a 5’ inner homology element. As used herein, the terms “internal homology region” and “inner homology element (IHE)” are used interchangeably. In some embodiments, the internal homology element is about 5-50 nucleotides in length. In some embodiments, the internal homology element is about 5-30 nucleotides in length. In some embodiments, the internal homology region is about 10-25 nucleotides in length. In some embodiments, the internal homology element is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length. In some embodiments, the 5’ internal homology element is located at the 5’ end of the 5’ spacer sequence. The internal homology element forms base-pairing with an internal homology region, e.g., at the 3’ end (3’ inner homology element). In some embodiments, the nucleic acid described herein comprising 5’ and 3’ inner homology elements that are 75%, 80%, 85%, 90%, 95%, or 100% complementary to each other.

[0159] In some embodiments, the 5’ spacer sequence comprises a polyA sequence. The polyA sequence may comprise 15-30 As. In some embodiments, the polyA sequence comprises 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 As. In other embodiments, the 5’ spacer sequence comprises a poly A-C sequence. Internal Ribosome Entry Site (IRES)

[0160] In some embodiments, the nucleic acid molecule described herein comprises an internal ribosome entry site (IRES) sequence. As used herein, the term “internal ribosome entry site” or “IRES” refers to an RNA sequence or structural element ranging in size from 10 nucleotides to 1,000 nucleotides or more which is capable of initiating translation of a polypeptide in the absence of a normal RNA cap structure. An IRES element may engage a eukaryotic ribosome for translation, or initiate cap-independent translation and protein synthesis.

[0161] In some embodiments, the IRES has a sequence of an IRES, or is a functional fragment or variant thereof.

[0162] The IRES sequence may be derived from a viral genome or is a cellular IRES. In one embodiment, the nucleic acid molecule described herein comprises a viral IRES.

[0163] In some embodiments, the IRES may include but is not limited to, the encephalomyocarditis virus (EMCV) IRES, polio virus IRES, Kaposi sarcoma-associated herpesvirus (KSHV) vFLIP IRES, or hepatitis C virus (HCV) IRES. In some embodiments, the IRES has a sequence of an IRES from Taura syndrome virus, Triatoma virus, Theiler’sAttorney Docket No: ORB-014WO1 encephalomyelitis virus, Simian Virus 40, Solenopsis invicta virus 1, Rhopalosiphum padi virus, Reticuloendotheliosis virus, Human poliovirus 1, Plautia stali intestine virus, Kashmir bee virus, Human rhinovirus 2, Homalodisca coagulata virus- 1, Human Immunodeficiency Virus type 1, Homalodisca coagulata virus- 1, Himetobi P virus, Hepatitis C virus, Hepatitis A virus, Hepatitis GB virus, Foot and mouth disease virus, Human enterovirus 71, Equine rhinitis virus, Ectropis obliqua picorna-like virus, Encephalomyocarditis virus, Drosophila C Virus, Human coxsackievirus B3, Crucifer tobamovirus, Cricket paralysis virus, Bovine viral diarrhea virus 1, Black Queen Cell Virus, Aphid lethal paralysis virus, Avian encephalomyelitis virus, Acute bee paralysis virus, Hibiscus chlorotic ringspot virus, Classical swine fever virus, Human FGF2, Human SFTPAI, Human AMLI / RUNXI, Drosophila antennapedia, Human AQP4, Human ATIR, Human BAG-I, Human BCL2, Human BiP, Human c-IAPl, Human c-myc, Human eIF4G, Mouse NDST4L, Human LEFI, Mouse HIFI alpha, Human n.myc, Mouse Gtx, Human p27kipl, Human PDGF2 / c-sis, Human p53, Human Pim-I, Mouse Rbm3, Drosophila reaper, Canine Scamper, Drosophila Ubx, Human UNR, Mouse UtrA, Human VEGF-A, Human XIAP, Drosophila hairless, S. cerevisiae TFIID, S. cerevisiae Y API, tobacco etch virus, turnip crinkle virus, EMCV-A, EMCV-B, EMCV-Bf, EMCV-Cf, EMCV pEC9, Picobirnavirus, HCV QC64, Human Cosavirus EID, Human Cosavirus F, Human Cosavirus JMY, Rhinovirus NAT00I, HRV14, HRV89, HRVC-02, HRV-A21, Salivirus A SHI, Salivirus FHB, Salivirus NG-JI, Human Parechovirus 1, Crohivirus B, Y c-3, Rosavirus M-7, Shanbavirus A, Pasivirus A, Pasivirus A 2, Echovirus El 4, Human Parechovirus 5, Aichi Virus, Hepatitis A Virus HA16, Phopivirus, CVAI0, Enterovirus C, Enterovirus D, Enterovirus J, Human Pegivirus 2, GBV-C GTI 10, GBV-C Kl 737, GBV-C Iowa, Pegivirus A 1220, Pasivirus A 3, Sapelovirus, Rosavirus B, Bakunsa Virus, Tremovirus A, Swine Pasivirus 1, PLV-CHN, Pasivirus A, Sicinivirus, Hepacivirus K, Hepacivirus A, BVDVl, Border Disease Virus, BVDV2, CSFV-PK15C, SF573 Dicistrovirus, Hubei Picorna-like Virus, CRPV, Apodemus, Apodemus Agrarius Picornavirus, Caprine Kobuvirus, Canine Kobuvirus, Mouse Kobuvirus, Parabovirus, Salivirus A BN5, Salivirus A BN2, Salivirus A 02394, Salivirus A GUT, Salivirus A CH, Salivirus A SZl, Salivirus FHB, CVB3, CVBl, Echovirus 7, CVB5, EVA71, CVA3, CVA12, or EV24.

[0164] In some embodiments, the IRES that can be included in a circular RNA is a Type 1 IRES.

[0165] In some embodiments, the IRES that can be included in a circular RNA is a viral IRES sequence.Attorney Docket No: ORB-014WO1

[0166] In some embodiments, the IRES is an enterovirus IRES. In some embodiments, the IRES is a human rhinovirus (HRV) IRES.

[0167] In some embodiments, the IRES that can be included in a circular RNA is a non- viral IRES sequence, including but not limited to IRES sequences from yeast, the human angiotensin II type 1 receptor IRES, fibroblast growth factor IRESs (e.g., FGF-1 IRES and FGF-2 IRES), vascular endothelial growth factor IRES, and insulin-like growth factor 2 IRES.

[0168] In some embodiments, the IRES that can be included in a circular RNA is a synthetic IRES sequence. A “synthetic IRES” is an IRES that is modified relative to a wild- type IRES in order to modulate its structure and / or activity. For example, in some embodiments, an IRES that is modified to incorporate an aptamer sequence is a synthetic IRES.

[0169] In some embodiments, the IRES sequence in the circular RNA comprises at least one RNA secondary structure element or feature.

[0170] The IRES may be of any length or size. For example, the IRES may be about 100 nucleotides to about 1,000 nucleotides in length (e.g., about 150, about 200, about 225, about 250, about 275, about 300, about 325, about 350, about 375, about 400, about 425, about 450, about 475, about 500, about 525, about 550, about 575, about 600, about 625, about 650, about 675, about 700, about 750, about 800, about 850, or about 900 nucleotides in length, or a range defined by any two of the foregoing values). In some embodiments, the IRES may be about 200 nucleotides to about 800 nucleotides in length (e.g., about 150, about 200, about 210, about 220, about 240, about 260, about 280, about 320, about 340, about 360, about 380, about 420, about 440, about 460, about 480, about 500, about 520, about 540, about 560, about 580, about 600, about 620, about 640, about 660, about 680, about 700, about 720, about 740, about 760, about 780, or about 800 nucleotides in length, or a range defined by any two of the foregoing values). In some embodiments, the IRES may be about 200 to about 400, about 400 to about 600, about 600 to about 700, or about 600 to about 800 nucleotides in length. In some embodiments, the IRES is about 210 nucleotides in length. In some embodiments, the IRES may be about 100 to about 3,000 nucleotides in length.

[0171] In some embodiments, the IRES sequence may be operably linked to a protein- coding sequence. Different IRES elements (and exonic elements in general) affect the strength of protein expression as well as the cell / tissue specificity. Selection of an IRES element depends on the purpose of protein expression.Attorney Docket No: ORB-014WO1

[0172] In some embodiments, the IRES is “in-frame” with respect to the protein-coding nucleic acid sequence, that is, the IRES is positioned in the circular RNA molecule in the correct reading frame for the encoded protein. In other embodiments, the IRES may be “out of frame” with respect to the protein-coding nucleic acid sequence, such that the position of the IRES disrupts the open reading frame (ORF) of the protein-coding nucleic acid sequence. In other embodiments, the IRES may overlap with one or more ORFs of the protein-coding nucleic acid sequence. 3’ UTR

[0173] In some embodiments, the nucleic acid molecule provide herein comprises 3’ UTR. In some embodiments, the 3’ UTR is also a 3’ spacer sequence. There is a growing body of evidence about the regulatory roles played by the UTRs in terms of stability of the nucleic acid molecule and translation. The regulatory features of a UTR can be incorporated into the nucleic acid molecules and circular RNAs made from the nucleic acid constructs. The specific features can also be incorporated to ensure controlled down-regulation of the transcript in case they are misdirected to undesired organ sites.

[0174] The 3’ UTR may be derived from human beta-globin, human alpha-globin, xenopus beta-globin, xenopus alpha-globin.

[0175] In some embodiments, the nucleic acid molecule comprises an additional 3’ spacer sequence at 3’ end of 3’ UTR.

[0176] In some embodiments, the 3’ UTR sequence comprises a 3’ inner homology element at the 3’ end of the 3’ UTR. In other embodiments, a 3’ inner homology element is added downstream of the 3’ UTR. The 3’ inner homology element pairs with the inner homology element in the 5’ spacer. In some embodiments, the 3’ internal homology element is about 5-50 nucleotides in length. In some embodiments, the 3’ inner homology element is 5-30 nucleotides in length. In some embodiments, the 3’ internal homology region is about 10-25 nucleotides in length. In some embodiments, the 3’ inner homology element has the same length as the inner homology element in the 5’ spacer. In some embodiments, the inner homology element is 10, 15, 20, or 25 nucleotides in length. In some embodiments, the 3’ inner homology element is at least 75%, 80%, 85%, 90%, 95%, or 100% complementary to the inner homology element in the 5’ spacer.

[0177] In some embodiments, the nucleic acid molecule does not include inner homology elements.Attorney Docket No: ORB-014WO1 Homology arms

[0178] As discussed herein, the inventors generated four different embodiments of RNA constructs (as shown in FIG. 3A- 3D). The inventors of the present disclosure found that, in some embodiments, the nucleic acid molecule that does not include 5’ or 3’ homology arm (HA) had higher circularization efficiency. As used herein, the terms “homology arm” and “outer homology element (OHE)” are used interchangeably. A 5’ homology arm (HA) is also referred to a 5’ outer homology element (OHE). A 3’ homology arm (HA) is also referred to a 3’ outer homology element (OHE). The results indicated that 5’ and 3’ homology arms (i.e., outer homology elements (OHEs) are not necessarily required for RNA circularization.

[0179] Homology arms are complementary sequences (e.g., 10-50 nucleotides) that pair with each other at the ends of a linear nucleic acid (e.g., a linear precursor mRNA). The 5’ homology arm is located at the 5’ end of the upstream intron sequence (i.e., before and adjacent to or within the upstream intron sequence). The 3’ homology arm is located at the 3’ end of the downstream intron sequence (i.e., after and adjacent to or within the downstream intron sequence). Though it has been reported that 5’ and 3’ homology arms are required for RNA circularization, the present disclosure demonstrates that, surprisingly, a nucleic acid construct that does not include 5’ or 3’ homology arm had increased circularization efficiency.

[0180] In some embodiments, the nucleic acid molecule comprises, from the 5’ to 3’ end, an upstream intron sequence corresponding to a 3’ splicing fragment of the T4td intron of SEQ ID NO: 1, a 5’ spacer comprising a 5’ inner homology element, optionally an IRES, a RNA sequence of interest, a 3’UTR, a 3’ inner homology element, and a downstream intron sequence corresponding to the 5’ splicing fragment of T4td intron of SEQ ID NO: 1, wherein the nucleic acid molecule does not comprise 5’ or 3’ homology arm. As a non-limiting example, the 5’ inner homology element comprises the sequence of accacacaaatggtcgccga, and the 3’ inner homology element comprises its complementary sequence. RNA sequence of interest

[0181] The circular RNAs and nuclei acid molecules for making circular RNAs comprise a sequence of interest, i.e., a nucleic acid sequence element with a biological function, including but not limited to encoding a polypeptide of interest, a CAR, a regulatory element of gene expression, a therapeutic nucleic acid molecule, and a guide RNA, etc. In some embodiments, the sequence of interest may comprise two or more biological functions.Attorney Docket No: ORB-014WO1 Accordingly, the circular RNAs may be bifunctional. As the name implies, bifunctional circular RNAs are those having or capable of at least two functions. These molecules may also by convention be referred to as multi-functional (e.g., have more than two functions). Protein of interest

[0182] In some embodiments, the sequence of interest encodes a polypeptide of interest (i.e., a protein of interest). In some embodiments, the sequence of interest may encode two or more polypeptides. The two or more polypeptides may have the same amino acid sequences; alternatively, the two or more polypeptides may have different amino acid sequences. The polypeptide of interest may be one known in the art and / or described herein. In this context, the circular RNA may act as a messenger RNA (mRNA), having the same encoding function as its liner mRNA counterpart.

[0183] A polypeptide of interest may include, but is not limited to, whole polypeptides, a plurality of polypeptides or fragments of polypeptides, which independently may be encoded by one or more nucleic acids, a plurality of nucleic acids, fragments of nucleic acids or variants of any of the aforementioned. As used herein, the term “polypeptides of interest” refer to any polypeptide which is selected to be encoded in the primary construct of the present disclosure. As used herein, “polypeptide” means a polymer of amino acid residues (natural or unnatural) linked together most often by peptide bonds. The term, as used herein, refers to proteins, polypeptides, and peptides of any size, structure, or function. In some instances, the polypeptide encoded is smaller than about 50 amino acids and the polypeptide is then termed a peptide. If the polypeptide is a peptide, it will be at least about 2, 3, 4, or at least 5 amino acid residues long. Thus, polypeptides include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing. A polypeptide may be a single molecule or may be a multi-molecular complex such as a dimer, trimer or tetramer. They may also comprise single chain or multichain polypeptides such as antibodies or insulin and may be associated or linked. Most commonly disulfide linkages are found in multichain polypeptides. The term polypeptide may also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid.

[0184] The term “polypeptide variant” refers to molecules which differ in their amino acid sequence from a native or reference sequence. The amino acid sequence variants may possess substitutions, deletions, and / or insertions at certain positions within the amino acid sequence,Attorney Docket No: ORB-014WO1 as compared to a native or reference sequence. Ordinarily, variants will possess at least about 50% identity (homology) to a native or reference sequence, and preferably, they will be at least about 80%, more preferably at least about 90% identical (homologous) to a native or reference sequence.

[0185] In general, the coding nucleic acid sequence may be sufficient to encode a polypeptide of at least 10 amino acids in length, e.g., 10 to 5000 amino acids in length, or 10- 1000 amino acids in length, or 50-2000 amino acids in length, or 30-3000 amino acids in length, or 100-1000 amino acids in length, or 100-3000 amino acids in length, or 200-1000 amino acids in length, or 200-500 amino acids in length, or 500-5000 amino acids in length, or 500-4000 amino acids in length, or 500-1500 amino acids in length, or 1000-5000 amino acids in length.

[0186] Generally, the coding nucleic acid sequence element may be greater than 30 nucleotides in length, e.g., at least or greater than about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1, 100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2250, 2,500, and 3,000, 3,500, 4,000, 4,500, 5,000, 5,500, 6,000, 6,500, 7,000, 7,500, 8,000, 8,500, 9,000, 9,500, 10,000, 20,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000 or up to and including 100,000 nucleotides.

[0187] In some embodiments, the sequence of interest may encode a therapeutic protein or polypeptide. The therapeutic protein may be an enzyme, a replacement therapy protein, etc. According to the present disclosure, one or more therapeutic proteins or peptides currently being marketed or in development may be encoded by the circular RNAs of the present disclosure.

[0188] In some embodiments, the therapeutic polypeptide is a recombinant or chimeric polypeptide. As a non-limiting example, the recombinant polypeptide is a chimeric antigen receptor (CAR).

[0189] In some embodiments, the therapeutic polypeptide is a cytokine (e.g., IFNg, IL2, IL7, IL12, IL15, IL21, IL27 etc.)

[0190] In some embodiments, the therapeutic polypeptide is a transcription factor.

[0191] In some embodiments, the sequence of interest may encode an antigen of interest. The antigen may be an antigen that causes infection such as a viral antigen, a fungal antigen and a bacterial antigen. The antigen may also be a cancer antigen such as a neoantigen and an antigen that is specific or associated with a cancer (e.g., a tumor associated antigen (TAA)).Attorney Docket No: ORB-014WO1

[0192] As used herein, a “neoantigen” refers to a class of tumor antigens which arises from tumor-specific mutations in an expressed protein.

[0193] In some embodiments, the encoded polypeptide may be an antibody, a heavy chain of an antibody, a light chain of an antibody, a variable region of a heavy chain of an antibody, a variable region of a light chain of an antibody, a Fab fragment, and the like.

[0194] As used herein, the term “antibody” is referred to in the broadest sense and specifically covers various embodiments including, but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies formed from at least two intact antibodies), and antibody fragments (e.g., diabodies) so long as they exhibit a desired biological activity (e.g., “functional”). Antibodies are primarily amino acid-based molecules but may also comprise one or more modifications (including, but not limited to the addition of sugar moieties, fluorescent moieties, chemical tags, etc.). Non-limiting examples of antibodies or fragments thereof include VH and VL domains, scFvs, Fab, Fab’, F(ab’)2, Fv fragment, diabodies, linear antibodies, single chain antibody molecules, multispecific antibodies, bispecific antibodies, intrabodies, monoclonal antibodies, polyclonal antibodies, humanized antibodies, codon-optimized antibodies, tandem scFv antibodies, bispecific T-cell engagers, mAb2 antibodies, chimeric antigen receptors (CAR), tetravalent bispecific antibodies, biosynthetic antibodies, native antibodies, miniaturized antibodies, unibodies, maxibodies, antibodies to senescent cells, antibodies to conformers, antibodies to disease specific epitopes, or antibodies to innate defense molecules.

[0195] As used herein, the term “monoclonal antibody” refers to an antibody obtained from a population of substantially homogeneous cells (or clones), i.e., the individual antibodies comprising the population are identical and / or bind the same epitope, except for possible variants that may arise during production of the monoclonal antibodies, such variants generally being present in minor amounts. In contrast to polyclonal antibody preparations that typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen.

[0196] The modifier “monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies and is not to be construed as requiring production of the antibody by any particular method. The monoclonal antibodies herein include "chimeric" antibodies (immunoglobulins) in which a portion of the heavy and / or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous toAttorney Docket No: ORB-014WO1 corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies.

[0197] As used herein the term, “antibody fragment” refers to any portion of an intact antibody. In some embodiments, antibody fragments comprise antigen binding regions from intact antibodies. Examples of antibody fragments may include, but are not limited to Fab, Fab', F(ab')2, and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules; and multispecific antibodies formed from antibody fragments. Papain digestion of antibodies produces two identical antigen-binding fragments, called "Fab" fragments, each with a single antigen-binding site. Also produced is a residual "Fc" fragment, whose name reflects its ability to crystallize readily. Pepsin treatment yields an F(ab')2fragment that has two antigen-binding sites and is still capable of cross-linking antigen. Compounds and / or compositions of the present invention may comprise one or more of these fragments. For the purposes herein, an "antibody" may comprise a heavy and light variable domain as well as an Fc region.

[0198] As used herein, the term “antibody variant” refers to a biomolecule resembling an antibody in structure and / or function comprising some differences in their amino acid sequence, composition or structure as compared to a native antibody.

[0199] In some embodiments, the polypeptides of interest encoded may also include but are not limited to, biologics, cell penetrating peptides, secreted proteins, plasma membrane proteins, cytoplasmic or cytoskeletal proteins, intracellular membrane bound proteins, nuclear proteins, proteins associated with human disease, targeting moieties or those proteins encoded by the human genome for which no therapeutic indication has been identified but which nonetheless have utility in areas of research and discovery. As used herein, a “biologic” is a polypeptide-based molecule produced by the methods provided herein and which may be used to treat, cure, mitigate, prevent, or diagnose a serious or life-threatening disease or medical condition.

[0200] In some embodiments, the polypeptide of interest is a recombinant protein. In some cases, the recombinant protein is a chimeric antigen receptor (CAR). The CAR comprises an antigen binding domain, a hinge, a transmembrane domain and at least one intracellular signaling domain. In some embodiments, the CAR comprises an antigen binding domain, a hinge, a transmembrane domain, at least one co-stimulating signaling domain and an activation signaling domain.

[0201] The antigen binding domain of the CAR recognizes cellular antigen. Numerous antigen binding domains are known in the art, including those based on the antigen bindingAttorney Docket No: ORB-014WO1 site of an antibody, antibody mimetics and T cell receptors. In some embodiments, the antigen binding domain is ab antigen binding fragment derived from an antibody specific to an antigen of interest. Such as a single-chain variable fragment (scFv) and a single domain antibody VHH.

[0202] In some embodiments, the antigen binding domain recognizes a tumor antigen, such as CD19, CD20, CD22, BCMA and other tumor associated antigens.

[0203] The hinge region (also known as spacer or linker region) is a region with the CAR to connect the antigen binding domain with the transmembrane domain and spatially separate the antigen-binding domain from the intracellular domains within the CAR. A flexible hinge allows the antigen-binding domain to orient in different directions to facilitate binding and effective formation of the CAR-antigen complex. The hinge domain may comprise about 20- 100 amino acids in length. In some embodiments, the hinge domain comprises at least 25, 30, 35, 40, 45, 50, or 60 amino acids. In some embodiments, the hinge domain comprises a sequence derived from an IgG Fc region (e.g., CH1, CH2 and / or CH3 regions), an IgG hinge or CD8 stalk region.

[0204] The transmembrane domain of the CAR may be any protein structure which is thermodynamically stable in a membrane. The transmembrane domain of any transmembrane protein can be used to supply the transmembrane portion of the CAR described herein. As non-limiting examples, the CAR comprises a transmembrane domain derived from CD28, CD3ζ, CD3 epsilon, CD3 gamma, CD3 delta, CD45, CD2, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD 134, CD137 / 4-1BB, CD154, ICOS / CD278, GITR / CD357, or NKG2D.

[0205] The intracellular portion of the CAR comprises at least one co-stimulatory domain and an activation signaling domain. In some embodiments, the intracellular activation signaling domain is derived from CD3 zeta.

[0206] In some embodiments, one or more costimulatory signaling domains are inserted between the transmembrane domain and the CD3zeta intracellular domain. The costimulatory domain may be derived from, but not limited to, CD28, OX40, CD27, 4-1BB / CD137, CD2, CD7, CD30, CD40, programmed death-1 (PD-1), inducible T cell costimulator (ICOS), CD8 gamma, CD3 delta, CD3 epsilon, CD247, CD276 (B7-H3), LIGHT (tumor necrosis factor superfamily member 14; TNFSF1.4), NKG2C, Ig alpha (CD79a), Fc gamma receptor, MHC class I molecule, TNF receptor proteins, Immunoglobulin-like proteins, cytokine receptors, integrins, signaling lymphocytic activation molecules (SLAM proteins), activating NK cellAttorney Docket No: ORB-014WO1 receptors, BTLA, a Toll ligand receptor, ICAM-1, B7-H3, CDS, ICAM-1, GITR, BAFFR, LIGHT, HVEM (LIGHTR), KIRDS2, SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD 19, CD4, CD8alpha, CD8beta, 11.2 beta, IL2R gamma, IL7R alpha, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, ITGAE, CD103, ITGAL, LFA-1, ITGAM, ITGAX, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, NKG2D, TNFR2, TRANCE RANKL, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 or CD83. Non-coding functional sequences

[0207] In some embodiments, the circular RNAs and nucleic acid molecules for making circular RNAs described herein may comprise one or more nucleic acid sequences of interest that have a regulatory function, i.e., the sequence is a non-coding sequence but has a biological function and / or activity (e.g., non-coding functions), e.g., interactions with other types of non-coding RNA molecules, primarily microRNAs, long noncoding RNAs, and RNA‐binding proteins.

[0208] In one embodiment, the circular RNA of the present disclosure comprises a nucleic acid sequence acting as a miRNA sponge, which competes endogenous RNA. As used herein, the term “miRNA sponge” refers to a circular polynucleotide comprising a single-stranded non-coding polynucleotide with repeat copies of at least one specific microRNA binding site to hold microRNA molecules of interest. The miRNA sponge acts as an artificial microRNA inhibitor, when expressed in a cell, would decrease the cellular level of the microRNA of interest.

[0209] The miRNA sponge sequence may comprise at least one miRNA response element (MRE) that binds to a miRNA and negatively regulates its activity. As used herein, the term “miRNA response element (MRE)” refers to a target site (i.e., a short nucleic acid fragment) that binds to a miRNA. In some embodiments, the circular polynucleotide may comprise two or more MREs. The number of MREs in the circular polynucleotide is variable and relates to the length of the circular polynucleotide. As non-limiting examples, the circular polynucleotide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10 or more MREs. The multiple MREs may have the same nucleic acid sequences and bind to the same miRNA; or alternatively, the MREs have different nucleic acid sequences and bind to different miRNAs, such as 2, 3, 4, 5, or more different miRNAs.

[0210] In some embodiments, the miRNA sponge sequence may comprise 1-150 conserved miRNA target sites to bind to a miRNA to sponge the miRNA, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,Attorney Docket No: ORB-014WO1 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 95, 100, or 150 miRNA target sites to sponge the miRNA.

[0211] In some embodiments, the circular RNA described herein may regulate more than one miRNA, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more miRNAs.

[0212] The circular RNA described herein may be used to affect target miRNA activities, i.e., by acting as miRNAs sponge, circular RNAs may down-regulate miRNA activity and / or up-regulate the expression of miRNA target genes.

[0213] In some embodiments, the circular RNA comprises a nucleic acid sequence that binds to one or more RNA binding proteins (RBPs) acting as a protein sponge.

[0214] In some embodiments, the circular RNA comprises a nucleic acid sequence that interacts with one or more protein to enhance protein function.

[0215] In some embodiments, the circular RNA comprises a nucleic acid sequence that acts as scaffold to mediate complex formation between specific enzymes and substrates.

[0216] In some embodiments, the circular RNA comprises a nucleic acid sequence that binds to one or more protein to recruit proteins to specific locations.

[0217] In some embodiments, the circular RNA may comprise one or more long noncoding RNA (lncRNA, or lincRNA), a small nucleolar RNA (sno-RNA), microRNA (miRNA), small interfering RNA (siRNA) or Piwi-interacting RNA (piRNA) and / or a portion thereof.

[0218] These functional non-coding sequences may be included in the circular RNA alone and used for their functions. Alternatively, these functional non-coding sequences may be included in the circular RNA encoding a polypeptide of interest. Signaling nucleotides

[0219] In some embodiments, the circular RNAs and nucleic acid molecules for making circular RNAs may also encode additional features which may facilitate the trafficking of the polypeptides to therapeutically relevant sites. One such feature which aids in protein trafficking is the signal sequence. As used herein, a “signal sequence” or “signal peptide” is a polynucleotide or polypeptide, respectively, which is from about 9 to 200 nucleotides (3-60 amino acids) in length which is incorporated at the 5' terminus of the coding region or the N- terminus polypeptide encoded, respectively. In some embodiments, addition of these sequences results in trafficking of the encoded polypeptide to the endoplasmic reticulumAttorney Docket No: ORB-014WO1 through one or more secretory pathways. Some signal peptides are cleaved from the protein by signal peptidase after the proteins are transported.

[0220] As described herein, the circular RNAs may comprise regions that partially or substantially not translatable, e.g., having a noncoding region. Such noncoding regions are different from the non-coding functional sequences and may located in any region of the circular RNA. Those non-coding regions include but are not limited to the linker, the spacer and / or the flanking regions. The noncoding regions may locate in more than one region of the circular RNA. Constructs and vectors

[0221] In some embodiments, the nucleic acid molecule described herein is a DNA construct. The construct comprises an upstream intron sequence and a downstream intron sequence which flanks exonic sequence (e.g., a protein coding RNA sequence).

[0222] In some embodiment, viral vectors may be used to package the constructs for making circular RNAs. The viral vectors may be AAV vectors.

[0223] In other embodiments, the construct is non-viral vector. Exemplary non-viral vectors may include plasmids, cosmids and artificial chromosomes.

[0224] In some embodiments, the construct includes from about 30 to about 100,000 nucleotides (e.g., from 30 to 50, from 30 to 100, from 30 to 250, from 30 to 500, from 30 to 1,000, from 30 to 1,500, from 30 to 3,000, from 30 to 5,000, from 30 to 7,000, from 30 to 10,000, from 30 to 25,000, from 30 to 50,000, from 30 to 70,000, from 100 to 250, from 100 to 500, from 100 to 1,000, from 100 to 1,500, from 100 to 3,000, from 100 to 5,000, from 100 to 7,000, from 100 to 10,000, from 100 to 25,000, from 100 to 50,000, from 100 to 70,000, from 100 to 100,000, from 500 to 1,000, from 500 to 1,500, from 500 to 2,000, from 500 to 3,000, from 500 to 5,000, from 500 to 7,000, from 500 to 10,000, from 500 to 25,000, from 500 to 50,000, from 500 to 70,000, from 500 to 100,000, from 1,000 to 1,500, from 1,000 to 2,000, from 1,000 to 3,000, from 1,000 to 5,000, from 1,000 to 7,000, from 1,000 to 10,000, from 1,000 to 25,000, from 1,000 to 50,000, from 1,000 to 70,000, from 1,000 to 100,000, from 1,500 to 3,000, from 1,500 to 5,000, from 1,500 to 7,000, from 1,500 to 10,000, from 1,500 to 25,000, from 1,500 to 50,000, from 1,500 to 70,000, from 1,500 to 100,000, from 2,000 to 3,000, from 2,000 to 5,000, from 2,000 to 7,000, from 2,000 to 10,000, from 2,000 to 25,000, from 2,000 to 50,000, from 2,000 to 70,000, and from 2,000 to 100,000 nucleotides.Attorney Docket No: ORB-014WO1

[0225] The constructs and vectors provided herein can be made using standard techniques of molecular biology. For example, the various elements of the vectors provided herein can be obtained using recombinant methods, or by deriving the polynucleotides from a vector known to include the same. The various elements of the vectors provided herein can also be produced synthetically, rather than cloned, based on the known sequences. The complete sequence can be assembled from overlapping oligonucleotides prepared by standard methods and assembled into the complete sequence. Linear RNA

[0226] In some embodiments, the nucleic acid molecules described herein are linear RNA (e.g., a linear mRNA). The linear RNA can be circularized in vitro or in vivo to produce a circular RNA.

[0227] In some embodiments, the linear RNA is synthesized by in vitro transcription (IVT) of a DNA construct described herein. For example, the linear RNA can be generated by incubating a vector described herein under conditions permissive of transcription of the precursor RNA encoded by the vector. In some embodiments, a linear RNA is synthesized by incubating a vector described herein that comprises an RNA polymerase promoter upstream of the upstream intron sequence and / or expression sequences with a compatible RNA polymerase enzyme under conditions permissive of in vitro transcription. In some embodiments, the vector is incubated inside of a cell by a bacteriophage RNA polymerase or in the nucleus of a cell by host RNA polymerase II.

[0228] In some embodiments, the resulting linear RNA can be used to generate circular RNA by incubating it in the presence of magnesium ions and guanosine nucleotide or nucleoside at a temperature at which RNA circularization occurs (e.g., between 30 °C and 60 °C). Circular RNAs

[0229] In accordance with the present disclosure, provided herein include circular RNAs. The circular RNA can be made from a nucleic acid molecule described herein. In some embodiments, the circular RNA is synthesized by the Group I or II intron sequences mediated self-splicing of the nucleic acid molecule described herein. For an example, an IVT linear RNA polynucleotide is circularized to produce the circular RNA. In some embodiments, the circular RNA comprises a portion of upstream intron fragment and a portion of downstreamAttorney Docket No: ORB-014WO1 intron fragment. In some embodiments, the portion of upstream intron fragment and / or the portion of downstream intron fragment optionally comprises an exon fragment.

[0230] In some embodiments, the circular RNA of the present disclosure has increased stability in vivo.

[0231] In some embodiments, the circular RNA of the present disclosure has reduced immunogenicity.

[0232] In some embodiments, the circular RNA of the present disclosure has enhanced translation efficiency. In some embodiments, the circular RNA has a translation efficiency at least at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 150%, at least 2 fold, at least 3 fold, at least 4 fold, at least 5 fold, at least 6 fold, at least 7 fold, at least 8 fold, at least 9 fold, at least 10 fold, at least 15 fold, at least 20 fold, at least 25 fold, at least 30 fold, at least 35 fold, at least 40 fold, at least 45 fold, at least 50 fold, at least 55 fold, at least 60 fold, at least 65 fold, at least 70 fold, at least 75 fold, at least 80 fold, at least 85 fold, at least 90, at least 95 fold, or at least 100 fold greater than a linear RNA counterpart. Modifications

[0233] Modifications may be introduced into the circular RNAs and nucleic acid molecules described herein. The circular RNAs of the present disclosure may include one, two, three, or more modifications. The modifications may be various distinct modifications. In some embodiments, the modifications may locate at various regions and fragments of the circular RNAs, including but not limited to, the coding region(s), the untranslated region(s), intron sequences, the flanking region(s), and / or the terminal or tailing regions.

[0234] The modifications which render the nucleic acid molecules, when introduced to a cell, more resistant to degradation in the cell and / or more stable in the cell as compared to unmodified polynucleotides. The modifications may also increase the biological functions of nucleic acid molecules as compared to unmodified polynucleotides, such as binding to an RBP or another polynucleotide.

[0235] The modifications may be structural and / or chemical modifications. The chemical modification may be a nucleotide and / or nucleoside modification including a nucleobase modification and / or a sugar modification, and a backbone linkage modification (i.e., the internucleoside linkage, e.g., a linking phosphate, a phosphodiester linkage, and aAttorney Docket No: ORB-014WO1 phosphodiester backbone). The structural modification may include a secondary structural modification, and a tertiary structural modification.

[0236] Modifications according to the present disclosure may be modifications of ribonucleic acids (RNAs) to deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs) or hybrids thereof.

[0237] In some embodiments, one, two, or more (optionally different) nucleoside or nucleotide modifications may be incorporated to the circular RNA. As described herein, “nucleoside” is defined as a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or a pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”). Five primary / canonical nucleobases: adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U) are the fundamental units of nucleic acid molecules, in which adenine and guanine, referred to purine bases, have a fused-ring skeletal structure derived of purine while uracil, and thymine, derived of pyrimidine, are referred to pyrimidine bases. As described herein, “nucleotide” is defined as a nucleoside including a phosphate group or other backbone linkage (internucleoside linkage).

[0238] In some embodiments, the circular RNA comprises at least one modification described herein. In other embodiments, the circular RNA comprises two, three, four, or more (optionally different) chemical modifications described herein. The modifications may be combinations of nucleobase (purine and / or pyrimidine), sugar and backbone (internucleoside) linkage modifications. The modifications may be located on one or more nucleotides of the circular RNA. In some embodiments, all the nucleotides of the circular RNA are chemically modified. In some embodiments, all the nucleotides of the nucleic acid sequence with a biological function are chemically modified.

[0239] The circular RNA described herein may contain from about 1% to about 100% modified nucleotides (either in relation to overall nucleotide content, or in relation to one or more types of nucleotide, i.e. any one or more of A, G, T / U or C) or any intervening percentage (e.g., from 1% to 20%, from 1% to 25%, from 1% to 50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1% to 90%, from 1% to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from 50% to 70%, from 50% to 80%, fromAttorney Docket No: ORB-014WO1 50% to 90%, from 50% to 95%, from 50% to 100%, from 70% to 80%, from 70% to 90%, from 70% to 95%, from 70% to 100%, from 80% to 90%, from 80% to 95%, from 80% to 100%, from 85% to 95%, from 85% to 100%, from 90% to 95%, from 90% to 100%, and from 95% to 100%).

[0240] In some embodiments, the polynucleotides are at least 50% modified, e.g., at least 50% of the nucleotides are modified. In some embodiments, the polynucleotides are at least 75% modified, e.g., at least 75% of the nucleotides are modified. It is to be understood that since a nucleotide (sugar, base and phosphate moiety, e.g., linkage) may each be modified, any modification to any portion of a nucleotide, or nucleoside, will constitute a modification.

[0241] In some embodiments, the polynucleotides are at least 10% modified in only one component of the nucleotide, with such component being the nucleobase, sugar, or linkage between nucleosides. For example, modifications may be made to at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of the nucleobases, sugars, or linkages of a polynucleotide described herein.

[0242] The circular RNA described herein can be designed with a patterned array of sugar, nucleobase or linkage modifications. In some embodiments, the polynucleotides can comprise modifications to maximize stability.

[0243] The modified nucleosides and nucleotides can include a modified nucleobase. Examples of nucleobases in RNA include, but are not limited to, adenine(A), guanine(G), cytosine(C), and uracil(U). Examples of nucleobases in DNA include, but are not limited to, adenine(A), guanine(G), cytosine(C), and thymine(T).

[0244] In some embodiments, the modified nucleobase is a modified uracil(U). Exemplary nucleobases and nucleosides having a modified uracil include pseudouridine (ψ), pyridin-4- one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 4- thio-uridine (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho5U), 5- aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridine (I5U) or 5-bromo-uridine (br5U)), 3- methyl-uridine (m3U), 5-methoxy-uridine (mo5U), uridine 5-oxyacetic acid (cmo5U), uridine 5-oxyacetic acid methyl ester (mcmo5U), 5-carboxymethyl-uridine (cm5U), 1-carboxymethyl- pseudouridine, 5-carboxyhydroxymethyl-uridine (chm5U), 5-carboxyhydroxymethyl-uridine methyl ester (mchm5U), 5-methoxycarbonylmethyl-uridine (mcm5U), 5- methoxycarbonylmethyl-2-thio-uridine (mcm5s2U), 5-aminomethyl-2-thio-uridine (nm5s2U), 5-methylaminomethyl-uridine (mnm5U), 5-methylaminomethyl-2-thio-uridine (mnm5s2U), 5- methylaminomethyl-2-seleno-uridine (mnm5se2U), 5-carbamoylmethyl-uridine (ncm5U), 5- carboxymethylaminomethyl-uridine (cmnm5U), 5-carboxymethylaminomethyl-2-thio-uridineAttorney Docket No: ORB-014WO1 (cmnm5s2U), 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine (τm5U), 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine(τm5s2U), 1-taurinomethyl-4- thio-pseudouridine, 5-methyl-uridine (m5U, i.e., having the nucleobase deoxythymine), 1- methylpseudouridine (m1ψ), 5-methyl-2-thio-uridine (m5s2U), pseudouracil (ψ), 1-methyl-4- thio-pseudouridine (m1s4ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m3ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza- pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyl- dihydrouridine (m5D), 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy- uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio- pseudouridine, N1-methyl-pseudouridine (also known as 1-methylpseudouridine, 3- (3-amino-3-carboxypropyl)uridine (acp3U), 1-methyl-3-(3-amino-3- carboxypropyl)pseudouridine (acp3ψ), 5-(isopentenylaminomethyl)uridine (inm5U), 5- (isopentenylaminomethyl)-2-thio-uridine (inm5s2U), α-thio-uridine, 2′-O-methyl-uridine (Um), 5,2′-O-dimethyl-uridine (m5Um), 2′-O-methyl-pseudouridine (ψm), 2-thio-2′-O- methyl-uridine (s2Um), 5-methoxycarbonylmethyl-2′-O-methyl-uridine (mcm5Um), 5- carbamoylmethyl-2′-O-methyl-uridine (ncm5Um), 5-carboxymethylaminomethyl-2′-O- methyl-uridine (cmnm5Um), 3,2′-O-dimethyl-uridine (m3Um), 5-(isopentenylaminomethyl)- 2′-O-methyl-uridine (inm5Um), 1-thio-uridine, deoxythymidine, 2'‐F‐ara‐uridine, 2'‐F‐ uridine, 2'‐OH‐ara‐uridine, 5‐(2‐carbomethoxyvinyl) uridine, and 5‐[3‐(1‐E‐ propenylamino)uridine.

[0245] In some embodiments, the modified nucleobase is a modified cytosine(C). Exemplary nucleobases and nucleosides having a modified cytosine include 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m3C), N4-acetyl-cytidine (ac4C), 5- formyl-cytidine (f5C), N4-methyl-cytidine (m4C), 5-methyl-cytidine (m5C), 5-halo-cytidine (e.g., 5-iodo-cytidine), 5-hydroxymethyl-cytidine (hm5C), 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine (s2C), 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza- pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5- methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2- methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl- pseudoisocytidine, lysidine (k2C), α-thio-cytidine, 2′-O-methyl-cytidine (Cm), 5,2′-O- dimethyl-cytidine (m5Cm), N4-acetyl-2′-O-methyl-cytidine (ac4Cm), N4,2′-O-dimethyl- cytidine (m4Cm), 5-formyl-2′-O-methyl-cytidine (f5Cm), N4,N4,2′-O-trimethyl-cytidine (m42Cm), 1-thio-cytidine, 2'‐F‐ara‐cytidine, 2'‐F‐cytidine, and 2'‐OH‐ara‐cytidine.Attorney Docket No: ORB-014WO1

[0246] In some embodiments, the modified nucleobase is a modified adenine(A). Exemplary nucleobases and nucleosides having a modified adenine include 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7- deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyl-adenosine (m1A), 2-methyl- adenine (m2A), N6-methyl-adenosine (m6A), 2-methylthio-N6-methyl-adenosine (ms2m6A), N6-isopentenyl-adenosine (i6A), 2-methylthio-N6-isopentenyl-adenosine (ms2i6A), N6-(cis- hydroxyisopentenyl)adenosine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine (ms2io6A), N6-glycinylcarbamoyl-adenosine (g6A), N6-threonylcarbamoyl-adenosine (t6A), N6-methyl-N6-threonylcarbamoyl-adenosine (m6t6A), 2-methylthio-N6-threonylcarbamoyl- adenosine (ms2g6A), N6,N6-dimethyl-adenosine (m62A), N6-hydroxynorvalylcarbamoyl- adenosine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenosine (ms2hn6A), N6- acetyl-adenosine (ac6A), 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, α- thio-adenosine, 2′-O-methyl-adenosine (Am), N6,2′-O-dimethyl-adenosine (m6Am), N6,N6,2′-O-trimethyl-adenosine (m62Am), 1,2′-O-dimethyl-adenosine (m1Am), 2′-O- ribosyladenosine (phosphate) (Ar(p)), 2-amino-N6-methyl-purine, 1-thio-adenosine, 8-azido- adenosine, 2'‐F‐ara‐adenosine, 2'‐F‐adenosine, 2'‐OH‐ara‐adenosine, and N6‐(19‐amino‐ pentaoxanonadecyl)-adenosine.

[0247] In some embodiments, the modified nucleobase is a modified guanine(G). Exemplary nucleobases and nucleosides having a modified guanine include inosine (I), 1- methyl-inosine (m1I), wyosine (imG), methylwyosine (mimG), 4-demethyl-wyosine (imG- 14), isowyosine (imG2), wybutosine (yW), peroxywybutosine (o2yW), hydroxywybutosine (OHyW), undermodified hydroxywybutosine (OHyW*), 7-deaza-guanosine, queuosine (Q), epoxyqueuosine (oQ), galactosyl-queuosine (galQ), mannosyl-queuosine (manQ), 7-cyano-7- deaza-guanosine (preQ0), 7-aminomethyl-7-deaza-guanosine (preQ1), archaeosine (G+), 7- deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza- guanosine, 7-methyl-guanosine (m7G), 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6- methoxy-guanosine, 1-methyl-guanosine (m1G), N2-methyl-guanosine (m2G), N2,N2- dimethyl-guanosine (m22G), N2,7-dimethyl-guanosine (m2,7G), N2, N2,7-dimethyl-guanosine (m2,2,7G), 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2- methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, α-thio-guanosine, 2′-O-methyl- guanosine (Gm), N2-methyl-2′-O-methyl-guanosine (m2Gm), N2,N2-dimethyl-2′-O-methyl- guanosine (m22Gm), 1-methyl-2′-O-methyl-guanosine (m1Gm), N2,7-dimethyl-2′-O-methyl-Attorney Docket No: ORB-014WO1 guanosine (m2,7Gm), 2′-O-methyl-inosine (Im), 1,2′-O-dimethyl-inosine (m1Im), and 2′-O- ribosylguanosine (phosphate) (Gr(p)).

[0248] In some embodiments, the nucleobase of the nucleotide can be independently selected from a purine, a pyrimidine, a purine or pyrimidine analog. The nucleobase and / or analog may be each be independently selected from adenine, cytosine, guanine, uracil, naturally-occurring and synthetic derivatives of a base, including but not limited to pyrazolo[3,4-d]pyrimidines, 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2- thiothymine and 2-thiocytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo (e.g., 8-bromo), 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5- bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, deazaguanine, 7-deazaguanine, 3- deazaguanine, deazaadenine, 7-deazaadenine, 3-deazaadenine, pyrazolo[3,4-d]pyrimidine, imidazo[1,5-a]1,3,5 triazinones, 9-deazapurines, imidazo[4,5-d]pyrazines, thiazolo[4,5- d]pyrimidines, pyrazin-2-ones, 1,2,4-triazine, pyridazine; and 1,3,5 triazine.

[0249] The circular polynucleotide of the present disclosure may comprise a nucleoside modification. One or more atoms of a pyrimidine nucleobase may be replaced or substituted, for example, with optionally substituted amino, optionally substituted thiol, optionally substituted alkyl (e.g., methyl or ethyl), optionally substituted or halo (e.g., chloro or fluoro) atoms or groups.

[0250] As non-limiting examples, the uracil nucleosides of the circular RNA described herein are all modified. The modifications may be the same or different. In some embodiments, the guanine nucleosides of the circular polynucleotide of the present disclosure are all modified. The modifications may be the same or different. In some embodiments, the guanine nucleosides of the circular polynucleotide of the present disclosure are all modified. The modifications may be the same or different. In some embodiments, the cytosine nucleosides of the circular polynucleotide of the present disclosure are all modified. The modifications may be the same or different. In some embodiments, the adenine nucleosides of the circular polynucleotide of the present disclosure are all modified. The modifications may be the same or different.

[0251] In one embodiment of the disclosure, the circular RNA described herein is modified to comprise N6-methyladenosine (m6A) nucleotides.Attorney Docket No: ORB-014WO1

[0252] Modifications of the modified nucleosides and nucleotides can be present in the sugar subunit. In some embodiments, the circular RNA described herein comprises at least one sugar modification. Generally, RNA includes the sugar subunit: ribose, which is a 5- membered ring having an oxygen atom.

[0253] In one example, the 2’ hydroxyl group (OH) can be modified or replaced with a number of different substituents. Exemplary substitutions at the 2′OH-position include, but are not limited to, H, halo, optionally substituted C1-6 alkyl; optionally substituted C1-6 alkoxy; optionally substituted C6-10 aryloxy; optionally substituted C3-8 cycloalkyl; optionally substituted C3-8 cycloalkoxy; optionally substituted C6-10 aryloxy; optionally substituted C6-10 aryl-C1-6 alkoxy, optionally substituted C1-12 (heterocyclyl)oxy; a sugar (e.g., ribose, pentose, or any described herein); a polyethyleneglycol (PEG)- O(CH2CH2O)nCH2CH2OR, where R is H or optionally substituted alkyl, and n is an integer from 0 to 20 (e.g., from 0 to 4, from 0 to 8, from 0 to 10, from 0 to 16, from 1 to 4, from 1 to 8, from 1 to 10, from 1 to 16, from 1 to 20, from 2 to 4, from 2 to 8, from 2 to 10, from 2 to 16, from 2 to 20, from 4 to 8, from 4 to 10, from 4 to 16, and from 4 to 20); and “locked” nucleic acids (LNA) in which the 2′-hydroxyl is connected by a C1-6 alkylene or C1-6 heteroalkylene bridge to the 4’-carbon of the same ribose sugar, where exemplary bridges include methylene, propylene, ether, or amino bridges; aminoalkyl; aminoalkoxy; amino; and amino acid.

[0254] Other exemplary sugar modifications include replacement of the oxygen atom (O) in ribose (e.g., with S, Se, or alkylene, such as methylene or ethylene); addition of a double bond (e.g., to replace ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., to form a 6- or 7-membered ring having an additional carbon or heteroatom, such as for anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino that also has a phosphoramidate backbone); multicyclic forms (e.g., tricyclo; and “unlocked” forms, such as glycol nucleic acid (GNA) (e.g., R-GNA or S-GNA, where ribose is replaced by glycol units attached to phosphodiester bonds), threose nucleic acid (TNA, where ribose is replace with α-L-threofuranosyl-(3′→2′)) , and peptide nucleic acid (PNA, where 2-amino-ethyl- glycine linkages replace the ribose and phosphodiester backbone).

[0255] The sugar subunit can also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose. Thus, polynucleotides as described herein, including circRNAs, can include nucleotides containing, e.g., arabinose, as the sugar.Attorney Docket No: ORB-014WO1

[0256] Nonlimiting examples of the sugar modification may include the modifications provided in Table 1. The polynucleotides of the present disclosure can have one or more nucleotides carrying a modification as provided in Table 1. In some embodiments, each of the nucleotides of a polynucleotide described herein carries any one of the modifications as provided in Table 1, or none of the modifications as provided in Table 1. Table 1. Nucleotide Sugar ModificationsAttorney Docket No: ORB-014WO1Attorney Docket No: ORB-014WO1

[0257] In some embodiments, at least one of the 2' positions of the sugar (OH in RNA or H in DNA) of a nucleotide of the polynucleotides is substituted with -O- Methoxyethyl, referred to as 2’-OMe. In some embodiments, at least one of the 2' positions of the sugar (OH in RNA or H in DNA) of a nucleotide of the polynucleotides is substituted with -F, referred to as 2’-F. In some embodiments, the sugar modification can be one or more locked nucleic acids (LNAs). In some embodiments, the polynucleotides can be fully 2’-MOE-sugar modified.Attorney Docket No: ORB-014WO1

[0258] In some embodiments, modifications (e.g., one or more modifications) are present in the internucleoside linkage (the linking phosphate or the phosphodiester linkage or the phosphodiester backbone). In the context of the polynucleotide backbone, the phrases “phosphate” and “phosphodiester” are used interchangeably.

[0259] Backbone phosphate groups can be modified by replacing one or more of the oxygen atoms with a different substituent. Further, the modified nucleosides and nucleotides can include the wholesale replacement of an unmodified phosphate moiety with another internucleoside linkage as described herein. Examples of modified phosphate groups include, but are not limited to, phosphorothioate, methylphosphonates phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters. Phosphorodithioates have both non-linking oxygens replaced by sulfur. The phosphate linker can also be modified by the replacement of a linking oxygen with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene-phosphonates).

[0260] The α-thio substituted phosphate moiety is provided to confer stability to RNA and DNA polynucleotides through the unnatural phosphorothioate backbone linkages. Phosphorothioate DNA and RNA have increased nuclease resistance and subsequently a longer half-life in a cellular environment. Phosphorothioate linked polynucleotide molecules are expected to also reduce the innate immune response through weaker binding / activation of cellular innate immune molecules.

[0261] In some embodiments, the circular RNA described herein comprise at least one phosphorothioate linkage, methylphosphonate linkage between nucleotides, 5’-(E)- vinylphosphonate (5’-E-VP), a phosphate mimic, as a modification.

[0262] The internucleoside linkages of the polynucleotides may be partially or fully modified.

[0263] Modified nucleotides incorporated the circular polynucleotides of the present disclosure may include for example, 2’-O-Methyl-modified or 2’-O-Methoxyethyl-modified nucleotides (2’-OMe and 2’-MOE modifications, respectively), an alpha-thio-nucleoside (e.g., 5′-O-(1-thiophosphate)-adenosine, 5′-O-(1-thiophosphate)-cytidine (α-thio-cytidine), 5′- O-(1-thiophosphate)-guanosine, 5′-O-(1-thiophosphate)-uridine, or 5′-O-(1-thiophosphate)- pseudouridine.

[0264] Additional modifications to the circular RNA described herein include, but are not limited to, any modifications as described in PCT Publication WO2017070626, including, for example, modification or deletion of nucleotides (or codons) encoding one or more N-linkedAttorney Docket No: ORB-014WO1 glycosylation site in a translated polypeptide. Modifications may also comprise any modifications as described in PCT Publication WO2018200892. The circular polynucleotides of the present disclosure may further comprise features or modifications as described in PCT patent application publications WO2020255063, WO2020182869, WO2016011222, WO2016011226, WO2016005004, WO2016000792, WO2015176737, WO2015085318, WO2015048744, and WO2015034925, and United States patent application publications US20200254086, US20200206362, US20180311336 and US20180303929; the contents of each of which are incorporated herein by reference in their entireties.

[0265] Different sugar modifications, nucleobase modifications, and / or internucleoside linkages (e.g., backbone structures) may be introduced at various positions in a polynucleotide described herein. One of ordinary skill in the art will appreciate that the nucleotide analogs or other modification(s) may be located at any position(s) of a polynucleotide such that the function of the polynucleotide is not substantially decreased. Codon optimization

[0266] The circular RNAs and nucleic acid molecules for making circular RNAs, their regions or parts or subregions may be codon optimized. In some embodiments, the coding sequences of the circular RNAs are codon optimized. Codon optimization methods are known in the art and may be useful in efforts to achieve one or more of several goals. These goals include, but are not limited to, match codon frequencies in target and host organisms to ensure proper folding, alter GC content to increase mRNA stability or reduce secondary structures, minimize tandem repeat codons or base runs that may impair gene construction or expression, customize transcriptional and translational control regions, insert or remove protein trafficking sequences, remove / add post translation modification sites in encoded protein (e.g. glycosylation sites), add, remove or shuffle protein domains, insert or delete restriction sites, modify ribosome binding sites and mRNA degradation sites, to adjust translational rates to allow the various domains of the protein to fold properly, or to reduce or eliminate problem secondary structures within the polynucleotide.

[0267] In some embodiments, a codon optimized sequence may be one in which codons in a polynucleotide encoding a polypeptide have been substituted in order to increase the expression, stability and / or activity of the polypeptide. Factors that influence codon optimization include, but are not limited to one or more of: (i) variation of codon biases between two or more organisms or genes or synthetically constructed bias tables, (ii) variation in the degree of codon bias within an organism, gene, or set of genes, (iii)Attorney Docket No: ORB-014WO1 systematic variation of codons including context, (iv) variation of codons according to their decoding tRNAs, (v) variation of codons according to GC %, either overall or in one position of the triplet, (vi) variation in degree of similarity to a reference sequence for example a naturally occurring sequence, (vii) variation in the codon frequency cutoff, (viii) structural properties of mRNAs transcribed from the DNA sequence, (ix) prior knowledge about the function of the DNA sequences upon which design of the codon substitution set is to be based, and / or (x) systematic variation of codon sets for each amino acid.

[0268] In some embodiments, a codon optimized polynucleotide may minimize ribozyme collisions and / or limit structural interference between the expression sequence and the IRES.

[0269] Codon optimization tools, algorithms and services are known in the art, non- limiting examples include, but are not limited to, services from GeneArt (Life Technologies), DNA2.0 (Menlo Park Calif.) and / or proprietary methods. In some embodiments, the coding sequence is optimized using optimization algorithms. Pharmaceutical compositions

[0270] Provided by the present disclosure include compositions such as pharmaceutical compositions comprising at least one circular RNA or nucleic acid molecule for making a circular RNA as described herein. Compositions described herein may be formulated for administration to a particular target cell, a target tissue, or a target organ and / or a subject.

[0271] Pharmaceutical formulations may additionally comprise a pharmaceutically acceptable excipient, which, as used herein, includes, but is not limited to, any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, and the like, as suited to the particular dosage form desired. Various excipients for formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (see Remington: The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro, Lippincott, Williams & Wilkins, Baltimore, MD, 2006; incorporated herein by reference in its entirety). The use of a conventional excipient medium may be contemplated within the scope of the present disclosure, except insofar as any conventional excipient medium may be incompatible with a substance or its derivatives, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutical composition.

[0272] Formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general,Attorney Docket No: ORB-014WO1 such preparatory methods include the step of bringing the active ingredient (e.g., circular RNAs) into association with an excipient and / or one or more other accessory ingredients, and then, if necessary and / or desirable, dividing, shaping and / or packaging the product into a desired single- or multi-dose unit.

[0273] A pharmaceutical composition in accordance with the disclosure may be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as a plurality of single unit doses. As used herein, a “unit dose” is discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and / or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.

[0274] Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and / or any additional ingredients in a pharmaceutical composition in accordance with the disclosure will vary, depending upon the identity, size, and / or condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, the composition may comprise between 0.1% and 100%, e.g., between 0.5 and 50%, between 1 and 30%, between 5 and 80%, between 10 and 50%, between 20 and 90%, at least 70% (w / w), or at least 80% (w / w) active ingredient.

[0275] In some embodiments, the formulations described herein may contain at least one circular RNA molecule. In some embodiments, the formulations may contain one, two, three, four or five circular RNAs with different sequences. In one embodiment, the formulation contains at least two circular RNAs. In one embodiment, the formulation contains at least three circular RNAs. In another embodiment, the formulation contains at least four circular RNAs. In yet another embodiment, the formulation contains at least five circular RNAs.

[0276] The pharmaceutical compositions and formulations of the present disclosure can be formulated with one or more excipients to increase the stability of circular RNA; increase cell penetration; permit the sustained, controlled or delayed release; alter the biodistribution (e.g., target the nucleic acid vaccine composition to specific tissues or cell types); increase the translation of encoded protein in vivo; and / or alter the release of encoded protein in vivo.

[0277] In addition to traditional excipients, excipients of the present disclosure can include, without limitation, lipids, lipidoids, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, nucleic acid molecules, cells, organelles, explants, nanoparticle mimics and combinations thereof.Attorney Docket No: ORB-014WO1

[0278] In vivo delivery of nucleic acids may be affected by many parameters, including, but not limited to, the formulation composition, nature of particle, degree of loading, polynucleotide to lipid / lipidoid ratio, nature of polynucleotides such as sequence contents, single-stranded or double-stranded, linear or circular, length and modifications, particle sizes and charges, and administration routes, etc.

[0279] The present disclosure contemplates the formulation and use in delivering at least one circular RNA compositions and at least one pharmaceutically acceptable carrier, such as circular RNAs encoding proteins including antigen proteins for nucleic acid vaccines. Complexes, micelles, liposomes or particles can be prepared containing any suitable lipids and lipidoids and therefore, can result in an effective delivery of the circular polynucleotide compositions following the injection of a formulation via localized and / or systemic routes of administration, e.g., by various means including, but not limited to, intravenous (IV), intramuscular (IM), subcutaneous (SC), intraparenchymal (IPa), intrathecal (IT), sub-retinal, intranasal, or intracerebroventricular (ICV) administration. Lipid nanoparticles (LNPs)

[0280] In some embodiments, the circular RNAs, nucleic acid molecules and compositions thereof described herein may be formulated in a delivery vehicle, e.g., a lipid nanoparticle (LNP). As used herein, the terms “delivery vehicle,” “lipid nanoparticle”, “nanoparticle” or grammatical equivalent, are used interchangeably. In general, LNPs can be characterized as small solid or semi-solid particles possessing an exterior lipid layer with a hydrophilic exterior surface that is exposed to the non-LNP environment, an interior space which may aqueous (vesicle like) or non-aqueous (micelle like), and at least one hydrophobic inter-membrane space. LNP membranes may be lamellar or non-lamellar and may be comprised of 1, 2, 3, 4, 5 or more layers.

[0281] The LNPs for delivering the circular RNAs, nucleic acid molecules and compositions thereof described herein may have a diameter from 10-1000 nm. The nanoparticle may be 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 450, 455, 460, 465, 470, 475, 480, 485, 490, 495, 500, 505, 510, 515, 520, 525, 530, 535, 540, 545, 550, 555, 560, 565, 570, 575, 580, 585, 590, 595, 600, 605, 610, 615, 620, 625, 630, 635, 640,Attorney Docket No: ORB-014WO1 645, 650, 655, 660, 665, 670, 675, 680, 685, 690, 695, 700, 705, 710, 715, 720, 725, 730, 735, 740, 745, 750, 755, 760, 765, 770, 775, 780, 785, 790, 795, 800, 805, 810, 815, 820, 825, 830, 835, 840, 845, 850, 855, 860, 865, 870, 875, 880, 885, 890, 895, 900, 905, 910, 915, 920, 925, 930, 935, 940, 945, 950, 955, 960, 965, 970, 975, 980, 985, 990, 995, or 1000 nm, or less than 100 nm, less than 150 nm, less than 200 nm, less than 250 nm, less than 300 nm, less than 350 nm, less than 400 nm, less than 450 nm, less than 500 nm, less than 550 nm, less than 600 nm, less than 650 nm, less than 700 nm, less than 750 nm, less than 800 nm, less than 850 nm, less than 900 nm, less than 950 nm or less than 1000 nm.

[0282] In some embodiments, the lipid nanoparticles for delivering the circular RNAs, nucleic acid molecules and compositions thereof described herein may have a diameter from about 1 to about 100 nm, such as but not limited to, from about 1 nm to about 10 nm, about 1 nm to about 20 nm, from about 1 nm to about 30 nm, from about 1 nm to about 40 nm, from about 1 nm to about 50 nm, from about 1 nm to about 60 nm, from about 1 nm to about 70 nm, from about 1 nm to about 80 nm, from about 1 nm to about 90 nm, from about 5 nm to about from 100 nm, from about 5 nm to about 10 nm, about 5 nm to about 20 nm, from about 5 nm to about 30 nm, from about 5 nm to about 40 nm, from about 5 nm to about 50 nm, from about 5 nm to about 60 nm, from about 5 nm to about 70 nm, from about 5 nm to about 80 nm, from about 5 nm to about 90 nm, and / or from about 5 nm to about 100 nm.

[0283] In some embodiments, the lipid nanoparticles for delivering the circular RNAs, nucleic acid molecules and compositions thereof described herein may have a diameter from about 10 to about 100 nm, such as, but not limited to, about 10 nm to about 20 nm, about 10 nm to about 30 nm, about 10 nm to about 40 nm, about 10 nm to about 50 nm, about 10 nm to about 60 nm, about 10 nm to about 70 nm, about 10 nm to about 80 nm, about 10 nm to about 90 nm, about 20 nm to about 30 nm, about 20 nm to about 40 nm, about 20 nm to about 50 nm, about 20 nm to about 60 nm, about 20 nm to about 70 nm, about 20 nm to about 80 nm, about 20 nm to about 90 nm, about 20 nm to about 100 nm, about 30 nm to about 40 nm, about 30 nm to about 50 nm, about 30 nm to about 60 nm, about 30 nm to about 70 nm, about 30 nm to about 80 nm, about 30 nm to about 90 nm, about 30 nm to about 100 nm, about 40 nm to about 50 nm, about 40 nm to about 60 nm, about 40 nm to about 70 nm, about 40 nm to about 80 nm, about 40 nm to about 90 nm, about 40 nm to about 100 nm, about 50 nm to about 60 nm, about 50 nm to about 70 nm about 50 nm to about 80 nm, about 50 nm to about 90 nm, about 50 nm to about 100 nm, about 60 nm to about 70 nm, about 60 nm to about 80 nm, about 60 nm to about 90 nm, about 60 nm to about 100 nm, about 70 nm to about 80 nm,Attorney Docket No: ORB-014WO1 about 70 nm to about 90 nm, about 70 nm to about 100 nm, about 80 nm to about 90 nm, about 80 nm to about 100 nm and / or about 90 nm to about 100 nm.

[0284] In some embodiments, the lipid nanoparticles for delivering the circular RNAs, nucleic acid molecules and compositions thereof described herein may have a diameter from about 50 nm to about 100 nm.

[0285] LNPs useful herein are known in the art and generally comprise one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids and one or more polyethylene glycol (PEG) modified lipids. In some embodiments, a LNP comprises no more than three distinct lipid components. The components of the LNP may be selected based on the desired target, tropism, cargo (e.g., a circular RNA), size, or other desired feature or property. The relative amounts (ratio) of ionizable lipid, helper lipid, cholesterol and PEG-modified lipids substantially affect the efficacy of lipid nanoparticles and may be optimized for a given application and administration route.

[0286] In general, the circular RNAs, nucleic acid molecules and compositions thereof described herein may be formulated using LNPs into their interior space, into the inter membrane space, onto their exterior surface, or any combination thereof. Ionizable lipids

[0287] The LNP for delivering the circular RNAs, nucleic acid molecules and compositions thereof described herein comprises at least one ionizable (i.e. cationic) lipid.

[0288] In some embodiments, the LNPs may contain one or more cationic lipids selected from C12-200, DLin-KC2-DMA, HGT4003, HGT5000, HGT5001, MC3,DLinDMA, DLinkC2DMA, cKK-El2, ICE, , DODAC, DDAB, DMRIE DOSPA, DOGS, DODAP, DODMA, DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, and combinations thereof.

[0289] Other suitable cationic lipids include (20Z,23Z)-N,N-dimethylnonacosa-20,23- dien-10-amine, (17Z,20Z)-N,N-dimemylhexacosa-17,20-dien-9-amine, (1Z,19Z)-N5N- dimethylpentacosa-l 6, 19-dien-8-amine, (13Z,16Z)-N,N-dimethyldocosa-13,16-dien-5- amine, (12Z,15Z)-N,N-dimethylhenicosa-12,15-dien-4-amine, (14Z,17Z)-N,N- dimethyltricosa-14,17-dien-6-amine, (15Z,18Z)-N,N-dimethyltetracosa-15,18-dien-7-amine, (18Z,21Z)-N,N-dimethylheptacosa-18,21-dien-10-amine, (15Ζ,18Ζ)-Ν,Ν-dimethyltetracosa- 15,18-dien-5-amine, (14Z,17Z)-N,N-dimethyltricosa-14,17-dien-4-amine, (19Z,22Z)-N,N- dimeihyloctacosa-19,22-dien-9-amine, (18Z,21 Z)-N,N-dimethylheptacosa- 18 ,21 -dien-8 –Attorney Docket No: ORB-014WO1 amine, (17Z,20Z)-N,N-dimethylhexacosa- 17,20-dien-7-amine, (16Z,19Z)-N,N- dimethylpentacosa-16,19-dien-6-amine, (22Z,25Z)-N,N-dimethylhentriaconta-22,25-dien-10- amine, (21 Z ,24Z)-N,N-dimethyltriaconta-21,24-dien-9-amine, (18Z)-N,N-dimetylheptacos- 18-en-10-amine, (17Z)-N,N-dimethylhexacos-17-en-9-amine, (19Z,22Z)-N,N- dimethyloctacosa-19,22-dien-7-amine, N,N-dimethylheptacosan-10-amine, (20Z,23Z)-N- ethyl-N-methylnonacosa-20,23-dien-l0-amine, 1-[(11Z,14Z)-l-nonylicosa-11,14-dien-l-yl] pyrrolidine, (20Z)-N,N-dimethylheptacos-20-en-l 0-amine, (15Z)-N,N-dimethyl eptacos-15- en-l 0-amine, (14Z)-N,N-dimethylnonacos-14-en-l0-amine, (17Z)-N,N-dimethylnonacos-17- en-l0-amine, (24Z)-N,N-dimethyltritriacont-24-en-l0-amine, (20Z)-N,N-dimethylnonacos-20- en-l 0-amine, (22Z)-N,N-dimethylhentriacont-22-en-l0-amine, (16Z)-N,N-dimethylpentacos- 16-en-8-amine, (12Z,15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-dien-1–amine, (13Z,16Z)- N,N-dimethyl-3-nonyldocosa-l3,16-dien-l–amine, N,N-dimethyl-l-[(lS,2R)-2- octylcyclopropyl] eptadecan-8-amine, 1-[(1S,2R)-2-hexylcyclopropyl]-N,N- dimethylnonadecan-10-amine, Ν,Ν-dimethyl-1-[(1S ,2R)-2-octylcyclopropyl]nonadecan-10- amine, N,N-dimethyl-21-[(lS,2R)-2-octylcyclopropyl]henicosan-l0-amine,Ν,Ν-dimethyl-1- [(1S,2S)-2-{[(lR,2R)-2-pentylcycIopropyl]methyl}cyclopropyl]nonadecan-10-amine,Ν,Ν- dimethyl-1-[(1S,2R)-2-octylcyclopropyl]hexadecan-8-amine, Ν,Ν-dimethyl-[(lR,2S)-2- undecyIcyclopropyl]tetradecan-5-amine, N,N-dimethyl-3-{7-[(1S,2R)-2- octylcyclopropyl]heptyl} dodecan-1–amine, 1-[(1R,2S)-2-hepty lcyclopropyl]-Ν,Ν- dimethyloctadecan-9–amine, 1-[(1S,2R)-2-decylcyclopropyl]-N,N-dimethylpentadecan-6- amine, N,N-dimethyl-l-[(lS,2R)-2-octylcyclopropyl]pentadecan-8-amine, R-N,N-dimethyl-1- [(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-(octyloxy)propan-2-amine, S-N,N-dimethyl-1- [(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-(octyloxy)propan-2-amine, 1-{2-[(9Z,12Z)- octadeca-9,12-dien-1-yloxy]-1-[(octyloxy)methyl]ethyl}pyrrolidine, (2S)-N,N-dimethyl-1- [(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-[(5Z)-oct-5-en-1-yloxy]propan-2-amine, 1-{2- [(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-1-[(octyloxy)methyl]ethyl}azetidine, (2S)-1- (hexyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, (2S)-1- (heptyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, Ν,Ν- dimethyl-1-(nonyloxy)-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, Ν,Ν- dimethyl-1-[(9Z)-octadec-9-en-1-yloxy]-3-(octyloxy)propan-2-amine; (2S)-N,N-dimethyl-1- [(6Z,9Z,12Z)-octadeca-6,9,12-trien-1-yloxy]-3-(octyloxy)propan-2-amine, (2S)-1- [(11Z,14Z)-icosa-11,14-dien-1-yloxy]-N,N-dimethyl-3-(pentyloxy)propan-2-amine, (2S)-1- (hexyloxy)-3-[(11Z,14Z)-icosa-11,14-dien-1-yloxy]-N,N-dimethylpropan-2-amine, 1- [(11Z,14Z)-icosa-11,14-dien-1-yloxy]-Ν,Ν-dimethy1-3-(octyloxy)propan-2-amine, 1-Attorney Docket No: ORB-014WO1 [(13Z,16Z)-docosa-l3,16-dien-l-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, (2S)-1- [(13Z,16Z)-docosa-13,16-dien-1-yloxy]-3-(hexyloxy)-N,N-dimethylpropan-2-amine, (2S)-1- [(13Z)-docos-13-en-1-yloxy]-3-(hexyloxy)-N,N-dimethylpropan-2-amine, 1-[(13Z)-docos- 13-en-1-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, 1-[(9Z)-hexadec-9-en-1-yloxy]- N,N-dimethyl-3-(octyloxy)propan-2-amine, (2R)-N,N-dimethyl-H(1-metoylo ctyl)oxy]-3- [(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, (2R)-1-[(3,7-dimethyloctyl)oxy]- N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, N,N-dimethyl-1- (octyloxy)-3-({8-[(1S,2S)-2-{[(1R,2R)-2- pentylcyclopropyl]methyl}cyclopropyl]octyl}oxy)propan-2-amine, N,N-dimethyl-1-{[8-(2- oc1ylcyclopropyl)octyl]oxy}-3-(octyloxy)propan-2-amine and (1lE,20Z,23Z)-N,N- dimethylnonacosa-l1,20,2-trien-10-amine or a pharmaceutically acceptable salt or stereoisomer thereof.

[0290] Other suitable cationic lipids which may be used in the compositions and methods of the present disclosure include ionizable cationic lipids described in PCT Patent Application Publication Nos. WO2012040184, WO2011153120, WO2011149733, WO2011090965, WO2011043913, WO2011022460, WO2012061259, WO2012054365, WO2012044638, WO2010080724, WO201021865 and WO2008103276, US Patent Nos. 7,893,302, 7,404,969 and 8,283,333 and US Patent Publication No. US20100036115 and US20120202871; the contents of each of which are herein incorporated by reference in their entirety.

[0291] In some embodiments, the cationic lipid may be synthesized by methods known in the art and / or as described in PCT Patent Application Publication Nos. WO2012040184, WO2011153120, WO2011149733, WO2011090965, WO2011043913, WO2011022460, WO2012061259, WO2012054365, WO2012044638, WO2010080724 and WO201021865; the contents of each of which are herein incorporated by reference in their entirety.

[0292] In some embodiments, the LNP for formulating the circular RNAs, nucleic acid molecules and compositions thereof described herein may comprise a plurality of cationic lipids, such as a first and a second cationic lipid. The first cationic lipid can be selected on the basis of a first property and the second cationic lipid can be selected on the basis of a second property. The first and second properties may be complementary.

[0293] In some embodiments, the nanoparticles described herein may comprise at least one cationic polymer described herein and / or known in the art.

[0294] In some embodiments, the compositions of the present disclosure include one or more cationic lipids that constitute at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%,Attorney Docket No: ORB-014WO1 55%, 60%, 65%, or 70%, measured by weight, of the total lipid content in the lipid nanoparticle. In some embodiments, the compositions of the present disclosure include one or more cationic lipids that constitute at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70%, measured as a mol %, of the total lipid content in the lipid nanoparticle. In some embodiments, the compositions of the present disclosure include one or more cationic lipids that constitute about 30-70 % (e.g., about 30-65%, about 30-60%, about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%), measured by weight, of the total lipid content in the lipid nanoparticle. In some embodiments, the compositions of the present disclosure include one or more cationic lipids that constitute about 30-70 % (e.g., about 30-65%, about 30-60%, about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%), measured as mol %, of the total lipid content in the lipid nanoparticle.

[0295] In some embodiments, the ionizable lipid comprises a compound disclosed in WO 2021 / 141969 A1 (Hamilton et al.), the entirety of which is incorporated by reference herein. In some embodiments, the ionizable lipid comprises a compound of Formula (I) of WO 2021 / 141969 A1 (Hamilton et al.).(Formula (I))

[0296] In some embodiments, R1in Formula (I) comprises C9-C20 alkyl or C9-C20 alkenyl with 1-3 units of unsaturation. For example, in some embodiments R1comprises a C9-C20alkenyl with 2 units of unsaturation, such as, without limitation, a C17alkenyl with 2 units of unsaturation.

[0297] In some embodiments, X3, X5, and X6in Formula (I) are independently absent.

[0298] In some embodiments, X1is -O-. In some embodiments, X1is absent. -(CH)a-

[0299] In some embodiments, X2isX7. In some embodiments, X2is -(CH2)a- or - CH(OH)-. In some embodiments, a is an integer between 0 and 6. In some embodiments, a is 0, 1, 2, 3, 4, 5, or 6. In some embodiments, a is 0 and X2is absent. In some embodiments, a is 1.Attorney Docket No: ORB-014WO1

[0300] In some embodiments, X7is independently hydrogen or hydroxyl. In some embodiments, X7is hydroxyl. In some embodiments, X7is hydrogen.

[0301] In some embodiments, X4is a 6-membered heterocyclyl optionally substituted with 1 or 2 C1-C6alkyl groups. In some embodiments, the heterocyclyl comprises at least one nitrogen. For example, some embodiments, X4is piperidinyl. In some embodiments, X4is ethylpiperidinyl.

[0302] In some embodiments, A1and A2are independently C5-C12alkyl or C5-C12alkenyl with 1-3 units of unsaturation. In some embodiments, A1and A2are independently C5-C12 alkenyl with 1 unit of unsaturation. In some embodiments, A1is C8 alkenyl with 1 unit of unsaturation. In some embodiments, A2is C8alkenyl with 1 unit of unsaturation.

[0303] In some embodiments, n1 is an integer between 1 and 6. In some embodiments, n1 is 1, 2, 3, 4, 5, or 6. In some embodiments, n1 is 2.

[0304] In some embodiments, the ionizable lipid comprises a compound disclosed in WO 2022 / 140252 A1 (Patwardhan et al.), the entirety of which is incorporated by reference herein. In some embodiments, the ionizable lipid comprises a compound of Formula (III-a-i) of WO 2022 / 140252 A1 (Patwardhan et al.), or its N-oxide:(Formula (III-a-i))

[0305] In some embodiments, R1is hydrogen.

[0306] In some embodiments, L1is C2-C6 heteroalkylenyl comprising at least 1 heteroatom. In some embodiments, the heteroatom is oxygen. For example, in some embodiments, L1is a C4 heteroalkylenyl comprising 1 oxygen atom, such as, for example and without limitation, - OCH2CH2CH2-. In some embodiments, L1is a C3 heteroalkylenyl comprising 1 oxygen atom, such as, for example and without limitation, - OCH2CH2-.

[0307] In some embodiments, each R is independently C6-C12alkyl or C6-C12alkenyl with 1-3 units of unsaturation.

[0308] In some embodiments, each L is independently C1-C5 alkylenyl.

[0309] In some embodiments, each L2is independently C4-C8alkylenyl.

[0310] In some embodiments, the ionizable lipid comprises a compound of Formula (I’’- a) of WO 2022 / 140252 A1 (Patwardhan et al.).Attorney Docket No: ORB-014WO1(Formula (I’’-a-iii))

[0311] In some embodiments, R1is hydrogen.

[0312] In some embodiments, L1is C2-C6heteroalkylenyl comprising at least 1 heteroatom. In some embodiments, the heteroatom is oxygen. In some embodiments, L1is a C3 heteroalkylenyl comprising 1 oxygen atom, such as, for example and without limitation, - OCH2CH2-.

[0313] In some embodiments, each R is independently C6-C12alkyl or C6-C12alkenyl with 1-3 units of unsaturation.

[0314] In some embodiments, R’’ is C6-C12 alkyl.

[0315] In some embodiments, each L is independently C1-C5alkylenyl.

[0316] In some embodiments, each L2is independently C4-C8 alkylenyl.

[0317] Exemplary ionizable lipids include 3-((((1-ethylpiperidin-3- yl)methoxy)carbonyl)oxy)-2-(((4-(((Z)-oct-5-en-1-yl)oxy)-4-(((Z)-oct-5-en-1- yl)oxy)butanoyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate ( Compound 1).(Compound 1) (3-hydroxypropyl)azanediyl)bis(heptane-7,1-diyl) bis(4,4-bis(((E)-oct-5-en-1- yl)oxy)butanoate) (Compound 2);Attorney Docket No: ORB-014WO1(Compound 2) ((2-hydroxyethyl)azanediyl)bis(hexane-6,1-diyl) bis(6,6-bis(hexyloxy)hexanoate) (Compound 3).(Compound 3) nonyl 8-((6-((4,4-bis(octyloxy)butanoyl)oxy)hexyl)(2-hydroxyethyl)amino)octanoate (Compound 4).(Compound 4) nonyl 8-((2-hydroxyethyl)(6-((4-(((Z)-oct-5-en-1-yl)oxy)-4-(((Z)-oct-5-en-1- yl)oxy)butanoyl)oxy)hexyl)amino)octanoate (Compound 5).(Compound 5) and Compound 6.Attorney Docket No: ORB-014WO1(Compound 6) Non-cationic lipids / helper lipids

[0318] The LNP for delivering the circular RNAs, nucleic acid molecules and compositions thereof described herein may comprise one or more non-cationic lipids (helper lipids). The helper lipids in LNPs may contribute to their stability and delivery efficiency, and / or mitigate the toxicity owing to the cationic lipids. A “non-cationic lipid" refers to any neutral, zwitterionic or anionic lipid.

[0319] Non-cationic lipids include, but are not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4- (N-maleimidomethyl)-cyclohexane-l-carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl- ethanolamine (DSPE), phosphatidylserine, sphingolipids, cerebrosides, gangliosides, 16-O- monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, l-stearoyl-2-oleoyl- phosphatidyethanolamine (SOPE), or a mixture thereof.

[0320] In some embodiments, the non-cationic lipid is a phospholipid such as a synthetic phospholipid, including but not limited to, DDPC, DLPC, DMPC, DPPC, DSPC, DOPC, POPC and DEPC; DMPG, DPPG, DSPG and POPG; DMPA, DPPA and DSPA; DMPE, DPPE, DSPE and DOPE; DOPS; and polyglycerin attached phospholipids (PG phospholipid). The phospholipid may be selected based on administration routes, e.g., DPPC, POPC and POPG used in LNPs for injection and DOPC, POPC and DDPC used in LNPs for pulmonary delivery. In some embodiments, the phospholipid may be a purified lipid from a natural source.

[0321] In some embodiments, the LNP for delivering the circular RNAs, nucleic acid molecules and compositions thereof described herein may comprise one or more neutral helper lipids such as dioleoyl phosphoethanolamine (DOPE), prostaglandins, eicosanoids, glycerides, glycosylated diacyl glycerols, oxygenated fatty acids, NAGly and PAHSA. TheAttorney Docket No: ORB-014WO1 neutral lipid is a lipid that does not carry a net charge in the conditions under which the composition is formulated and / or administered.

[0322] In some embodiments, the non-cationic lipid may comprise a molar ratio of about 5% to about 90%, or about 10 % to about 70% of the total lipid present in an LNP. In some embodiments, the percentage of non-cationic lipid in a LNP may be greater than 5%, greater than 10%, greater than 20%, greater than 30%, or greater than 40%. Cholesterol-derived lipids

[0323] The LNP for delivering the circular RNAs, nucleic acid molecules and compositions thereof described herein comprises one or more cholesterol derived lipids. The cholesterol derived lipids can be a cholesterol, a naturally occurring cholesterol analogue, or a synthetic cholesterol like compound and the cholesterol derivatives. In some embodiments, a naturally occurring cholesterol analog may be selected from those by Patel et al., (Nature Communications, 2020; 983); the contents of which are incorporated herein by reference in their entirety. In some embodiments, the LNPs comprise one or more cholesterol derivatives, e.g., PtdChol.

[0324] In some embodiments, the cholesterol-based lipid may comprise a molar ration of about 2% to about 30%, or about 5% to about 20% of the total lipid present in an LNP. In some embodiments, the percentage of cholesterol-based lipid in the lipid nanoparticle may be greater than 5%, greater than 10%, greater than 20%, greater than 30%, or greater than 40%. PEG-modified lipids

[0325] The LNP described herein comprises one or more PEG modified lipids, such as PEG polymers and PEGylated lipids.

[0326] Suitable PEG-modified lipids include, but are not limited to, a polyethylene glycol chain of up to 5 kDa in length covalently attached to a lipid with alkyl chain(s) of C6- C20 length. The addition of such components may prevent complex aggregation and may also provide a means for increasing circulation lifetime and increasing the delivery of the lipid- nucleic acid composition to the target tissues, or they may be selected to rapidly exchange out of the formulation in vivo. Particularly useful exchangeable lipids are PEG-ceramides having shorter acyl chains (e.g., C14 or C18). The PEG-modified may comprise a molar ratio from about 0% to about 20%, about 0.5% to about 20%, about 1% to about 15%, about 4% to about 10%, or about 2% of the total lipid present in the LNP.

[0327] In some embodiments, LNPs for delivering the circular RNAs, nucleic acid molecules and compositions thereof described herein may include at least one of theAttorney Docket No: ORB-014WO1 PEGylated lipids described in PCT Patent Application Publication No. WO2012099755, the contents of which are herein incorporated by reference in their entirety.

[0328] In some embodiments, the ratio of PEG in the lipid nanoparticle (LNP) formulations may be increased or decreased and / or the carbon chain length of the PEG lipid may be modified from C14 to C18 to alter the pharmacokinetics and / or biodistribution of the LNP formulations.

[0329] In some embodiments, the LNP comprises PEG-c-DOMG. In some embodiments, the PEG-c-DOMG may be replaced with a PEG lipid such as, but not limited to, PEG-DSG (1,2-Distearoyl-sn-glycerol, methoxypolyethylene glycol), PEG-DPG (1,2-Dipalmitoyl-sn- glycerol, methoxypolyethylene glycol), or PEG-DMG 2000 (1,2-dimyristoyl-sn-glycero-3- phophoethanolamine-N-[methoxy(polyethylene glycol)-2000). As a non-limiting example, the LNP formulation may contain PEG-DMG 2000, DLin-DMA, DSPC and cholesterol. As another non-limiting example, the LNP formulation may contain PEG-DMG 2000, DLin- DMA, DSPC and cholesterol in a molar ratio of 2:40:10:48 (see e.g., Geall et al., PNAS, 2012, 109(36): 14604-14609; herein incorporated by reference in its entirety).

[0330] Lipid nanoparticle formulations may be improved by replacing the cationic lipid with a biodegradable cationic lipid which is known as a rapidly eliminated lipid nanoparticle (reLNP). Ionizable cationic lipids, such as, but not limited to, DLinDMA, DLin-KC2-DMA, and DLin-MC3-DMA, have been shown to accumulate in plasma and tissues over time and may be a potential source of toxicity. The rapid metabolism of the rapidly eliminated lipids can improve the tolerability and therapeutic index of the lipid nanoparticles. Inclusion of an enzymatically degraded ester linkage can improve the degradation and metabolism profile of the cationic component, while still maintaining the activity of the reLNP formulation. The ester linkage can be internally located within the lipid chain or it may be terminally located at the terminal end of the lipid chain. The internal ester linkage may replace any carbon in the lipid chain.

[0331] In some embodiments, the LNP for delivering circular RNAs, nucleic acid molecules and compositions thereof described herein may comprise a cleavable lipid such as those described in PCT Patent Application Publication No. WO2012170889, the contents of which are herein incorporated by reference in their entirety.

[0332] In some embodiments, the LNP for delivering circular RNAs, nucleic acid molecules and compositions thereof described herein may comprises a conjugated lipid. In a non-limiting example, the conjugated lipid may have a formula such as described in US Pub. No. US 20120264810 to Lin et al., the contents of which are incorporated herein by referenceAttorney Docket No: ORB-014WO1 in their entirety. The conjugate lipid may form a lipid particle which further comprises a cationic lipid, a neutral lipid, and a lipid capable of reducing aggregation.

[0333] In some embodiments, the LNP for formulating the circular RNAs, nucleic acid molecules and compositions thereof described herein may comprise a mixture of cationic compounds and neutral lipids. As a non-limiting example, the cationic compounds may be formula (I) disclosed in PCT Patent Application Publication No.: WO 1999010390 to Ansell et al., the contents of which are described herein by reference in their entirety, and the neutral lipid may be selected from the group consisting of diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide and sphingomyelin.

[0334] In some embodiments, the LNP formulations described herein may additionally comprise a permeability enhancer molecule. Non-limiting permeability enhancer molecules are described in US Patent Publication No. US20050222064; the contents of which are herein incorporated by reference in their entirety.

[0335] In some embodiments, the LNP for formulating the circular RNAs, nucleic acid molecules and compositions thereof described herein may be encapsulated into any polymer known in the art which may form a gel when injected into a subject. As another non-limiting example, the lipid nanoparticle may be encapsulated into a polymer matrix which may be biodegradable.

[0336] In some embodiments, the LNP for formulating the circular RNAs, nucleic acid molecules and compositions thereof described herein may be encapsulated in the lipid formulation to form a stable nucleic acid-lipid particle (SNALP) such as described in US Pat. No. US8,546,554 to de Fougerolles et al., the contents of which are incorporated here by reference in their entirety. In one non-limiting example, the SNALP includes 40% 2,2- Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (Lipid A), 10% dioleoylphosphatidylcholine (DSPC), 40% cholesterol, 10% polyethylene glycol (PEG)-C- DOMG (mole percent) with a particle size of 63.0±20 nm and a 0.027 nucleic acid / lipid ratio.

[0337] In some embodiments, the LNPs for formulating the circular RNAs, nucleic acid molecules and compositions thereof described herein may comprise an endosomal membrane destabilizer as disclosed in US Pat. No. US 7,189,705 to Lam et al., the contents of which are incorporated herein by reference in their entirety. As a non-limiting example, the endosomal membrane destabilizer may be a Ca2+ion.

[0338] In some embodiments, the LNPs for formulating the circular RNAs, nucleic acid molecules and compositions thereof described herein may comprise a charged lipid or an amino lipid. As used herein, the term “charged lipid” is meant to include those lipids havingAttorney Docket No: ORB-014WO1 one or two fatty acyl or fatty alkyl chains and a quaternary amino head group. The quaternary amine carries a permanent positive charge. The head group can optionally include an ionizable group, such as a primary, secondary, or tertiary amine that may be protonated at physiological pH. The presence of the quaternary amine can alter the pKa of the ionizable group relative to the pKa of the Group In a structurally similar compound that lacks the quaternary amine (e.g., the quaternary amine is replaced by a tertiary amine). In a non- limiting example, the charged lipid used in any of the formulations described herein may be any charged lipid described in EP2509636 to Manoharan et al., the contents of which are incorporated herein by reference in their entirety. In some embodiments, a charged lipid is referred to as an “amino lipid.” In a non-limiting example, the amino lipid may be any amino lipid described in US Pub. No. US20110256175 to Hope et al., the contents of which are incorporated herein by reference in their entirety. For example, the amino lipids may have the structure disclosed in Tables 3-7 of Hope, such as structure (II), DLin-K-C2-DMA, DLin-K2- DMA, DLin-K6-DMA, etc. In another non-limiting example, the amino lipids may be any amino lipid described in US 20110117125 to Hope et al., the contents of which are incorporated herein by reference in their entirety, such as a lipid of structure (I), DLin-K- DMA, DLin-C-DAP, DLin-DAC, DLin-MA, DLin-S-DMA, etc. In another non-limiting example, the amino lipid may have the structure (I), (II), (III), or (IV), or 4-(R)-DLin-K- DMA (VI), 4-(S)-DLin-K-DMA (V) as described in PCT Patent Application Publication No. WO2009132131 to Manoharan et al., the contents of which are incorporated herein by reference in their entirety.

[0339] In some embodiments, the LNPs for formulating the circular polynucleotide compositions of the present disclosure may comprise reverse head group lipids, e.g., formulated with a zwitterionic lipid comprising a headgroup wherein the positive charge is located near the acyl chain region and the negative charge is located at the distal end of the head group, such as a lipid having structure (A) or structure (I) described in PCT Patent Application Publication No. WO2011056682 to Leung et al., the contents of which are incorporated herein by reference in their entirety.

[0340] In some embodiments, the lipid components of the LNP to nucleic acid ratio (mass / mass ratio) (e.g., lipids to circular polynucleotide compositions ratio) may be in the range of from about 1:1 to about 50:1, from about 1:1 to about 25:1, from about 3:1 to about 15:1, from about 4:1 to about 10:1, from about 5:1 to about 9:1, or about 6:1 to about 9:1, or 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1. 9:1, 10:1, 11:1, 12:1, 13:1. 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 21:1, 22:1, 23:1, 24:1, 25:1, 26:1, 27:1, 28:1, 29:1, 30:1, 31:1, 32:1, 33:1, 34:1,Attorney Docket No: ORB-014WO1 35:1, 36:1, 37:1, 38:1, 38:1, 39:1, 40:1, 41:1, 42:1, 43:1, 44:1, 45:1, 46:1, 47:1, 48:1, 49:1, or 50:1.

[0341] In some embodiments, the LNP formulation may be formulated by the methods described in International Publication Nos. WO2011127255 or WO2008103276. As a non- limiting example, the circular polynucleotide compositions of the present disclosure may be encapsulated in any of the lipid nanoparticle (LNP) formulations described in WO2011127255 and / or WO2008103276; the contents of each of which are herein incorporated by reference in their entirety. Other nanoparticles and delivery agents

[0342] In some embodiments, other delivery vehicles are used to deliver circular RNAs, nucleic acid molecules and compositions thereof described herein. The vehicles may include other lipid-based particles such as lipidoids, liposomes, lipoplexes, micelles, multilamellar vesicle (MLV), unicellular vesicle (SUV), polymer-based nanoparticles and exosomes.

[0343] In some embodiments, compositions described herein may also be constructed or altered such that their properties are suitable for different administration routes, such as parenteral (intravenously, intramuscularly, intradermally, intraperitoneally or subcutaneously), oral, rectal, ophthalmic and / or topical administration.

[0344] In some embodiments, compositions of the present disclosure can be formulated for controlled release and / or targeted delivery. As used herein, “controlled release” refers to a pharmaceutical composition or compound release profile that conforms to a particular pattern of release to affect a therapeutic outcome. As used herein, “sustained release” refers to a pharmaceutical composition or compound that conforms to a release rate over a specific period of time. The period of time may include, but is not limited to, hours, days, weeks, months and years. In some embodiments, the compositions may be encapsulated into a delivery agent described herein and / or known in the art for controlled release and / or targeted delivery. Engineered exosomes

[0345] Exosomes are tiny vesicles smaller than 50 nm secreted by mature reticulocytes, which are associated with transferrin receptors and function in antigen presentation during the regulation of immune cells. In some embodiments, engineered exosomes act as cargo carriers and deliver small hydrophilic or lipophilic molecules, including some therapeutic drugs to cells, participating in the regulation of many major diseases. Exosomes can improveAttorney Docket No: ORB-014WO1 bioavailability of some drugs when taken orally, reducing the total dose required for administration, and minimizing side effects. Virus-like particles (VLPs)

[0346] In some embodiments, RNA therapeutics discussed herein are delivered using virus-like particles. Viral particles include recombinant viruses and virus-like particles (VLPs). As used herein, the term “Virus-like particles (VLPs)” are molecules that closely resemble viruses, but are non-infectious. VLPs can be naturally occurring or synthesized through the individual expression of viral structural proteins, which can then self-assemble into the virus-like structure. Combinations of structural capsid proteins from different viruses can be used to create recombinant VLPs. VLPs can be produced from different viruses, such as adeno-associated viruses, retroviruses, lentiviruses and vesiculoviruses. VLPs can be produced in multiple cell culture systems including bacteria, mammalian cell lines, insect cell lines, yeast and plant cells. VLPs possess diverse applications in therapeutics, immunization, and diagnostics. VLPs have been synthesized in a wide range of expression systems (ESs), including prokaryotic (bacteria) and eukaryotic (insect cells, mammalian cell lines, plant cells, or yeast). The functionality of VLPs can be increased through modifying their exterior or interior surface by displaying the heterologous epitopes of interest using different methods like peptide conjugation, genetic fusion, and chemical crosslinking.

[0347] In some embodiments, the VLP is derived from a Vesiculovirus. In some embodiments, the VLP is derived from VSV (Indiana vesiculovirus, formerly Vesicular stomatitis Indiana virus (VSIV or VSV). In some embodiments, the virus like particle comprises a mutated VSV-G protein. VSV-G protein is a single transmembrane glycoprotein (G) which plays a critical role during the initial steps of virus infection. it is responsible for virus attachment to specific receptor, LDL-R. In the cell, G protein triggers the fusion between the viral and endosomal membranes, which releases the viral genome in the cytosol for the subsequent steps of infection. In some embodiments, VSV-G protein is mutated to abolish its binding to LDL-R receptor. For example, a VSV-G envelope protein may be a mutated at one or more of any one of H8, K47, Y209, and / or R354. In some embodiments, a VLP may comprise a mutated VSV-G protein described in the PCT patent application Publication No. WO2019057974; the contents of which are incorporated herein by reference in their entireties. In some aspects, the VLP for delivery RNA therapeutics is a viral particle disclosed in the PCT Publication Nos. WO2020236263 and WO2023107886; the contents of each of which are incorporated herein by reference in their entireties.Attorney Docket No: ORB-014WO1

[0348] In some embodiments, the virus like particle is pseudotyped. As a non-limiting example, the virus like particle is VSV-G-pseudotyped lentiviruses (VSV-G-LVs).

[0349] In some embodiments, the viral particle for delivering RNA therapeutics is a retrovirus, a recombinant AAV, or an adenovirus. Administration

[0350] The present disclosure encompasses the delivery of circular RNAs, nucleic acid molecules and compositions thereof described herein for any therapeutic, prophylactic, pharmaceutical, diagnostic or research use. The circular RNAs and compositions thereof described herein may be loaded to delivery vehicles such as those formulation components discussed herein in order to be administered to target cells, tissues, organs and / or subjects. The formulated circular RNA compositions may be delivered to the cell using routes of administration known in the art and described herein.

[0351] Delivery may also be naked. The circular RNAs and compositions may be delivered to a cell naked. As used herein in, “naked” refers to delivering the compositions described herein free from agents which promote transfection. The naked circular RNA compositions may be delivered to the cell using routes of administration known in the art and described herein.

[0352] As described herein, the circular RNA compositions may also be formulated for direct delivery to an organ or tissue in any of several ways in the art including, but not limited to, direct soaking or bathing, via a catheter, by gels, powder, ointments, creams, gels, lotions, and / or drops, by using substrates such as fabric or biodegradable materials coated or impregnated with the compositions, and the like.

[0353] The compositions of the present disclosure may be administered by any route which results in a therapeutically effective outcome. These include, but are not limited to enteral, gastroenteral, epidural, oral, transdermal, epidural (peridural), intracerebral (into the cerebrum), intracerebroventricular (into the cerebral ventricles), epicutaneous (application onto the skin), intradermal, (into the skin itself), subcutaneous (under the skin), nasal administration (through the nose), intravenous (into a vein), intraarterial (into an artery), intramuscular (into a muscle), intracardiac (into the heart), intraosseous infusion (into the bone marrow), intrathecal (into the spinal canal), intraperitoneal, (infusion or injection into the peritoneum), intravesical infusion, intravitreal, (through the eye), intracavernous injection, ( into the base of the penis), intravaginal administration, intrauterine, extra- amniotic administration, transdermal (diffusion through the intact skin for systemicAttorney Docket No: ORB-014WO1 distribution), transmucosal (diffusion through a mucous membrane), insufflation (snorting), sublingual, sublabial, enema, eye drops (onto the conjunctiva), or in ear drops. In specific embodiments, compositions may be administered in a way which allows them to cross the blood-brain barrier, vascular barrier, or other epithelial barrier. Routes of administration disclosed in International Publication WO 2013 / 090648 filed December 14, 2012, the contents of which are incorporated herein by reference in their entirety, may be used to administer the circular polynucleotide-based compositions of the present disclosure.

[0354] The compositions described herein can be formulated into a dosage form and for a route of administration as described herein, such as liquid dosage forms, injectable preparations, pulmonary forms, and solid dosage. Methods of use thereof

[0355] In accordance, the circular RNAs, nucleic acid molecules and compositions thereof are used for therapy. In some embodiments, the circular RNAs, nucleic acid molecules and compositions thereof are used for treating a disease, e.g., an autoimmune disease, an infectious disease, a genetic disorder and a cancer, in a subject, including a human subject. In accordance, the present disclosure provides a method for treating or preventing a disease using circular RNAs, nucleic acid molecules and compositions thereof described herein.

[0356] In some embodiments of the method, the sequence of interest encodes a chimeric antigen receptor (CAR), a therapeutic protein, an enzyme replacement protein, an antigen, or an antibody.

[0357] In some embodiments, the linear RNA is unmodified.

[0358] In some embodiments, the linear RNA is modified.

[0359] In some embodiments, the linear RNA comprises one or more modified nucleotides selected from N1-methylpseudouridine and / or 5-methoxyuridine.

[0360] In some embodiments, the method makes intact circular RNA.

[0361] In some embodiments, the circular RNA is formulated in a delivery vehicle.

[0362] In some embodiments, the delivery vehicle is a lipid nanoparticle.

[0363] In some embodiments, the lipid nanoparticle is conjugated to a targeting moiety.

[0364] In some embodiments, provided herein is a circular RNA produced from the precursor nucleic acid molecule of the present disclosure.

[0365] In some embodiments, provided herein is a circular RNA produced by the method of the present disclosure.Attorney Docket No: ORB-014WO1

[0366] As a non-limiting example, the circular RNAs, nucleic acid molecules and compositions thereof are used for treating or preventing cancer. Cancer includes a broad group of various diseases characterized by the uncontrolled growth of abnormal cells in the body. Unregulated cell division and growth results in the formation of malignant tumors that invade neighboring tissues and may also metastasize to distant parts of the body through the lymphatic system or bloodstream. Examples of cancers that may be treated by the methods disclosed herein include, but are not limited to, cancers of the immune system including lymphoma, leukemia, myeloma, and other leukocyte malignancies. In some embodiments, the methods disclosed herein may be used to reduce the tumor size of a tumor derived from, for example , bone cancer, pancreatic cancer, skin cancer, cancer of the head or neck, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, multiple myeloma, Hodgkin's Disease, non-Hodgkin's lymphoma (NHL), primary mediastinal large B cell lymphoma (PMBC), diffuse large B cell lymphoma (DLBCL), follicular lymphoma (FL), transformed follicular lymphoma, splenic marginal zone lymphoma (SMZL), cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, cancer of the urethra, cancer of the penis, chronic or acute leukemia, acute myeloid leukemia (AML), chronic myeloid leukemia, acute lymphoblastic leukemia (ALL) (including non T cell ALL), chronic lymphocytic leukemia (CLL), solid tumors of childhood, lymphocytic lymphoma, cancer of the bladder, cancer of the kidney or ureter, neoplasm of the central nervous system (CNS), primary CNS lymphoma, tumor angiogenesis, spinal axis tumor, brain stem glioma, pituitary adenoma, epidermoid cancer, squamous cell cancer, T cell lymphoma, environmentally induced cancers including those induced by asbestos, other B cell malignancies, and combinations of said cancers. In some embodiments, the methods disclosed herein may be used to reduce the tumor size of a tumor derived from, for example, sarcomas and carcinomas, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, Kaposi's sarcoma, sarcoma of soft tissue, and other sarcomas, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, hepatocellular carcinoma, lung cancer, colorectal cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma (for example adenocarcinoma of the pancreas, colon, ovary, lung, breast, stomach, prostate, cervix, or esophagus), sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, medullary carcinoma, bronchogenic carcinoma, renalAttorney Docket No: ORB-014WO1 cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, Wilms' tumor, cervical cancer, testicular tumor, bladder carcinoma, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, carcinoma of the renal pelvis, CNS tumors (such as a glioma, astrocytoma, medulloblastoma, craniopharyogioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, melanoma, neuroblastoma and retinoblastoma). The particular cancer may be responsive to chemo- or radiation therapy or the cancer may be refractory. A refractory cancer refers to a cancer that is not amenable to surgical intervention and the cancer is either initially unresponsive to chemo- or radiation therapy or the cancer becomes unresponsive over time.

[0367] In some embodiments, the circular RNAs, nucleic acid molecules and compositions thereof are used for treating or preventing an infectious disease, such as a viral infection. The circular RNAs, nucleic acid molecules and compositions thereof may be used as vaccines.

[0368] In some embodiments, the circular RNAs, nucleic acid molecules and compositions thereof are used for treating or preventing a genetic disorder.

[0369] In some embodiments, the circular RNAs, nucleic acid molecules and compositions thereof are used for inducing an immune response in a subject. The immune response includes the action of a cell of the immune system (for example, T lymphocytes, B lymphocytes, natural killer (NK) cells, macrophages, eosinophils, mast, cells, dendritic cells and neutrophils) and soluble macromolecules produced by any of these cells or the liver (including Antibodies, cytokines, and complement) that results in selective targeting, binding to, damage to, destruction of, and / or elimination from a vertebrate's body of invading pathogens, cells or tissues infected with pathogens, cancerous or other abnormal cells, or, in cases of autoimmunity or pathological inflammation, normal human cells or tissues.

[0370] In some embodiments, the compositions of the present disclosure are used to treat an autoimmune disease, including systemic lupus erythematosus (SLE) / lupus nephritis.

[0371] In some embodiments, the compositions of the present disclosure are used to induce an immune response for therapeutic or prophylactic purposes.

[0372] In some embodiments, the compositions of the present disclosure are used as vaccines to prevent infection, e.g., viral infections.

[0373] In some embodiments, the compositions of the present disclosure may be used as cancer vaccines. In this regard, the circular RNA comprises an antigen coding nucleic acid sequence. The antigen is a tumor associated antigen (TAA) or a fragment thereof.Attorney Docket No: ORB-014WO1

[0374] In some embodiments, the compositions described herein are co-administered with one or more additional therapeutic agents (e.g., in the same pharmaceutical composition or in separate pharmaceutical compositions). In some embodiments, the compositions described herein can be administered first and the one or more additional therapeutic agents can be administered second, or vice versa. Alternatively, the therapeutic compositions described herein, and the one or more additional therapeutic agents can be administered simultaneously.

[0375] In some embodiments, the subject is a mammal. In some embodiments, the mammal referred to herein can be any mammal, including, but not limited to, mice and hamsters, rabbits, cats, dogs, pigs and primates. Preferably, the mammal is a human (e.g., a patient). EXAMPLES Example 1: Permuted Intron-Exon (PIE) constructs that allow RNA circularization

[0376] This example illustrates the nucleic acid construct designs that were used to test RNA circularization and efficiency, using self-splicing Group I intron sequences derived from T4td intron (FIG. 1).

[0377] As illustrated in FIG. 2, plasmid parts (Part 0 for the upstream intron sequence (US intron); Part 1 for 5’ spacer; Part 345 for gene coding sequence, which is also referred to herein as “the sequence of interest”; Part 6 for 3’ UTR; and Part 7 for the downstream intron sequence (DS intron)) were synthesized by cloning polymerase chain reaction (PCR) products or pre-made DNA fragments. The nucleic acid constructs for making circular RNA were assembled by cloning parts 1–7 into an entry vector including a T7 promotor and a T7 terminator via a Golden Gate reaction according to the method described in Chen et al (Nature Biotechnology, 2023; 41(2): 262–272).

[0378] Four different embodiments of the nucleic acid constructs were generated, as shown in FIGs. 3A-3D. FIG. 3A shows an RNA transcript construct comprising 5’ and 3’ inner homology elements (i.e., IHEs) and 5’ and 3’ homology arms (i.e., outer homology arms (OHEs) )(OHE / IHE). FIG. 3B shows an RNA transcript construct including 5’ and 3’ inner homology elements (i.e., IHE) only (- / IHE), without outer homology arms. FIG. 3C shows an RNA transcript construct that lacks both inner homology elements, and 5’ and 3’ homology arms (- / -). FIG. 3D shows an RNA transcript construct including 5’ and 3’ homology arms only (OHE / -), without inner homology elements.Attorney Docket No: ORB-014WO1

[0379] The nucleic acid constructs were transformed into E. coli. Colonies were picked, mini-prepped and sequenced to confirm the assembled constructs.

[0380] The sequence encoding a GFP protein was cloned into the constructs (i.e., Part 345) and the IRES sequence from iHRVB3 was used. Example 2: Co-transcriptional circularization

[0381] The plasmids were linearized and used as linearized transcription templates for in vitro transcription (IVT) to generate linear RNA precursors. In vitro transcription (IVT) was performed in the presence of magnesium (Mg+2) only, or Mg+2 and a guanine nucleotide (Guanosine Monophosphate (GMP)), in addition to nucleoside triphosphates (ATP, CTP, GTP and UTP). The ratio of GMP to GTP (Guanosine Triphosphate) was about 5:1. Mg+2 was also a component of the IVT reaction buffer. Mg+2 and guanine nucleotide (GMP or GTP) were cofactors for the autocatalytic reaction of self-splicing Group I intron. IVT synthesis was initiated with the addition of T7 RNA polymerase. The self-splicing reaction circularized the linear RNA transcript during the IVT reaction.

[0382] Additionally, after IVT, the reaction mixtures were conditioned for refolding and ribozyme activation to increase the yield of circular RNA products. The splicing reactions, IVT, and refolding were analyzed by gel electrophoresis to measure circularization of the RNA precursors. Example 3: Testing different Group I T4td intron sequences for RNA circularization

[0383] This study tested T4td Group I intron sequences split at various positions for RNA circularization efficiency.

[0384] The T4 bacteriophage td gene (T4td) intron sequence (SEQ ID NO: 1, FIG. 1) was split at different positions illustrated in FIG. 4 to generate a pair of an upstream (US) intron sequence comprising a 3’ splicing site and a downstream (DS) intron sequence comprising a 5’ splicing site. The corresponding US intron and DS intron sequences were cloned into circular constructs in Example 1 to test their circularization efficiency. The permuted US and DS intron sequences used in Chen et al. (Nature Biotechnology, 2023; 41(2): 262–272) (referred to as “legacy split” in FIG. 4 was used as a comparison for circularization efficiency of the T4td introns disclosed herein.

[0385] All T4td intron fragment pairs generated circular RNAs, more efficiently or comparably to the legacy T4td intron sequences (Chen et al., Nature Biotechnology, 2023; 41(2): 262–272). Similarly, all T4td intron sequence pairs had higher or comparable circularization efficiency post refolding and ribozyme activation. FIG. 5A shows anAttorney Docket No: ORB-014WO1 exemplary gel image of T4td-v2, as compared to the legacy split (labeled as T4_td). The results also showed that the T4td-v2 introns resulted in less accumulation of nicked circRNAs during in vitro transcription and post refolding and ribozyme activation. Fewer undesirable byproducts of IVT and circularization reactions (e.g., dsRNA, linear RNA, nicked circRNA) were observed (the bands on top of the labeled “circle” bands in FIG. 5A). The nicked circRNA band represents single nicks that occur at random positions in an intact circRNA. Less nicked circular RNAs indicated purer intact circRNAs. FIG. 5B – FIG. 5C show results demonstrating circularization efficiency of the tested introns. By initial co-transcriptional circularization reaction, T4td-v2 and T4td-v3 introns circularized RNA, and generated about over 50% circular RNA over total RNAs (including circular RNAs and linear RNAs) (FIG. 5B). After folding and ribozyme activation, the T4td-v2 and T4td-v3 constructs generated over 80% circular RNA over total RNAs (including circular RNAs and linear RNAs) (FIG. 5C).

[0386] The T4td intron sequences were further tested for self-splicing and nicking activities at different temperatures ranging from 30°C to 60°C. FIG. 6 are representative gel images showing RNA circularization of T4td-v1 and T4td-v2 at different temperatures (post- refolding and ribozyme activation). The “% spliced” circRNAs over total RNAs post refolding ribozyme activation were measured and the “% nicked RNA (post-refolding ribozyme activation) were also measured and subtracted from the “% spliced” RNA. The overall % intact circRNA was measured for each intron sequence pair at each temperature (as shown in Table 2 below). The results indicated that at temperatures ranges of 37°C to 60°C, each pair of T4td intron sequences resulted in circularization of a precursor RNA sequence. . Table 2: Overall intact circRNA yield (%) (post-refolding ribozyme activation) at different temperaturesExample 4: Circularization of Constructs including T4td-v1 IntronAttorney Docket No: ORB-014WO1

[0387] The study tested how other elements of the RNA precursor construct impacted circularization efficiency.

[0388] The DNA constructs including the upstream and downstream intron sequences from T4td-v1 permutation were modified at one or more parts of the construct (FIG.2), including different 5’ spacer sequences (Part 1 in FIG. 2), different IRESs (Part 2 in FIG. 2), different coding sequences (Parts 345 in FIG. 2) or different 3’ UTR sequences (Part 6 in FIG. 2). The study showed that T4td-v1 intron sequences had a broad range of circularization efficiencies using different constructs (as shown in FIG. 7A – FIG. 7D). Example 5: Outer and inner homology elements and RNA circularization

[0389] This study tested RNA circularization of the constructs that removed the 5’ and 3’ homology armsThe four construct designs described in Example 1 (as illustrated in FIGs. 3A-3D): (1) both OHE / IHE (“OHE / IHE”, FIG. 3A), (2) IHE only, no OHE (“- / IHE”, FIG. 3B), (3) no OHE or IHE ( “- / -“, FIG. 3C) and (4) OHE only, no IHE (“OHE / -“, FIG. 3D) were prepared and RNA sequences were circularized. Each construct included “US” and “DS” sequences from T4td-v1 and T4td-v2, respectively. The results (as shown in Table 3a) showed that both 5’ and 3’ outer homology arm (OHE) and inner homology elements (IHEs) are not necessary for RNA circularization, in the context of the T4td intron fragments from T4td-v1 and T4td-v2 splits. To further test T4td intron mediated RNA circularization without inclusion of homology elements, 10 pairs of “US” and “DS” intron sequences from T4td intron (each split at different positions) (Table 3b) were used in constructs without 5’ and 3’ homology arms and inner homology elements (“- / -“ in FIG. 3C). As shown in Table 3b, the inventors identified certain intron fragments that do not require any homology elements that resulted in RNA circularization (e.g., Constructs GB0002_PRR1, GB0017_T4.v.td1, T4td-int22, T4td-int25, T4td-int 30 and T4td-int33). Table 3a. Circularization of T4td intron fragments with or without homology armsAttorney Docket No: ORB-014WO1 Table 3b. Circularization of T4td intron fragments without homology armsTable 4: Exemplary upstream and downstream sequences used in circular RNA constructsAttorney Docket No: ORB-014WO1Attorney Docket No: ORB-014WO1Attorney Docket No: ORB-014WO1Attorney Docket No: ORB-014WO1Attorney Docket No: ORB-014WO1EQUIVALENTS AND SCOPE

[0390] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The scope of the present invention is not intended to be limited to the above description, but rather is as set forth in the following claims:

Claims

Attorney Docket No: ORB-014WO1 Claims 1. A precursor nucleic acid molecule for making a circular RNA, comprising in 5’ to 3’ order: an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is between 180-260 nucleotides in length, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is between 110-210 nucleotides in length.

2. The precursor nucleic acid molecule of claim 1, wherein the upstream T4td Group I self-splicing intron fragment is between 220-230 nucleotides in length, and wherein the downstream T4td Group I self-splicing intron fragment is between 170-190 nucleotides in length.

3. The precursor nucleic acid molecule of claim 1 or 2, wherein the upstream T4td Group I self-splicing intron fragment is 244 nucleotides in length.

4. The precursor nucleic acid molecule of claim 3, wherein the downstream T4td Group I self-splicing intron fragment is between 170-190 nucleotides in length.

5. The precursor nucleic acid molecule of claim 1 or 2, wherein the upstream T4td Group I self-splicing intron fragment is 225 nucleotides in length.

6. The precursor nucleic acid molecule of claim 5, wherein the downstream T4td Group I self-splicing intron fragment is between 170-190 nucleotides in length.

7. The precursor nucleic acid molecule of claim 1 or 2, wherein the downstream T4td Group I self-splicing intron fragment is 189 nucleotides in length.

8. The precursor nucleic acid molecule of claim 7, wherein the upstream T4td Group I self-splicing intron fragment is between 200-250 nucleotides in length.

9. The precursor nucleic acid molecule of claim 1 or 2,Attorney Docket No: ORB-014WO1 wherein the downstream T4td Group I self-splicing intron fragment is 176 nucleotides in length.

10. The precursor nucleic acid molecule of claim 5, wherein the upstream T4td Group I self-splicing intron fragment is between 200-250 nucleotides in length.

11. The precursor nucleic acid molecule of claim 1 or 2, wherein the upstream T4td Group I self-splicing intron fragment is 244 nucleotides in length, and wherein the downstream T4td Group I self-splicing intron fragment is 189 nucleotides in length.

12. The precursor nucleic acid molecule of claim 1 or 2, wherein the upstream T4td Group I self-splicing intron fragment is 226 nucleotides in length, and wherein the downstream T4td Group I self-splicing intron fragment is 189 nucleotides in length.

13. The precursor nucleic acid molecule of claim 1 or 2, wherein the upstream T4td Group I self-splicing intron fragment is 227 nucleotides in length, and wherein the downstream T4td Group I self-splicing intron fragment is 176 nucleotides in length.

14. The precursor nucleic acid molecule of claim 1 or 2, wherein the upstream T4td Group I self-splicing intron fragment is 225 nucleotides in length, and wherein the downstream T4td Group I self-splicing intron fragment is 176 nucleotides in length.

15. The precursor nucleic acid molecule of claim 1 or 2, wherein the upstream T4td Group I self-splicing intron fragment is 244 nucleotides in length, and wherein the downstream T4td Group I self-splicing intron fragment is 176 nucleotides in length.

16. The precursor nucleic acid molecule of claim 1 or 2, wherein the upstream T4td Group I self-splicing intron fragment is 225 nucleotides in length, andAttorney Docket No: ORB-014WO1 wherein the downstream T4td Group I self-splicing intron fragment is 189 nucleotides in length.

17. The precursor nucleic acid molecule of claim 1 or 2, wherein the upstream T4td Group I self-splicing intron fragment is 185 nucleotides in length, and wherein the downstream T4td Group I self-splicing intron fragment is 165 nucleotides in length.

18. The precursor nucleic acid molecule of claim 1 or 2, wherein the upstream T4td Group I self-splicing intron fragment is 183 nucleotides in length, and wherein the downstream T4td Group I self-splicing intron fragment is 112 nucleotides in length.

19. The precursor nucleic acid molecule of claim 1 or 2, wherein the upstream T4td Group I self-splicing intron fragment is 183 nucleotides in length, and wherein the downstream T4td Group I self-splicing intron fragment is 104 nucleotides in length.

20. The precursor nucleic acid molecule of claim 1 or 2, wherein the upstream T4td Group I self-splicing intron fragment is 244 nucleotides in length, and wherein the downstream T4td Group I self-splicing intron fragment is 182 nucleotides in length.

21. A precursor nucleic acid molecule comprising: an upstream T4td Group I self-splicing intron fragment comprising a 3’ splice site and the nucleotide positions 850 to +7 of SEQ ID NO: 1, and a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site and the nucleotide positions -5 to 99 of SEQ ID NO:

1.

22. The precursor nucleic acid molecule of claim 21, wherein the upstream T4td Group I self-splicing intron fragment comprises the nucleotide positions 800 to +26 of SEQ ID NO: 1, and wherein the downstream T4td Group I self-splicing intron fragment comprises the nucleotide positions -20 to 169 of SEQ ID NO:

1.

23. The precursor nucleic acid molecule of claim 21,Attorney Docket No: ORB-014WO1 wherein the upstream T4td Group I self-splicing intron fragment comprises the nucleotide positions 850 to +17 of SEQ ID NO: 1, and wherein the downstream T4td Group I self-splicing intron fragment comprises the nucleotide positions -20 to 169 of SEQ ID NO:

1.

24. The precursor nucleic acid molecule of claim 21, wherein the upstream T4td Group I self-splicing intron fragment comprises the nucleotide positions 800 to +8 of SEQ ID NO: 1, and wherein the downstream T4td Group I self-splicing intron fragment comprises the nucleotide positions -20 to 169 of SEQ ID NO:

1.

25. The precursor nucleic acid molecule of claim 21, wherein the upstream T4td Group I self-splicing intron fragment comprises the nucleotide positions 852 to +17 of SEQ ID NO: 1, and wherein the downstream T4td Group I self-splicing intron fragment comprises the nucleotide positions -13 to 99 of SEQ ID NO:

1.

26. The precursor nucleic acid molecule of claim 21, wherein the upstream T4td Group I self-splicing intron fragment comprises the nucleotide positions 852 to +17 of SEQ ID NO: 1, and wherein the downstream T4td Group I self-splicing intron fragment comprises the nucleotide positions -5 to 99 of SEQ ID NO:

1.

27. The precursor nucleic acid molecule of claim 21, wherein the upstream T4td Group I self-splicing intron fragment comprises the nucleotide positions 800 to +9 of SEQ ID NO: 1, and wherein the downstream T4td Group I self-splicing intron fragment comprises the nucleotide positions -7 to 169 of SEQ ID NO:

1.

28. The precursor nucleic acid molecule of claim 21, wherein the upstream T4td Group I self-splicing intron fragment comprises the nucleotide positions 800 to +26 of SEQ ID NO: 1, and wherein the downstream T4td Group I self-splicing intron fragment comprises the nucleotide positions -13 to 169 of SEQ ID NO:

1.

29. The precursor nucleic acid molecule of claim 21, wherein the upstream T4td Group I self-splicing intron fragment comprises the nucleotide positions 800 to +7 of SEQ ID NO: 1, and wherein the downstream T4td Group I self-splicing intron fragment comprises the nucleotide positions -7 to 169 of SEQ ID NO: 1.Attorney Docket No: ORB-014WO1 30. The precursor nucleic acid molecule of claim 21, wherein the upstream T4td Group I self-splicing intron fragment comprises the nucleotide positions 800 to +26 of SEQ ID NO: 1, and wherein the downstream T4td Group I self-splicing intron fragment comprises the nucleotide positions -7 to 169 of SEQ ID NO:

1.

31. The precursor nucleic acid molecule of claim 21, wherein the upstream T4td Group I self-splicing intron fragment comprises the nucleotide positions 800 to +7 of SEQ ID NO: 1, and wherein the downstream T4td Group I self-splicing intron fragment comprises the nucleotide positions -20 to 169 of SEQ ID NO:

1.

32. The precursor nucleic acid molecule of any one of the preceding claims, wherein the precursor molecule does not comprise a 5’ homology arm or a 3’ homology arm.

33. The precursor nucleic acid molecule of any one of the preceding claims, wherein the precursor molecule does not comprise a 5’ homology arm and a 3’ homology arm.

34. The precursor nucleic acid molecule of any one of the preceding claims, wherein the precursor molecule comprises a nucleic acid encoding a sequence of interest between the upstream T4td Group I self-splicing intron fragment and the downstream T4td Group I self- splicing intron fragment.

35. The precursor nucleic acid molecule of claim 8, wherein the precursor molecule comprises a nucleic acid sequence encoding an internal ribosomal entry site (IRES) operably linked to the sequence of interest.

36. The precursor nucleic acid molecule of any one of the preceding claims, wherein the precursor molecule comprises a 5’ spacer sequence and / or a 3’ spacer sequence.

37. A precursor nucleic acid molecule comprising in the following order: i. an upstream T4 bacteriophage Td (T4td) Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 244 nucleotides in length, ii. a 5’ spacer sequence, iii. an internal ribosome entry site (IRES), iv. a sequence of interest, v. a 3’ spacer sequence, andAttorney Docket No: ORB-014WO1 vi. a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 189 nucleotides in length.

38. A precursor nucleic acid molecule comprising in the following order: i. an upstream T4td Group I self-splicing intron fragment comprising a 3’ splice site, wherein the upstream T4td Group I self-splicing intron fragment is 226 nucleotides in length, ii. a 5’ spacer sequence, iii. an internal ribosome entry site (IRES), iv. a sequence of interest, v. a 3’ spacer sequence, and vi. a downstream T4td Group I self-splicing intron fragment comprising a 5’ splice site, wherein the downstream T4td Group I self-splicing intron fragment is 189 nucleotides in length.

39. A method of producing a circular RNA, the method comprising: (a) providing a precursor nucleic acid molecule, wherein the precursor molecule comprises in 5’ to 3’ order: i. an upstream T4td Group I self-splicing intron fragment of greater than 180 nucleotides in length, ii. an IRES, iii. a sequence of interest, and iv. a downstream T4td Group I self-splicing intron fragment of greater than 95 nucleotides in length, and (b) allowing splicing of the T4td self-splicing intron from the precursor nucleic acid molecule, thereby circularizing the precursor molecule into the circular RNA.

40. The method of claim 39, wherein the 3’ T4td Group I self-splicing intron fragment is between 180-260 nucleotides in length, and the 5’ T4td Group I self-splicing intron fragment is between 110-210 nucleotides in length.

41. The method of claim 39, wherein the 3’ T4td Group I self-splicing intron fragment is between 220-230 nucleotides in length, and the 5’ T4td Group I self-splicing intron fragment is between 170-190 nucleotides in length.Attorney Docket No: ORB-014WO1 42. The method of claim 39, wherein the 3’ T4td Group I self-splicing intron fragment is 244 nucleotides in length, and the 5’ T4td Group I self-splicing intron fragment is 189 nucleotides in length.

43. A method of treating a disease in a subject, the method comprising administering to the subject the precursor nucleic acid molecule of any one of claims 1-38, or a circular RNA produced from the precursor nucleic acid molecule of any one of claims 1-38.

44. The method of claim 43, wherein the precursor nucleic acid molecule is linear RNA.

45. The method of any one of claims 39-44, wherein the sequence of interest encodes a chimeric antigen receptor (CAR), a therapeutic protein, an enzyme replacement protein, an antigen, or an antibody.

46. The method of claim 44, wherein the linear RNA is unmodified.

47. The method of claim 44, wherein the linear RNA is modified.

48. The method of claim 47, wherein the linear RNA comprises one or more modified nucleotides selected from N1-methylpseudouridine and / or 5-methoxyuridine.

49. The method of any one of claims 39-48, wherein the method makes intact circular RNA.

50. The method of claim 49, wherein the circular RNA is formulated in a delivery vehicle.

51. The method of claim 50, wherein the delivery vehicle is a lipid nanoparticle.

52. The method of claim 51, wherein the lipid nanoparticle is conjugated to a targeting moiety.

53. A circular RNA produced from the precursor nucleic acid molecule of any one of claims 1-38.

54. A circular RNA produced by the method of any one of claims 39-52.

Images