Circular functional nucleic acid, preparation method therefor and use thereof

Abstract

Provided are a circular functional nucleic acid, a preparation method therefor and a use thereof. The method involves combining a functional nucleic acid with a circular nucleic acid, using a method combining DNA template-directed assembly with enzymatic conjugation to first prepare a single-stranded circular DNA, synthesize a corresponding outer short strand, and conjugate a functional nucleic acid drug onto the outer short strand, and optimizing and screening reaction conditions, thereby preparing a circular functional nucleic acid. The circular functional nucleic acid has the characteristics of adjustable size, adjustable valence state (multivalent or polyvalent), high stability, and the capability for chemical conjugation with drugs or drug incorporation, etc.; a novel circular multivalent functional nucleic acid technology is created, which significantly enhances the targeting ability and stability of nucleic acid drugs; thus, a nucleic acid drug development platform o-FLARE having efficient targeting, immune agonism, and protein degradation functions can be established.

Description

Annular functional nucleic acid and preparation method and application thereof TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine, and specifically relates to an annular functional nucleic acid and a preparation method and application thereof. BACKGROUND

[0002] Malignant tumors have strong heterogeneity and dynamic changes, and many tumor treatment methods have treatment bottlenecks such as escape, drug resistance, metastasis and recurrence. Taking pancreatic cancer as an example, due to the high frequency of KRAS mutation, poor immunogenicity, high immunosuppression and high fibrosis of the tumor microenvironment, it presents typical "cold tumor" characteristics, and it is difficult to achieve precise targeting.

[0003] Targeted therapy is the main means of malignant tumor treatment, and nucleic acid drugs (also known as functional nucleic acids) have great potential in tumor targeted therapy. Among them, nucleic acid aptamers have the characteristics of high affinity and high specificity in recognizing specific target molecules, which improves the target enrichment of chemotherapeutic drugs. In addition to targeted recognition, most other functional nucleic acid drugs (ASO, CpG, etc.) can regulate mRNA stability and transcription, thereby regulating the expression of target genes. However, functional nucleic acids have always faced the bottlenecks of easy degradation, short blood circulation and difficulty in extrahepatic targeting. Therefore, it is urgent to find a functional nucleic acid that can realize stable performance, efficient delivery and precise targeting to solve the problems of targeting, stability and long-term circulation of functional nucleic acids.

[0004] Annular nucleic acid refers to a class of closed circular nucleic acid molecules, which is a type of nucleic acid molecule structure widely existing in nature, has stable structure and good anti-enzyme cutting ability. Based on the structure of annular nucleic acid, the nucleic acid drugs can be modified, which can solve the problems in the application of nucleic acid drugs. However, due to the limited synthesis method and application demand of annular nucleic acid field, the application research of annular nucleic acid is still in the primary stage, which also poses great challenges to the research in this field.

[0005] CN116790608A provides an annular nucleic acid aptamer, which is prepared by circularizing ordinary linear nucleic acid aptamer, and it is believed that the annular nucleic acid aptamer can improve the stability and has important significance for cancer treatment. However, the direct circularization of linear nucleic acid aptamer changes its spatial structure, which will inevitably have certain adverse effects on the functionality of nucleic acid aptamer.

[0006] According to the application research demand of functional nucleic acid field and the current research status of annular nucleic acid field, it is urgent to find a more reasonable and efficient solution, and it is expected to combine the characteristics of functional nucleic acid and annular nucleic acid, to realize low-cost and efficient synthesis, to solve the problems of targeting, stability and long-term circulation of functional nucleic acid, and to improve the curative effect.

[0007] SUMMARY

[0008] To solve the above problems, the application provides a kind of annular functional nucleic acid and its preparation method and application, combine functional nucleic acid with annular nucleic acid, use DNA template assembly cooperation enzyme method coupling method, first prepare single-stranded annular nucleic acid, synthesis corresponding outer short chain, and couple functional nucleic acid drug on outer short chain, optimize screening reaction conditions, to prepare annular functional nucleic acid, with adjustable size, adjustable valence (multivalent or multiple), strong stability, can be chemically coupled drug or drug chimeric etc., create annular multivalent functional nucleic acid new technology, can significantly improve the targeting and stability of nucleic acid drugs, construct the nucleic acid drug development platform o-FLARE with efficient targeting, immune stimulation, protein degradation function.

[0009] The application develops a kind of brand-new annular functional nucleic acid and annular functional nucleic acid coupling drug o-FLARE new technology, multiple functional nucleic acids are accurately assembled and coupled, small molecule drugs, antibodies, nanobodies, single-chain antibodies, polypeptides and other functional groups can be simultaneously coupled, to construct stable structure, component can be coded, long-acting circulating targeted nucleic acid drugs, solve the targeting, stability and long-acting circulation problem of nucleic acid drugs.The o-FLARE innovative technology disclosed in the application will promote the development of targeted functional nucleic acid drugs, and will also promote the deep integration of mRNA, gene editing technology and tumor treatment.

[0010] In one aspect, the application provides an annular functional nucleic acid, which comprises an annular nucleic acid and a functional conjugate, the functional conjugate is connected to the annular nucleic acid, and the functional conjugate comprises one or more of nucleic acid, drug, and nucleic acid-drug complex.

[0011] Further, the nucleic acid in the annular nucleic acid comprises any one or more of DNA, RNA, microRNA, siRNA, shRNA, mRNA, microRNA, siRNA, shRNA, and lncRNA.

[0012] Further, the annular nucleic acid is a double-stranded annular nucleic acid, which comprises an inner annular single strand and an outer complementary short strand; the sequence and number of the outer complementary short strand are matched and designed according to the sequence and length of the inner annular single strand.

[0013] It can be understood that the inner side of the annular nucleic acid is a complete single-stranded closed loop, and the outer side is composed of a plurality of short strands complementary to the single-stranded closed loop; the length of the outer complementary short strand can be designed according to product needs, but the key is that each outer complementary short strand is combined together and can be completely matched with the inner annular single strand, so as to form a complete double-stranded annular nucleic acid.

[0014] Further, the functional conjugate is connected to the outer side complementary short strand of the double-stranded circular nucleic acid; the number of the functional conjugate is 1 or more than 1.

[0015] In some modes, the functional conjugate is connected to the outer side complementary short strand, which is equivalent to replacing some bases on the outer side complementary short strand with the functional conjugate, so that when the outer side complementary short strand is combined with the inner side single-stranded circular strand, the functional conjugate is also combined to form a circular functional nucleic acid.

[0016] Further, when the functional conjugate is an aptamer, the number of the functional conjugate is preferably 3-6, which is uniformly distributed on the outer side complementary short strand of the double-stranded circular nucleic acid.

[0017] In some modes, the number of the functional conjugate is equivalent to the valence, and the number of the functional conjugate is 3 or 6, which is equivalent to a trivalent circular functional nucleic acid or a hexavalent circular functional nucleic acid.

[0018] The functional region of the circular functional nucleic acid needs to be free to function, that is, the individual efficacy of each functional conjugate needs to be ensured, and a suitable valence can help each functional conjugate to function freely. Studies have shown that trivalent and hexavalent circular multivalent aptamers exhibit better targeting ability and absorption capacity, which may be because in trivalent and hexavalent circular multivalent aptamers, each aptamer can function more effectively and can also cooperate with each other to promote the effect.

[0019] Further, when the functional conjugate is an ASO-aptamer complex, the number of the functional conjugate is preferably 4 (equivalent to a divalent ASO, a divalent aptamer), which is uniformly distributed on the outer side complementary short strand of the double-stranded circular nucleic acid.

[0020] For different functional conjugates, the spatial structure of the circular functional nucleic acid constructed is different, and the effect on the functional conjugate is also different. For the ASO-aptamer complex, the tetravalent circular ASO (equivalent to a divalent ASO, a divalent aptamer) is more conducive to improving the targeting ability and absorption capacity.

[0021] Further, the nucleic acid of the inner side single-stranded circular strand, the outer side complementary short strand, or the functional conjugate can have a modification, and the modification includes one or more of a phosphate backbone modification, a base modification, a nucleotide modification, an enzyme modification, a methylation modification, and a phosphorylation modification.

[0022] The functional nucleic acid prepared by the application is connected with the functional conjugate and the circular nucleic acid, and the circular nucleic acid can be connected with multiple functional conjugates, so that the circular multivalent functional nucleic acid is prepared. According to the different functional conjugates, different circular multivalent functional nucleic acids can be prepared. The circular nucleic acid includes circular RNA, single-stranded circular DNA, double-stranded circular DNA and the like. The circular nucleic acid is connected with the functional conjugate, and various circular multivalent functional nucleic acids can be prepared.

[0023] In some modes, the application provides a circular multivalent nucleic acid aptamer, which comprises a circular nucleic acid and a nucleic acid aptamer, and the nucleic acid aptamer is connected with the circular nucleic acid.

[0024] In some modes, the application provides a circular multivalent nucleic acid aptamer-drug complex, which comprises a circular nucleic acid and a nucleic acid aptamer-drug complex, and the nucleic acid aptamer-drug complex is connected with the circular nucleic acid.

[0025] In some modes, the application provides a circular multivalent nucleic acid aptamer-antibody complex, which comprises a circular nucleic acid and a nucleic acid aptamer-drug complex, and the nucleic acid aptamer-drug complex is connected with the circular nucleic acid.

[0026] In some modes, the application provides a circular multivalent nucleic acid aptamer-polypeptide complex, which comprises a circular nucleic acid and a nucleic acid aptamer-drug complex, and the nucleic acid aptamer-drug complex is connected with the circular nucleic acid.

[0027] In some modes, the application provides a circular multivalent antisense functional nucleic acid, which comprises a circular nucleic acid and an antisense functional nucleic acid, and the antisense functional nucleic acid is connected with the circular nucleic acid.

[0028] In some modes, the application provides a circular multivalent CpG oligonucleic acid, which comprises a circular nucleic acid and a CpG oligonucleic acid, and the CpG oligonucleic acid is connected with the circular nucleic acid.

[0029] In another aspect, the application provides a preparation method of the circular functional nucleic acid, and the method comprises the following steps:

[0030] (1) synthesizing an inner side single-stranded circular nucleic acid;

[0031] (2) synthesizing an outer side complementary short chain, and the outer side complementary short chain is connected with a functional conjugate; the functional conjugate comprises one or more of nucleic acid, drug, and a complex of nucleic acid and drug.

[0032] (3) reacting the inner side single-stranded circular nucleic acid with the outer side complementary short chain to synthesize the circular functional nucleic acid.

[0033] The application designs a clever preparation method for the preparation of the circular functional nucleic acid, and the preparation is performed by using the DNA template assembly and the coupling enzyme method, which is simple and efficient.

[0034] Further, the synthesis method of the inner loop single strand in step (1) is as follows: synthesizing linear single strand and splint DNA respectively, connecting the linear single strand and the splint DNA to form a closed loop structure, cutting the splint DNA on the closed loop structure, and obtaining the inner loop single strand; the sequence of the splint DNA is completely complementary to the 10-30 base sequences on both sides of the 5' and 3' ends of the linear single strand.

[0035] Further, the linear single strand comprises a nucleotide sequence shown in any one or more of the sequence tables SEQ ID NO. 1-4; and the splint DNA comprises a nucleotide sequence shown in the sequence table SEQ ID NO. 5.

[0036] In some ways, the synthesis method of the inner loop single strand in step (1) comprises:

[0037] 1) reacting the linear single strand and the splint DNA, adding the linear single strand, the splint DNA, T4 ligase buffer, and PBS into a PCR instrument for reaction at 80-95℃ for 0-1h, gradient cooling for 1-3h, and cooling to 4-16℃;

[0038] 2) adding T4 nucleic acid ligase to the reaction solution of step 1) for reaction for 1-48h;

[0039] 3) verifying the formation of the closed loop structure by urea denaturation gel, terminating the reaction, then adding exonuclease to the reaction solution, and reacting at 37℃ for about 1-4h to cut off the splint DNA;

[0040] 4) extracting the reaction solution of step 3) with DNA extraction solution according to a volume ratio of (1-3):1 to remove the enzymes in the reaction solution, taking the supernatant, adding ammonium acetate and anhydrous ethanol for low-temperature precipitation, centrifuging to remove the supernatant, and adding PBS or water to the precipitate for redissolution;

[0041] 5) selecting a suitable ultrafiltration tube according to the size of the loop DNA molecule for ultrafiltration purification to obtain the final loop single strand DNA.

[0042] In some ways, the linear single strand in step 1) is any one of ssl60 (SEQ ID NO. 1), ssl80 (SEQ ID NO. 2), ssl100 (SEQ ID NO. 3), ssl120 (SEQ ID NO. 4); the amount ratio of the linear single strand to the splint DNA substance is 1:2; the T4 ligase buffer consists of 366 mM Tris-HCl (pH 7.6), 6.6 mM MgCl2, 10 mM DTT and 0.1 mM ATP.

[0043] In some ways, the amount of T4 nucleic acid ligase added in step 2) is 15-20 U / μL.

[0044] In some ways, the amount of exonuclease added in step 3) is 15-20 U / μL.

[0045] In some ways, the composition of the DNA extraction solution in step 4) is phenol: chloroform: isoamyl alcohol = 25:24:1; ammonium acetate PH = 5.2, the concentration is 3 mM.

[0046] In some ways, the ultrafiltration tube in step 5) is 10 kDa or 30 kDa.

[0047] In the synthesis process of the inner side loop single strand, the 5' and 3' ends of the single strand loop nucleic acid are connected by using T4 nucleic acid ligase. In some ways, the T4 nucleic acid ligase includes one or more of T4 DNA ligase, T4 RNA ligase.

[0048] It can be understood that the sequence for constructing the inner side loop single strand DNA and the outer side complementary short chain DNA is not fixed and can be selected as needed. The outer side complementary short chain DNA is equivalent to dividing the inner side loop single strand DNA into multiple short sequences, and the complementary short chain designed for each short sequence is combined together, that is, the complete outer side loop chain complementary to the inner side loop single strand DNA.

[0049] Further, the outer side complementary short chain in step (2) includes any one or more of X-1, X-2, X-3, X-4, X-5, X-6; X-1=tctccgttccSagcacatcct, X-2=ctctgaccagSgtccttcact, X-3=cacgcgttttStgcagtcctc, X-4=ggctccttggSgttgcgatct, X-5=gttggtcagtScgattccggt, X-6=cgtgttagctSgcagatggca; S is a functional coupling.

[0050] Further, in the reaction process of the inner side loop single strand and the outer side complementary short strand in step (3), when the linear single strand used for preparing the inner side loop single strand has the nucleotide sequence shown in SEQ ID NO. 1, the outer side complementary short strand comprises X-1, X-3 and X-4; when the linear single strand used for preparing the inner side loop single strand has the nucleotide sequence shown in SEQ ID NO. 2, the outer side complementary short strand comprises X-1, X-2, X-3 and X-4; when the linear single strand used for preparing the inner side loop single strand has the nucleotide sequence shown in SEQ ID NO. 3, the outer side complementary short strand comprises X-1, X-2, X-3, X-4 and X-5; when the linear single strand used for preparing the inner side loop single strand has the nucleotide sequence shown in SEQ ID NO. 4, the outer side complementary short strand comprises X-1, X-2, X-3, X-4, X-5 and X-6.

[0051] In other words, the inner side loop single strand DNA is any one of ssc60, ssc80, ssc100 and ssc120, ssc60 reacts with strand X-1, 3, 4, ssc80 reacts with strand X-1, 2, 3, 4, ssc100 reacts with strand X-1, 2, 3, 4, 5, and ssc120 reacts with strand X-1, 2, 3, 4, 5, 6.

[0052] The sequence design of the inner side loop single strand and the outer side complementary short strand here is only an example and is not limited thereto. In the experimental study, it is found that the design of such nucleic acid sequence is helpful to successfully complete the construction of the loop functional nucleic acid and does not cause problems such as excessive repetition of a certain base affecting the construction of the loop functional nucleic acid. However, the sequence and length of the inner side loop single strand and the outer side complementary short strand can be adjusted according to actual needs.

[0053] In some modes, the S is a nucleic acid aptamer sequence, such as nucleic acid aptamer SL1, Sgc8c or PD4S, etc., wherein SL1 = ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT (SEQ ID NO. 6), sgc8c = ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA (SEQ ID NO. 7), PD4S = CGCACTATGTTTTACGAGCCGTTTCCTCGGCAGATAGTAAGTGC (SEQ ID NO. 8), which is used for preparing the loop multivalent nucleic acid aptamer.

[0054] In some ways, the S is a nucleic acid aptamer sequence with a DBCO modification (DBCO-nucleic acid aptamer), such as SL1-DBCO = ATCAGGCTGGATGGT (DBCO) AGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT, which can be used for the preparation of circular multivalent nucleic acid aptamer-drug complexes.

[0055] In some ways, the S is any one or more ASOs, such as ASO = (MOE-T) * (MOE-G) * (MOE-C) * (MOE-A) * (MOE-C) * (dT) * (dG) * (dT) * (dA) * (dC) * (dT) * (dC) * (dC) * (dT) * (dC) * (MOE-T) * (MOE-T) * (MOE-G) * (MOE-A) * (MOE-C) (* represents base thio modification), which is used for the preparation of circular multivalent ASOs.

[0056] In some ways, the S is any one or more CpGs, such as ODN 1826 = tccatgacgttcctgacgtt (all base thio modification), which is used for the preparation of circular multivalent CpGs.

[0057] In some ways, the method for synthesizing a circular functional nucleic acid in step (3) comprises:

[0058] 1) The inner side of the single strand is reacted with 3-6 DNA in the outer side of the complementary short chain X-1, X-2, X-3, X-4, X-5 and X-6, the reaction chain, T4 ligase buffer, added to PBS, and the pcr instrument is reacted at 95℃ for 5min, and the temperature is gradually reduced to 4℃;

[0059] 2) The reaction solution is added with T4 ligase, and reacted at 16℃ for 3-4h;

[0060] 3) The reaction solution is added with exonuclease, and reacted at 37℃ for 2h;

[0061] 4) Extraction and precipitation;

[0062] 5) Resuspend, ultrafiltration, and obtain the final circular double-stranded DNA.

[0063] Further, when the functional conjugate is a nucleic acid-drug complex, the preparation process further comprises preparation of an outer complementary short chain X-R1-R3-R2-Y, wherein X is a nucleic acid with a complementary short chain, R1 is a modification group of X, R3 is a linking group of X and a drug, Y is a drug, and R2 is a modification group of Y; the method for synthesizing X-R1-R3-R2-Y comprises: reacting X-R1 and Y-R2 in a molar ratio of 1:(1-10), using PBS as a buffer, using a shaker at 500-2000 rpm, and reacting overnight, and obtaining the outer complementary short chain X-R1-R3-R2-Y after ultrafiltration.

[0064] In some modes, the method for synthesizing the circular functional nucleic acid in step (3) comprises: reacting the inner circular single strand and the outer complementary short chain in a molar ratio of 1:(1-10), using PBS as a buffer, using a shaker at 500-2000 rpm, and reacting overnight, and obtaining the final product of the circular functional nucleic acid after ultrafiltration.

[0065] In some modes, R1 comprises a linker comprising any one or more of an amino group, a hydroxyl group, a thiol group, an NHS lipid, a carboxyl group, an azide, an alkyne, an alkene, a maleimide, an S-tetrazine, a DBCO, a TCO, and a BCN at a terminal end; R2 comprises a linker comprising any one or more of an amino group, a hydroxyl group, an NHS lipid, a carboxyl group, an azide, an alkyne, an alkene, a maleimide, an S-tetrazine, a DBCO, a TCO, and a BCN at a terminal end; and R3 comprises any one or more of a coupling reaction between a terminal group of R1 and a terminal group of R2 to generate a coupling group.

[0066] It can be understood that the outer complementary short chain for constructing the nucleic acid-drug complex with the outer complementary short chain does not necessarily have to be consistent with the sequences of X-1 to X-6 described above, and the sequences of the inner circular single strand and the outer complementary short chain can be additionally designed according to the sequence of the circular functional nucleic acid-drug complex to be prepared, as long as the construction of the circular functional nucleic acid-drug complex can be completed.

[0067] Further, when the functional conjugate is a nucleic acid-antibody complex or a nucleic acid-polypeptide complex, the preparation method of the circular functional nucleic acid is consistent with that of the nucleic acid-drug complex, and the drug is replaced by an antibody or a polypeptide.

[0068] In another aspect, the present application provides a preparation method of a circular nucleic acid, comprising the following steps:

[0069] (a) synthesizing an inner circular single strand;

[0070] (b) synthesizing an outer complementary short chain;

[0071] (c) reacting the single-stranded circular nucleic acid and the outer complementary short chain to synthesize a circular nucleic acid.

[0072] Further, the synthesis method of the inner side loop single strand in step (a) is: synthesizing linear single strand and splint DNA respectively, connecting the linear single strand and the splint DNA to form a closed loop structure, cutting the splint DNA on the closed loop structure, and obtaining the inner side loop single strand; the sequence of the splint DNA is completely complementary to the 10-30 base sequences on both sides of the 5' and 3' ends of the linear single strand.

[0073] Further, the linear single strand is any one of ssl60 (SEQ ID NO. 1), ssl80 (SEQ ID NO. 2), ssl100 (SEQ ID NO. 3), and ssl120 (SEQ ID NO. 4); and the splint DNA comprises the nucleotide sequence shown in the sequence table SEQ ID NO. 5.

[0074] Further, the outer side complementary short chain in step (b) comprises any one or more of X-1, X-2, X-3, X-4, X-5, and X-6; X-1=tctccgttccagcacatcct, X-2=ctctgaccaggtccttcact, X-3=cacgcgtttttgcagtcctc, X-4=ggctccttgggttgcgatct, X-5=gttggtcagtcgattccggt, and X-6=cgtgttagctgcagatggca.

[0075] Further, in the reaction process of the inner side loop single strand and the outer side complementary short chain in step (3), ssc60 reacts with chains X-1, 3, and 4, ssc80 reacts with chains X-1, 2, 3, and 4, ssc100 reacts with chains X-1, 2, 3, and 4, and ssc120 reacts with chains X-1, 2, 3, 4, 5, and 6.

[0076] Further, the preparation method of the circular nucleic acid comprises the following steps:

[0077] a) The inner side loop single strand is reacted with 3-6 DNA among X-1, 2, 3, 4, 5, and 6, the reaction chain, T4 ligase buffer, is added to PBS, and a PCR instrument is used for reaction at 95°C for 5 min and gradient cooling to 4°C;

[0078] b) The reaction solution is added with T4 ligase, and reacted at 16°C for 3-4 h;

[0079] c) The reaction solution is added with exonuclease, and reacted at 37°C for 2 h;

[0080] d) Extraction and precipitation;

[0081] e) reconstitution, ultrafiltration, to obtain the final circular double-stranded DNA.

[0082] In another aspect, the present application provides a preparation method of circular multivalent aptamer, which adopts the preparation method of circular functional nucleic acid as described above, wherein the S sequence in the outer complementary short chain is any one or more aptamer sequences.

[0083] In some embodiments, the present application prepares circular multivalent aptamer of SL1 (SEQ ID NO. 6), Sgc8c (SEQ ID NO. 7), and PD4S (SEQ ID NO. 8), including different valences of the same aptamer, and different valences of different aptamers.

[0084] In some embodiments, when the outer complementary short chain is X-2, X-4, X-6, S = sgc8c; when the outer complementary short chain is X-1, X-3, X-5, S = SL1, that is, the six-valent circular functional nucleic acid contains two aptamers.

[0085] In some embodiments, when the outer complementary short chain is X-2, X-5, S = sgc8c; when the outer complementary short chain is X-1, X-4, S = SL1; when the outer complementary short chain is X-3, X-6, S = PD4S, that is, the six-valent circular functional nucleic acid contains three aptamers (Figure 6-c).

[0086] In another aspect, the present application provides a preparation method of circular multivalent ASO, which contains ASO or aptamer in the outer complementary short chain. The circular multivalent ASO prepared by the present application includes different valences of the same ASO, and different valences of different ASOs; and the circular multivalent ASO + aptamer is also prepared, which can help the ASO enter the cell through the targeting function of the aptamer. The steps are the same as those of the preparation method of circular double-stranded nucleic acid. When preparing the circular trivalent ASO, ssl120 (SEQ ID NO. 4) is used for preparation, the outer complementary short chain is X-1, 3, 5, and the S sequence is absent; the reaction chain is X-2, 4, 6, and the S is one or more ASO sequences; when preparing the circular six-valent ASO + aptamer, the reaction chain is X-1, 3, 5, the outer complementary short chain is SL1, and the S is one or more ASO sequences.

[0087] In another aspect, the present application provides a preparation method of a circular multi-valent CpG containing any one or more CpGs or nucleic acid aptamers in the outer complementary short chain. The circular multi-valent CpG prepared by the present application includes different valence states of the same CpG and different valence states of different CpGs; and a circular multi-valent CpG+aptamer is also prepared to assist the CpG into cells through the targeting function of the nucleic acid aptamer. The steps are the same as those in the preparation method of the circular double-stranded nucleic acid. When the circular tri-valent CpG is prepared, the reaction chain is X-1, 3, 5, S, and there is no sequence of X-2, 4, 6, S. When the circular multi-valent CpG+aptamer is prepared, the reaction chain is X-1, 3, 5, S, and the sequence of X-2, 4, 6, S is CLN0020 (a nucleic acid aptamer targeting CD16).

[0088] In another aspect, the present application provides a preparation method of a circular multi-valent nucleic acid-drug complex, which adopts the preparation method of the circular functional nucleic acid as described above, wherein SL1-DBCO is a nucleic acid aptamer with a modification (wherein SL1 is a nucleic acid aptamer SL1 with an outer complementary short chain, and DBOC is a modification group), and N3-Vc-MMAE / diABZI is a drug with a N3-Vc modification. The present application prepares two nucleic acid aptamer-drug complexes SL1-MMAE and SL1-diABZI with an outer complementary short chain. The preparation method of the circular multi-valent nucleic acid-drug complex includes the following steps:

[0089] 1) Preparation of a nucleic acid aptamer-drug complex with an outer complementary short chain: SL1-DBCO and Vc-MMAE / diABZI are reacted in a molar ratio of 1:2, the buffer is PBS, the shaking speed is 800 rpm, the reaction is carried out overnight, and the final product SL1-MMAE / diABZI (SL1 is connected with a modification group DBCO, and MMAE / diABZI is connected with a modification group N3-Vc) is obtained after ultrafiltration;

[0090] 2) Reaction of the inner circular single strand with SL1-MMAE / diABZI, and the steps are the same as those in the preparation method of the circular double-stranded nucleic acid;

[0091] 3) Ultrafiltration for purification to obtain the final product.

[0092] In some ways, the preparation process of the annular multivalent nucleic acid-drug complex includes the preparation of the outer complementary short chain X-R1-R3-R2-Y, wherein X is a nucleic acid with a complementary short chain, R1 is a modification group of X, R3 is a linking group of X and a drug, Y is a drug, and R2 is a modification group of Y. The method for synthesizing X-R1-R3-R2-Y includes: 1) reacting X-R1 and Y-R2 in a molar ratio of 1:(1-10), using PBS as the buffer, using a shaker at 500-2000 rpm, reacting overnight, and obtaining the outer complementary short chain X-R1-R3-R2-Y after ultrafiltration.

[0093] 2) reacting the inner annular single strand with X-R1-R3-R2-Y, and the reaction steps are the same as those in the preparation method of the double-stranded annular nucleic acid;

[0094] 3) ultrafiltration purification to obtain the final product annular multivalent nucleic acid-drug complex.

[0095] The present application prepares three kinds of annular multivalent nucleic acid aptamer-drug complexes, uses the annular single strand ssc120 DNA as the inner annular single strand, and synthesizes an annular six-valent nucleic acid aptamer-drug complex, wherein the drugs are MMAE, diABZI, and MMAE+diABZI, respectively.

[0096] The structure of the annular nucleic acid, the annular functional nucleic acid, and the annular functional nucleic acid-drug complex constructed by the present application is shown in FIG. 1.

[0097] In another aspect, the present application provides a use of an annular functional nucleic acid for preparing a reagent for improving the affinity of a nucleic acid aptamer to a target, wherein the annular functional nucleic acid comprises an inner annular single strand and an outer complementary short chain, and the outer complementary short chain is connected with a nucleic acid aptamer.

[0098] In another aspect, the present application provides a use of an annular functional nucleic acid for preparing a reagent for improving the tumor targeting ability, wherein the annular functional nucleic acid comprises an inner annular single strand and an outer complementary short chain, and the outer complementary short chain is connected with a nucleic acid aptamer.

[0099] In another aspect, the present application provides a use of an annular functional nucleic acid for preparing a reagent for prolonging the retention in a tumor, characterized in that the annular functional nucleic acid comprises an inner annular single strand and an outer complementary short chain, and the outer complementary short chain is connected with a nucleic acid aptamer.

[0100] The annular functional nucleic acid, the preparation method and the application provided by the present application have the following beneficial effects:

[0101] (1) A brand-new annular multivalent functional nucleic acid preparation technology is provided, which combines the functional nucleic acid with the annular nucleic acid, significantly improves the targeting and stability of the nucleic acid drug, and constructs a nucleic acid drug development platform o-FLARE.

[0102] (2) The synthesis of the circular multi-valent functional nucleic acid is simple and efficient, does not need to go through a complex reaction, and the synthesis yield of the final product can reach about 80%;

[0103] (3) The circular multi-valent nucleic acid aptamer-drug complex is also constructed, the synthesis steps are simple, the type and proportion of the coupled drug are convenient to control, the purification method is simple, and the synthesis yield of the final product can reach about 80%;

[0104] (4) The circular multi-valent functional nucleic acid is a completely closed loop structure, and the stability is greatly improved; compared with the nucleic acid aptamer / nucleic acid aptamer-drug monomer, the circular multi-valent nucleic acid aptamer / circular multi-valent nucleic acid aptamer-drug complex has better serum stability and longer blood circulation;

[0105] (5) The circular multi-valent functional nucleic acid has the characteristic of size controllability, different lengths of the inner ring provide different sizes of the circular multi-valent functional nucleic acid, and the overall structure size is about 5nm-20nm;

[0106] (6) The circular structure in the circular multi-valent functional nucleic acid can be precisely controlled by changing the different side chains of the outer ring, the nucleic acid type and different valence of the outer ring side chain, efficiently synthesizing the valence-controllable circular functional nucleic acid, including different valences of the same functional nucleic acid and different valences of different functional nucleic acids; at the same time, the drug combination and drug proportion are precisely controlled, the synergistic effect between drugs is promoted, and the cancer treatment effect is increased;

[0107] (7) The circular multi-valent functional nucleic acid aptamer has greatly improved affinity compared with the monovalent nucleic acid aptamer, the multi-valent structure of the same nucleic acid aptamer better targets tumor cells, has better affinity to tumor cells, and further increases the enrichment of drug molecules in tumor cells;

[0108] (8) By connecting different nucleic acid aptamers on the circular multi-valent nucleic acid, multi-target targeting can be realized, which is beneficial to increase the interaction between tumor cells and immune cells. BRIEF DESCRIPTION OF DRAWINGS

[0109] FIG. 1 is a structure diagram of a circular nucleic acid, a circular functional nucleic acid, and a circular functional nucleic acid-drug complex;

[0110] FIG. 2 is a preparation flowchart of the inner side circular single-stranded DNA (sscDNA) in Example 1;

[0111] FIG. 3 is a preparation flowchart of the circular double-stranded nucleic acid DNA (dscDNA) in Example 1;

[0112] FIG. 4 is a synthesis route flowchart of the circular multi-valent nucleic acid aptamer in Example 2;

[0113] Figure 5 is a graph showing the optimization of the ratio of nucleic acid strands used in the synthesis of the inner looped single-stranded, the circular double-stranded, and the circular multivalent nucleic acid aptamer in Example 3;

[0114] Figure 6 is a graph showing the gel electrophoresis characterization of the inner looped single-stranded, the circular double-stranded, and the circular multivalent nucleic acid aptamer in Example 4, wherein (a) preparation of the looped single-stranded DNA and the circular double-stranded DNA; (b) preparation of the circular multivalent nucleic acid aptamer; (c) preparation of the circular multivalent nucleic acid aptamer of the same nucleic acid aptamer and different nucleic acid aptamer;

[0115] Figure 7 is a graph showing the MALDI circular characterization of the molecular weight in Example 5, wherein (a) molecular weight of the looped single-stranded ssc; (b) molecular weight of the circular double-stranded dsc; (c) molecular weight of the circular multivalent nucleic acid aptamer; (d) molecular weight of the circular multivalent nucleic acid aptamer-drug complex;

[0116] Figure 8 is a graph showing the characterization of the size by DLS in Example 6;

[0117] Figure 9 is a graph showing the circular dichroism characterization of the DNA structure of the circular multivalent nucleic acid aptamer in Example 7;

[0118] Figure 10 is a graph showing the gel electrophoresis characterization of the enzyme digestion stability and serum stability of the circular multivalent nucleic acid aptamer in Example 8, wherein (a) is a graph showing the enzyme digestion stability of the linear single-stranded, the inner looped single-stranded, the circular double-stranded nucleic acid, and the circular multivalent nucleic acid aptamer; (b) is a graph showing the serum stability of the nucleic acid aptamer, the circular trivalent nucleic acid aptamer, the circular quadrivalent nucleic acid aptamer, the circular pentavalent nucleic acid aptamer, and the circular hexavalent nucleic acid aptamer;

[0119] Figure 11 is a graph showing the flow cytometry analysis of the targeting ability and the uptake ability of the circular multivalent nucleic acid aptamer to the target cell AsPC1 in Example 9, wherein (a) cell level targeting effect of the circular multivalent nucleic acid aptamer; (b) cell level endocytosis effect of the circular multivalent nucleic acid aptamer; HPNE is a low expression cMET negative cell, and AsPC1 is a high expression cMET positive cell;

[0120] Figure 12 is a graph showing the confocal analysis of the targeting ability and the uptake ability of the circular multivalent nucleic acid aptamer to the target cell AsPC1 in Example 10;

[0121] Figure 13 is a graph showing the animal imaging study of the tumor targeting ability of the circular multivalent nucleic acid aptamer in vivo in Example 11;

[0122] Figure 14 is a graph showing the gel electrophoresis characterization of the circular multivalent nucleic acid aptamer-drug complex in Example 12, wherein (a) preparation of the monovalent nucleic acid aptamer-drug complex; (b) preparation of the circular multivalent nucleic acid aptamer-drug complex;

[0123] Figure 15 is a schematic diagram of the toxicity analysis of the circular multivalent aptamer-drug complex in Example 13;

[0124] Figure 16 is a schematic diagram of the analysis results of the immune activation of BMDC cells by the circular hexavalent aptamer-drug conjugate and free drug molecules in Example 14;

[0125] Figure 17 is a graph of the tumor inhibition effect of the circular multivalent aptamer-drug complex in Example 15, wherein (a) is the change in tumor volume of mice, and (b) is the change in body weight of mice. DETAILED DESCRIPTION

[0126] The present application will be further described in conjunction with the accompanying drawings and examples. It should be noted that the following examples are intended to facilitate the understanding of the present application and do not limit the present application in any way. The experimental reagents, consumables and experimental instruments used in the following examples are commercially available if not specified.

[0127] Example 1: Preparation of circular nucleic acid

[0128] The preparation process of the circular nucleic acid provided in this example is as follows:

[0129] (1) Preparation of inner circular single-stranded DNA

[0130] The synthesis route of the inner circular single-stranded DNA is shown in Figure 2, and the following five kinds of inner circular single-stranded DNA are synthesized:

[0131] a. Synthesis of 60 nt inner circular single-stranded DNA (ssc60):

[0132] The sequence of ssl60 is AGATCGCAACCCAAGGAGCCGAGGACTGCAAAAACGCGTGAGGATGTGCTGGAACGGAGA (SEQ ID NO. 1), and the sequence of splint DNA is CTTGGGTTGCGATCTTCTCCGTTCCAGCAC (SEQ ID NO. 5).

[0133] 1) The following reaction system was prepared in DPBS buffer: 5' phosphorylated modified 60 nt linear single-stranded (ssl60) DNA, 1.62 nmol, complementary short-chain splint DNA 3.24 nmol, T4 ligase buffer (consisting of 366 mM Tris-HCl, pH 7.6, 6.6 mM MgCl2, 10 mM DTT and 0.1 mM ATP) with a total volume of 1.5 mL.

[0134] 2) The above reaction system is placed at 95°C for 5 min, 85°C-65°C for 30 min, 59°C-35°C for 30 min, 26°C for 5 min, and finally reduced to 16°C, then T4 ligase is added at an amount of 15-20 U / μL, and reacted at 16°C for 3-4 h;

[0135] 3) The closed loop structure is verified by urea denaturation gel. The reaction solution is added with exonuclease 1 and 3 (0.5% (v / v) Exonuclease III, and 2.5% (v / v) Exonuclease I), and reacted at 37°C for about 2 h, so as to cut off the splint DNA. The reaction solution is extracted with DNA extraction solution at a volume ratio of 1:1, so as to remove the enzyme in the reaction solution. The supernatant is taken, and ammonium acetate and anhydrous ethanol are added. The mixture is precipitated at -40°C for 4-5 h, centrifuged at 12000 rpm, and the supernatant is removed. The precipitate is redissolved with PBS, and purified by ultrafiltration tube (50 kDa or 100 kDa) to obtain the final single-stranded circular DNA. The obtained solution is stored at -20°C for use.

[0136] b. Synthesis of 80 nt inner loop single-stranded DNA (ssc80):

[0137] The sequence of ssl80 is AGATCGCAACCCAAGGAGCCGAGGACTGCAAAAACGCGTGAGTGAAGGACCTGGTCAGAGAGGATGTGCTGGAACGGAGA (SEQ ID NO. 2), and the preparation method is the same as that of ssc60, only that ssl60 is replaced by ssl80.

[0138] c. Synthesis of 100 nt loop single-stranded DNA (ssclOO):

[0139] The sequence of ssl100 is AGATCGCAACCCAAGGAGCCGAGGACTGCAAAAACGCGTGAGTGAAGGACCTGGTCAGAGACCGGAATCGACTGACCAACAGGATGTGCTGGAACGGAGA (SEQ ID NO. 3), only that ssl60 is replaced by ssl100.

[0140] d. Synthesis of 120 nt loop single-stranded DNA (sscl20):

[0141] The sequence of ssl120 is AGATCGCAACCCAAGGAGCCGAGGACTGCAAAAACGCGTGAGTGAAGGACCTGGTCAGAGACCGGAATCGACTGACCAACTGCCATCTGCAGCTAACACGAGGATGTGCTGGAACGGAGA (SEQ ID NO. 4), only ssl60 is replaced by ssl120.

[0142] (2) Synthesis of outer complementary short strands

[0143] The synthesized outer complementary short strands are as follows:

[0144] X-1 = TCTCCGTTCCAGCACATCCT, X-2 = CTCTGACCAGGTCCTTCACT,

[0145] X-3 = CACGCGTTTTTGCAGTCCTC, X-4 = GGCTCCTTGGGTTGCGATCT,

[0146] X-5 = GTTGGTCAGTCGATTCCGGT, X-6 = CGTGTTAGCTGCAGATGGCA.

[0147] (3) Combination of inner loop single strands and outer complementary short strands

[0148] The synthetic route of the combination reaction of inner loop single strands and outer complementary short strands to synthesize circular double-stranded nucleic acids is shown in Figure 3, and five kinds of circular nucleic acids are synthesized:

[0149] a. 60 nt circular double-stranded nucleic acid (dsc60)

[0150] 1) The following reaction system was prepared in DPBS buffer: 60 nt circular single-stranded (ssc60) DNA, 1.62 nmol, outer complementary short strands X-1, X-3, X-4, each 1.62 nmol, T4 ligase buffer, total volume 1.5 mL.

[0151] 2) The above reaction system was placed at 95°C for 5 min, and then cooled to 4°C by gradient cooling, and then T4 ligase was added, the amount was 15-20 U / μL, and the reaction was carried out at 16°C for 3-4 h.

[0152] 3) The reaction solution was added with exonuclease 1 and 3 (0.5% (v / v) Exonuclease III, and 2.5% (v / v) Exonuclease I), and the reaction was carried out at 37°C for about 2 h.

[0153] 4) The product was extracted to remove the enzyme, and after ultrafiltration purification, dsc60 was obtained.

[0154] b、80nt circular double-stranded nucleic acid (dsc80)

[0155] The preparation method is the same as that of dsc60, except that ssc60 is replaced by ssc80, and the outer complementary short chain is replaced by X-1, X-2, X-3, and X-4, each 1.62 nmol.

[0156] c、100nt circular double-stranded nucleic acid (dsc100)

[0157] The preparation method is the same as that of dsc60, except that ssc60 is replaced by ssc100, and the outer complementary short chain is replaced by X-1, X-2, X-3, X-4, and X-5, each 1.62 nmol.

[0158] d、120nt circular double-stranded nucleic acid (dsc120)

[0159] The preparation method is the same as that of dsc60, except that ssc60 is replaced by ssc120, and the outer complementary short chain is replaced by X-1, X-2, X-3, X-4, X-5, and X-6, each 1.62 nmol.

[0160] Example 2: Preparation of circular multivalent nucleic acid aptamer

[0161] The synthesis route of the circular multivalent nucleic acid aptamer (mv-apt) provided in this example is shown in Figure 4, wherein the nucleic acid aptamer S sequence is:

[0162] SL1 (ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT) (SEQ ID NO. 6),

[0163] Sgc8c (TCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA) (SEQ ID NO. 7),

[0164] PD-4S (CGCACTATGTTTTACGAGCCGTTTCCTCGGCAGATAGTAAGTGC) (SEQ ID NO. 8).

[0165] The nucleic acid aptamer in the circular multivalent nucleic acid aptamer can be one or more of SL1, Sgc8c, and PD-4S.

[0166] 1. The same nucleic acid aptamer is used to construct a circular multivalent nucleic acid aptamer

[0167] The embodiment adopts SL1 to synthesize outer complementary short chains X-1, X-2, X-3, X-4, X-5 and X-6 respectively, and construct circular trivalent nucleic acid aptamer, circular quadrivalent nucleic acid aptamer, circular pentavalent nucleic acid aptamer and circular hexavalent nucleic acid aptamer respectively.

[0168] a. Circular trivalent nucleic acid aptamer (dsc60-3Apt)

[0169] 1) The following reaction system was prepared in DPBS buffer: 60 nt circular single-stranded (ssc60) DNA, 1.62 nmol, outer complementary short chains X-1, X-3, X-4 (wherein X-1 = tctccgttccS (SEQ ID NO. 6) agcacatcct, X-3 = cacgcgttttS (SEQ ID NO. 6) tgcagtcctc, X-4 = ggctccttggS (SEQ ID NO. 6) gttgcgatct), three kinds, 3.24 nmol (equivalent amount of each), T4 ligase buffer, total volume 1.5 mL. 2) The above reaction system was placed at 95°C for 5 min, and then cooled to 4°C by gradient cooling, and then T4 ligase was added, the amount was 15-20 U / μL, and the reaction was carried out at 16°C for 3-4 h. 3) The reaction solution was added with exonuclease 1 and 3 (0.5% (v / v) Exonuclease III, and 2.5% (v / v) Exonuclease I), and the reaction was carried out at 37°C for about 2 h. 4) The product was extracted to remove the enzyme, and after ultrafiltration purification, the circular trivalent nucleic acid aptamer was obtained.

[0170] b. Circular quadrivalent nucleic acid aptamer (dsc80-4Apt)

[0171] The preparation method is the same as that of the circular trivalent nucleic acid aptamer, except that ssc60 is replaced by ssc80, and outer complementary short chains are replaced by X-1, X-2, X-3, X-4 (wherein X-1 = tctccgttccS (SEQ ID NO. 6) agcacatcct, X-2 = ctctgaccagS (SEQ ID NO. 6) gtccttcact, X-3 = cacgcgttttS (SEQ ID NO. 6) tgcagtcctc, X-4 = ggctccttggS (SEQ ID NO. 6) gttgcgatct), four kinds, 3.24 nmol (equivalent amount of each), to obtain the circular quadrivalent nucleic acid aptamer.

[0172] c. Circular pentavalent nucleic acid aptamer (dsc100-5Apt)

[0173] The preparation method is the same as that of the circular trivalent nucleic acid aptamer, wherein ssc60 is replaced by ssc100, and the outer complementary short chain is replaced by X-1, X-2, X-3, X-4, and X-5 (wherein X-1 = tctccgttccS (SEQ ID NO. 6) agcacatcct, X-2 = ctctgaccagS (SEQ ID NO. 6) gtccttcact, X-3 = cacgcgttttS (SEQ ID NO. 6) tgcagtcctc, X-4 = ggctccttggS (SEQ ID NO. 6) gttgcgatct, and X-5 = gttggtcagtS (SEQ ID NO. 6) cgattccggt), each 3.24 nmol (equivalent amount of each), to obtain the circular pentavalent nucleic acid aptamer.

[0174] d. Circular hexavalent nucleic acid aptamer (dsc120-6Apt)

[0175] The preparation method is the same as that of the circular trivalent nucleic acid aptamer, wherein ssc60 is replaced by ssc120, and the outer complementary short chain is replaced by X-1, X-2, X-3, X-4, X-5, and X-6 (wherein X-1 = tctccgttccS (SEQ ID NO. 6) agcacatcct, X-2 = ctctgaccagS (SEQ ID NO. 6) gtccttcact, X-3 = cacgcgttttS (SEQ ID NO. 6) tgcagtcctc, X-4 = ggctccttggS (SEQ ID NO. 6) gttgcgatct, X-5 = gttggtcagtS (SEQ ID NO. 6) cgattccggt, and X-6 = cgtgttagctS (SEQ ID NO. 6) gcagatggca), each 3.24 nmol (equivalent amount of each), to obtain the circular hexavalent nucleic acid aptamer.

[0176] 2. Different nucleic acid aptamers construct circular multivalent nucleic acid aptamer

[0177] a. Two nucleic acid aptamers construct circular multivalent nucleic acid aptamer (SL1, Sgc8c)

[0178] 1) Constructing a univalent SL1 bivalent Sgc8c circular trivalent nucleic acid aptamer

[0179] Preparation method is the same as the circular trivalent nucleic acid aptamer, the outer short chain complementary to X-1, X-3, X-4 (wherein X-1 = tctccgttccS (SEQ ID NO. 6) agcacatcct, X-3 = cacgcgttttS (SEQ ID NO. 6) tgcagtcctc, X-4 = ggctccttggS (SEQ ID NO. 7) gttgcgatct) three, get a SL1 two Sgc8c circular trivalent nucleic acid aptamer.

[0180] 2) Construction of two SL1 one Sgc8c circular trivalent nucleic acid aptamer

[0181] Preparation method is the same as the circular trivalent nucleic acid aptamer, the outer short chain complementary to X-1, X-3, X-4 (wherein X-1 = tctccgttccS (SEQ ID NO. 6) agcacatcct, X-3 = cacgcgttttS (SEQ ID NO. 6) tgcagtcctc, X-4 = ggctccttggS (SEQ ID NO. 7) gttgcgatct) three, get a SL1 two Sgc8c circular trivalent nucleic acid aptamer.

[0182] 3) Construction of three SL1 three Sgc8c circular six valent nucleic acid aptamer

[0183] Preparation method is the same as the circular trivalent nucleic acid aptamer, the outer short chain complementary to X-1, X-2, X-3, X-4, X-5, X-6 (wherein X-1 = tctccgttccS (SEQ ID NO. 6) agcacatcct, X-2 = ctctgaccagS (SEQ ID NO. 6) gtccttcact, X-3 = cacgcgttttS (SEQ ID NO. 6) tgcagtcctc, X-4 = ggctccttggS (SEQ ID NO. 7) gttgcgatct, X-5 = gttggtcagtS (SEQ ID NO. 7) cgattccggt, X-6 = cgtgttagctS (SEQ ID NO. 7) gcagatggca) six, get three SL1 three Sgc8c circular six valent nucleic acid aptamer.

[0184] 4) Construction of three SL1 three Sgc8c circular six valent nucleic acid aptamer

[0185] The preparation method is the same as that of the circular trivalent nucleic acid aptamer, replacing ssc60 with ssc120 and replacing the outer complementary short chain with X-1, X-2, X-3, X-4, X-5, and X-6 (wherein X-1 = tctccgttccS (SEQ ID NO. 6) agcacatcct, X-2 = ctctgaccagS (SEQ ID NO. 7) gtccttcact, X-3 = cacgcgttttS (SEQ ID NO. 6) tgcagtcctc, X-4 = ggctccttggS (SEQ ID NO. 7) gttgcgatct, X-5 = gttggtcagtS (SEQ ID NO. 6) cgattccggt, and X-6 = cgtgttagctS (SEQ ID NO. 7) gcagatggca), to obtain the trivalent SL1 trivalent Sgc8c circular six-valent nucleic acid aptamer.

[0186] b. Three nucleic acid aptamer constructs circular multivalent nucleic acid aptamer (SL1, Sgc8c, PD-4S)

[0187] 1) Construction of bivalent SL1 bivalent Sgc8c bivalent PD-4S circular six-valent nucleic acid aptamer

[0188] The preparation method is the same as that of the circular trivalent nucleic acid aptamer, replacing ssc60 with ssc120 and replacing the outer complementary short chain with X-1, X-2, X-3, X-4, X-5, and X-6 (wherein X-1 = tctccgttccS (SEQ ID NO. 6) agcacatcct, X-2 = ctctgaccagS (SEQ ID NO. 7) gtccttcact, X-3 = cacgcgttttS (SEQ ID NO. 8) tgcagtcctc, X-4 = ggctccttggS (SEQ ID NO. 6) gttgcgatct, X-5 = gttggtcagtS (SEQ ID NO. 7) cgattccggt, and X-6 = cgtgttagctS (SEQ ID NO. 8) gcagatggca), to obtain the bivalent SL1 bivalent Sgc8c bivalent PD-4S circular six-valent nucleic acid aptamer.

[0189] Example 3: Optimization of the preparation process of circular multivalent nucleic acid aptamer

[0190] 1. Optimization of the synthesis of the inner side circular single strand

[0191] The inner loop single strand was synthesized according to the method provided in Example 1. The 5' phosphorylated linear single strand (such as ssl120) DNA, 1.62 nmol, and the complementary short chain splint DNA were added in an amount of 1.62 nmol, 3.24 nmol, 4.86 nmol, and 6.48 nmol, respectively. The results showed that when the ratio of linear single strand and splint DNA was 1:2 and 1:3, the inner loop single strand could be efficiently synthesized, and when the ratio was less than 1:2 or more than 1:3, the yield would decrease significantly, especially when the ratio was 1:1, the yield was low. Therefore, the ratio of linear single strand and splint DNA was selected to be 1:2. The gel electrophoresis characterization of the ratio of linear single strand and splint DNA being 1:2 and 1:3 is shown in Figure 5.

[0192] 2. Optimization of synthesis of circular multivalent nucleic acid aptamer

[0193] The circular multivalent nucleic acid aptamer was synthesized according to the method provided in Example 2. It was found that the ratio of inner loop single strand and outer complementary short chain was also crucial. Taking the circular six-valent nucleic acid aptamer provided in Example 2-1-d as an example, the ssc120 was 1.62 nmol, and the outer complementary short chains X-1, X-2, X-3, X-4, X-5, and X-6 were each taken in an amount of 1.62 nmol, 3.24 nmol, 4.86 nmol, 6.48 nmol, and 8.1 nmol (each outer complementary short chain was equal in amount). The circular six-valent nucleic acid aptamer was synthesized, and the results showed that when the ratio of inner loop single strand and outer complementary short chain was 1:2, 1:3, and 1:4, the inner loop single strand could be efficiently synthesized, and when the ratio was less than 1:2 or more than 1:4, the yield would decrease significantly, especially when the ratio was 1:1, the yield was low. Therefore, the ratio of inner loop single strand and outer complementary short chain was selected to be 1:2. The gel electrophoresis characterization of the ratio of linear single strand and outer complementary short chain being 1:2, 1:3, and 1:4 is shown in Figure 5.

[0194] Example 4: Gel electrophoresis characterization of DNA structure

[0195] The DNA structure of the inner side loop single strand, circular nucleic acid, circular multivalent nucleic acid aptamer prepared in Example 1 and Example 2 was characterized by gel electrophoresis, and the results are shown in Figure 6, wherein (a) is the characterization of the inner side loop single strand DNA and the circular nucleic acid DNA, (b) is the characterization of the circular multivalent nucleic acid aptamer, and (c) is the characterization of the circular multivalent nucleic acid aptamer of the same nucleic acid aptamer and different nucleic acid aptamer; the inner side loop single strand is cy5 red fluorescence, and the outer complementary strand is FAM green fluorescence. When the circular double-stranded DNA or the circular multivalent nucleic acid aptamer is synthesized, it is yellow fluorescence in the gel imaging. Taking 60 nt as an example, when the DNA is synthesized from single strand to single ring, it is slower than the single strand DNA in the denaturing gel, and the position is higher; the red fluorescence and the green fluorescence are completely overlapped, which proves that the final product is a completely closed circular double-stranded DNA. This embodiment synthesizes the circular multivalent nucleic acid aptamer of the same nucleic acid aptamer and the circular multivalent nucleic acid aptamer structure of different nucleic acid aptamers on the basis of ssc60-ssc120.

[0196] As can be seen from Figure 6-(a), the linear single-stranded DNA and the inner side loop single-stranded DNA are red fluorescence, the circular nucleic acid DNA is yellow fluorescence, and the linear single-stranded DNA, the inner side loop single-stranded DNA and the circular nucleic acid DNA are different in the position of gel electrophoresis, which can be completely separated and characterized, indicating that the linear single-stranded, the inner side loop single-stranded and the circular nucleic acid are successfully prepared.

[0197] As can be seen from Figure 6-(b), the inner side loop single-stranded DNA is red fluorescence, and the circular multivalent nucleic acid aptamer is yellow fluorescence. In the characterization of the circular trivalent nucleic acid aptamer, the circular quadrivalent nucleic acid aptamer, the circular pentavalent nucleic acid aptamer and the circular hexavalent nucleic acid aptamer, green fluorescence (green fluorescence is the excess outer complementary strand) can also be seen, indicating that the circular trivalent nucleic acid aptamer, the circular quadrivalent nucleic acid aptamer, the circular pentavalent nucleic acid aptamer and the circular hexavalent nucleic acid aptamer are successfully prepared.

[0198] As can be seen from Figure 6-(c), the position of the circular trivalent nucleic acid aptamer or the circular hexavalent nucleic acid aptamer prepared from the circular multivalent nucleic acid aptamer of the same nucleic acid aptamer and different nucleic acid aptamer is also different, which can be completely distinguished.

[0199] Example 5: MALDI circular characterization of molecular weight

[0200] In this embodiment, the molecular weight of the inner side loop single strand prepared in Example 1 was characterized by MALDI circular. The purified end product (inner side loop single strand) was mixed with the matrix at 1:1. The matrix was a saturated 3-HPA solution of 10 mg / ml diammonium hydrogen citrate prepared by mixing water and acetonitrile at 1:1, and then MALDI circular characterization was carried out. The results are shown in Figure 7, wherein a is the molecular weight of the inner side loop single strand, b is the molecular weight of the circular double-stranded nucleic acid, c is the molecular weight of the circular multivalent nucleic acid aptamer, and d is the molecular weight of the circular multivalent nucleic acid-drug complex.

[0201] As can be seen from Figure 7, the molecular weight of ssc60 is about 1.8 x 10 4 , the molecular weight of ssc80 is about 2.5 x 10 4 , the molecular weight of ssc100 is about 3.2 x 10 4 , and the molecular weight of ssc120 is about 3.7 x 10 4 . The molecular weights of the circular double-stranded nucleic acid, the circular multivalent nucleic acid aptamer, and the circular multivalent nucleic acid-drug complex increase in turn.

[0202] Example 6: DLS characterization of size

[0203] This example characterizes the size of the inner side circular single-stranded and circular nucleic acid prepared in Example 1 by DLS, as shown in Figure 8. The purified end product is diluted in DPBS, and the size of the inner side circular single-stranded is about 6-13 nm, and the size of the circular multivalent nucleic acid aptamer is about 11-20 nm, which is measured by a nanoparticle size potential instrument.

[0204] Example 7: Circular dichroism characterization of DNA structure of circular multivalent nucleic acid aptamer

[0205] This example characterizes the DNA structure of the circular multivalent nucleic acid aptamer by circular dichroism, as shown in Figure 9. The purified end product is diluted in DPBS, and the structures of single-stranded, single-loop, double-stranded DNA, and the circular multivalent nucleic acid aptamer are characterized by a circular dichroism instrument. It can be seen that the DNA structure has changed significantly in different structures.

[0206] Example 8: Gel electrophoresis characterization of enzyme cutting stability and serum stability

[0207] This example characterizes the enzyme cutting stability and serum stability of the circular multivalent nucleic acid aptamer by gel electrophoresis. The linear single-stranded, inner side circular single-stranded, circular double-stranded nucleic acid, and circular multivalent nucleic acid aptamer prepared in Examples 1 and 2 are incubated in exonuclease I and exonuclease III at 37°C, with a final DNA concentration of 2 uM. The same volume is loaded for gel electrophoresis, and the results are shown in Figure 10(a). It can be seen that the linear single-stranded is almost degraded after enzyme cutting, while the inner side circular single-stranded, circular double-stranded nucleic acid, and circular multivalent nucleic acid aptamer have good enzyme cutting stability. The nucleic acid aptamer, circular trivalent nucleic acid aptamer, circular quadrivalent nucleic acid aptamer, circular pentavalent nucleic acid aptamer, and circular hexavalent nucleic acid aptamer prepared in Example 2 are incubated in a culture medium containing 10% serum at 37°C, with a final DNA concentration of 2 uM. The same volume is loaded for gel electrophoresis, and the results are shown in Figure 10(b). It can be seen that the nucleic acid aptamer is completely degraded at 24 h, which is very unstable, while the circular multivalent nucleic acid aptamer still exists stably after 24 h of serum incubation.

[0208] Example 9: Flow cytometry study on the targeting ability and absorption ability of the toroidal multivalent aptamer to target cells AsPC1

[0209] This example studies the targeting ability and absorption ability of the toroidal multivalent aptamer (prepared in Example 2) to target cells AsPC1 by flow cytometry. The cells are digested with an enzyme-free digestion solution, counted after centrifugation, and 300,000 cells per sample are used. The different valence toroidal multivalent aptamers (the final concentration of the aptamer is 200 nM) are incubated at 4°C or 37°C for 1 h. After incubation, the supernatant is removed, the unbound aptamer is washed with PBS, and finally resuspended in PBS for flow cytometry analysis. The results are shown in Figure 11, where (a) is the cell level targeting effect of the toroidal multivalent aptamer; (b) is the cell level endocytosis effect of the toroidal multivalent aptamer. HPNE is a low expression cMET negative cell, and AsPC1 is a high expression cMET positive cell.

[0210] According to Figure 11(a), the left side is the negative cell, which mainly illustrates the specificity of targeting, and the right side is the positive cell, which highly expresses the target cMET. This part is to illustrate that the displacement of the first four is larger than that of the fifth, indicating that the targeting effect of the toroidal aptamer is better than that of the monovalent aptamer.

[0211] Meanwhile, the final concentration of the aptamer in this example is consistent. Taking the 6-valent aptamer as an example, the final monovalent aptamer of the aptamer used for comparison is 6 times the nucleic acid quantification of the 6-valent aptamer structure, so as to ensure that the final aptamer concentration is consistent (the final concentration of the aptamer is 200 nM, and the final concentrations of the free and multivalent are consistent).

[0212] According to Figure 11(b), when the target cMET is highly expressed, the displacement of the three-valent and six-valent toroidal multivalent aptamer is larger than that of other valences, showing better absorption ability.

[0213] Example 10: Confocal study on the targeting ability and absorption ability of the toroidal multivalent aptamer to target cells

[0214] This example studies the targeting ability and absorption ability of the toroidal multivalent aptamer (prepared in Example 2) to target cells AsPC1 by flow cytometry. The cells are counted after centrifugation, and then plated in a confocal dish. The different valence toroidal multivalent aptamers (the final concentration of the aptamer is 200 nM) are diluted with medium and incubated at 4°C or 37°C for 1 h. After incubation, the supernatant is removed, the unbound aptamer is washed with PBS, and finally PBS is added for confocal analysis.

[0215] Meanwhile, the final concentration of the aptamer in this example is consistent. The final concentration of the aptamer is 200 nM, and the final concentrations of the free and multivalent are consistent.

[0216] The results are shown in Figure 12. It can be seen that the trivalent and hexavalent loop-shaped multivalent nucleic acid aptamer exhibits better targeting ability and absorption ability. The cy5 fluorescence is modified on all nucleic acid aptamers, and the amount of red fluorescence represents the amount of nucleic acid aptamer entering. When the trivalent and hexavalent loop-shaped multivalent nucleic acid aptamer is incubated, the amount of red fluorescence of the tumor cells is more, proving that the trivalent and hexavalent loop-shaped multivalent nucleic acid aptamer can target and enter the tumor cells with high expression of cMET more.

[0217] Example 11: Study on tumor targeting ability of loop-shaped multivalent nucleic acid aptamer in vivo by animal imaging

[0218] This example studies the tumor targeting ability of loop-shaped multivalent nucleic acid aptamer in vivo by animal imaging. Small molecule Cy5-labeled SL1 is used for the experiment, and the sample is dissolved in PBS to prepare a solution. In the tumor model constructed by pancreatic cancer AsPC1 cells, 100 μL of Cy5-labeled SL1 and Cy5-labeled loop-shaped multivalent nucleic acid aptamer is injected into the tail vein, and the amount of SL1 is 2.5 nmol. The in vivo distribution at different time points is observed using a small animal imaging instrument. Compared with the loop-shaped multivalent nucleic acid aptamer, the in vivo circulation time of Cy5-labeled SL1 is short, and it is quickly metabolized by the body. The loop-shaped multivalent nucleic acid aptamer has more enrichment and longer retention time in the tumor area, and still has obvious fluorescence at 12 h after injection. This indicates that the loop-shaped multivalent nucleic acid aptamer can specifically enrich and retain in the tumor area. Among them, the trivalent and hexavalent loop-shaped multivalent nucleic acid aptamer has stronger targeting ability and longer tumor retention time, and the most preferred is the hexavalent loop-shaped multivalent nucleic acid aptamer, which has the best targeting ability and the longest tumor retention time. In theory, the loop-shaped multivalent nucleic acid aptamer of the present application can be constructed from 3 to 12 valences, but from 7 valences, the sequence and length of the loop-shaped single strand and the outer complementary single strand need to be adjusted, the steps are more complicated, and there is no advantage in spatial structure, and more preferably 3-6 valences.

[0219] The nucleic acid aptamer binds to the target protein through the functional region, and the spatial structure has a great influence on the functional region when constructing a multivalent functional nucleic acid. If the functional region is affected, the affinity of the multivalent nucleic acid aptamer may not be better than that of the monovalent. The results of this example (Figure 13) show that the trivalent and hexavalent loop-shaped multivalent nucleic acid aptamer has better effect, which may be related to the spatial structure.

[0220] At the same time, the final concentration of the nucleic acid aptamer in this example is consistent, and the final concentration of the nucleic acid aptamer is 200 nM, and the final concentration of the free and multivalent is consistent.

[0221] Example 12: Construction of loop-shaped multivalent nucleic acid aptamer-drug complex

[0222] The nucleic acid aptamer-drug complex provided by the embodiment is a circular multi-valent nucleic acid aptamer-drug complex. The nucleic acid aptamer-drug complex with an outside short complementary chain is SL1 (ATCAGGCTGGATGGT (DBCO) AGCTCGGTCGGGGTGGGTGGGTT GGCAAGTCTGAT), which is reacted with a small molecule drug (MMAE or diABZI) with N3. The preparation process is as follows: the molar ratio of SL1-DBCO to N3-drug is 1:2, the buffer is PBS, the shaking speed is 800 rpm, the reaction is overnight, and the final product SL1-drug (SL1 is connected with a modified group DBCO, and the drug is connected with a modified group N3) is obtained after ultrafiltration. The nucleic acid aptamer-drug complex with an outside short complementary chain is reacted with an inside circular single-stranded nucleic acid. The preparation method is consistent with the preparation method of the circular double-stranded nucleic acid aptamer DNA described in Embodiment 2. At the same time, the circular double-stranded nucleic acid aptamer without a drug prepared is used as a control. The gel electrophoresis characterization result is shown in FIG. 14. It can be seen that in different structures, the DNA structure changes obviously, and therefore the gel electrophoresis position also changes.

[0223] Embodiment 13: Toxicity analysis of the circular multi-valent nucleic acid aptamer-drug complex

[0224] In this embodiment, the prepared circular six-valent nucleic acid aptamer-drug complex and the free nucleic acid aptamer-drug complex are subjected to cytotoxicity analysis on the target cells AsPC1 and the negative cells HPNE. The operation steps are as follows: the cells with a density of about 80% are digested, counted after digestion, and inoculated in a 96-well plate at a density of 100 ul per well and 5000 cells. After 24 h of cell adhesion, the cells are incubated with different concentration gradients of the circular multi-valent nucleic acid aptamer-drug complex and the drug molecule. The drug is diluted in the culture medium, 100 ul per well is incubated in the incubator for 72 h. 3) After 72 h, the cell culture medium is removed, 10% CCK8-containing medium is added to each well of the 96-well plate, and the incubator is incubated for 2-4 h. Then, the reading is read on the enzyme label instrument at 460 nm to test the cell proliferation rate. The nucleic acid quantification of the final monovalent nucleic acid aptamer-drug complex is 6 times that of the nucleic acid-drug complex quantification of the six-valent nucleic acid aptamer-drug complex structure. The result is shown in FIG. 15: the free drug molecule has strong toxicity to the target cells and the negative cells. In comparison, the circular multi-valent nucleic acid aptamer-drug conjugate only has an inhibitory effect on the cells in the target cells, and has little inhibitory effect on the negative cells, proving that the circular multi-valent nucleic acid aptamer-drug complex has higher targeting and thus lower cytotoxicity.

[0225] Embodiment 14: Immune activation analysis of the circular multi-valent nucleic acid aptamer-drug complex

[0226] The prepared circular hexavalent nucleic acid aptamer-drug complex, free drug molecule was used to analyze the immune activation of BMDC cells. The BMDC cells were collected and counted, 500ul per well, 800,000 cells. The cells were incubated with the same concentration of circular multivalent nucleic acid aptamer-drug complex and drug molecule in an incubator for 12 hours. The cells were collected, the protein was extracted, and Western blot analysis was performed. The nucleic acid or drug of the final monovalent nucleic acid aptamer, drug molecule, and nucleic acid aptamer-drug complex was quantified, which was 6 times the nucleic acid-drug complex quantification of the structure of the hexavalent nucleic acid aptamer-drug complex. The results are shown in Figure 16, which shows that the nucleic acid aptamer-drug complex and the drug molecule have a certain activation effect on the pathway.

[0227] Example 15: Tumor inhibition effect of circular multivalent nucleic acid aptamer-drug complex

[0228] In this example, the tumor inhibition effect of the circular hexavalent nucleic acid aptamer-drug complex was studied by in vivo tumor inhibition experiment. In the pancreatic cancer model constructed with AsPC1 cells, mice were treated with PBS, free SL1-MMAE, free SL1-diABZI, circular hexavalent Apt-MMAE, and circular hexavalent Apt-diABZI samples. The nucleic acid or drug of the final monovalent nucleic acid aptamer-drug complex was quantified, which was 6 times the nucleic acid-drug complex quantification of the structure of the hexavalent nucleic acid aptamer-drug complex. The tumor growth and body weight changes of the mice were observed, and the results are shown in Figure 17, where (a) is the change of mouse tumor volume, and (b) is the change of mouse body weight.

[0229] As can be seen from Figure 17-(a), the circular hexavalent nucleic acid aptamer-drug complex group has a significant tumor inhibition effect compared to other groups, and the tumor inhibition effect of the monovalent nucleic acid aptamer-drug complex is poorer under the same dose, indicating that the circular multivalent nucleic acid aptamer can significantly improve the in vivo tumor inhibition effect of the nucleic acid aptamer-drug complex.

[0230] As can be seen from Figure 17-(b), the circular hexavalent nucleic acid aptamer-drug complex group has the lowest toxicity to the mice compared to other groups, and has no adverse effect on the growth of the mice.

[0231] Example 16: Construction of circular multivalent nucleic acid-antibody complex

[0232] The circular multivalent nucleic acid-antibody complex constructed in this example has an outer complementary sequence X-R1 sequence that is one or more chemically modified nucleic acids, which reacts with Y-R2, where Y is one or more antibodies, to obtain a nucleic acid-antibody complex, which then reacts with the inner circular single-stranded nucleic acid. The preparation method is consistent with the preparation method of the circular multivalent nucleic acid-drug complex provided in Example 12.

[0233] Example 17: Construction of circular multivalent nucleic acid-polypeptide complex

[0234] The circular multivalent nucleic acid-polypeptide complex constructed in this example has an outer complementary sequence X-R1 sequence of one or more chemically modified nucleic acids, reacted with Y-R2, where Y is one or more polypeptides, to obtain a nucleic acid-polypeptide complex, and then reacted with an inner circular single-stranded nucleic acid. The preparation method is consistent with the preparation method of the circular multivalent nucleic acid-drug complex provided in Example 12.

[0235] Example 18: Construction of circular multivalent ASO, circular multivalent ASO+aptamer complex

[0236] This example uses the method provided in Example 2 to construct a circular multivalent ASO, in which the outer complementary short chain contains an ASO, ASO = (MOE-T)*(MOE-G)*(MOE-C)*(MOE-A)*(MOE-C)*(dT)*(dG)*(dT)*(dA)*(dC)*(dT)*(dC)*(dC)*(dT)*(dC)*(MOE-T)*(MOE-T)*(MOE-G)*(MOE-A)*(MOE-C).

[0237] The structure of the circular multivalent ASO was characterized by gel electrophoresis, and it was proved that the circular multivalent ASO was successfully constructed.

[0238] This example also synthesized different sequences of multiple ASOs in the same valence of circular multivalent ASO, and circular multivalent ASO-aptamer with inner ring of ssc80 and ssc120.

[0239] When preparing a circular six-valent ASO+aptamer, ssl120 (SEQ ID NO. 4) is used for preparation, the reaction chain is X-1, 3, 5, the outer complementary short chain is SL1, X-2, 4, 6, and S is one or more ASO sequences (equivalent to three-valent ASO, three-valent aptamer).

[0240] When preparing a circular four-valent ASO+aptamer, ssl180 (SEQ ID NO. 2) is used for preparation, the reaction chain is X-1, 3, the outer complementary short chain is SL1, X-2, 4, and S is one or more ASO sequences (equivalent to two-valent ASO, two-valent aptamer).

[0241] The cell targeting and absorption capacity of the looped multivalent ASO-aptamer was analyzed by flow cytometry. Unlike the looped multivalent aptamer, it was found that the looped tetravalent ASO-aptamer of ssc80 was stronger in cell targeting and absorption, and this structure was selected for KRAS degradation in positive cells AsPC1, because the spatial structure of tetravalent was more conducive to the looped tetravalent ASO-aptamer to play a therapeutic effect on tumors.

[0242] The KRAS protein degradation capacity of the looped multivalent ASO-aptamer was analyzed by WB. It was found that the looped multivalent ASO-aptamer of ssc80 was stronger in cell targeting and absorption, and this structure was selected for KRAS degradation in positive cells AsPC1.

[0243] The cells were incubated with the same concentration of ASO, looped multivalent aptamer, looped multivalent ASO, and looped multivalent ASO-aptamer, and incubated in an incubator for 48 h. The cells were collected, the protein was extracted, and Western blot analysis was performed. The results showed that at the same concentration, compared with ASO, looped multivalent aptamer, and looped multivalent ASO, looped multivalent ASO-aptamer could better enter the cells and effectively degrade KRAS protein in AsPC1 cells.

[0244] Example 19: Construction of looped multivalent CpG and looped multivalent CpG+aptamer complex

[0245] In this example, the method provided in Example 2 was used to construct a looped multivalent CpG, in which the outer complementary short chain contained CpG, and the CpG was ODN 1826=tccatgacgttcctgacgtt.

[0246] The looped multivalent CpG structure was characterized by gel electrophoresis, and it was proved that the looped multivalent CpG was successfully constructed.

[0247] In this example, looped multivalent CpG with different sequences in the same valence state, and looped multivalent CpG-aptamer with ssc80 and ssc120 as inner loops were also synthesized. The cell targeting and absorption capacity of the looped multivalent CpG-aptamer was analyzed by flow cytometry. It was found that the looped tetravalent CpG-aptamer of ssc80 was stronger in cell targeting and absorption when the inner loop was CpG-aptamer, and this structure was selected for TLR9 pathway in positive cells RAW264.7, because the spatial structure of tetravalent was more conducive to the looped tetravalent CpG-aptamer (equivalent to bivalent CpG, bivalent sptamer) to play a therapeutic effect on tumors.

[0248] The ability of the circular multivalent CpG-aptamer to activate the TLR9 pathway was analyzed by WB. RAW264.7 cells were incubated with the same concentration of CpG, circular multivalent CpG, and circular multivalent CpG-aptamer, and incubated in an incubator for 24 h. The cells were collected, and the proteins were extracted for Western blot analysis. It was found that the circular multivalent CpG-aptamer activated pNFκB more obviously at the same concentration.

[0249] The expression of CD80 and CD86 on the surface of RAW264.7 cells was analyzed by flow cytometry. RAW264.7 cells were incubated with the same concentration of CpG, circular multivalent CpG, and circular multivalent CpG-aptamer, and incubated in an incubator for 24 h. The cells were collected, and after blocking, CD80 and CD86 antibodies were incubated. The results showed that the circular multivalent CpG-aptamer activated CD80 and CD86 more obviously at the same concentration.

[0250] The levels of IL6 and TNFa secreted by RAW264.7 cells were analyzed by ELISA. RAW264.7 cells were incubated with the same concentration of CpG, circular multivalent CpG, and circular multivalent CpG-aptamer, and incubated in an incubator for 24 h. The cell supernatant was collected, and the IL6 and TNFα contents were measured. The results proved that the levels of IL6 and TNFα secreted after stimulation of the cells by the circular multivalent CpG-aptamer were higher at the same concentration.

[0251] Example 20: Double-stranded circular nucleic acid for protein / polypeptide expression

[0252] The nucleic acid sequence expressing the protein / polypeptide was designed as the outer complementary sequence of the double-stranded circular nucleic acid, and then reacted with the single-stranded circular nucleic acid. The preparation method was consistent with that of the circular double-stranded DNA. The circular nucleic acid structure was transfected into cells on 293T cells using a transfection reagent, and protein expression verification was performed, and the results proved that the double-stranded circular nucleic acid had stronger protein expression ability.

[0253] Although the present application is disclosed as above, the present application is not limited thereto. Any person skilled in the art can make various changes and modifications without departing from the spirit and scope of the present application, and therefore the protection scope of the present application should be subject to the scope defined by the claims.

[0254] SEQUENCE LISTING

Claims

1. A circular functional nucleic acid, characterized in that, The ring nucleic acid and the functional conjugate connected to the ring nucleic acid, the functional conjugate comprising one or more of nucleic acid, drug, nucleic acid-drug complex.

2. The circular functional nucleic acid of claim 1, wherein The nucleic acid in the ring nucleic acid comprises any one or more of DNA, RNA, microRNA, siRNA, shRNA, lncRNA.

3. The circular functional nucleic acid of claim 2, wherein The nucleic acid in the functional conjugate comprises one or more of aptamer, ASO, CpG, DNA enzyme, RNA; the drug comprises one or more of cytotoxic drug, small molecule targeted drug, immune checkpoint inhibitor, hormone drug, immune agonist or small molecule diagnostic agent; the nucleic acid-drug complex comprises one or more of nucleic acid-antibody conjugate, nucleic acid-nanobody conjugate, nucleic acid-single-chain antibody conjugate, nucleic acid-polypeptide conjugate.

4. The circular functional nucleic acid of claim 3, wherein The ring nucleic acid is double-stranded ring nucleic acid or single-stranded ring nucleic acid.

5. The circular functional nucleic acid of claim 4, wherein The ring nucleic acid is double-stranded ring nucleic acid, comprising inner side single-stranded ring and outer side complementary short chain; the sequence and number of the outer side complementary short chain are matched and designed according to the sequence and length of the inner side single-stranded ring.

6. The circular functional nucleic acid of claim 5, wherein The functional conjugate is connected to the outer side complementary short chain of the double-stranded ring nucleic acid; the number of the functional conjugate is 1 or more than 1.

7. The circular functional nucleic acid of claim 6, wherein The number of the functional conjugate is 3-6, which is uniformly distributed on the outer side complementary short chain of the double-stranded ring nucleic acid.

8. The circular functional nucleic acid of claim 5, wherein The nucleic acid of the inner side single-stranded ring, the outer side complementary short chain or the functional conjugate can be modified, and the modification comprises one or more of phosphate backbone modification, base modification, nucleotide modification, enzyme modification, methylation modification, phosphorylation modification.

9. A method for preparing a circular functional nucleic acid, characterized by, The method comprises the following steps: (1) synthesizing the inner side single-stranded ring; (2) synthesizing the outer side complementary short chain, wherein the outer side complementary short chain is connected with the functional conjugate; the functional conjugate comprises one or more of nucleic acid, drug, nucleic acid-drug complex. (3) reacting the inner side single-stranded ring with the outer side complementary short chain to synthesize the ring functional nucleic acid.

10. The production method according to claim 9, wherein The synthesis method of the inner side single-stranded ring in step (1) is as follows: synthesizing linear single strand and splint DNA respectively, carrying out ligation reaction on the linear single strand and the splint DNA to form a closed loop structure, and cutting off the splint DNA on the closed loop structure to obtain the inner side single-stranded ring; the sequence of the splint DNA is completely complementary to the sequence of 10-30 bases on both sides of the 5' and 3' ends of the linear single strand.

11. The production method according to claim 9, wherein The system of the ligation reaction contains T4 nucleic acid ligase, and the T4 nucleic acid ligase comprises one or more of T4 DNA ligase and T4 RNA ligase.

12. The production method according to claim 10, wherein The linear single strand comprises the nucleotide sequence shown in any one or more of the sequence tables SEQ ID NO. 1-4; the splint DNA comprises the nucleotide sequence shown in the sequence table SEQ ID NO.

5.

13. The production method according to claim 9, wherein The outer side complementary short chain in step (2) comprises any one or more of X-1, X-2, X-3, X-4, X-5, X-6; the X-1=tctccgttccSagcacatcct, X-2=ctctgaccagSgtccttcact, X-3=cacgcgttttStgcagtcctc, X-4=ggctccttggSgttgcgatct, X-5=gttggtcagtScgattccggt, X-6=cgtgttagctSgcagatggca; and the S is a functional conjugate.

14. The production method according to claim 9, wherein When the linear single strand used to prepare the inner side loop single strand has the nucleotide sequence shown in SEQ ID NO. 1, the outer side complementary short chain comprises X-1, X-3 and X-4; when the linear single strand used to prepare the inner side loop single strand has the nucleotide sequence shown in SEQ ID NO. 2, the outer side complementary short chain comprises X-1, X-2, X-3 and X-4; when the linear single strand used to prepare the inner side loop single strand has the nucleotide sequence shown in SEQ ID NO. 3, the outer side complementary short chain comprises X-1, X-2, X-3, X-4 and X-5; when the linear single strand used to prepare the inner side loop single strand has the nucleotide sequence shown in SEQ ID NO. 4, the outer side complementary short chain comprises X-1, X-2, X-3, X-4, X-5 and X-6.

15. The production method according to claim 9, wherein When the functional conjugate is an ASO, the outer side complementary short chain is X-1,3,5, and the S sequence is absent; the outer side complementary short chain is X-2,4,6, and the S is one or more ASO sequences; when the functional conjugate is an ASO and an aptamer, the outer side complementary short chain is X-1,3,5, and the S sequence is an aptamer, the outer side complementary short chain is X-2,4,6, and the S is one or more ASO sequences; when the functional conjugate is a CpG, the outer side complementary short chain is X-1,3,5, and the S sequence is absent; the X-2,4,6, and the S is one or more CpG sequences; when the functional conjugate is a CpG and an aptamer, the outer side complementary short chain is X-1,3,5, and the S sequence is an aptamer, the X-2,4,6, and the S is one or more CpG sequences.

16. The production method according to claim 9, wherein When the functional conjugate is a nucleic acid-drug complex, the preparation process further comprises preparation of the outer side complementary short chain X-R1-R3-R2-Y, wherein X is a nucleic acid with a complementary short chain, R1 is a modification group of X, R3 is a linking group of X and a drug, Y is a drug, and R2 is a modification group of Y; the method for synthesizing X-R1-R3-R2-Y comprises: reacting X-R1 and Y-R2 in a molar ratio of 1:(1-10), using PBS as the buffer, using a shaker at 500-2000 rpm, reacting overnight, and obtaining the outer side complementary short chain X-R1-R3-R2-Y after ultrafiltration.

17. A method of preparing a circular nucleic acid, characterized by, The method comprises the following steps: (a) synthesizing an inner side loop single strand; (b) synthesizing an outer side complementary short chain; (c) the single-stranded circular nucleic acid reacts with the outer complementary short strand to synthesize a circular nucleic acid.

18. Use of a circular functional nucleic acid for the preparation of a reagent for increasing the affinity of an aptamer for a target, characterized in that, The circular functional nucleic acid comprises an inner circular single strand and an outer complementary short strand, and the outer complementary short strand is connected with a nucleic acid aptamer.

19. Use of a circular functional nucleic acid for the preparation of an agent for improving the tumor targeting ability, characterized in that, The circular functional nucleic acid comprises an inner circular single strand and an outer complementary short strand, and the outer complementary short strand is connected with a nucleic acid aptamer.

20. Use of a circular functional nucleic acid for the preparation of an agent for prolonging the retention in a tumor, characterized in that, The circular functional nucleic acid comprises an inner circular single strand and an outer complementary short strand, and the outer complementary short strand is connected with a nucleic acid aptamer. The circular functional nucleic acid comprises an inner circular single strand and an outer complementary short strand, and the outer complementary short strand is connected with a nucleic acid aptamer.

Images