Composition for detecting streptococcus infantis CX-4 strain and use thereof
The WGS-based molecular markers and primers/probes enable rapid and cost-effective identification of Streptococcus infantis CX-4 strain, overcoming the limitations of 16S rRNA gene-based NGS assays by providing high specificity and accuracy in strain-level detection.
Patent Information
- Application Number
- PCT/KR2025/099727
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-02
- Filing Date
- 2025-03-12
- Publication Date
- 2026-01-08
AI Technical Summary
Current 16S rRNA gene-based next-generation sequencing (NGS) assays for detecting microorganisms are time-consuming and expensive, and they cannot accurately identify specific strains of Streptococcus infantis CX-4 due to limitations in detection specificity.
A composition and method using whole genome sequence (WGS)-based molecular markers, specifically designed primers and probes, to rapidly and accurately identify Streptococcus infantis CX-4 strain by nucleic acid amplification reactions such as PCR, utilizing polynucleotide sequences 1 to 5 or their complements for high specificity detection.
The WGS-based approach allows for rapid and accurate identification of Streptococcus infantis CX-4 strain at the strain or species level, reducing time and cost compared to traditional NGS methods, with high detection specificity and the ability to distinguish it from closely related strains or species.
Smart Images

Figure KR2025099727_08012026_PF_FP_ABST
Abstract
Description
Composition for detecting Streptococcus infantis CX-4 strain and use thereof
[0001] The present invention relates to a composition for identifying microorganisms at a specific strain level and to a use thereof.
[0002] The skin is the largest organ in the human body, directly exposed to the external environment. Its key function is to protect the body from external irritants and prevent moisture loss. Along with other bodily organs such as the intestines, the skin is home to a diverse array of microorganisms, including bacteria, fungi, small larvae, and viruses, all of which maintain specialized functions. These microorganisms and their entire genetic information (genome) are collectively referred to as the skin microbiome.
[0003] Skin microbiome research has become possible with the development of next-generation sequencing (NGS) analysis methods. Specifically, utilizing 16S rRNA gene primers allows for cataloging and processing the bacterial composition of the microbiome.
[0004] While these 16S rRNA gene-based NGS assays offer the advantage of detecting all microorganisms in a given environment, they currently require at least a week of analysis and have limitations in that the 16S rRNA gene alone cannot detect specific strains. Furthermore, using NGS to detect specific strains is expensive.
[0005] [Prior Art Literature]
[0006] [Patent Document]
[0007] (Patent Document 1) KR 10-2167386 B1
[0008] The present specification relates to a molecular marker based on Whole Genome Sequence (WGS) data that can identify Streptococcus infantis CX-4 strain at the strain or species level. Using the molecular marker, the Streptococcus infantis CX-4 strain can be identified relatively quickly and accurately through a nucleic acid amplification reaction such as polymerase chain reaction (PCR).
[0009] One aspect provides a composition for detecting Streptococcus infantis CX-4 strain, deposited under accession number KCCM12642P, comprising one or more agents selected from the following:
[0010] (1) A preparation capable of specifically detecting a polynucleotide comprising sequence number 1 or a complementary polynucleotide thereof;
[0011] (2) A preparation capable of specifically detecting a polynucleotide comprising sequence number 2 or a complementary polynucleotide thereof;
[0012] (3) A preparation capable of specifically detecting a polynucleotide comprising sequence number 3 or a complementary polynucleotide thereof;
[0013] (4) A preparation capable of specifically detecting a polynucleotide comprising sequence number 4 or a complementary polynucleotide thereof; and
[0014] (5) A preparation capable of specifically detecting a polynucleotide comprising sequence number 5 or a complementary polynucleotide thereof.
[0015] Another aspect is to provide a primer set for the detection of Streptococcus infantis CX-4 strain, deposited under accession number KCCM12642P, selected from the following:
[0016] (i) a first primer set comprising a forward primer represented by sequence number 6 and a reverse primer represented by sequence number 7;
[0017] (ii) a second primer set comprising a forward primer represented by sequence number 8 and a reverse primer represented by sequence number 9;
[0018] (iii) a third primer set comprising a forward primer represented by SEQ ID NO: 10 and a reverse primer represented by SEQ ID NO: 11;
[0019] (iv) a fourth primer set comprising a forward primer represented by SEQ ID NO: 12 and a reverse primer represented by SEQ ID NO: 13; and
[0020] (v) A fifth primer set consisting of a forward primer represented by sequence number 14 and a reverse primer represented by sequence number 15.
[0021] Another aspect is to provide a kit for detecting Streptococcus infantis CX-4 strain, deposited under accession number KCCM12642P, comprising a composition according to one aspect.
[0022] Another aspect provides a method for detecting Streptococcus infantis CX-4 strain deposited under accession number KCCM12642P using a composition, primer set, or kit according to one aspect.
[0023] Another aspect provides the use of a formulation capable of specifically detecting a polynucleotide comprising any one of SEQ ID NOs: 1 to 5 or a complementary polynucleotide thereof, for the manufacture of a composition for detecting Streptococcus infantis CX-4 strain deposited under accession number KCCM12642P.
[0024] One aspect provides a composition for detecting Streptococcus infantis CX-4 strain, deposited under accession number KCCM12642P, comprising one or more agents selected from the following:
[0025] (1) A preparation capable of specifically detecting a polynucleotide comprising sequence number 1 or a complementary polynucleotide thereof;
[0026] (2) A preparation capable of specifically detecting a polynucleotide comprising sequence number 2 or a complementary polynucleotide thereof;
[0027] (3) A preparation capable of specifically detecting a polynucleotide comprising sequence number 3 or a complementary polynucleotide thereof;
[0028] (4) A preparation capable of specifically detecting a polynucleotide comprising sequence number 4 or a complementary polynucleotide thereof; and
[0029] (5) A preparation capable of specifically detecting a polynucleotide comprising sequence number 5 or a complementary polynucleotide thereof.
[0030] The Streptococcus infantis CX-4 strain deposited under the above accession number KCCM12642P is known in Republic of Korea Patent No. 10-2167386.
[0031] The polynucleotide comprising any one of the above sequence numbers 1 to 5 or a complementary polynucleotide thereof may be a partial sequence of the whole genome sequence of the Streptococcus infantis CX-4 strain deposited under accession number KCCM12642P. The whole genome includes all genetic information of the microorganism, such as chromosomal DNA and plasmid DNA.
[0032] The above sequence number 1 may be a sequence from position 184 to position 398 of the complete sequence of the chromosomal DNA of the CX-4 strain.
[0033] The above sequence number 2 may be a sequence from position 46,001 to position 46,072 of the complete sequence of the chromosomal DNA of the CX-4 strain.
[0034] The above sequence number 3 may be a sequence from position 46,048 to position 46,133 of the complete sequence of the chromosomal DNA of the CX-4 strain.
[0035] The above sequence number 4 may be a sequence from position 46,067 to position 46,163 of the complete sequence of the chromosomal DNA of the CX-4 strain.
[0036] The above sequence number 5 may be a sequence from position 357,457 to position 357,580 of the complete sequence of the chromosomal DNA of the CX-4 strain.
[0037] The polynucleotide comprising any one of the above sequence numbers 1 to 5 or a complementary polynucleotide thereof may be a whole genome sequencing (WGS)-based molecular marker capable of identifying the Streptococcus infantis CX-4 strain at the strain or species level. The "molecular marker" refers to a molecule having a characteristic that can confirm the presence or state of a certain living organism or substance. For example, a specific DNA base sequence can be used as a molecular marker capable of determining the presence or absence of a specific strain. When any one of the above sequence numbers 1 to 5 or a complementary sequence thereof is present in the nucleic acid sequence of the microorganism to be analyzed, the microorganism can be identified as the Streptococcus infantis CX-4 strain.
[0038] In addition, since the polynucleotide comprising any one of the above sequence numbers 1 to 5 or a complementary polynucleotide thereof is a molecular marker based on whole genome sequencing (WGS), the detection specificity is significantly superior to that of the existing 16S rRNA gene-based NGS analysis method that cannot detect a specific strain. Therefore, by utilizing the above molecular marker, the Streptococcus infantis CX-4 strain can be distinguished from microorganisms belonging to closely related strains or closely related species that cannot be distinguished by general physiological or chemical differences.
[0039] In addition, by using a preparation capable of specifically detecting a polynucleotide composed of any one of the above sequence numbers 1 to 5 or a complementary polynucleotide thereof, a specific strain can be identified only by detecting a relatively short molecular marker of less than 300 bp, and thus time and cost can be significantly reduced compared to the existing NGS analysis method that identifies a 16S rRNA gene of several hundred to several thousand bp in length.
[0040] Accordingly, a formulation capable of specifically detecting a polynucleotide comprising any one of SEQ ID NOs: 1 to 5 or a complementary polynucleotide thereof may be a formulation capable of detecting or identifying a Streptococcus infantis CX-4 strain. The formulation may specifically detect only the Streptococcus infantis CX-4 strain, distinguishing it from microorganisms having different detailed lineages. Therefore, a composition according to the above aspect may be a composition for identifying a Streptococcus infantis CX-4 strain deposited under accession number KCCM12642P.
[0041] The above formulation is not limited in type as long as it is a substance capable of specifically binding to the polynucleotide or its complementary polynucleotide. The formulation may be, but is not limited to, a primer or probe that specifically binds to the polynucleotide or its complementary polynucleotide.
[0042] The above "primer" is a short single-stranded oligonucleotide that serves as a starting point for the production of another polymer strand complementary to the template during DNA synthesis. The primer used in the nucleic acid amplification reaction may include a primer set consisting of a forward primer and a reverse primer. The length of the primer may be, but is not limited to, 15 to 40 nt, 15 to 30 nt, 15 to 25 nt, 18 to 40 nt, 18 to 30 nt, or 18 to 25 nt.
[0043] When a nucleic acid amplification reaction is performed using a primer that specifically binds to a polynucleotide consisting of any one of sequence numbers 1 to 5 or a complementary polynucleotide thereof, the Streptococcus infantis CX-4 strain can be specifically identified based on whether or not an amplification product is detected.
[0044] In one specific example, the primer may be one or more selected from the following:
[0045] (i) a first primer set comprising a forward primer represented by sequence number 6 and a reverse primer represented by sequence number 7;
[0046] (ii) a second primer set comprising a forward primer represented by sequence number 8 and a reverse primer represented by sequence number 9;
[0047] (iii) a third primer set comprising a forward primer represented by SEQ ID NO: 10 and a reverse primer represented by SEQ ID NO: 11;
[0048] (iv) a fourth primer set comprising a forward primer represented by SEQ ID NO: 12 and a reverse primer represented by SEQ ID NO: 13; and
[0049] (v) A fifth primer set consisting of a forward primer represented by sequence number 14 and a reverse primer represented by sequence number 15.
[0050] The above "probe" refers to a DNA or RNA fragment complementary to a specific base sequence of DNA or RNA, and is labeled with a radioactive element, dye, fluorescent material, etc., so that the presence or absence of a specific base sequence can be confirmed. The length of the probe may be, but is not limited to, 10 to 500 bp, 10 to 300 bp, 10 to 200 bp, 10 to 100 bp, 50 to 500 bp, 50 to 300 bp, 50 to 200 bp, 50 to 100 bp, 100 to 500 bp, 100 to 300 bp, or 100 to 200 bp.
[0051] When hybridization is performed using a probe that specifically binds to a polynucleotide consisting of any one of sequence numbers 1 to 5 or a complementary polynucleotide thereof, the Streptococcus infantis CX-4 strain can be specifically identified by the presence or absence of hybridization.
[0052] In one specific embodiment, the probe may be an oligonucleotide consisting of a sequence of at least 10, at least 20, at least 30, at least 40, at least 50, at least 100, at least 150, or at least 200 contiguous nucleotides complementary to part or all of a polynucleotide comprising any one of SEQ ID NOs: 1 to 5 or a complementary polynucleotide thereof.
[0053] In one specific example, the probe may be an oligonucleotide consisting of a nucleotide sequence of 213 nt in length complementary to a polynucleotide consisting of SEQ ID NO: 1 or a complementary polynucleotide thereof.
[0054] In one specific example, the probe may be an oligonucleotide consisting of a nucleotide sequence of 70 nt in length complementary to a polynucleotide consisting of SEQ ID NO: 2 or a complementary polynucleotide thereof.
[0055] In one specific example, the probe may be an oligonucleotide consisting of a nucleotide sequence of 84 nt in length complementary to a polynucleotide consisting of SEQ ID NO: 3 or a complementary polynucleotide thereof.
[0056] In one specific example, the probe may be an oligonucleotide consisting of a nucleotide sequence of 95 nt in length complementary to a polynucleotide consisting of SEQ ID NO: 4 or a complementary polynucleotide thereof.
[0057] In one specific example, the probe may be an oligonucleotide consisting of a nucleotide sequence of 122 nt in length complementary to a polynucleotide consisting of SEQ ID NO: 5 or a complementary polynucleotide thereof.
[0058] The above primer or probe can be chemically synthesized using a known method. The primer or probe may additionally include one or more labels selected from a radioactive element, a chromophore, a chemiluminescent phosphor, a fluorophore, and a magnetic particle linked to the 5'-end or 3'-end.
[0059] The above "label" or "detectable label" may refer to any chemical moiety bound to a nucleotide or a nucleotide polymer, wherein the binding may be a covalent bond or a non-covalent bond. The detectable labels are known in the art. Non-limiting examples of the detectable labels include, 32 P or 35 Radioactive elements such as S; linker molecules such as biotin, avidin, streptavidin, horseradish peroxidase (HRP), protein A, protein G, antibodies or fragments thereof, FLAG tags, and myc tags; enzymes such as peroxidase and luciferase; electron donors and acceptors; dyes such as Cy5 and Cy3; and magnetic particles (MPs) such as iron oxide nanoparticles and gold nanoparticles.
[0060]
[0061] Another aspect provides a primer set for the detection of Streptococcus infantis CX-4 strain, deposited under accession number KCCM12642P, selected from the following:
[0062] (i) a first primer set comprising a forward primer represented by sequence number 6 and a reverse primer represented by sequence number 7;
[0063] (ii) a second primer set comprising a forward primer represented by sequence number 8 and a reverse primer represented by sequence number 9;
[0064] (iii) a third primer set comprising a forward primer represented by SEQ ID NO: 10 and a reverse primer represented by SEQ ID NO: 11;
[0065] (iv) a fourth primer set comprising a forward primer represented by SEQ ID NO: 12 and a reverse primer represented by SEQ ID NO: 13; and
[0066] (v) A fifth primer set consisting of a forward primer represented by sequence number 14 and a reverse primer represented by sequence number 15.
[0067] The forward primer represented by the above sequence number 6 has a length of 20 bp, a Tm (melting temperature) of about 57°C, and a GC% of about 50%.
[0068] The reverse primer represented by the above sequence number 7 is 22 bp in length, has a Tm of about 58°C, and a GC% of about 45%.
[0069] The forward primer represented by the above sequence number 8 is 20 bp in length, has a Tm of about 59°C, and a GC% of about 50%.
[0070] The reverse primer represented by the above sequence number 9 is 21 bp in length, has a Tm of about 58°C, and a GC% of about 43%.
[0071] The forward primer represented by the above sequence number 10 is 21 bp in length, has a Tm of about 58°C, and a GC% of about 43%.
[0072] The reverse primer represented by the above sequence number 11 is 20 bp in length, has a Tm of about 55°C, and a GC% of about 45%.
[0073] The forward primer represented by the above sequence number 12 is 20 bp in length, has a Tm of about 58°C, and a GC% of about 45%.
[0074] The reverse primer represented by the above sequence number 13 is 23 bp in length, has a Tm of about 57°C, and a GC% of about 39%.
[0075] The forward primer represented by the above sequence number 14 is 20 bp in length, has a Tm of about 58°C, and a GC% of about 50%.
[0076] The reverse primer represented by the above sequence number 15 is 20 bp in length, has a Tm of about 58°C, and a GC% of about 50%.
[0077] When performing a nucleic acid amplification reaction using the above primer set, the amplification product can be detected only when the Streptococcus infantis CX-4 strain is present.
[0078] In one embodiment, when PCR is performed using any one of the first to fifth primer sets, it was confirmed that, under one condition having the same annealing temperature and time, no PCR product was synthesized for Streptococcus oralis YM-13, Streptococcus mitis CX-8 strain, and Streptococcus pneumoniae CX-1 strain, which belong to the same genus but different species, and that a PCR product was synthesized only for Streptococcus infantis CX-4 strain. Through this, it was confirmed that even if strains of the same genus are present in a sample, only the Streptococcus infantis CX-4 strain can be specifically and clearly detected and identified at the species level.
[0079] In one embodiment, when PCR was performed using any one of the first to fifth primer sets, it was confirmed that, under one condition having the same annealing temperature and time, no PCR product was synthesized for the Streptococcus infantis KACC 13835 strain belonging to the same species but a different strain, and that a PCR product was synthesized only for the Streptococcus infantis CX-4 strain. Through this, it was confirmed that even if strains of the same species are present in a sample, only the Streptococcus infantis CX-4 strain can be specifically and clearly detected and identified at the strain level.
[0080]
[0081] Another aspect provides a kit for detecting Streptococcus infantis CX-4 strain, deposited under accession number KCCM12642P, comprising a composition according to one aspect.
[0082] The above kit may additionally include reagents required for nucleic acid amplification reaction.
[0083] The nucleic acid amplification reaction described above may be performed using any nucleic acid amplification technology known in the art without limitation. The nucleic acid amplification reaction may be, for example, PCR (polymerase chain reaction). The PCR may include, but is not limited to, real-time PCR, RT-PCR (Reverse Transcriptase Polymerase Chain Reaction), qRT-PCR (quantitative Real-Time Polymerase Chain Reaction), etc. Accordingly, the kit described above may be a PCR kit.
[0084] Reagents required for the above nucleic acid amplification reaction may include DNA polymerase, dNTP, buffer solution, etc.
[0085] The above kit may additionally include a user guide describing optimal reaction performance conditions.
[0086]
[0087] Another aspect provides a method for detecting Streptococcus infantis CX-4 strain deposited under accession number KCCM12642P using a composition, primer set, or kit according to one aspect.
[0088] The above detection may be performed by one or more methods selected from, but not limited to, PCR analysis, DNA sequencing, hybridization by microarray, DAF (DNA Amplification Fingerprinting), Northern blot, and Southern blot.
[0089] In one embodiment, the method comprises the steps of isolating nucleic acids from a sample;
[0090] A step of performing a nucleic acid amplification reaction using the above nucleic acid as a template and a primer set according to one aspect; and
[0091] It may include a step of detecting an amplification product generated by the above nucleic acid amplification reaction.
[0092] The above sample may be a strain to be analyzed or a material expected to contain the strain.
[0093] The nucleic acid may be DNA or RNA. The nucleic acid may be DNA. The DNA may include genomic DNA (gDNA). The DNA may include chromosomal DNA and plasmid DNA (pDNA). The genomic DNA may refer to chromosomal DNA.
[0094] A method known in the art can be used to isolate nucleic acids from the above sample.
[0095] The nucleic acid amplification reaction described above can be used without limitation as long as it is a nucleic acid amplification technique known in the art. The nucleic acid amplification reaction may be, for example, PCR. The PCR may include, but is not limited to, real-time PCR, RT-PCR, qRT-PCR, etc.
[0096] The annealing temperature of the nucleic acid amplification reaction may be 50 to 70°C, 52 to 60°C, 52 to 58°C, 52 to 56°C, 54 to 60°C, 54 to 58°C, 54 to 56°C, or about 55°C.
[0097] Detection of the above amplification product can be performed through, but is not limited to, DNA chips, gel electrophoresis, radiometric measurement, fluorescence measurement, phosphorescence measurement, magnetic field measurement, etc.
[0098] In the above detection step, if an amplification product is detected, it may be determined that the sample is the Streptococcus infantis CX-4 strain deposited with accession number KCCM12642P, or it may be determined that the strain is present in the sample.
[0099] Therefore, the above method may be a method for identifying the Streptococcus infantis CX-4 strain deposited under the accession number KCCM12642P.
[0100]
[0101] Another aspect provides the use of a formulation capable of specifically detecting a polynucleotide comprising any one of SEQ ID NOs: 1 to 5 or a complementary polynucleotide thereof, for the manufacture of a composition for detecting Streptococcus infantis CX-4 strain deposited under accession number KCCM12642P.
[0102]
[0103] Duplicate content is omitted in consideration of the complexity of this specification, and terms not otherwise defined herein have the meanings commonly used in the technical field to which the present invention belongs.
[0104] The composition according to the aspect utilizes a whole-genome sequencing (WGS)-based molecular marker, so that the Streptococcus infantis CX-4 strain can be rapidly and accurately detected or identified with high detection specificity at the strain or species level.
[0105] Figure 1 shows the results of confirming the first primer set for detection of the finally selected Streptococcus infantis CX-4 using NCBI Primer Blast.
[0106] Figure 2 shows the results of confirming the second primer set for detection of the finally selected Streptococcus infantis CX-4 using NCBI Primer Blast.
[0107] Figure 3 shows the results of confirming the third primer set for detection of Streptococcus infantis CX-4, which was finally selected, using NCBI Primer Blast.
[0108] Figure 4 shows the results of confirming the fourth primer set for detection of the finally selected Streptococcus infantis CX-4 using NCBI Primer Blast.
[0109] Figure 5 shows the results of confirming the fifth primer set for detection of the finally selected Streptococcus infantis CX-4 using NCBI Primer Blast.
[0110] Figure 6 shows the electrophoresis results of PCR products using the first primer set for detection of Streptococcus infantis CX-4.
[0111] Figure 7 shows the electrophoresis results of PCR products using the second primer set for detection of Streptococcus infantis CX-4.
[0112] Figure 8 shows the electrophoresis results of PCR products using the third primer set for detection of Streptococcus infantis CX-4.
[0113] Figure 9 shows the electrophoresis results of PCR products using the fourth primer set for detection of Streptococcus infantis CX-4.
[0114] Figure 10 shows the electrophoresis results of PCR products using the fifth primer set for detection of Streptococcus infantis CX-4.
[0115] The following examples are provided for more detailed description. However, these examples are provided solely to illustrate one or more specific examples, and the scope of the present invention is not limited to these examples.
[0116]
[0117] Example 1: Preparation of primer
[0118] Primers capable of specifically detecting Streptococcus infantis CX-4 strain (accession number: KCCM12642P) were developed.
[0119] First, whole-genome sequences of microorganisms belonging to closely related strains or species that cannot be distinguished by general physiological or chemical differences were collected from the National Center for Biotechnology Information (NCBI). The target strains and comparison strains are shown in Table 1.
[0120] Genus Species Strain Target strain Streptococcus infantis CX-4 Comparison strain 1 Streptococcus infantis KACC 13835 Comparison strain 2 Streptococcus oralis YM-13 Comparison strain 3 Streptococcus mitis CX-8 Comparison strain 4 Streptococcus pneumoniae CX-1
[0121] After fragmenting the whole genome information of the strains in Table 1 into 10-500 bp units, the fragmented sequences were numbered using Linux commands. Furthermore, sequence information was collected for the remaining regions after excluding regions with identical sequences using NCBI's Nucleotide Blast. Subsequently, candidate primers were designed using primer design systems such as NCBI Primer Blast among regions containing rare sequences.
[0122]
[0123] Example 2: In-silico PCR of candidate primers
[0124] Prior to producing the primers selected as candidates in Example 1, theoretical validation of the primers was performed through in-silico PCR using a server.
[0125] Figure 1 shows the results of confirming the first primer set for the detection of Streptococcus infantis CX-4, which was finally selected, using NCBI Primer Blast. The first primer set can specifically detect a 213 bp sequence from positions 184 to 398 of the full-length genomic DNA sequence of the Streptococcus infantis CX-4 strain. The 213 bp sequence is shown in SEQ ID NO: 1.
[0126] Figure 2 shows the results of confirming the second primer set for the detection of Streptococcus infantis CX-4, which was finally selected, using NCBI Primer Blast. The second primer set can specifically detect a 70 bp sequence from positions 46,001 to 46,072 of the full-length genomic DNA sequence of the Streptococcus infantis CX-4 strain. The 70 bp sequence is shown in SEQ ID NO: 2.
[0127] Figure 3 shows the results of confirming the third primer set for the detection of Streptococcus infantis CX-4, which was finally selected, using NCBI Primer Blast. The third primer set can specifically detect an 84 bp sequence from positions 46,048 to 46,133 of the full-length genomic DNA sequence of the Streptococcus infantis CX-4 strain. The 84 bp sequence is shown in SEQ ID NO: 3.
[0128] Figure 4 shows the results of confirming the fourth primer set for the detection of Streptococcus infantis CX-4, which was finally selected, using NCBI Primer Blast. The fourth primer set can specifically detect a 95 bp sequence from positions 46,067 to 46,163 of the full-length genomic DNA sequence of the Streptococcus infantis CX-4 strain. The 95 bp sequence is shown in SEQ ID NO: 4.
[0129] Figure 5 shows the results of confirming the fifth primer set for the detection of Streptococcus infantis CX-4, which was finally selected, using NCBI Primer Blast. The fifth primer set can specifically detect a 122 bp sequence from positions 357,457 to 357,580 of the full-length genomic DNA sequence of the Streptococcus infantis CX-4 strain. The 122 bp sequence is shown in SEQ ID NO: 5.
[0130]
[0131] Example 3: Primer verification PCR performed at optimal temperature
[0132] For the five primer sets finally selected in Example 2, primer validation experiments were conducted via PCR at the optimal temperature using the genomic DNA (gDNA) of the target strain and comparison strain as templates. Information on the five primer sets is shown in Table 2 below.
[0133] Target strain Primer set Direction Sequence (5'->3') Sequence number Annealing temperature Amplification product Streptococcus infantis CX-4 First primer set Forward TGGCTATCGGGTTTCCAAGTC6 55℃ 213 bp (SEQ ID NO: 1) Reverse TGGCTACAAATATTTCCATCTCC7 Second primer set Forward ATGCTCAAGGTGCCTTTATGC8 55℃ 70 bp (SEQ ID NO: 2) Reverse AGCGCTGTTTTACAAAGGTG9 Third primer set Forward ACCACCTTTGTAAAACAAGCG 10 55℃ 84 bp (SEQ ID NO: 3) Reverse TTTTTTCGGTACTGGAGTCAG 11 Fourth primer set Forward CGCTGCAATCTTGCATCTT 12 55℃ 95 bp (SEQ ID NO: 4) Reverse (Reverse)TGGATGATTTTGAGGATCTTGTG13 Primer set 5 Forward (Forward)GTAGACCTTGCCATTGCCTT1455℃122 bp (SEQ ID NO: 5) Reverse (Reverse)GAATGGCCAGTAGTTGTGCT15
[0134]
[0135] Example 4: Confirmation of specific reaction of primers
[0136] Experiments were conducted to confirm that the final selected primers specifically bind only to the target strain.
[0137] Specifically, PCR was performed using five primer sets for each of the genomic DNA (gDNA) of Streptococcus infantis CX-4, Streptococcus infantis KACC 13835, Streptococcus oralis YM-13, Streptococcus mitis CX-8, and Streptococcus pneumonia CX-1; DNA of environmental samples; and a negative control. Total skin DNA was used as the environmental sample DNA. Sterile distilled water (SDW) was used as the negative control.
[0138] Figure 6 shows the electrophoresis results of PCR products using the first primer set for detection of Streptococcus infantis CX-4.
[0139] Figure 7 shows the electrophoresis results of PCR products using the second primer set for detection of Streptococcus infantis CX-4.
[0140] Figure 8 shows the electrophoresis results of PCR products using the third primer set for detection of Streptococcus infantis CX-4.
[0141] Figure 9 shows the electrophoresis results of PCR products using the fourth primer set for detection of Streptococcus infantis CX-4.
[0142] Figure 10 shows the electrophoresis results of PCR products using the fifth primer set for detection of Streptococcus infantis CX-4.
[0143] As a result, as shown in FIGS. 6 to 10, all five primer sets were able to confirm DNA bands only in PCR products using Streptococcus infantis CX-4 as a sample.
[0144] The optimal PCR amplification conditions for detecting Streptococcus infantis CX-4 strain are shown in Table 3 below.
[0145] Temperature Time Cycle Pre-denaturation 95℃ 3 minutes 1 cycle Denaturation 95℃ 30 seconds 30 cycles Annealing 55℃ 30 seconds Extension 72℃ 30 seconds Final Extension 72℃ 3 minutes 1 cycle Hold 4℃ ∞
Claims
1. A composition for detecting Streptococcus infantis CX-4 strain deposited under accession number KCCM12642P, comprising at least one preparation selected from the following: (1) A preparation capable of specifically detecting a polynucleotide comprising sequence number 1 or a complementary polynucleotide thereof; (2) A preparation capable of specifically detecting a polynucleotide comprising sequence number 2 or a complementary polynucleotide thereof; (3) A preparation capable of specifically detecting a polynucleotide comprising sequence number 3 or a complementary polynucleotide thereof; (4) A preparation capable of specifically detecting a polynucleotide comprising sequence number 4 or a complementary polynucleotide thereof; and (5) A preparation capable of specifically detecting a polynucleotide comprising sequence number 5 or a complementary polynucleotide thereof.
2. A composition according to claim 1, wherein the polynucleotide or its complementary polynucleotide is a partial sequence of the whole genome sequence of the Streptococcus infantis CX-4 strain.
3. A composition according to claim 1, wherein the agent is a primer or probe that specifically binds to the polynucleotide or its complementary polynucleotide.
4. In claim 3, the composition wherein the primer is at least one selected from the following: (i) a first primer set comprising a forward primer represented by sequence number 6 and a reverse primer represented by sequence number 7; (ii) a second primer set comprising a forward primer represented by sequence number 8 and a reverse primer represented by sequence number 9; (iii) a third primer set comprising a forward primer represented by SEQ ID NO: 10 and a reverse primer represented by SEQ ID NO: 11; (iv) a fourth primer set comprising a forward primer represented by SEQ ID NO: 12 and a reverse primer represented by SEQ ID NO: 13; and (v) A fifth primer set consisting of a forward primer represented by sequence number 14 and a reverse primer represented by sequence number 15.
5. Primer set for detection of Streptococcus infantis CX-4 strain deposited under accession number KCCM12642P selected from the following: (i) a first primer set comprising a forward primer represented by sequence number 6 and a reverse primer represented by sequence number 7; (ii) a second primer set comprising a forward primer represented by sequence number 8 and a reverse primer represented by sequence number 9; (iii) a third primer set comprising a forward primer represented by SEQ ID NO: 10 and a reverse primer represented by SEQ ID NO: 11; (iv) a fourth primer set comprising a forward primer represented by SEQ ID NO: 12 and a reverse primer represented by SEQ ID NO: 13; and (v) A fifth primer set consisting of a forward primer represented by sequence number 14 and a reverse primer represented by sequence number 15.
6. A kit for detecting Streptococcus infantis CX-4 strain, deposited under accession number KCCM12642P, comprising the composition of claim 1.
7. A kit according to claim 6, further comprising a reagent necessary for a nucleic acid amplification reaction.
8. Step of isolating nucleic acid from the sample; A step of performing a nucleic acid amplification reaction using the above nucleic acid as a template and the primer set of claim 5; and A method for detecting Streptococcus infantis CX-4 strain deposited under accession number KCCM12642P, comprising a step of detecting an amplification product produced by the above nucleic acid amplification reaction.
9. A method according to claim 8, wherein the nucleic acid is DNA.
10. A method according to claim 8, wherein, when an amplification product is detected, the sample is determined to be the Streptococcus infantis CX-4 strain deposited under accession number KCCM12642P, or the strain is determined to be present in the sample.
11. Use of a preparation capable of specifically detecting a polynucleotide comprising any one of sequence numbers 1 to 5 or a complementary polynucleotide thereof, for the manufacture of a composition for detecting Streptococcus infantis CX-4 strain deposited under accession number KCCM12642P.
Citation Information
Patent Citations
Composition for strengthening skin barrier, moisturizing skin or anti-aging
KR102167386B1
MNP marker combination of streptococcus pneumonia, primer pair combination, kit and uses thereof
WO2023077488A1