Method and device for portable detection of pathogens

The CRISPR-based Lab-in-Tube device addresses the challenges of TB and drug-resistant strain detection in resource-limited settings by integrating nucleic acid amplification and detection in a portable, user-friendly format, achieving rapid and accurate results.

WO2026015678A1PCT designated stage Publication Date: 2026-01-15THE ADMINISTRATORS OF THE TULANE EDUCATIONAL FUND
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/037040
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-03-07
Filing Date
2025-07-09
Publication Date
2026-01-15

AI Technical Summary

Technical Problem

Current TB diagnostic methods, particularly in resource-limited settings, face challenges due to the need for centralized laboratories, specialized personnel, and expensive equipment, leading to delayed and inaccurate diagnoses, especially for drug-resistant TB strains, and other pathogens like Mycobacterium abscessus, Pneumocystis jirovecii, and Zaire ebolavirus, which are difficult to identify quickly and accurately.

Method used

A CRISPR-based portable assay integrated into a Lab-in-Tube (LIT) device for point-of-care detection, utilizing a 3D-printed cap design with lyophilized reagents and a pen-like mechanism, enabling one-pot nucleic acid amplification and detection in bodily fluids without the need for complex infrastructure, suitable for diverse environments.

Benefits of technology

The device provides rapid, accurate, and cost-effective detection of TB and drug-resistant strains within one hour, suitable for diverse patient samples, enhancing diagnostic accessibility and reducing errors in resource-limited settings.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000015_0001
    Figure IMGF000015_0001
  • Figure IMGF000016_0001
    Figure IMGF000016_0001
  • Figure IMGF000017_0001
    Figure IMGF000017_0001
Patent Text Reader

Abstract

A method and device for portable detection of a nucleic acid of interest is disclosed. The device comprises a) a housing, b) a processing module, comprising a microprocessor, c) an incubator module, comprising a heating element; d) an imaging module, comprising an imaging chamber, an image capturing element, and an optical element, wherein the imaging module is operatively connected to the processing module to analyze images captured by the image capturing element; and e) a power source, wherein the power source is operatively connected to the incubator module, the imaging module, and the processing module. The device can further comprise a testing cartridge and a testing strip.
Need to check novelty before this filing date? Find Prior Art

Description

METHOD AND DEVICE FOR PORTABLE DETECTION OF PATHOGENSPRIOR RELATED APPLICATIONS

[0001] This application claims priority to U.S. provisional application serial number 63 / 669,004, filed July 9, 2024; 63 / 669,192, filed July 9, 2024; and 63 / 768,870, filed March 7, 2025, each of which is incorporated herein in its entirety for all purposes.FEDERALLY SPONSORED RESEARCH STATEMENT

[0002] This invention was made with government support under R21 AU69582, R01 AI173021, R01 AI175618, R01 AI174964, R01 AI144168, and ROl AI177986 awarded by the National Institutes of Health. The government has certain rights in the invention.FIELD OF THE DISCLOSURE

[0003] The disclosure generally relates to detection of active tuberculosis and other pathogens, and more particularly to a method and device for portable detection of active tuberculosis or other pathogens and drug resistance, as well as a CRISPR-based portable assay for detecting said pathogens in various bodily fluids in a fast, accurate and cost- effective manner.BACKGROUND OF THE DISCLOSURE

[0004] Tuberculosis (TB) is a serious global health threat, particularly in low- and middle-income countries where over 90% of new TB cases occur. Recent efforts to improve TB diagnostic testing capacity have not been sufficient with an estimated 4.2 million (40%) of TB cases being undiagnosed or unreported in 2021. In addition, TB prevalence and mortality have increased due to interruption of TB health services during the COVID-19 pandemic. High TB burden areas often have poor healthcare infrastructure, funding, and training, reducing diagnosis and treatment efficacy where these services are most needed. Therefore, there is an urgent need to increase access to TB care in low- and middle-income settings to improve TB health equity.

[0005] Rapid and reliable assays are needed at the point-of-care (POC) to accomplish TB diagnosis at sites of patient care and sample collection in resource-limited settingswithout the need for sample transportation, specialized personnel, and expensive, bulky equipment.

[0006] Diagnosing TB at patient care sites that lack centralized clinical laboratories is a challenge, making TB case finding difficult before TB transmission occurs further in the community. GeneXpert is the most commonly used molecular TB diagnostic test but has been difficult to apply in areas of high TB burden contributing to missing TB cases. Difficulties in application of TB testing labs in high burden areas include requirement for stable external power supply and BSL-2 labs with specialized technicians. In addition, the cost of establishing testing labs is inhibitory for expanding testing outside of centralized laboratories with sufficient infrastructure where samples often need to be shipped to testing sites complicating and delaying the diagnostic result.

[0007] Drug resistant (DR) TB cases are major obstacles to the treatment of TB leading to a low treatment success rate of 60% globally. There was an increase in rifampicin- resistant TB, a key first-line TB drug, with 450,000 new cases of rifampicin-resistant TB identified in 2021. Although WHO recommends DR testing for all active TB cases, current approaches for drug resistance detection have significant limitations. Drug susceptibility testing (DST) is the gold- standard, but turnaround time can take weeks and the process is resource intensive. GeneXpert can detect mutations leading to rifampicin- resistance, but share the same limitations when detecting active TB including expense, infrastructure, personnel etc. Sequencing-based assays target a wide range of drug resistant mutations but are difficult to apply at the point-of-care (POC) due to high cost and equipment requirement. New POC DR TB assays that can be used in resourcelimited areas are needed to improve care.

[0008] Streamlined CRISPR-detection assay designs have been used to diagnose infectious disease with great potential at the POC. High clinical sensitivity and specificity has been achieved using CRISPR-based assays with limited equipment and workflow steps required. These assays typically comprise of three steps to achieve sample-to- answer workflows with limited resource and technical expertise required: (1) lysis of pathogen to release nucleic acid into lysate, (2) one-pot isothermal amplification and CRISPR detection of pathogen nucleic acid, and (3) simplified readout by naked eye or smartphone imaging providing quantitative, reportable results. Optimized lysis procedures by chemical-, thermal, or mechanical-rupture of pathogen membranes have been developed to protect released nucleic acid without conventional DNA isolationssteps. Combining CRISPR fluorescent production with isothermal amplification methods including recombinase polymerase amplification (RPA), loop mediated isothermal amplification (LAMP), and rolling circle amplification (RCA) can specifically detect small concentrations of pathogen markers. Lateral flow, color change, and smartphone imaging readouts have been well validated to allow users to easily understand the result of the assay. CRISPR-based assays show great potential in rapidly detecting infectious disease with limited resources performed by minimally trained personnel.

[0009] Apart from use in POC applications, CRISPR detection assays have been useful in diagnosing infectious disease in minimally invasive sample types with low target concentration due to CRISPR signal enhancement after target amplification. For active TB in children and people living with HIV, sputum collection is often not possible so non-sputum based tests are needed to evaluate disease status. Previously, we have used CRISPR to diagnose TB in pediatric serum samples using near POC assays utilizing one- pot RPA-CRISPR reactions. These assays simplified the equipment and liquid handling steps required for diagnosis compared to PCR, but the pipetting steps and requirement for cold-chain storage limited application in the field. There is an urgent need for one- step detection of TB infection in serum samples from children and HIV patients where isolated DNA is directly added and signal is automatically analyzed.

[0010] Additionally, several pathogens have been causing health problems and are difficult to easily and accurately identify the source microbes. For example, Mycobacterium abscessus complex is a mycobacterium found in water, soil and dust and it causes a variety of infections, including serious lung infection in people having chronic lung diseases such as cystic fibrosis. Effective treatment requires correct identification of mycobacterium for appropriate combination of antibiotics. Pneumocystis jirovecii is a yeast-like fungus of the genus Pneumocystis. The causative organism of Pneumocystis pneumonia, it is an important human pathogen, particularly among immunocompromised hosts — particularly those with HIV infection, but also those with severely suppressed immune systems due to various reasons, such as bone marrow transplants. Zaire ebolavirus is one of six known species within the genus Ebolavirus. Four of the six known ebolaviruses cause a severe and often fatal hemorrhagic fever in humans and other mammals, known as Ebola virus disease. Clinically it is identified through a combination of symptom evaluation, laboratory testing, and epidemiologicalinvestigation. Borrelia burgdorferi is the bacteria that causes Lyme disease. It is clinically identified through a combination of methods including serological testing, PCR or culturing. The conventional methods of identifying these pathogens are time consuming and / or error-prone.

[0011] Therefore, there is the need for a method and device for portable detection of active TB, especially against certain drug resistant strains, at point-of-care that is easily operated and low cost.SUMMARY OF THE DISCLOSURE

[0012] To fulfill the need, the present disclosure describes a CRISPR-based assay for detecting tuberculosis (TB) that is both portable, accurate and cost effect that can be used in areas where regular PCR is not feasible. DNA isolation, target amplification, and data analysis steps are integrated into a single clinical application that can be operated by a person with minimal training, as shown in FIG. 1 A and ID. A bodily fluid sample, such as sputum, saliva, blood or urine, is first collected in an assay tube that optionally already has lysis buffer in it, although certain samples may not need lysis. Depending on sample type, when necessary for lysing, the assay tube is swirled and incubated. Subsequently, the sample is placed into contact with a test strip within the assay tube that contains CRISPR-based reagents to initiate the assay reaction. Each test strip has primers and gRNAs that target either the conserved sequences of a pathogen’s genome, or the most frequent mutations associated with drug resistance to the drugs approved for treatment of that pathogen. In the case of TB, these include rifampin (RIF), isoniazid (INH), ethambutol (EMB), pyrazinamide (PZA), and potentially many others. Fluorescent signals (emitted from the CRISPR-based reagents) indicating the presence of a DNA or RNA target is read by a portable device, and positive signals in any of the multiplex reactions is considered an indication of drug resistance to that drug. Alternatively, colorimetric probes, electrochemical probes, chemiluminescent probes, or ratiometric probes can also be used without deviating from the invention.

[0013] One such portable device is described here, termed a Lab-in-Tube (LIT) diagnostic device, that is low-cost, ultraportable, battery-operated, and capable of mediating CRISPR-based disease diagnosis and drug-resistance detection in a single sample collection tube. With a patient’s sample, such as sputum, plasma serum, bronchoalveolar lavage, gastric lavage, oral wash, swabs, urine, saliva, feces or others,the disease and DR disease phenotypes can be detected within one hour. The integrated workflow allows diagnosis using portable devices and LIT consumable, through one or more steps including sample liquification, microbe lysis, one-pot RPA-CRISPR detection, fluorescent imaging, and automatic fluorescent analysis achieved by the complete unit.

[0014] To enable certain steps of this workflow, lyophilized detection reagents can be absorbed onto a paper-based matrix, which eliminates liquid handling (other than the biological sample from patients). Such lyophilized detection reagents do not require cold-chain storage or transportation. PAM-free gRNAs used herein permit enhanced sensitivity and reaction kinetics, while the novel gRNA design allows specific detection of SNPs representing certain drug-resistant mutations. Additionally, the method and device of this disclosure presents high diagnostic sensitivity and specificity among various adult and pediatric patient sample types, such as sputum and blood samples. The method and device of this disclosure can be widely applied to different pathogens and patient sample types / origins.

[0015] Another inexpensive option for enabling portions of this workflow, termed a Labin-Tube Cap device, is described herein, offering several significant improvements over existing solutions, particularly in point-of-care diagnostics and complementing other aspects of this disclosure. Its 3D-printed, low-cost design reduces manufacturing expenses, making it more accessible in resource-limited settings. The pen-like design with simple positions (up, down, and optionally middle) enhances portability and user- friendliness, making it ideal for diverse environments. The device's interlocking parts eliminate the need for glue or complex assembly, reducing the risk of contamination and failure, while the rubber band tension mechanism ensures durability and secure placement without the risk of malfunction. Other mechanical features may be used to hold the LIT Cap together without deviating from the present disclosure. Compatible with a variety of diagnostic processes, the Lab-in-Tube Cap is versatile, adaptable, and enhances hygiene and safety by preventing sample contamination. Specifically designed for point-of-care use, it can be deployed in remote areas with minimal infrastructure, improving access to medical testing and diagnostics without requiring sophisticated lab equipment. This combination of affordability, ease of use, and functionality provides a reliable solution for rapid diagnostics.

[0016] Constructed from as few as five interlocking parts, the cap is easy to assemble without requiring glue, making it robust and production friendly. Additionally, this cap can be held together using tension (e.g., via low-cost rubber bands), ensuring the device remains a single, cohesive piece while keeping contaminants out of the sample. It seals one-pot assays effectively and supports two-step diagnostic workflows, such as DNA amplification followed by detection.

[0017] Optimized for disposable use in point-of-care settings, the cap can incorporate a number of analytical materials including low-cost cellulose discs and DNA enrichment membranes, ensuring efficient reagent delivery and precise sample alignment with Labin-Tube readout devices. By eliminating the need to reopen the test tube during diagnostics, it enhances workflow efficiency and accuracy. Furthermore, with its intuitive design, users simply "click" to operate, making the device highly accessible and reducing the risk of user error.

[0018] This innovative cap bridges the gap between advanced diagnostic performance and accessibility, making it an ideal tool for global health applications, especially in resource-limited settings. One configuration of the Lab-in-Tube Cap introduces a novel three-position click mechanism (up, middle, down), enabling precise control over diagnostic workflows, unlike traditional two-stage designs. It can be assembled using rubber bands as well as springs or other tensioning mechanism, preventing contamination and keeping the device cohesive without requiring glue. Made from as few as five interlocking parts, this low-cost cap is compatible with 3D printing and other rapid prototyping manufacture, easy to assemble, and disposable, making it ideal for point-of- care settings. It supports seamless one-pot diagnostic workflows, such as DNA amplification and detection, enhancing efficiency while minimizing user error. With its intuitive, pen-like operation, the cap combines advanced functionality with accessibility, making it a game-changer for global health diagnostics.

[0019] The Lab-in-Tube Cap addresses several challenges in point-of-care diagnostics, particularly the risk of sample contamination, user error, and inefficiency in multi-step diagnostic workflows. Unlike traditional methods, Lab-in-Tube Cap does not require reopening tubes to introduce reagents or make contact between diagnostic components, reducing the risk of errors and workflow disruptions. Additionally, this embodiment addresses the lack of simple, disposable, and cost-effective solutions in low-resource and remote settings.

[0020] The purpose of the Lab-in-Tube Cap is to provide an affordable, user-friendly, and efficient solution for point-of-care diagnostics. By integrating a click mechanism with a range of click positions (two, three or more) and supporting seamless one-pot workflows, the cap simplifies DNA amplification and detection steps, reduces handling errors, and improves sample alignment. It is specifically designed to enhance diagnostic accuracy and accessibility, making advanced testing feasible in resource-limited environments.

[0021] The Lab-in-Tube Cap can be applied in point-of-care diagnostics, especially in low-resource settings, by enabling rapid, cost-effective testing for a variety of diseases affecting those settings, including tuberculosis, pneumonia, ebola, HIV and various other diseases, as long as the corresponding pathogens are present in the bodily fluid sample. Its portable, easy-to-use design makes it ideal for field use in remote areas, mobile health units, or emergency response situations. It can integrate with numerous molecular diagnostic platforms, including the CRISPR-based assays described herein, supporting nucleic acid amplification and detection for various assays. Additionally, it has applications in environmental and food safety testing, as well as personalized medicine, offering a versatile solution for on-site, reliable diagnostics without the need for complex laboratory infrastructure.

[0022] In one aspect of this disclosure, a portable device for detecting presence of a pathogen in a biological sample is described, and the portable device comprises: a housing; a processing module, optionally comprising a microprocessor; an incubator module, optionally comprising a heating or cooling element; an imaging module, comprising one or more of an imaging chamber, an image capturing element, and / or a light-emitting element, wherein the imaging module is operatively connected to the processing module to analyze images captured by the image capturing element; and a power source, wherein the power source is operatively connected to one or more of the incubator module, the imaging module, and / or the processing module.

[0023] In another aspect of this disclosure, a method of detecting presence of a pathogen in a biological sample is described, the method comprising: amplifying a target nucleic acid sequence from a bodily fluid sample; and detecting presence of the target nucleic acid sequence using a CRISPR-mediated system; wherein the CRISPR-mediated system comprises a CRISPR effector protein, a guide RNA (gRNA) that hybridizes with thetarget nucleic acid sequence, and a reporter molecule that is detectable on cleavage by the CRISPR effector protein.

[0024] In one aspect of this disclosure, a test strip for detecting a pathogen is described. The test strip comprises nucleotide amplification reagents and CRISPR reagents. A number of pathogens can be detected, including TB, Mycobacterium abscessus. Pneumocystis jirovecii, Zaire ebolavirus, Borrelia burgdorferi, and other pathogens sharing characteristics with these. The inventors envision that the device and method described herein can be readily used for a wide range of applications, as long as the target nucleic acid is present in a biological sample, and can therefore be amplified and detected.

[0025] In one embodiment, the housing comprises an incubating opening and an imaging opening, wherein the incubating opening is connected to the heating element of the incubator module, and the imaging opening is connected to the imaging module.

[0026] In one embodiment, the portable device comprises a testing cartridge and a testing strip.

[0027] In one embodiment, the testing cartridge is shaped and sized to fit into the imaging chamber and / or the incubating opening to be heated by the heating element.

[0028] In one embodiment, the testing strip comprises a DNA-binding membrane.

[0029] In one embodiment, the testing strip comprises nucleic acid amplification reagents and CRISPR-detection reagents fixed on a substrate.

[0030] In one embodiment, the nucleic acid amplification reagents comprises one or more of RPA primers and / or RPA enzymes, and the CRISPR-detection reagents comprises one or more of Casl2a, Casl2b, Casl3, Cas9, and Casl4 effector proteins, gRNAs, and / or fluorescent probes or other probes such as colorimeter, electrochemical probes, chemiluminescent probes, or ratiometric probes, etc.

[0031] In one embodiment, the testing cartridge comprises a loading mechanism that holds the testing strip away from the bottom of the testing cartridge.

[0032] In one embodiment, the processing module further comprising a display.

[0033] In one embodiment, the processing module further comprising a data transmission unit, wherein the data transmission unit transmits data to a separate digital device.

[0034] In one embodiment, the imaging module further comprises a filter to filter lights entering into the image capturing element. In one embodiment, the imaging module further comprises optical lenses for zooming.

[0035] In one embodiment, the power source is a rechargeable battery, a non- rechargeable battery, a generator, an alternator, a solar energy module, or a source of DC current.

[0036] In one embodiment, the gRNA hybridizes with a target sequence that is a portion of IS6110, esxB, IS 1081, gyrA, and 16s rRNA.

[0037] In one embodiment, the gRNA hybridizes with a target sequence having at least one of: i) S450L, D435V, H445Y, H445D, D435Y, S450W, L452P, H445L, S450F, L430P, or H445R SNPs of rpoB, ii) S315T, S315N, or W328L of katG,' iii) c-777t (fabGl_c-15t) or g-154a (fabGl_L203L) of fabGl-inhA,' iv) M306V, D354A, Y319S, D328Y, Q497R, G406A, G406D, G406S, Q497K or G406C of embB, v) H57D, a-l lg, Q10P, H51D, T76P, G97D, V7G, C14R, D49G or H57R of pncA.

[0038] In one embodiment, the gRNA does not need to include a protospacer adjacent motif (PAM) sequence.

[0039] In one embodiment, the biological or bodily fluid sample is sputum, blood, serum, saliva, feces, urine, cerebrospinal fluid, as well as other biological samples known in the field. Processing of the biological samples for easier access to nucleic acid is known to persons skilled in the art, and therefore will not be described in detail.

[0040] In one embodiment, the amplifying of the target nucleic acid sequence is carried out using polymerase chain reaction (PCR), recombinase polymerase amplification (RPA), nucleic acid sequence-based amplification (NASB A), rolling circle amplification (RCA), or loop-mediated isothermal amplification (LAMP).

[0041] In one embodiment, the target nucleic acid sequence corresponds to a portion of the DNA or RNA from Mycobacterium tuberculosis, Mycobacterium abscessus, Mycobacterium avium, Mycobacterium kansasii, Zaire ebolavirus, Pneumocystis jirovecii, or Treponema pallidum.

[0042] In one embodiment, the target sequence comprises a drug resistant gene.

[0043] In one embodiment, the targe sequence comprises a portion of a gene selected from rpoB, katG, fabGl-inhA, embB, and pncA.

[0044] In one embodiment, the method further comprises, prior to step a), a lysis step by introducing the biological sample into a lysis solution.

[0045] In one embodiment, the lysis step is carried out at a temperature between room temperature and 100°C for a predetermined period of time.

[0046] In one embodiment, the amplification step a) is carried out at a temperature between 30 and 40°C for a predetermined period of time.

[0047] The test strip can be made of various materials as long as the sample liquid can adequately interact with the reagents. One example is sample being absorbed through capillary effect to react with the reagents. In one embodiment, the test strips can be made of paper, cellulose, cotton, fiber or sponge. Paper is advantageous in its microfluidic property as well as the possibility of immobilizing reagents thereon, but other materials sharing these characteristics are compatible with this approach.

[0048] The nucleotide amplification reagents and CRISPR reagents are immobilized on the test strip through various methods known to people having ordinary skills in the art. For example, the reagents may be immobilized by lyophilization to allow easier transportation and shell life. Other immobilization method may also be used, such as covalent attachment or method known in the field.

[0049] The bodily fluids as used herein can be blood, sputum, saliva, urine or other bodily fluids that may have trace of pathogen-derived molecules, e.g., nucleic acids, in them. In one embodiment, the bodily fluid is sputum, and in another embodiment the bodily fluid is blood.

[0050] The CRISPR-based reagents may include CRISPR effector proteins, guide RNAs, and / or reporter molecules. Non-limiting examples of CRISPR effector proteins include Cast 2a (Lachnospiraceae bacterium), Cas9 (Streptococcus pyogenes) and Cast 3 (Leptotrichia shahii).Caslla enzyme 1: EnGen Lba Caslla (Cpfl) (Lachnospiraceae bacterium)Casl2a enzyme 2: CRISPR-Casl2a (Cpfl) (Lachnospiraceae bacterium)Casl2a enzyme 3: ToloBio Casl2a (Lachnospiraceae bacterium)

[0051] The guide RNAs in the CRISPR-mediated reaction are crucial for recognizing the target sequences. For this disclosure, non-limiting example of the guide RNA sequence may include:IS6110 gRNA 1: UAAUUUCUACUCUUGUAGAUAUCAGCUCGGUCUUGUAUAG (SEQ ID NO: 1)IS6110 gRNA 2: UAAUUUCUACUCUUGUAGAUUCAGCUCGGUCUUGUAUAGG (SEQ ID NO: 2)IS6110 gRNA 3: UAAUUUCUACUCUUGUAGAUCCAGUACUGCAACGACGUCC (SEQ ID NO: 3) rpoB S450L gRNA 1: UAAUUUCUACUCUUGUAGAUACUGUUGGCGCUGGGGCCCGG(SEQ ID NO: 4) rpoB S450L gRNA 2: UAAUUUCUACUCUUGUAGAUGCGCCAACAGUCGGCGCUUGU(SEQ ID NO: 5) rpoB S450L gRNA 3: UAAUUUCUACUCUUGUAGAUCCAACAGTCGGCGCTTGTGGG(SEQ ID NO: 6) rpoB D435V gRNA 1: UAAUUUCUACUCUUGUAGAUUCCAGAACAACCCGCUGUCGG (SEQ ID NO: 7) rpoB D435V gRNA 2: UAAUUUCUACUCUUGUAGAUUGCAGAACAACCCGCUGUCGG (SEQ ID NO: 8) rpoB H445Y gRNA 1: UAAUUUCUACUCUUGUAGAUAGGUCAACCCCGACAGCGGGU (SEQ ID NO: 9) rpoB H445Y gRNA 2: UAAUUUCUACUCUUGUAGAUAGUUCAACCCCGACAGCGGGU (SEQ ID NO: 10) rpoB H445D gRNA 1: UAAUUUCUACUCUUGUAGAUCCGACAAGCGCCGACUGUCGG (SEQ ID NO: 11) rpoB H445D gRNA 2: UAAUUUCUACUCUUGUAGAUGACCGACAAGCGCCGACUGUC (SEQ ID NO: 12) rpoB D435Y gRNA 1: UAAUUUCUACUCUUGUAGAUCAAUUCAUGUACCAGAACAAC (SEQ ID NO: 13) rpoB D435Y gRNA 2: UAAUUUCUACUCUUGUAGAUGGUACAUGAAUUGGCUCAGCU (SEQ ID NO: 14) rpoB S450W gRNA 1: UAAUUUCUACUCUUGUAGAUACUGUGGGCGCUGGGGCCCGG (SEQ ID NO: 15) rpoB S450W gRNA 2: UAAUUUCUACUCUUGUAGAUAGAGUGGGCGCUGGGGCCCGG (SEQ ID NO: 16)rpoB L452P gRNA 1 : UAAUUUCUACUCUUGUAGAU UCGCCGGGGCCCGGCGGUCUG (SEQ ID NO: 17) rpoB L452P gRNA 2: UAAUUUCUACUCUUGUAGAU GCGCCUGGGCCCGGCGGUCUG (SEQ ID NO: 18) rpoB H445L gRNA 1 : UAAUUUCUACUCUUGUAGAU AACCCUCAAGCGCCGACUGUC (SEQ ID NO: 19) rpoB H445L gRNA 2: UAAUUUCUACUCUUGUAGAU CACCCUCAAGCGCCGACUGUC (SEQ ID NO: 20) rpoB S450F gRNA 1 : UAAUUUCUACUCUUGUAGAU GUUCGCGCUGGGGCCCGGCGG (SEQ ID NO: 21) rpoB S450F gRNA 2: UAAUUUCUACUCUUGUAGAU CUGUUCGCGCUGGGGCCCGGC (SEQ ID NO: 22) rpoB L430P gRNA 1 : UAAUUUCUACUCUUGUAGAU CAGCCGAGCCAAUUCAUGGAC (SEQ ID NO: 23) rpoB L430P gRNA 2: UAAUUUCUACUCUUGUAGAU GCUCGGCUGGCUGGUGCCGAA (SEQ ID NO: 24) rpoB H445R gRNA 1 : UAAUUUCUACUCUUGUAGAUUGAGCCGGGUCAACCCCGACA (SEQ ID NO: 25) rpoB H445R gRNA 2: UAAUUUCUACUCUUGUAGAUGUGGGUCAACCCCGACAGCGG (SEQ ID NO: 26)

[0052] Non-limiting examples of the reporter molecules include a single-stranded DNA or a single-stranded RNA labeled with fluorescence and quencher, gold nanoparticles, or biotin-FAM. Reporter molecule sequence 1 : FAM-TTTTTTTTTTTT-BHQ (SEQ ID NO: 27)Reporter molecule sequence 2: Cy5-TTTTTTTTTTTT-IAbRQSp (SEQ ID NO: 28)

[0053] The nucleotide amplification reagents may include reagents suitable for polymerase chain reaction (PCR), recombinase polymerase amplification (RPA), nucleic acid sequence-based amplification (NASBA), rolling circle amplification (RCA), or loop-mediated isothermal amplification (LAMP). In one embodiment, the amplifying step is carried out using PCR.

[0054] When the target is circulating nucleic acid in bodily fluids, including but not limited to A-Z / A-cfDNA, there may be no need for the additional steps of isolating cfDNA prior to testing.

[0055] In one embodiment, all ingredients (lysing, CRISPR and nucleotide amplification) are immobilized on the test strip. In one embodiment, only some ingredients are immobilized on the test strip. For example, the lysing agent may be added separately to the sample based on the type of the sample and / or the amount of sample available. In embodiments where some ingredients are not immobilized on the test strip, the non-immobilized reagents may be provided in other portions of the testing cartridge and / or portable device.

[0056] As used herein, “microprocessor” refers to an electronic processing unit that executes predetermined functions such as performing data analysis from captured images.

[0057] As used herein, “module” refers to a separable component that performs a particular function and can be removed and replaced.

[0058] As used herein, “heating or cooling element” refers to a circuit component capable of transforming other types of energy, e.g., electric energy, to transfer heat into or out of the fluid.

[0059] As used herein, “incubator” refers to a module or a structure that allows a biological sample to sit for a predetermined period of time and at a preferably controlled temperature.

[0060] As used herein, “image capturing element” refers to an electrical element comprising a vision sensor that converts the analogue values of an image to a digital signal. Examples of image capturing elements include charge coupled device (CCD), complementary metal oxide semiconductors (CMOS), or digital cameras.

[0061] As used herein, “light-emitting element” refers to a light source of suitable wavelength to excite the fluorescent response from a sample.

[0062] As used herein, “power source” refers to a source of electrical power, such as a rechargeable battery. There is no limitation on the shape, size or form of the source, as long as the delivered power is sufficient for operating the necessary functions (e.g., heating, imaging and analyzing). The power can be direct current or alternating current. Example power sources include a battery (rechargeable or non-rechargeable), a capacitor, a generator, an alternator, an inverter, a solar electricity module, and / or a source of alternating current.

[0063] As used herein, “testing strip” refers to a substrate shaped and sized to fit in a testing cartridge, wherein the substrate is loaded with reagents.

[0064] As used herein, “testing cartridge” refers to a container for collecting a patient’s biological sample for one or more of lysis, amplification, and / or detection along with the testing strip.

[0065] As used herein, “nucleic acid amplification reagents” refers to enzymes and primers used in amplifying nucleic acid sequences of interest. Depending on the type of amplification used, different enzymes and primers are provided. For Recombinase Polymerase Amplification (RPA), the reagents comprise recombinases and oligonucleotide primers specifically complementary to either end of the target nucleic acid sequence. For loop-mediated isothermal amplification (LAMP), a strand-displacingDNA polymerase and multiple primers. For rolling circle amplification (RCA), DNA / RNA polymerases along with an initiator protein are provided.

[0066] As used herein, “CRISPR-detection reagents” refers to reagents utilizing the CRISPR mechanism, specifically the CRISPR-associated (Cas) enzyme and guide RNAs (gRNA), for detecting the presence of a target nucleic acid sequence. For fluorescent signals, the CRISPR-detection reagents can further comprise reporter that, upon cleavage by the Cas effector protein, the reporter can emit fluorescent light. The gRNAs can be specifically designed to recognize and cleave nucleic acid targets. The Cas effector proteins may include Cas9, Casl2a, among other categories of Cas effector proteins.

[0067] As used herein, “biological sample” refers to samples collected from a patient that may contain the pathogen for CRISPR-based detection. The biological samples need for different pathogens may be different, but may include sputum, blood, serum, saliva, feces, cerebrospinal fluid, urine, or other sample type known in the field.

[0068] The use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims or the specification means one or more than one, unless the context dictates otherwise.

[0069] The term “about” means the stated value plus or minus the margin of error of measurement or plus or minus 10% if no method of measurement is indicated.

[0070] The use of the term “or” in the claims is used to mean “and / or” unless explicitly indicated to refer to alternatives only or if the alternatives are mutually exclusive.

[0071] The terms “comprise”, “have”, “include” and “contain” (and their variants) are open-ended linking verbs and allow the addition of other elements when used in a claim.

[0072] The phrase “consisting of’ is closed, and excludes all additional elements.

[0073] The phrase “consisting essentially of’ excludes additional material elements, but allows the inclusions of non-material elements that do not substantially change the nature of the invention.

[0074] The following abbreviations are used herein:BRIEF DESCRIPTION OF THE DRAWINGS

[0075] FIG. 1A-E Point-of-care, CRISPR-based TB diagnostic device that detects Mtb DNA in multiple specimen types. FIG. 1A: LIT-TB assay workflow indicating the time required for its sample lysis, lysate loading, assay incubation, and analysis steps. FIG. IB: design and components of the LIT-TB assay tube. FIG. 1C: overview of sample inputs and assay functions of the handheld device to process the diagnostic specimen and capture and analyze the assay results. FIG. ID: a 3D rendering of the components of the POC LIT assay device. FIG. 1E-F: LIT assay with one port that serve as both the incubation and the reader port.

[0076] FIG. 2A-K. RPA-CRISPR device and parameters. FIG. 2A: Signal produced by RPA-CRISPR reactions using gRNAs with (grnAl) or without consensus PAM sequences (gRNA2 and gRNA3). n = 3. *P < 0.05 and **P < 0.01 versus gRNA2 + gRNA3 by Kruskall-Wallis test with Dunn’s test for multiple comparisons. FIG. 2B: evaluation of gRNA2 + gRNA3 multiplex assay performance at different temperatures. n = 3. FIG. 2C: RPA-CRISPR reaction kinetics for Mtb DNA detection when using RPA-CRISPR reagents lyophilized on different support matrices over time, n = 3. FIG. 2D: Storage temperature effects on lyophilized RPA-CRISPR reagent activity. NTC, no template control, n = 3. FIG. 2E: circuit diagram of the microprocessor connections controlling image sensor, led, heater, led screen, and wireless output components of the assay device. Vcc, voltage at the common collector. FIG. 2F: heating efficiency values with different insulating materials in the LIT incubator port, n = 5. **P < 0.01 versus ambient air by Kruskall-Wallis test with Dunn’s test for multiple comparisons. FIG. 2G: Workflow used to optimize ROI detection. Training data images were assessed by shrinking a circle centered on the fixed position of the LIT-TB reagents to exclude meanpixel values that do not differ from background noise. Radii of varying size were compared to iden- tify the optimal size of the ROI for analysis. Ix, intensity for a given radius x; Ix+n, intensity for a radius x plus n; Ibiank, intensity of the background (notemplate control); lb, mean intensity for a given distance n radius away from the center. FIG. 2H: representative images of the detection ROI with RPA-CRISPR signal and FIG. 21: a concentration curve generated with DNA isolated from healthy serum spiked with serial dilutions of Mtb DNA. The black dotted line is the linear regression best-fit line, and red dotted lines are the 95% ci. n = 3. FIG. 2J: Signal detected in RPA-CRISPR assays performed with DNA isolated from Mtb and other mycobacteria species, n = 3. FIG. 2K: RPA-CRISPR assay specific for a drug-resistant mutant (rpoB S4501) performed using DNA from drug-resistant mutant Mtb, wild-type Mtb, or NTC. n = 3. data in FIGs. 2A-D, F, J and K are presented as means ± SD, and dots in FIGs. 2A, D, F, J and K represent replicates, a.u., arbitrary units.

[0077] FIG. 3A-H LIT-TB assay performance with pediatric TB cohort serum samples. FIG. 3A: Clinical findings and LIT-TB results for different TB subgroups. N / A, not available, n = 1, PTB and EPTB; n = 12, confirmed PTB; n = 6, unconfirmed PTB; n = 8, EPTB. FIG. 3B: TST and serial LIT-TB results in pediatric close contacts of the TB cohort, n = 35. FIG. 3C: Serum LIT-TB signals at baseline and after treatment for all TB cases with follow-up samples (n = 26). FIG. 3D: Serum LIT-TB signals over time in confirmed PTB (n = 11), unconfirmed PTB (n = 6), and EPTB (n = 8) cases before and after treatment initiation. Data in FIG. 3C and 3D are presented as means ± SD, where the dashed line denotes the positive signal threshold. *P < 0.05, **P < 0.01, and ***P < 0.001 versus baseline by Welch ANOVA with Dunnett’s T3 test for multiple comparisons, n.s., not significant. FIG. 3E-H: Clinical findings and serum LIT-TB results before and after anti-TB treatment initiation for a child with EPTB who had rapid treatment responses (E), a child with PTB and EPTB who displayed EPTB symptoms through 8-week posttreatment initiation with clinical response at week 35 (F), and children with confirmed TB who had drug resistance (G) or were noncompliant with the treatment regimen between 4 and 10 weeks posttreatment initiation but exhibited treatment response after adjusted treatment or increased compliance (H). Positive signal threshold (dashed line) was calculated using mean plus SD of triplicate NTC samples. Data represent single LIT-TB results in the designated patients at the indicated time points. NIH, National Institutes of Health.

[0078] FIG. 4A-I. LIT-TB diagnostic performance with direct saliva and sputum specimens obtained from adult TB cohorts. FIG. 4A: Schematic of in-tube sputum and saliva liquification by DTT and heat-mediated DNAse and Mtb inactivation and Mtb lysis. FIG. 4B: Sputum absorbance at 600 nm before and after a 10-min RT incubation with the indicated chemicals, where decreased absorbance indicates sputum solubilization, n = 3 replicates per condition. FIG. 4C: RPA-CRISPR fluorescent signal detected after assay DNA capture discs made from different materials were incubated with Mtb DNA-spiked sputum lysates, rinsed, and added to RPA-CRISPR reactions. PC, polycarbonate, n = 3 replicates per condition. FIG. 4D: Clinical findings and saliva LIT- TB results for a case-control TB cohort and FIG. 4E: relative fluorescent intensity detected for these samples. **P < 0.01 by Welch’s t test, n = 15, Mtb negative; n = 15, active TB. FIG. 4F: Clinical findings and sputum LIT-TB results for a cohort of individuals diagnosed with TB disease or NTM infections or with no evidence of Mtb infection and FIG. 4G: relative fluorescent intensity detected for these samples. ****P < 0.0001 by Welch’s t test, n = 23, culture negative; n = 8, NTM; n = 5, Mtb. FIG. 4H-I: Sputum LIT-TB signal detected for two patients with TB with serial samples collected at <2 and > 6 weeks after anti-TB treatment initiation. Positive signal thresholds for saliva and sputum cohorts were calculated by the mean plus three times the SD of triplicate NTC normal saliva and artificial sputum samples. Optimization experiments were run in triplicate, and patient testing results were obtained from a single LIT-TB test. Data in (B), (C), (E), and (G) are presented as means ± SD; dots represent individual samples. Schematic illustration created with BioRender. OD, optical density.

[0079] FIG. 5. One-step CRISPR-TBD2 detection from sputum. Sputum sample from a TB suspect is collected in an assay tube, that is then capped swirled to mix this sample with lyophilized lysis buffer, incubated, and then drawn into five capillary tubes that contain RPA-CRISPR reagents to initiate the assay reaction. Multiplex reactions used to assess DR phenotypes employ primers and gRNAs targeting the top 10 mutations associated with resistance to the first line TB drugs: rifampin (RIF), isoniazid (INH), ethambutol (EMB), and pyrazinamide (PZA). Fluorescent signal indicating the presence of a DNA target is read by battery-powered portable device, and positive signal in any of the multiplex reactions is considered evidence of drug resistance to that drug.

[0080] FIG. 6. Tube design for paper-based multiplex TB drug resistance detection, a.Sputum collection tube cap integrated with two air bubble and a one-way air valve forreaction tube insertion, b. CRISPR reaction tubes have RPA CRISPR papers, c. Working flow of POC TB detection using lyophilized lysis buffer, RPA reagents, and CRISPR reagents. By adding sputum into lyophilized reagents on the tube bottom, sputum samples and water can rehydrate the reagents and release TB DNA. By press air bubble and incubate at 37°C, sputum lysate will react with RPA-CRISPR reagents. TB diagnosis and drug resistance will be determined as the panel at right.

[0081] FIG. 7. Fluorescent reading system for CRISPR- TBD2 test a. Raspberry Pi reading device design, b. Arduino portable dry bath circuit design, and c. case design, d. prototype of Raspberry Pi reading device, d. prototype of assay tube. e. Example testing results from our new multiplex testing tube. Dash lines indicate the reaction tubes

[0082] FIG. 8. TB DNA testing lyophilized CRISPR reagent on paper. Different paper is the optimal substrate for CRISPR reagent detection lyophilization with significant signal detected at 20 minutes (a) or up to 2 hours (b). (a) Fluorescent intensity for all types of lyophilized paper types, (b) Fluorescent intensity measurements over time for all types of paper with blot paper demonstrating the strongest increase in signal. Fluorescent intensity after 30 minutes of incubation with one-pot CRISPR in (c) solution, or on (d) paper targeting TB gene IS6110. (e) Specific detection of S450L drug resistant SNP of the rpoB gene in wildtype (WT) and mutated (SNP) DNA fragments. NTC = no template control. Pos Ctrl = Positive control.

[0083] FIG. 9. Direct artificial sputum test using paper-based RPA-CRISPR reagent, (a) before and after pictures of sputum after no treatment or treatment with 100pM and l,000pM DTT at room temperature for 10 minutes, (b) Fluorescent intensity from treated artificial sputum spike-in samples directly onto RPA-CRISPR reagents.

[0084] FIG. 10. CRISPR-TB assay for the detection of the Mtb esxB gene and a rpoB S450L DR-TB SNP. CRISPR-TB assay results for the detection of the Mtb biomarker esxB and a major SNP associated with DR-TB (rpoB S450L), indicating that both TB cases have detectable esxB signal but only DR-TB cases have detectable rpoB S450L target signals.

[0085] FIG 11 A. Lab-in-Tube as applied to four additional microorganisms: Mycobacterium abscessus. Pneumocystis jirovecii, Zaire ebolavirus, and Borrelia burgdorferi. FIG. 11B. CRISPR Mtb-cfDNA assay as applied to urine samples fromHIV-positive children. FIG. 11C. CRISPR Mtb-cfDNA assay as applied to adult saliva samples

[0086] FIG. 12. Lab-in-Tube Cap parts and assembly. (A) Interlocking parts (1) cap outer mold, (2) push button, (3) rotating pin, (4) target zone lock, and (5) plunger. (B) Assembled cap with rubber bands attached. (C) Cap attached to Falcon 5mL tubes at click positions (i) middle, (ii) down, (iii) up.

[0087] FIG. 13. Translucent assembly. Push button is inserted into cap outer mold followed by rotating pin. Sawtooth faces of push button and rotating pin face each other. This is then followed by the target zone lock which when inserted into cap outer mold all the way and twisted 45 degrees will lock assembly together (via one way lock). Holes in the target zone lock allow of plunger to pass through. Plunger and target zone lock are held together via elastic bands.

[0088] FIG. 14. 3D printed plunger pen “click” design. (A) Components of the 3D printed plunger of the LIT-TB device and the initial position of the assembled lab-in- tube device. (B) Images depicting the “click” mechanism of lab-in-tube device, where the first click lowers its DNA enrichment membrane into the lysate, and the second allows its rubber bands to contract and brings the DNA capture membrane into contact with a membrane containing the lyophilized assay reagents to allow DNA transfer and the initiation of the RPA-CRISPR reaction.

[0089] FIG. 15. Fluorescent intensity values detected in LIT assay tubes using clear and opaque caps. Fluorescent values detected in LIT assays performed with Mtb DNA (positive control) and distilled water (Negative Control) samples in LIT assays tubes with clear and opaque caps.

[0090] FIG. 16. RPA signal detected upon direct analysis of artificial sputum samples spiked with H37Rv concentrations using Lab-in-Tube Cap. Aliquots of liquified and heat-treated artificial sputum spiked with the indicated concentrations of Mtb strain H37Rv were added to the lab-in-tube for fluorescent signal analysis to evaluate the limit of detection. All samples were analyzed in triplicate, comparable to the reported LoDs of GeneXpert MTB / RIF (130 CFU / mL) and GeneXpert Ultra (15.6 CFU / mL). Comparison of these results to those of a standard curve generated with a plasmid containing IS6110 target of the LIT-TB assay, found that this corresponded to 38.2 IS6110 copies / pL, and thus 2.4 Mtb genomes / pL given that the Mtb H37Rv genome contains 16 copies of the IS6110 insertion element.DETAILED DESCRIPTION

[0091] The disclosure provides novel method and device for point-of-care detection of active pathogens and certain drug-resistant phenotypes. Please refer to FIG. 1, which shows the CRISPR-based pathogen-detection method and device of this disclosure that can be used for various sample types. In the case of FIG. 1, the pathogen is TB, but the present disclosure is compatible with many pathogens. Please refer to FIG. 1A, which shows the steps of an actual detection: 1) patient’s sample is collected in the assay tube containing lysis buffer, and sealed with a cap containing the integrated plunger-driven sample collection tube, 2) transferred to the incubator port for solubilization (lysis buffer) to lyse pathogens and inactivate sample, such as Mtb bacilli, and dissociation of sample if used (e.g., in the case of sputum), 3) LIT plunger is then depressed to load the lysate onto the DNA capture membrane and initiate the RPA-CRISPR reaction in this device port; 4) upon transferred to the readout port where the reaction signal is imaged and quantified by the assay device for accurate readout.

[0092] Now please refer to FIG. ID, which shows the exploded view of the diagnostic device of this disclosure. The diagnostic device comprises a housing 101 and three main modules: the incubator module 110, the imaging module 120, and the processing module 130, along with an integrated power source that powers the device. For the incubator module, a heating element 111 is surrounded by an insulator 112, where the heating element is operative connected to the power source and controlled by an on / off switch. The heating element 111 is shaped to receive the cartridge to heat up the content in the cartridge. In certain embodiments, elements of this device may be optional.

[0093] The imaging module 120 comprises a camera 121 adjacent to a hollow filter cube 122 having two openings 123a, 123b at 90 degree angle to each other. A dichroic mirror 127 is placed within the hollow filter cube, with a light source 124 placed adjacent to opening 123b and an excitation filter 125 interposed between the light source 124 and the opening 123b. The camera 121 is located on top the opening 123a with an emission filter 126 interposed between the camera 121 and the opening 123a. The light is transmitted from light source 124 through the excitation filter 125, the dichroic mirror 127, the opening 123a, the emission filter 126 to the camera 121. The hollow center of the filter cube 122 along with the two openings 123a, 123b constitute the imaging chamber in which the cartridge will be inserted and imaged for analysis. Manyembodiments are possible for the light source 124, such as a laser, light-emitting diode, fluorescent or incandescent bulb, etc.

[0094] The processing module 130 comprises a processor 131, a display 132, and a power source 133. The readout from the camera 121 will be processed and analyzed by the microprocessor 131, and the results will be displayed on the display. The power source 133 powers both the heating element 111, the microprocessor 131 and the display 132. Specifically, the images taken by the camera 121 will undergo intensity analysis to determine whether active pathogen is present, and if there is any drug resistant SNPs present in the sample. While here a Raspberry Pi microprocessor is used, other microprocessor may also be used.

[0095] FIG. 1E-F shows another configuration of the portable LIT device where only one port is needed for both heated incubation and imaging. FIG. IE shows a 3- dimenstional view of the one-port device, where the imaging module is placed right next to the space for the tube to be heated on top of the heating element 111 and incubated. The laser 124 emits a light through the excitation filter 125. The emission filter 126, the dichroic mirror 127 are similarly placed within the hollow filter cube 122 for imaging of the light signal generated by the CIRSPR-probe when a target nucleic acid is present in the sample. FIG. IF is a top view of the one-port LIT device showing the relative relationship between the components.

[0096] Please refer to FIG. IB, which shows the component of the testing cartridge and testing strip used in this disclosure. For an easy-to-use and low-cost one-pot testing strip, all the necessary ingredients can be lyophilized onto a paper substrate, though this is an optional embodiment. This greatly reduces the need for low-temperature storage / transportation. The primers, enzymes, effector proteins, gRNA and probes are lyophilized on a filter paper, which is cut to fit the size and shape of a testing cartridge. The testing cartridge further comprises lyophilized lysis buffer and a loading mechanism (e.g., a spring or rubber band-operated mechanism) to load the testing strip into the testing cartridge.

[0097] Please refer to FIG. 1C, which shows the overview of sample inputs and assay functions of the device to process the diagnostic specimen and capture and analyze the assay results. A blood sample, or alternatively a saliva, sputum, urine, or other patient sample, is collected from a patient. The sample is placed into the testing cartridge, which is in turn placed in the incubator slot of the diagnostic device for reaction (celllysis, amplification, and / or detection) under temperature control provided by the device. The portable device can be programmed for different heating / incubation cycle based on the sample type, as some samples (e.g., sputum) typically take higher temperature and longer lysis / reaction incubation than other samples. Upon completion of the reaction step, the cartridge is accurately read within the reader slot.

[0098] With the present disclosure, it is possible to (1) eliminate the need for a separate nucleic acid isolation step before CRISPR reaction, (2) eliminate the need for skillintensive liquid handling steps (e.g., pipetting), (3) optionally employ integrated assay device for the incubation step without external power supply, (4) stabilize diagnostic reagents to bypass the need for frozen transport and storage, and (5) build a device to capture and quantify assay signal automatically. For the true POC test described herein, IS6110 sequence was chosen as the target sequence because it is a multicopy target in the Mtb genome, making it more readily detected than single copy targets. It is validated that primers and gRNA that specifically detect target pathogen infection without cross reaction with other, similar pathogens. The optional readout via a common device (e.g., smartphone) allows for automated fluorescence intensity analysis and diagnostic result reporting for pathogen infection and drug-resistance.

[0099] Optimization of conditions for one-pot detection of pathogen nucleic acid

[0100] To improve capability of implementation into resource-limited settings, POC tests should minimize the number of user steps to reduce training requirements and user error. We thus developed an approach to eliminate the step of nucleic acid isolation while using portable smartphone device for fluorescence assay signal detection for detection of pathogen in various patient sample types. To improve flexibility of the readout that can be integrated into a wide range of assay designs, we elected a fluorescent imaging-based readout, although other embodiments are readily available in the art. Quenched FAM-labeled probes that are commonly used in CRISPR-based detection systems was not suitable for imaging due to matrix autofluorescence (data not shown). To overcome autofluorescence issues, red Cy5 probe along with its matching quencher was used, which demonstrated much lower fluorescence at baseline and higher signal- to-noise ratio compared to FAM. Because the activation of fluorescence of FAM and Cy5 probes is caused by the same Casl2a-based cleavage of ssDNA, swapping the label and quencher should not affect CRISPR-mediated cleavage.

[0101] Single-tube RPA and CRISPR assay conditions were optimized by adjusting the RPA-to-CRISPR activity ratio to avoid premature target cleavage, which can reduce amplicon accumulation required for RPA efficiency and CRISPR cleavage kinetics required for sensitive target detection. Because nonconsensus PAM sequences reduced CRISPR cleavage activity, we examined assay signal produced in reactions using gRNAs targeting amplicon sequences with (gRNAl) and without (gRNA2 and gRNA3) consensus PAM sites (Fig. 2A). Reactions that used gRNAs that did not target consensus PAMs (gRNA2 and gRNA3) yielded higher signal com- pared with gRNAl alone, although gRNAl (consensus PAM) and gRNA2 differed only by a 1-base pair shift. CRISPR signal can also be enhanced by using multiple gRNAs that recognize nonoverlapping sites on a target amplicon. The signal did not differ between reactions performed with equal total amounts of gRNAl + gRNA2 or gRNAl, likely because of recognition site com- petition and gRNAl -mediated amplicon depletion. Reactions performed with gRNAl + gRNA3 also did not exhibit greater signal than those that used gRNA3 alone, and such increases were detected only in reactions using gRNA2 + gRNA3. Subsequent assays were thus performed with gRNA2 + gRNA3. CRISPR reaction efficiency was also adjusted by selecting the best reaction temperature and the best Casl2a enzyme, reaction buffer, and gRNA concentration for the assay (Fig. 2B). These analyses found that the maximum signal was detected at 37°C in reactions performed with- out added CRISPR buffer and containing a 42 nM concentration of a Casl2a / gRNA2 + 3 complexes, and these conditions were used for all further analyses.

[0102] Since TB IS6110 detection reaction is the primary method in this example, optimization of the one-pot RPA-CRISPR detection strategy was carried out. When RPA and CRISPR reagents are in the same tube, the amplicons produced by RPA can be immediately cut by Casl2a. This presents a potential issue because if Casl2a cleaves RPA amplicons too quickly, the number of amplicons available as templates for further amplification of target DNA is reduced. Further, if the number of available amplification is reduced, then the overall detection capacity of the one-pot system declines because high RPA amplicon levels are required for efficient CRISPR reaction kinetics and signal.

[0103] Because of this, attenuating CRISPR activity to allow target amplicon accumulation can thus improve assay performance. Multiple approaches have been used to attenuate CRISPR activity including utilizing sub-optimal PAMs or PAM-free gRNA target regions, which can decrease CRISPR cleavage and thus increase the rate of thetotal one-pot reaction. We examined signal produced by three gRNA, one with full TTTV- PAM region and two others that target region without a complete PAM (Figure 2A). The gRNA with the PAM sequence produced the lowest signal while the two gRNAs without PAMs produced higher signals. In addition, using multiple gRNAs targeting the same amplicon also increased the assay signal. We further improved the overall reaction by Cast 2a enzyme selection, using lower Cast 2a concentration, and removing optimal buffer for Casl2a cleavage (not shown).

[0104] Here it is identified that a range of 37-42°C incubation temperature for RPA- CRISPR reaction to perform similarly in detecting Mtb DNA that matches manufactures instructions for both RPA and CRISPR enzymes (Figure 2B).

[0105] Test strip substrate. This example used lyophilized detection reagents to stabilize assay reagents and permit assay transport and storage at increased temperatures. This can reduce cold-chain concerns and increase the expiration time of an assay. During lyophilization, the support matrix used during lyophilization can affect the stability of lyophilized reagents so we tested multiple materials for their ability to preserve RPA- CRISPR activity upon lyophilization (Figure 2C). These membranes include cotton, cellulose, nitrocellulose, and PES matrixes. RPA-CRISPR reagents were absorbed on these substrates, flash-frozen in liquid nitrogen, and placed into lyophilizer. After lyophilization, the reagents were then rehydrated by addition of Mtb DNA aliquot. Of the matrices tested, cotton-based blot paper produced the strongest signal with >50% max signal within 30 minutes after lyophilization and addition of TB gDNA. Reagents lyophilized on cellulose supports revealed moderate-to-weak signals and activity did not appear to depend upon pore size or thickness with Whatman 4 paper performing the best of the cellulose membranes. Additionally, nitrocellulose and PES exhibited very low signals.

[0106] To test ability of lyophilized RPA-CRIPSR reagents in this example to be used without storage in freezers, we next analyzed results produced with lyophilized reagents stored at different temperatures and times. After lyophilization, detection membranes were incubated at common storage (-20°C, +4°C, RT) temperatures from 1-3 months prior to analysis in low humidity pouches (Figure 2E). During the first two months, there is a small drop in signal detected for reagents stored room temperature and 4°C compared to - 20°C. After the 3rdmonth, small differences were detected for membranes stored at -20 and 4°C and there was complete loss of activity at room temperature.

[0107] Device design. A true POC assay should require minimal equipment and sample handling to reduce user steps, expensive equipment requirement and workflow complexity. In the present disclosure, the CRISPR assay for pathogen detection requires at minimum two steps: (1) incubation of enzymatic reactions on detection test strip, and (2) automated signal imaging. The in-house fabrication of mechanical components was achieved through 3D printing technology, though the approach is compatible with many fabrication methods. In this setup, insulation and heating elements were strategically positioned at the center of the optical system to enable simultaneous reaction and imaging (Figure 2D). The imaging system incorporates cost-effective LEDs and lasers. The optical imaging module comprises an optional excitation filter, a dichroic mirror, and an optional emission filter integrated into a filter cube and positioned adj acent to the camera. To orchestrate the system, a microprocessor, powered by a power source, was employed for controlling both the light sources and the camera during image acquisition. The results were then displayed on a display for user interaction. One example component list and cost breakdown of the portable device is provided below in Table 1.TABLE 1: Parts and cost breakdown of the assay device

[0108] Different materials for insulation were investigated as shown in Figure 2F. Specifically, we recorded temperature differentials (AT), the corresponding durations (t) for these changes, and determined the theoretical heating time (theoretical) necessary to elevate the temperature of a fixed volume of water (ImL) under prescribed power output conditions (1W) for the given AT. To encapsulate the observed phenomena in a quantitative framework, we formulated the percent efficiency (r ) of the heating processusing the equation: q = (theoretical / t) * 100. This equation serves as a crucial tool for evaluating and comparing the thermal performance of diverse insulating materials. By systematically analyzing these parameters, the objective is to pinpoint the material that maximizes efficiency, thereby informing the selection of the most suitable insulator for incorporation into the POC device. After efficiency analysis using various insulating materials including wood, Styrofoam, and packing material, Styrofoam was chosen moving forward as it displayed the highest efficiency and the lowest time to reach target temperature in our system.

[0109] To simplify user steps required for readout analysis, an automatic fluorescent intensity analysis system was developed in this example to display a value for easily understandable readout on the LED screen. In the area optimization phase of our experimental design, we focused on refining the parameters governing the displayed values on our device, specifically within a fixed circular region (Figure 2G). This circle is centered at the geometric midpoint of the fixed laser point dot, leveraging the immobility of our optical components to ensure consistent circle positioning. This strategic placement minimizes extraneous light, treating any signal outside the laser radius as noise, thereby mitigating potential interference. To address the inherent gaussian distribution of light emitted by the laser, the radius of the circular region was systematically optimized. This optimization involved a process wherein the noise level in the image is calculated based on three negative controls.

[0110] Subsequently, we determined an acceptable threshold for noise within the circular region, ensuring that at least 95% of the pixels within the circle represent true signal. This corresponded to maintaining a false discovery rate of 5% for any given pixel within the circular region to be classified as noise. This process was iteratively applied across a range of radii, culminating in the selection of the radius showcasing the most favorable signal -to-noise ratio for subsequent analyses. With the optimized radius, an extensive suite of analyses was conducted, encompassing the calculation of mean grey value, standard deviation, and normalized values, aiming to discern differences between sample concentrations in noisy (clear capped) and unnoisy (opaque capped) tubes. Additionally, values in TYE 665 versus Cy5 fluorescent dyes were compared. This thorough examination complemented the assessment of area fraction and applied mean grey value within the circular region. To ensure a precise analysis, various levels of thresholding were implemented, specifying brightness criteria for pixels consideration.This approach was systematically applied across a spectrum of concentrations, for both Cy5 and TYE 665 fluorescent dyes.

[0111] The resulting dataset provides a comprehensive understanding of the device's performance under diverse conditions, including variations between noisy and unnoisy tubes as well as distinctions between TYE 665 and Cy5. The dynamic nature of our methodology allows optimization for the robust collection and analysis of data, guiding the identification of optimal parameters for precise and reliable signal detection in our experimental setup. Camera control and image analysis were executed using Python (version 3.10) for this study. The RPi camera module 3 was managed through the Picamera2 library (version 0.3.16), providing precise control over image capture parameters. The camera settings included fixing the distance to 10cm, extending the exposure time to 10 seconds, and augmenting the analogue gain for enhanced image quality. Image analysis was carried out using OpenCV (version 4.8.1.78).

[0112] The process involved isolating the red channel, applying a Gaussian blur (3x3 kernel size) to eliminate noise, delineating a circle around the target region with the correct radius, generating a mask for intensity calculation, and computing average and standard deviation values. Text annotations were strategically placed on the image, and the final processed image was displayed for a smooth user experience. This comprehensive methodology ensures accurate control over imaging parameters and robust analysis for precise results in our experimental setup.

[0113] Validating analytical results. Fluorescence increases linearly with starting Mtb concentration between a range of 0.1-10,000 pg / pL (Fig. 2H-I). Mtb is a member of a superfamily of mycobacteria, some of which also cause human respiratory disease. Mycobacteria that cause human disease can exhibit variable sequence conservation, and in silico design of primers and gRNA specific for Mtb is necessary to ensure no cross reaction with closely related sequences where non-specific amplification or cleavage could produce false positive signal. We therefore analyzed RPA-CRISPR signal detected for several human pathogenic mycobacteria and none of the non-tuberculosis mycobacteria produced fluorescence greater than background signal (Fig. 2J).

[0114] Detection of drug resistant mutation S450L present on TB gene rpoB. Detection of Mtb drug-resistance entails detection of single base pair changes known to cause drug-resistance to rifampicin. On the rpoB gene of Mtb, S450L is most common mutation leading to rifampicin-resistance in TB infected patients. To change assay forspecific detection of this mutation, primers were used to amplify the 81 bp hot spot region of rpoB and then gRNA were designed to specifically detect this single base pair change. To confirm mutation detection, synthetic sequences with and without the S450L mutation were spiked-into sputum with rpoB primers / gRNA and then LIT-TB assay performed. Significantly higher signal is observed in the presence of S450L sequence compared to wildtype sequence that does not contain this mutation (Fig. 2K).

[0115] There are other drug resistance strains of Mtb, such as multidrug-resistant TB (MDR TB), pre-extensively drug-resistant TB (pre-XDR TB), extensively drug-resistant TB (XDR TB). Suitable primers / gRNA can be designed and manufactured against each of the target Mtb strain. For example, other SNPs may include: i) S450L, D435V, H445Y, H445Da D435Y, S450W, L452P, H445L, S450F, L430P, or H445R SNPs of rpoB (NCBI sequence Gene ID 888164); ii) S315T, S315N, or W328L of katG (NCBI Gene ID 885638); iii) c-777t (fabGl_c-15t) or g-154a (fabGl_L203L) of fabGl-inhA (NCBI Gene ID 886551); iv) M306V, D354A, Y319S, D328Y, Q497R, G406A, G406D, G406S, Q497K or G406C of embB (NCBI Gene ID 886126); v) H57D, a-l lg, Q10P, H51D, T76P, G97D, V7G, C14R, D49G or H57R of pncA (NCBI Gene ID 888260).

[0116] Moreover, the method and device of this disclosure is not limited to the detection of tuberculosis, and may be used for other pathogens, as long as specific target sequences may be identified, and the corresponding amplification primers and gRNAs can be manufactured. These pathogens include Mycobacterium tuberculosis (IS6110, IS1081, rpoB, katG, fabGl-inhA, embB, pncA) Mycobacterium abscessus, Mycobacterium avium, Mycobacterium kansasii, Zaire ebolavirus (NP, GP), Pneumocystis jirovecii (mtLSU, mtSSU, Nad4, Sp, GscT), and Treponema pallidum (BMP, polA, TPP47). Additionally, drug resistant genes / mutations / SNP may also be a target for detection, such as mecA, fusB, fusA, msrA, ermA, ermB, ermC, parC, parE, dfrB, etc.

[0117] The system was used to detect active TB using pediatric serum and monitor Mtb cfDNA levels throughout treatment. Utilizing DNA isolation-free approach, the LIT-TB system displayed 100% sensitivity and 94.5% specificity in baseline patient sputum samples. With specific design of CRISPR gRNAs to detect mutations, rifampicin- resistant mutation S450L of the rpoB gene is accomplished to inform clinicians on treatment choice. One embodiment of the portable device is a lightweight, field- deployable microincubator and smartphone imager, that can be transported to sites ofsample collection and performed by individuals with minimal training at the point-of- care.EXAMPLE 1: MTB-CFDNA FROM PEDIATRIC SERUM COHORTS

[0118] Sputum is the primary diagnostic specimen for PTB diagnosis, but young children, individuals living with HIV or other immune insufficiencies, and individuals with EPTB often cannot produce sputum or produce sputum with low Mtb concentrations that yield false negatives results. Mtb DNA can be detected in the sera of patients with TB by a sensitive laboratory -based CRISPR assay, and we therefore analyzed LIT-TB performance using cell-free DNA isolated from sera of a pediatric TB cohort enrolled in the Dominican Republic. This cohort contained 27 children diagnosed with PTB or EPTB (one patient was diagnosed with both PTB and EPTB) who were classified as having “confirmed” and “unconfirmed” TB on the basis of microbiologic or clinical evidence, respectively; and 35 children who were close contacts but did not demonstrate evidence oiMtb infection and were tuberculin skin test (TST) negative (data not shown). Confirmed TB was classified as children with bacteriological confirmation of TB (culture or GeneXpert positive). Unconfirmed TB was classified as children with no bacteriological confirmation but meeting at least two of the following criteria: symptoms suggestive of TB, a chest x-ray consistent with TB, TB exposure or immunological evidence of Mtb infection, or a positive response to TB treatment. Serum Mtb DNA signals detected for treatment-naive patients with TB had similar high sensitivity for TB (81%; 22 of 27 cases), PTB (83%; 15 of 18), and EPTB (75%; six of eight), all of which exceeded those obtained by sputum, induced sputum, or gastric lavage cultures (55%; five of nine) or by GeneXpert MTB / RIF (Xpert) (68%; 15 of 22). Sensitivity also did not significantly differ between confirmed (92%; 11 of 12 cases; 95% CI: 61.5 to 99.8) and unconfirmed PTB cases (75%; four of six cases; 95% CI: 22.3 to 95.7) (Fig. 3A). In the Dominican Republic cohort, serum LIT-TB, sputum Xpert, and culture results detected 23, 15, and 5 cases, respectively; eight were serum LIT-TB positive only, one was sputum Xpert positive only, and four were diagnosed by other clinical findings (data not shown). Serum LIT-TB results were positive for 78% (seven of nine) of EPTB or PTB plus EPTB cases, which otherwise required tissue biopsy (tuberculous lymph- adenitis), x-ray imagery (Pott’s disease and spinal TB), or other clinical observations to diagnose.

[0119] Mtb DNA signal was sporadically detected in the first samples of the close contact group (94% specificity; 2 of 35 children) but not in any of their follow-upsamples, indicating that repeat testing accurately classified all close contacts as TB negative (FIG. 3B) In sera obtained from children in the United States (New Orleans, Louisiana) who had low likelihood of TB disease but who were not tested for TB, all 49 participants tested negative by LIT-TB (data not shown). LIT- TB signal tended to decrease after treatment initiation, resulting in a progressive decrease in serum-positive samples from baseline (81% positive) to the first, second, and third intervals after treatment initiation (46, 25, and 6% positive) (Fig. 3C). Similar results were observed in the confirmed PTB and unconfirmed PTB groups, and patients with EPTB had a significant drop (P < 0.05) in signals from samples taken 6 to 12 weeks after treatment compared with baseline (Fig. 3D).

[0120] Results from several cases highlight the advantages of serum LIT-TB assay results for TB diagnosis or treatment monitoring. For example, a 4-year-old male diagnosed with lymphatic EPTB by a biopsy that revealed granulomatous lymphadenitis with caseating necrosis who was LIT-TB positive at TB diagnosis converted to and remained negative after treatment initiation, consistent with a positive-to-negative chest x-ray conversion (Fig. 3E). In addition, a 3-year-old male diagnosed with both PTB and lymphatic EPTB had continued EPTB throughout treatment (up to 8 weeks posttreatment), and LIT-TB signal gradually declined throughout treatment until becoming negative at 35 weeks when a clinical response was observed (Fig. 3F). By contrast, a 12-year-old male diagnosed with rifampin-resistant PTB by Xpert and treated with moxifloxacin, clofazimine, ethionamide, cycloserine, and bedaquiline did not exhibit clinical response or serum LIT-TB conversion by 10 weeks after treatment initiation but had negative values for both at the fourth study visit 27 weeks after treatment initiation (Fig. 3G). Persistent serum LIT-TB, symptoms, and chest x-ray results consistent with TB were also detected in a 15-y ear-old female with confirmed PTB who stopped treatment after 4 weeks, and these values did not convert until after she reinitiated treatment at 10 weeks postdiagnosis because of progression of her TB symptoms (Fig. 3H).EXAMPLE 2: SIMPLIFIED SPUTUM PROCESSING AND TB LYSIS STRATEGY

[0121] Noninvasive respiratory specimens, such as sputum and saliva, could be more enriched for Mtb bacilli and Mtb DNA than blood and were therefore analyzed using LIT-TB assay tubes modified to contain chemicals that can reduce the viscosity of these specimens and lyse Mtb bacilli (Fig. 4A). NaOH, dithiothreitol (DTT), and iso-propanolall liquefied these samples, either alone or in combination, as measured by a reduction in absorbance (Fig. 4B). DTT, which dissociates disulfide bonds, lacked the denaturing effects of the other materials, had similar effects on saliva (data not shown), and was thus selected for further use. Next, the temperature necessary for complete heat-induced Mtb killing was determined by heat-treating Mtb H37Rv strain bacilli [4.6 x 107 colonyforming units (CFU) / ml] spiked into artificial sputum. Complete sterilization was observed after samples were incubated at 80°C for 15 or 30 min as il- lustrated by lack of colony growth on agar plates (data not shown). A 15-min 90°C incubation was selected for sample inactivation because of the variable heat killing performance reported at 80°C in the literature.

[0122] The complete LIT-TB design should directly capture Mtb DNA from liquified sputum or saliva lysates and rehydrate lyophilized assay reagents to initiate an RPA- CRISPR reaction. Nucleic acid capture onto cellulose-backed porous membranes has been described previously and has potential to permit one-step capture of DNA from patient samples that is compatible with nucleic acid amplification-based tests. Mtb DNA-spiked sputum lysates were added to DNA capture / transfer membranes, rinsed, and transferred to RPA-CRISPR detection membranes. Polyethersulfone (PES) and cellulose-based Whatman membranes supported similar performance in this analysis (Fig. 4C). We next evaluated whether RPA-CRISPR signal derived from membranes that were or were not subjected to this wash step and found that it was required for maximum signal production only when using the Whatman membrane, suggesting this matrix transferred RPA-CRISPR reaction inhibitors without this rinse (data not shown). We therefore used a sandwich approach where Whatman paper was used as a support matrix to attach the PES membrane to the assay plunger. In this design, double-sided tape was used to affix the Whatman matrix to both materials and had a punched-out region between the PES and Whatman layers to allow the sample to wick into the Whatman matrix to enhance DNA absorption on the PES membrane surface facing this sample.

[0123] A 3D-printed plunger was designed to hold the DNA enrichment membrane and RPA-CRISPR reagent membranes to permit DNA capture and target detection within sealed LIT-TB tubes and protect the user from Mtb exposure (data not shown). After collecting the sample in this tube, pressing this plunger (first click) lowers the DNA capture membrane into the heat-inactivated sample lysate. Pressing this plunger again(second click) raises this DNA capture membrane above the lysate and brings it into contact with an RPA-CRISPR reagent-loaded membrane carried by the inner shaft of the plunger. This action allows the transfer of captured cell-free DNA that initiates the RPA-CRISPR reaction (data not shown).

[0124] LIT-TB analysis of a standard curve generated by spiking artificial sputum with serial dilutions of Mtb H37Rv yielded a limit of detection (LoD; 78.1 CFU / ml) for this assay (data not shown) comparable to LoDs reported for GeneXpert MTB / RIF (130 CFU / ml) and GeneX- pert Ultra (15.6 CFU / ml). Comparison of this LoD (78.1 CFU / ml) to a standard curve generated with a plasmid containing the IS6110 target of the LIT-TB assay found that this LoD corresponded to 38.2 IS6110 copies / pl and thus 2.4 Mtb genomes / pl, given that the Mtb H37Rv genome contains 16 copies of the IS6110 insertion element.

[0125] LIT-TB POC assay performance with saliva and sputum samples from two adult TB cohorts.

[0126] Saliva from a case-control cohort of 15 adults diagnosed with TB disease and 15 who lacked evidence of Mtb infection was analyzed by LIT-TB POC assay operators blinded to sample reference results. This analysis detected 11 true-positive signals [73% sensitivity (95% CI: 44.9 to 92.2)], with no false positives [100% specificity (95% CI: 78.2 to 100)] (Fig. 4D), although fluorescent signals from the TB-positive samples varied widely (Fig. 4E). Similar LIT-TB POC assay results were obtained upon analysis of 71 sputum samples obtained from 36 adults (>18 years) with suspected TB. Diagnostic sensitivity by LIT-TB was high [100% (95% CI: 47.8 to 100), five of five cases], and specificity [90.3% (95% CL 74.3 to 98.0), 28 of 31 controls] was similar for individuals with nontuberculous mycobacteria (NTM) infections [87.5% (95% CL 47.4 to 99.7), seven of eight cases] or no evidence oiMtb infection [91.3% (95% CI: 72.0 to 98.9), 19 of 21 individuals] (Fig. 4F). All (15 of 15) Mtb culture-positive samples were LIT-TB positive, whereas 3 of 56 Mtb culture-negative samples had LIT-TB false-positive results (Fig. 4G). True-positive and true-negative fluorescent intensity signals were highly divergent [105.2 ± 2.5 versus 1.9 ± 0.5 relative fluorescence units (RFU)], whereas false positives revealed intermediate values (range, 34.3 to 99.0 RFU). Sputum LIT-TB signals were also highly consistent among sequential pretreatment samples available for a subset of individuals, except in one individual diagnosed with an NTM infection who had two true negatives and one false positive suggestive of sample contamination (datanot shown). However, serial pretreatment samples were not available for the other two individuals with false-positive results. Last, two patients who had available sputum collected at <2 weeks and > 6 weeks posttreatment initiation revealed consistent signals within the early treatment that which decreased during later treatment (Fig. 4, H and I)EXAMPLE 3: DIAGNOSTIC PERFORMANCE OF THE LIT POC ASSAY IN SPUTUM

[0127] To testLIT-TB assay in patient sputum samples, a cohort of seventy-nine sputum samples were collected from individuals in Asia, Africa, Middle East, and North America and blindly analyzed by our Mtb IS6110 DNA status POC assay and device (Fig. 4G). After unblinding we obtained the smear and culture results for all patients as well as patient age, gender, country, sample collection dates, Mtb history and HIV status. Mtb history was defined as the patient having confirmed Mtb infection and received anti-A- treatment although the timing of their treatment start date was unknown except for two patients. As it is common to take multiple sputum samples from the same patient collected over a three-day period, there are many samples collected from the same patient. The LIT-TB assay showed high sensitivity (100.0%) and specificity (94.4%) in patients without Mtb history.

[0128] All the culture or smear positive samples produced nearly maximum fluorescent signal (Fig. 4H). Interestingly, there are two patients where multiple sputum samples were taken at baseline, and then ~2 months after receiving anti-Mtb treatment there was another cohort of multiple sputum samples taken (Fig. 41). At the first timepoint, the fluorescent intensity is high with signal reaching maximum for all samples. At the second time point, the fluorescent intensity decreases for all samples and 1 sputum sample in each patient is negative which could indicate an effective treatment response. All of the culture or smear positive samples produced nearly maximum fluorescent while patients with Mtb history that were positive using LIT-TB were mostly less than culture positive samples.

[0129] The results indicate that a user-friendly POC TB diagnostic assay system can analyze serum and respiratory samples for robust diagnosis of PTB and EPTB in nonclinical settings. Mtb DNA concentrations can be very low in serum versus respiratory specimens, but serum Mtb DNA can diagnose both PTB and EPTB, and thus, serum-based Mtb DNA assays are of substantial interest despite their additional sampleprocessing requirements (blood collection, serum / plasma isolation, and DNA extraction). Multiple studies have detected Mtb DNA in blood using laboratory assays that are not suitable for POC tests because of their equipment, workflow, and reagent storage requirements, but the herein proposed LIT approach minimizes many of these issues to make this approach feasible with minimal additional battery-powered equipment. Serum LIT results diagnosed pediatric PTB and EPTB cases with similarly strong performance and decreased in association with symptom improvement after treatment initiation and remained stable or in- creased during treatment noncompliance or ineffective treatment, suggesting their potential utility for treatment monitoring. Similar on-treatment saliva and sputum samples were not available for this cohort or the other analyzed cohorts but would be expected to have less utility for monitoring treatment clearance because of the known persistence of DNA from nonviable Mtb bacilli in respiratory specimens after initiation of effective treatment. Nonetheless, LIT sputum results did detect Mtb DNA decreases in two individuals with serial samples available at an early and subsequent treatment intervals, suggesting the potential utility of such results in some cases.

[0130] Several groups have used RPA and other amplification techniques, including loop-mediated isothermal amplification (LAMP) and rolling circle amplification (RCA), to facilitate rapid and simple diagnosis of mycobacteria from respiratory specimens, whereas others have used low-volume PCR to streamline the diagnostic workflow. However, most of these methods rely on separate DNA extraction methods, or other approaches, that are not suitable for use in resource-limited settings. For example, a WHO-supported LAMP assay uses an isothermal LAMP approach to rapidly amplify (<1 hour) an Mtb DNA target used for TB diagnosis but relies on a standard DNA isolation approach that limits its utility. Separate DNA isolation is also required by an RPA-based assay that sensitively detects and quantifies a Mycobacterium smegmatis DNA target using an electrochemical readout method and an RCA- based assay reported to detect rpoB gene mutations associated with Mtb drug-resistant with high sensitivity and specificity. Last, low-volume droplet PCR assays have been used to detect Mtb IS6110 at high sensitivity and may thus be particularly useful for TB diagnosis from saliva samples where Xpert reveals reduced sensitivity, but they rely on DNA isolation, as well as additional equipment that is not suitable for use in POC applications.

[0131] In contrast, in the LIT-TB approach described here, DNA concentration is achieved within the tube by lowering the device’ s inner plunger that holds a DNA capture membrane into a sputum or saliva specimen after a short, high-temperature incubation step has been used to inactivate and lyse any Mtb bacilli present in this sample. This plunger is then raised, twisted, and depressed again to bring an outer plunger holding a reagent-loaded membrane into contact with the DNA capture membrane to initiate the assay’s RPA- CRISPR reaction. All of these steps, including the assay readout step, occur on the assay device without opening the assay tube, unlike previously described methods. Serum or plasma analyses differ in that cell-free DNA from these samples is isolated in a separate procedure and then applied to the DNA capture membrane before analysis using the remainder of the standard LIT-TB assay workflow. Further analysis of TB bacilli and DNA loads in various sample types is needed before application of non-sputum diagnostics. Mean Mtb bacilli concentrations reported for sputum specimens range from 103 to 105 CFU / ml, although age, HIV status, sputum specimen quality, and other factors can influence these estimates, and these values do not directly reflect the amount of Mtb genomic DNA present in these samples, which should be higher because of the presence of nonviable Mtb bacilli.

[0132] We could not find similar Mtb CFU / ml estimates for saliva, but at least one study that has analyzed both specimens with GeneXpert Ultra observed higher relative signals (78% versus 19% moderate / high) in sputum versus saliva samples from the same patients, although this study did not provide cycle threshold (Ct) values or other more quantitative results. Few studies have reported mean Mtb cfDNA concentrations detected in the sera of individuals with TB. We have previously reported that the mean Mtb cfDNA concentration detected in sera obtained from one cohort of young children with TB was 5.58 copies / pl, although about half the samples tested had Mtb cfDNA concentrations of <0.25 copies / pl, with a median concentration of 0.13 copies / pl. We could not find similar Mtb CFU / ml estimates for saliva, but at least one study that analyzed both specimens with GeneXpert Ultra observed higher relative signal (78% versus 19% moderate / high) in sputum versus saliva samples from the same patients, although this study did not provide Ct values or other more quantitative results.EXAMPLE 4: LAB-IN-TUBE CFDNA ASSAY FOR ADDITIONAL PATHOGENS

[0133] The Mtb-cfDNA assay as described above has also been tested with DNA / RNA samples from different pathogens, including Mycobacterium abscessus (NTM) DNA,Borrelia burgdorteri (Lyme disease) DNA, Pneumocystis firovecii (pneumonia) RNA, and Zaire ebolavirus (Ebola) RNA. The results are shown in FIG. 11 A. It is seen that the fluorescent intensity of the positive samples can be easily distinguished from the negative ones, further proving the LIT assay of this disclosure is equally applicable to identify a wide range of pathogens.EXAMPLE 5: LIT MTB-CFDNA ASSAY FOR URINE AND SALIVA

[0134] Saliva and oral swab samples have been investigated as potential alternative specimens for TB diagnostics because they can be readily obtained from all patients, unlike other respiratory specimens, and because Xpert exhibits similar diagnostic performance when used to analyze saliva or sputum. Mtb DNA signals detected in saliva were lower and more variable than sputum signals, although matching samples were not available from a single cohort for direct comparison. Saliva-based LIT TB could thus have reduced performance for some patients with PTB, particularly those who have low Mtb concentrations in their respiratory specimens, although this might be mitigated by optimizing sample collection or analyzing serial specimens similar to Xpert assays. Nevertheless, these findings imply that a LIT system could analyze respiratory specimens at the POC in remote or resource-limited settings with- out access to Xpert to expand TB diagnostic efforts.

[0135] Normally, GeneXpert would be limited to sites with the resources to purchase and operate an Xpert system (a minimum of $19,000 per machine and approximately $8 per sample, with subsidies) (57, 58), but our findings indicate that saliva and sputum LIT-TB assay results have good diagnostic performance for PTB at low cost (<$800 per instrument and $2.62 per sample). In addition, LIT-TB cost per machine is largely attributed to an expensive optics system ($690), which could be replaced with low-cost excitation and emission filters to substantially reduce cost at scale. Use of Xpert in resource- limited settings requires either that samples be shipped to a centralized laboratory or that an Xpert system, computer, power source, and other incidental materials be transported to the site and operated in an area with at least minimal environmental control, neither of which may be practical.

[0136] The CRISPR Mtb-cfDNA assay described herein has also been applied to urine samples from HIV-positive children and saliva samples from adults. The procedures are similar to that of sputum, except the samples were from different bodily fluids. Theresults are shown in FIGs. 11B-C. It is seen that in terms of the normalized RFU, Mtb- positive samples collected from HIV-positive pediatric patients’ urine can be distinguished from negative samples. Similarly, Mtb-positive samples collected from adult saliva are also distinguishable from negative samples. These findings demonstrate that the assay described herein is not only effective for detecting Mtb-cfDNA in blood but may also enable the sensitive detection of trace amounts of Mtb nucleic acids in urine and saliva. This shows the potential for non-sputum, non-invasive TB diagnostics, making it more easily accessible without the need for intrusive sample gathering.

[0137] The testing procedures for urine and saliva are similar to those used for blood.

[0138] The one-pot RPA and CRISPR detection is also a complex process with multiple enzymes, oligos and buffers working at the same time in a single tube. Additionally, CRISPR cleavage of RPA products is inhibitory to nucleic acid detection. Therefore, PAM-free gRNAs or sub-optimal PAMs are used to allow for RPA to amplify sufficient products before CRISPR cleavage.

[0139] Furthermore, to accurately quantify the fluorescent result, the device of this disclosure employs an integrated camera with automated fluorescent analysis by microprocessor, where the detected value is easy to record. Membrane-based (PES, cellulose) DNA enrichment can be utilized to further improve sensitivity of sputum- and saliva-based assay. In one embodiment, the method and device of this disclosures can also be used for detecting pathogens in serum-based samples, although certain optimization may be needed.

[0140] The sample collecting / detection tube also comprises a testing strip that has all necessary ingredients lyophilized, so that there is no need to transfer the sample into a separate detection system. The lyophilization also allows for longer shelf life.

[0141] Because sputum is difficult to obtain in children and patients living with HIV we examined performance of LIT detection paper and portable device using Mtb cfDNA from pediatric serum samples. In this longitudinal cohort, we observe a significant drop in LIT signal overall in the pediatric cohort throughout Mtb treatment. This supports that blood-based testing could enhance treatment monitoring because the clearance of Mtb cfDNA is rapid compared to sputum where residual DNA could be detected.

[0142] Another potential advantage of blood-based TB testing is that obtaining blood samples is repeatable from sample to sample compared to sputum where multiple (often3) sputum samples are taken across three days to ensure that a good sputum sample is obtained. Using the inventive DNA enrichment strategy, no Mtb cfDNA was detected, likely because of the low concentration of target IS6110 in raw serum samples. Automating DNA analysis with limited fluid movement could make true POC detection of Mtb cfDNA with one-pot detection possible.

[0143] One key feature of the sputum-based LIT test is the elimination of conventional DNA extraction step. Conventional column or magnetic bead-based DNA isolation methods require multiple centrifugation and wash steps that are not conducive to POC application. Many studies utilize isothermal or isothermal-CRISPR detection of target nucleic acid, but these studies often require prior DNA or RNA isolation. To bypass requirement for multi-step DNA isolation methods, membranes are used in the testing strip. These membranes can either bind DNA by controlling sample flow through the membrane, or by using a “dipstick” method where the membrane is placed into the inactivated sample to bind DNA. Here, we tested multiple membranes in sputum after TB lysis and then integrated Mtb DNA detection with one-pot RPA-CRISPR detection for enhanced POC detection. Integrating membrane-based DNA enrichment with one- pot RPA-CRISPR detection allows for Mtb detection with limited equipment and user steps.

[0144] The disclosure also provides novel testing method and device for detecting the presence of MTB in a bodily fluid sample, as well as the capability of predicting resistance of the MTB to first-line TB drugs. In the method, the steps of DNA isolation, target amplification and data analysis are integrated in a single portable device that can be operated with individuals having minimal training. The target is A-f / A-cfDNA in the bodily fluid sample, and the method and device starts with a test strip having the nucleotide amplification reagents and CRISPR reagents immobilized thereon.

[0145] The immobilized nucleotide amplification reagents and CRISPR reagents will be activated once they are in contact with the bodily fluid sample. The nucleotide amplification reagents start to amplify specific nucleotide fragments, and the CRISPR reagents will bind to specific sequences and emit fluorescent signals that can be detected.

[0146] The nucleotide reagents comprise, for example, DNA polymerase and substrate for nucleotide amplification. The DNA polymerase can amplify the nucleotides preferably without the need of heating and denaturing the DNAs. Suitable DNA polymerase

[0147] The inventive method and device can be illustrated with reference to FIG. 5, which uses sputum as an example for the bodily fluid sample. In FIG. 5, sputum sample from a TB suspect is collected in an assay tube, which is then capped and swirled to mix the sample with lysis buffer that may be lyophilized and rehydrated by the sample. The mixture is then incubated, and then drawn into multiple capillary tubes that contain RPA- CRISPR reagents to initiate the assay reaction. Multiplex reactions used to assess drugresistant phenotypes employ primers and gRNAs that target the top 10 mutations associated with resistance to the first line TB drugs: rifampin (RIF), isoniazid (INH), ethambutol (EMB), and pyrazinamide (PZA). Resistance against 2ndline TB drugs may also be target for detection. Once the target sequences are detected by the RPA-CRISPR reagents, fluorescent signal indicating the presence of a DNA target is read by a portable device that may be battery-powered. Positive signals in any of the multiplex reactions is considered definitive proof of the subject's drug resistance to that drug.

[0148] Inventors' preliminary results (not shown) of the ultrasensitive CRISPR-mediated TB diagnosis assay can detect and quantify circulating A / / / i-cfDNA in a retrospective TB cohort. Additional results from longitudinal serum samples collected during TB treatment also provide strong proof-of-principle evidence, supporting the use of the assay for rapid TB treatment evaluation.EXAMPLE 6: PORTABLE TB DIAGNOSTIC

[0149] In places where resources and trained personnel are scarce with TB prevalence, a portable device may be of significant importance to quickly and accurately diagnose TB patients and prescribe the correct medication based on the drug resistance.

[0150] As such, a portable lab-in-a-tube device is described with respect to FIGs. 6-8 and 8. In FIG. 6, the cap of the sputum collection tube is integrated with two air bubbles and a one-way air valve for reaction tube insertion. The air bubbles and the one-way valve ensures that the liquids in the tube are flowing in the desired direction to react with reagents. Other possible driving mechanism and microfluidic may also be used. The CRISPR reaction tubes have a plurality of RPA CRISPR papers that have CRISPR reagents immobilized thereon, or alternatively lyophilized at the bottom of the tube, as shown in (b).

[0151] In one embodiment of the TB detection device and method of this disclosure, shown in (c), the lysis buffer, RPA reagents, and CRISPR reagents are all lyophilizedand placed at the bottom of the test tube for easier storage and transportation. Once actual testing is required, the collected sputum sample is added to the lyophilized reagents at the bottom of the test tube, where the sputum sample and water can rehydrate the reagents, thereby releasing the TB DNA in the sample. By press air bubble and incubate at 37°C, sputum lysate will react with RPA-CRISPR reagents. TB diagnosis and drug resistance will be determined according to the panel on the right hand side.

[0152] Specifically, the viscosity of sputum samples is very high, and often need to be reduced before lysis and subsequent reaction can take place. The air bladder (21) provides the necessary pneumatic drive to force the processed sputum to flow into an array of pre-loaded assay tubes to initiate RPA and CRISPR reactions to the specific DNA targets. Additionally, the one-way gas valve (22) in the cap is connected to the tops of the reaction tubes, such that by depressing the air bladder the sputum sample will flow into the reaction tubes, while also preventing backflow of the sample.

[0153] Five reaction tubes having smaller diameters are shown in FIG. 6 (c), but the number of reaction tubes can vary, depending on the need, as long as the reaction tubes fit inside the test tube, and the air bladder (21) can successfully drive the sample fluid into the desired direction.

[0154] Each of the reaction tubes comprises RPA-CRISPR reagents specific for a gene target, such as a generic TB target, orthose of certain drug-resistant strains. For example, the multi-copy insertion element IS6110 can be used for detecting overall TB diagnosis, and certain single nucleotide polymorphism (SNPs) that are linked to specific TB drugs: rpoB (rifampin), katG and FabGl (isoniazid), embB (ethambutol), and pncA (pyrazinamide), as shown in FIG. 6(b).

[0155] In a typical procedure, the sputum sample is collected and incubated with lysis / denaturation buffer reagents at room temperature for about 10 minutes in order to reduce its viscosity and to release Mtb DNA. After the incubation period, the air bladder is pressed to force the released Mtb DNA into a cotton matrix containing lyophilized RPA-CRISPR reagents, thereby initiate the polymerization and CRISPR-detection reactions, as shown in FIG. 6(c). If a specific DNA target is detected, the respective test tube will emit a fluorescent signal, which can be read by a portable readout device.EXAMPLE 7: PORTABLE READER DEVICE

[0156] An alternative embodiment of the portable detector can be used to load samples, perform RPA-CRISPR reactions, detect and analyze fluorescent signals, thereby confirming a diagnosis. The portable detector (310) is illustrated in FIG. 7(a), and can have a 3D-printed case (311) that houses an LED (313), a power source (315), a light filter (317), as well as other necessary components, such as a receiver (319) for the test tube as described above with regard to FIG. 6.

[0157] The detector device (310) further comprises a camera module (321) for taking images, a processor (323) for computation, and an LCD screen (325) to show the results. This design can be manufactured fairly inexpensively and quickly, and the processor can be programed to control the camera module to detect and analyze the results. This would also eliminate the potential for software compatibility issue on different smartphone platforms.

[0158] The LEDs (313) emit the light and excite the fluorescent molecules. LEDs have the advantage of reduced cost and energy consumption, therefore longer battery life. In other embodiment, different light sources, such as laser diodes, may also be used for higher excitation intensity for better imaging. Other light source configurations can also be used to achieve similar results.

[0159] Optionally, a dry bath (330) may be provided to further improve the CRISPR- TBD assay by supplying higher temperature for the reaction to proceed at a higher rate. The dry bath (330) can thus make it comparable to a regular bench test. As shown in FIG. 7(b), Arduino-controlled positive temperature coefficient (PTC) heating elements (331) can provide a constant temperature at about 36 to 39 °C, which is ideal for sputum denaturation / lysis and the RPA-CRISPR reaction. The heating element can be powered by an integrated rechargeable battery (333), or replaceable external batteries. As shown in FIG. 7(c), the dry bath (330) also comprises a receiver (335) on top of the heating element (331) to heat the sample in the test tube. An LCD display (337) can also be included to indicate the current temperature.

[0160] A prototype assay device is shown in FIG. 7(d). Preliminary results indicate that the RPA-CRISPR fluorescent signal produced by the reaction tubes loaded with 1,000 copy / mL of Mtb IS6110 DNA in PBS. The result is shown in FIG. 7(e).

[0161] The optimized assay tube can produce detectable CRISPR-TBD signal after a 20- 25 mins assay procedure. The sensitivity, accuracy, linearity and reproducibility results indicate that the assay provides comparable results to laboratory results that were obtained by a benchtop fluorescent microplate reader. Specifically, the minimum LOD (limit of detection) of 0.1 copy / pL and <15% CV (coefficient of variation) over the assay's linear range is on par with laboratory standards. Additionally, the overall cost of the portable device (including the heater) will be low enough to manufacture, and a single charge of battery should be sufficient to operate 200 samples.EXAMPLE 8: IMMOBILIZATION OF RPA-CRISPR REAGENTS

[0162] Reagents used in the CRISPR-TBD assay are preferably immobilized on the test strip to allow easier transport and storage in environments of the assay's intended use. One way of immobilizing the RPA-CRSPR reagents would be lyophilization. Several candidates for lyophilization carriers were therefore evaluated: Waterman filter papers with 6, 20, 22, 25, 30 pm mean pore sizes, transblot filter paper, and nitrocellulose paper. These candidates were evaluated by having 5mm diameter discs of each to absorb 50pL of an RPA-CRISPR reaction solution. The transblot paper discs produced the highest specific signal when these reagent-loaded discs were added to 50 pL standards containing 100 copies of Mtb IS6110 DNA and incubated at 37°C for 20 minutes, as shown in FIG. 8(a). The transblot paper is therefore the preferable material for the test strip as used in this disclosure. However, other material may also be used.

[0163] To analyze the fluorescent signals, CRISPR-TB signal development was performed for 2 hours at 37°C, using the same standards with four different settings: adding RPA and CRISPR reagents in aqueous solution, lyophilization of RPA-CRISPR reagents without the transblot papers, lyophilization of RPA-CRISPR reagents with the transblot papers, or the transblot paper alone as a negative control. Similar signal was detected in reactions performed with the RPA-CRISPR reagents that were lyophilized with and without a transblot paper support matrix, as shown in FIG. 8(b).

[0164] To display assay performance at different temperatures, one-pot RPA-CRISPR reactions targeting IS6110 DNA were incubated at 42 °C, 37 °C, room temperature (about 25 °C), and by holding the tube in a person's hand. The results are shown in FIGs. 4(c), (d). It is shown that the assay can be operated at temperature ranges from 25 to42°C with comparable performance. This would further validate that the assay can be run in TB-prevalent countries regardless of their weather conditions.

[0165] Additional assays were conducted to target drug-resistant SNP S450L of the rpoB gene. The results shown in FIG. 8(e) indicate that the one-pot CRISPR system on paper can specifically detect this mutation using wildtype and mutated gene fragments. This finding also supports the assay being used for detecting different drug-resistant SNPs, which can then be used to tailor treatment regimens for the patients.EXAMPLE 9: IMMOBILIZATION OF RPA-CRISPR REAGENTS

[0166] 11 artificial sputum samples were collected with TB DNA spike-in, with 2% isopropanol-NaOH solution buffer (total volume of about 500 pL) at a ratio of 2: 1, and incubated at 37 °C for 10 minutes. The resulting samples were than added to the RPA- CRISPER test strips and incubated for another 20 minutes. Here Isopropanol-NaOH solution is a mucolytic and lysis reagent that breaks down the viscous sputum to become homogenous clear liquid that contains TB DNA that were released from the Mtb cells. The results are shown in FIG. 9(a), which indicate that the fluorescent intensity is around IxlO6a.u. See FIG. 9(b). However, the mean intensity of the six TB patients is around 2.5-5 x 106a.u., which is at least 2.5-fold higher than healthy donors. The resulting fluorescent intensity from the positive sputum samples that underwent isolation-free RPA-CRISPR assay can therefore be readily read and analyzed.EXAMPLE 10: DETECTION OF THE RPOB S450L DRUG RESISTANCE MUTATION

[0167] Having established that the assay is capable of detecting sputum samples, inventors next evaluated the assay's ability to detect a SNP-derived S450L mutation, which is the most common cause of rifampin resistance and DR-TB. This SNP converts the wildtype sequence (GTCG) to a PAM motif (GTTG) that can direct gRNA-mediated cleavage by CRISPR Casl2a activity. It is shown that the CRISPR-TBD assay of this disclosure, designed to detect this SNP, produced strong specific signal for amplicons containing mutant vs. wildtype SNP sequence, see FIG. 10(a). The strong signal can easily be detected and analyzed by the device to determine whether a drug resistance mutation is present.

[0168] A multiplex CRISPR-TBD assay designed to detect the single copy Mtb virulence gene esxB and this DR-linked rpoB SNP identified esxB cfDNA in plasma of both DS-TB and DR-TB cases before ATT start but detected the rpoB mutant SNP only in DR-TB cases. See FIG. 10(b)-(c).

[0169] Multiplex reactions that employ a set of gRNAs to detect various SNPs responsible for the most common resistance mutations for each drug on a limited set of amplicons will facilitate the sensitive and specific screening for drug resistance phenotypes. Indeed, the results herein clearly show that the multiplex works as intended to accurately and quickly detect the samples with both non-drug-resistance samples and drug-resistance samples. The rapid, simple and integrated diagnosis and DR-TB screening approach should permit individuals with TB, and particularly those with different types of drug-resistance-TB, in order to initiate an appropriate treatment regimen at initial TB diagnosis, which is not normally feasible since screening for DR- TB is usually performed as a secondary test due to various considerations. Specifically, gRNAs can be customized for different SNPs, or other target sequences that may be of interest.

[0170] Additionally, the method and device herein can be used for quantitative CRISPR- based assays read by benchtop plate reader or a mobile device. Fluorescent signal from the CRISPR-TBD assay can also be quantified in the assay reader device described above. The sputum Af / A-DNA levels read by the assay reader device are expected to reflect dynamic changes in Mtb burden over time in response to therapeutic intervention. For example, if samples are collected at different time interval of the same subject, and the resulting curve of fluorescent signals would be indictive of the subject's Mtb burden that can be used to correlate with the treatment regimen to see if the medications are working.EXAMPLE 11: LIT ASSAY TUBE DESIGN AND USE

[0171] One embodiment of the portable device design employs a 5 mL round bottom polypropylene tube (Globe Scientific 110446) fitted with a 3D-printed plunger that contains a 6mm PES / Whatman DNA enrichment membrane, placed below a cotton blot membrane disc loaded with RPA-CRISPR reagents. The 3D-printed plunger is composed of five separate 3D-printed parts and two identical rubber bands (Amazon, B08B3K2RBS) that, when assembled and inserted into the polypropylene tube form a closed system. This plunger uses a pen click mechanism to control its movement withinthe sealed chamber, where the first click of the plunger lowers its DNA capture membrane into the sample lysate and the second click raises this membrane and brings it into contact with a membrane containing RPA-CRISPR reagents to initiate the reaction used to detect the target DNA fragment.

[0172] Optionally, a third click is can be employed to open up an imaging window, or to allow for the start state to cover the fluorophore and RPA-CRISPR reagents and protect it from light (e.g. photo bleaching effects or early degradation). Alternatively, a 1 -click configuration can be beneficial, where the plunger is already fully down as the start state, and the one click raises the membrane into contact with the RPA-CRISPR reagents.

[0173] For saliva and sputum analyses, 500 pL of patient respiratory sample was added to two distinct LIT assay tube variants containing lyophilized DTT amounts designed to achieve 10 mM or 100 mM DTT final concentrations in these respective sample types, which were transferred to the incubator port of the portable assay device for 15 minutes to permit Mtb lysis and DNase inactivation. After 7 minutes, tubes were removed and shaken briefly, replaced, and allowed to incubate for an additional 8 minutes, after which their plungers were depressed to lower the DNA enrichment membrane into the sample lysate by the 3D-printed clicker, and then a second click orchestrates contact onto reagent-loaded blot paper to initiate the RPA-CRISPR reaction within the 37-42 °C region of the assay tube. For pediatric serum analyses, DNA was isolated from 200 pL serum samples using a MagMAX Cell-Free DNA Isolation Kit (Applied Biosystems, A29319) on a KingFisher Flex (ThermoFisher) system, eluted in 50 pL DNase-free water, and stored at -80°C until use. A 5 pL aliquot (10%) of a sample was added directly to the RPA-CRISPR detection membrane and incubated for 45 minutes in a LIT assay tube loaded with 1 mL PBS to generate the standard 37-42 °C region in the assay tube. After the RPA-CRISPR reaction, the LIT assay tubes were transferred to the assay readout port to quantify assay signal by selecting the OpenCV icon using the device touchscreen to capture a fluorescent image and calculate a quantitative result, both of which are automatically displayed on the touchscreen. The positive signal cutoff value was calculated as the mean plus three times the standard deviation value detected from three independent no template control assay reactions. The assay value can be recorded by hand or saved on the microprocessor and exported to another device using the USB port or Bluetooth, or WiFi functions of the microprocessor.

[0174] The present invention is exemplified with respect to lab in a tube, point of care detection device and method for detection of a pathogen’s presence and drug resistant mutations. However, this is exemplary only, and the invention can be broadly applied to other pathogens where pathogen-specific target sequence can be identified, and the corresponding primers and gRNAs can be manufactured. The device is not limited by RPA-CRISPR, and can capture any fluorescence, colorimetric, or light producing or reflecting process as long as the presence of a target nucleic acid produces a detectable light signal. The preceding examples are intended to be illustrative only, and not unduly limit the scope of the appended claims.

[0175] The following references are incorporated by reference in their entirety for all purposes.1. 1. G. J. Abou Jaoude et al., National tuberculosis spending efficiency and its associated factors in 121 low-income and middle-income countries, 2010-19: A data envelopment and stochastic frontier analysis. Lancet Global Health 10, e649-e660 (2022).2. WHO, “Global Tuberculosis Report 2022” (2022).3. WHO, “The END TB Strategy” (2015).4. A. Esmail et al., Comparison of two diagnostic intervention packages for community-based active case finding for tuberculosis: An open-label randomized controlled trial. Nat. Med. 29, 1009-1016 (2023).5. G. Zwama et al., Health system influences on the implementation of tuberculosis infection prevention and control at health facilities in low-income and middle-income countries: A scoping review. BMJ Glob. Health 6, e004735 (2021).6. M. Nadjib et al., Cost and affordability of scaling up tuberculosis diagnosis using Xpert MTB / RIF testing in West Java, Indonesia. PLOS ONE 17, e0264912 (2022).7. A. S. Piatek et al., GeneXpert for TB diagnosis: Planned and purposeful implementation. Glob. Health Sci. Pract. 1, 18-23 (2013).8. WHO, “Xpert MTB / RIF Implementation Manual Technical and Operational ‘How-to’: Practical Considerations” (2014).9. R. Vongthilath-Moeung et al., Janssens, Time to detection of growth for Mycobacterium tuberculosis in a low incidence area. Front. Cell. Infect. Microbiol. 11, 704169 (2021).10. M. D. Fenta et al., Facilitators and barriers to tuberculosis active case findings in low-and middle-income countries: A systematic review of qualitative research. BMC Infect. Dis. 23, 515 (2023).11. WHO, “High-Priority Target Product Profiles for New Tuberculosis Diagnostics: Report of a Consensus Meeting” (2014).12. H. Alsdurf et al., Tuberculosis screening costs and cost-effectiveness in high-risk groups: A systematic review. BMC Infect. Dis. 21, 935 (2021).13. J. Y. Lee, Diagnosis and treatment of extrapulmonary tuberculosis. Tuberc. Respir. Dis. 78, 47-55 (2015).14. R. Gopalaswamy et al., Extrapulmonary tuberculosis — An update on the diagnosis, treatment and drug resistance. J. Respir. 1, 141-164 (2021).15. T. A. Thomas, Tuberculosis in children. Pediatr. Clin. North Am. 64, 893-909 (2017).16. R . K. Gupta et al., Prevalence of tuberculosis in post-mortem studies of HIV-infected adults and children in resource-limited settings. AIDS 29, 1987-2002 (2015).17. T. G. Connell et al., Advances in the diagnosis of pulmonary tuberculosis in HIV-infected and HIV-uninfected children. J. Infect. Dis. 204, SI 151— SI 158 (2011).18. H . E. Jenkins et al., Mortality in children diagnosed with tuberculosis: A systematic review and meta-analysis. Lancet Infect. Dis. 17, 285-295 (2017).19. M. T. Montales et al., HIV-associated TB syndemic: A growing clinical challenge worldwide. Front. Public Health 3, 281 (2015).20. S.-A. Ohene et al., Extra-pulmonary tuberculosis: A retrospective study of patients in Accra, Ghana. PLOS ONE 14, e0209650 (2019).21. 1 . Bouzouita et al., Usefulness of Xpert MTB / RIF Ultra for rapid diagnosis of extrapulmonary tuberculosis in Tunisia. Sci. Rep. 14, 2217 (2024).22. M. Tadesse et al., Xpert MTB / RIF assay for the diagnosis of extrapulmonary tuberculosis: A diagnostic evaluation study. Clin. Microbiol. Infect. 25, 1000-1005 (2019).23. E . Maclean et al., A systematic review of biomarkers to detect active tuberculosis. Nat. Microbiol. 4, 748-758 (2019).24. Z. Huang et al., CRISPR detection of circulating cell-free Mycobacterium tuberculosis DNA in adults and children, including children with HIV: A molecular diagnostics study. Lancet Microbe 3, E482-E492 (2022).25. S. G. Thakku et al., Genome-wide tiled detection of circulating Mycobacterium tuberculosis cell-free DNA using Casl3. Nat. Commun. 14, 1803 (2023).26. R . C. Wood et al., Detection of Mycobacterium tuberculosis DNA on the oral mucosa of tuberculosis patients. Sci. Rep. 5, 8668 (2015).27. E . C. Church et al., Oral swabs with a rapid molecular diagnostic test for pulmonary tuberculosis in adults and children: A systematic review. Lancet Glob. Health 12, e45-e54 (2024).28. P. Byanyima et al., Feasibility and sensitivity of saliva GeneXpert MTB / RIF ultra for tuberculosis diagnosis in adults in Uganda. Microbiol. Spectrum 10, e0086022 (2022).29. K. J. Land et al., REASSURED diagnostics to inform disease control strategies, strengthen health systems and improve patient outcomes. Nat. Microbiol. 4, 46-54 (2019).30. P. Ma et al., Compensatory effects of M. tuberculosis rpoB mutations outside the rifampicin resistance-determining region. Emerg. Microbes Infect. 10, 743-752 (2021).31. M.-C. Li et al., rpoB Mutations are associated with variable levels of rifampin and rifabutin resistance in Mycobacterium tuberculosis. Infect. Drug Resist. 15, 6853-6861 (2022).32. D . R. Joel et al., Diagnosis of paediatric tuberculosis using sputum induction in Botswana: Programme description and findings. Int. J. Tuberc. Lung Dis. 18, 328-334 (2014).33. B. J. Marais, H. S. Schaaf, Childhood tuberculosis: An emerging and previously neglected problem. Infect. Dis. Clin. North Am. 24, 727-749 (2010).34. J. G. Peter et al., Sputum induction to aid diagnosis of smear-negative or sputum-scarce tuberculosis in adults in HIV-endemic settings. Eur. Respir. J. 43, 185-194 (2014).35. C . Doig et al., The efficacy of the heat killing of Mycobacterium tuberculosis. J. Clin. Pathol. 55, 778-779 (2002). 36. P. Shetty, D. Ghosh, D. Paul, Thermal lysis and isothermal amplification of Mycobacterium tuberculosis H37Rv in one tube. J. Microbiol. Methods 143, 1-5 (2017).37. P. Berner-Melchior, H. B. Drugeon, Inactivation of Mycobacterium tuberculosis for DNA typing analysis. J. Clin. Microbiol. 37, 2350-2351 (1999).38. H. de Puig et al., Minimally instrumented SHERLOCK (miSHERLOC K) for CRISPR- based point-of-care diagnosis of SARS-CoV-2 and emerging variants. Sci. Adv. 7, eabh2944 (2021).39. Y. Zou et al., Nucleic acid purification from plants, animals and microbes in under 30 seconds. PLOS Biol. 15, e2003916 (2017).40. Y. Chen, Y. Hu, X. Lu, Polyethersulfone-based microfluidic device integrated with DNA extraction on paper and recombinase polymerase amplification for the detection of Salmonella enterica. ACS Sens. 8, 2331-2339 (2023).41. D . Helb et al., Rapid detection of Mycobacterium tuberculosis and rifampin resistance by use of on-demand, near-patient technology. J. Clin. Microbiol. 48, 229-237 (2010).42. Y. He et al., Serum-based diagnosis of pediatric tuberculosis by assay of Mycobacterium tuberculosis factors: A retrospective cohort study. J. Clin. Microbiol. 59, e0175620 (2021).43. S.-W. Pan et al., Mycobacterium tuberculosis-derived circulating cell-free DNA in patients with pulmonary tuberculosis and persons with latent tuberculosis infection. PLOS ONE 16, e0253879 (2021).44. G. Theron et al., Xpert MTB / RIF results in patients with previous tuberculosis: Can we distinguish true from false positive results? Clin. Infect. Dis. 62, 995-1001 (2016).45. G. Theron et al., False-positive Xpert MTB / RIF results in retested patients with previous tuberculosis: Frequency, profile, and prospective clinical outcomes. J. Clin. Microbiol. 56, eO 169617 (2018).46. WHO, “The Use of Loop-Mediated Isothermal Amplification (TB-LAMP) for the Diagnosis of Pulmonary Tuberculosis: Policy Guidance” (2016).47. D . S. Boyle et al., Rapid detection of Mycobacterium tuberculosis by recombinase polymerase amplification. PLOS ONE 9, el03091 (2014).48. M. N. Tsaloglou et al., Handheld isothermal amplification and electrochemical detection of DNA in resource-limited settings. Anal. Biochem. 543, 116-121 (2018).49. X. Chen et al„ Rolling circle amplification for direct detection of rpoB gene mutations in Mycobacterium tuberculosis isolates from clinical specimens. J. Clin. Microbiol. 52, 1540- 1548 (2014).50. J. Yang et al., Use of digital droplet PCR to detect Mycobacterium tuberculosis DNA in whole blood-derived DNA samples from patients with pulmonary and extrapulmonary tuberculosis. Front. Cell. Infect. Microbiol. 7, 369 (2017).51. R . Ushio et al., Digital PCR assay detection of circulating Mycobacterium tuberculosis DNA in pulmonary tuberculosis patient plasma. Tuberculosis 99, 47-53 (2016).52. C ,-K.Kim et al.„ Comparative evaluation of the loop-mediated isothermal amplification assay for detecting pulmonary tuberculosis. Ann. Lab. Med. 38, 119-124 (2018).53. M. Palaci et al., Cavitary disease and quantitative sputum bacillary load in cases of pulmonary tuberculosis. J. Clin. Microbiol. 45, 4064-4066 (2007).54. E . Musisi et al., Accuracy of the tuberculosis molecular bacterial load assay to diagnose and monitor response to anti-tuberculosis therapy: A longitudinal comparative study with standard-of-care smear microscopy, Xpert MTB / RIF Ultra, and culture in Uganda. Lancet Microbe 5, E345-E354 (2024).55. A. R. Namuganga et al., Suitability of saliva for tuberculosis diagnosis: Comparing with serum. BMC Infect. Dis. 17, 600 (2017).56. C . S. Laxton et al., The potential of saliva as an accessible and sensitive sample type for the detection of respiratory pathogens and host immunity. Lancet Microbe 4, E837-E850 (2023).57. A. W. Kaso, A. Hailu, Costs and cost-effectiveness of Gene Xpert compared to smear microscopy for the diagnosis of pulmonary tuberculosis using real-world data from Arsi zone, Ethiopia. PLOS ONE 16, e0259056 (2021).58. The Global Fund, “Briefing Note New Pricing for Cepheid GeneXpert Tuberculosis Testing” (2023).59. W. A. Alemayehu et al., Comparative study of OMNIgene®* SPUTUM reagent versus cold-chain for the transportation of sputum samples to GeneXpert®MTB / RIF testing sites in Malawi. BMC Infect. Dis. 19, 424 (2019).60. S. Brown, J. E. Leavy, J. Jancey, Implementation of GeneXpert for TB testing in low-and middle-income countries: A systematic review. Glob. Health Sci. Prac. 9, 698-710 (2021).61. T. Nalugwa et al., Challenges with scale-up of GeneXpert MTB / RIF® in Uganda: A health systems perspective. BMC Health Serv. Res. 20, 162 (2020).62. N . L. Rendell et al., Implementation of the Xpert MTB / RIF assay for tuberculosis in Mongolia: A qualitative exploration of barriers and enablers. PeerJ 5, e3567 (2017).63. WHO, “WHO Consolidated Guidelines on Tuberculosis -Module 3: Diagnosis -Rapid Diagnostics for Tuberculosis Detection” (2021).64. J. M. Hong et al., Point-of-care diagnostic tests for tuberculosis disease. Sci. Transl. Med. 14, eabj4124 (2022).65. Africa Medical Supplies Platform, GeneXpert IV-4 desktop (2024).66. H ACH, GeneXpert IV, 2 module configuration with laptop (2024).67. Stop TB Partnership, GDF January 2024 Diagnostics, Medical Devices & Other Health Products Catalog (2024).68. S. M. Graham et al., Clinical case definitions for classification of intrathoracic tuberculosis in children: An update. Clin. Infect. Dis. 61, S179-S187 (2015).

[0176]

Claims

CLAIMS1. A portable device for detecting presence of a nucleic acid sequence of interest in a biological sample, the portable device comprising: a) a housing; b) a processing module, comprising a microprocessor; c) an incubator module, optionally comprising a heating element; d) an imaging module, comprising an imaging chamber, an image capturing element, and optionally a light-emitting element, wherein the imaging module is operatively connected to the processing module to analyze images captured by the image capturing element; and e) a power source, wherein the power source is operatively connected to the incubator module, the imaging module, and the processing module.

2. The portable device of claim 1, wherein the housing comprises an incubating opening and optionally an imaging opening, wherein the incubating opening is connected to the heating element of the incubator module, and the imaging opening is connected to the imaging module, wherein the imaging opening can be the same as the incubating opening.

3. The portable device of any of claims 1-2, further comprising a testing cartridge and a testing strip.

4. The portable device of claim 3, wherein the testing cartridge is shaped and sized to fit into the incubating opening.

5. The portable device of claim 3, wherein the testing strip comprises a nucleic acidbinding membrane.

6. The portable device of any of claims 3-5, wherein the testing strip comprises nucleic acid amplification reagents and CRISPR-detection reagents fixed on a substrate.

7. The portable device of claim 6, wherein the nucleic acid amplification reagents comprise RPA primers and RPA enzymes, and the CRISPR-detection reagents comprise one of Cast 2a, Cast 2b, Cast 3, Cas9, and Cast 4 effector protein, gRNAs, and one or moreoptical probes.

8. The portable device of any of claims 3-7, wherein the testing cartridge comprises a loading mechanism that holds the testing strip away from the bottom of the testing cartridge.

9. The portable device of claim 1, wherein the processing module further comprises a data transmission unit, wherein the data transmission unit transmits data to a separate digital device.

10. The portable device of claim 1, wherein the imaging module further comprises one or more of an emission filter, excitation filter, and / or dichroic mirror to manipulate light entering the image capturing element.

11. The portable device of claim 1, wherein the nucleic acid of interest originates from Homo sapiens, Borrelia burgdorferi, Mycobacterium tuberculosis, Mycobacterium abscessus, Mycobacterium avium, Mycobacterium kansasii, Zaire ebolavirus, Pneumocystis jirovecii, or Treponema pallidum.

12. The portable device of claim 11, wherein the gRNA hybridizes with a target sequence that is a portion of IS6110.

13. The portable device of claim 11, wherein the gRNA hybridizes with a target sequence having at least one of: i) S450L, D435V, H445Y, H445D, D435Y, S450W, L452P, H445L, S450F, L430P, or H445R SNPs of rpoB, ii) S315T, S315N, or W328L of ka / G, iii) c-777t (fabGl_c-15t) or g-154a (fabGl_L203L) of fabGl-inhA,' iv) M306V, D354A, Y319S, D328Y, Q497R, G406A, G406D, G406S, Q497K or G406C of embB, v) H57D, a-l lg, Q10P, H51D, T76P, G97D, V7G, C14R, D49G or H57R of pncA.

14. The portable device of any of claims 7-13, wherein the gRNA does not include a protospacer adjacent motif (PAM) sequence.

15. The portable device of claim 1, wherein the portable device comprises a plurality of test strips, and wherein each said test strip comprises a gRNA having single nucleotide polymorphisms of drug resistant strains of MTB.

16. The portable device of claim 1, wherein the biological sample is sputum, blood,serum, saliva or urine.

17. A method of detecting the presence of a nucleic acid of interest in a bodily fluid sample by using a test strip and a test tube, the test strip having nucleotide amplification reagents and CRISPR reagents immobilized thereon, the method comprising: a) obtaining a bodily fluid sample from a subject, b) adding the bodily fluid sample to the test tube, c) inserting the test strip into the test tube, and d) reading one or more optical signals from the test tube.

18. The method of claim 17, wherein the bodily fluid sample is sputum, blood, saliva or urine.

19. The method of claim 17Error! Reference source not found., wherein the target nucleic acid sequence corresponds to a portion of Homo sapiens, Borrelia burgdorferi, Mycobacterium tuberculosis, Mycobacterium abscessus, Mycobacterium avium, Mycobacterium kansasii, Zaire ebolavirus, Pneumocystis jirovecii, or Treponema pallidum DNA or RNA.

20. The method of one of claims 17-19, wherein the CRISPR reagents comprise one or more gRNAs free of protospacer adjacent motif (PAM) sequence.

21. The method of claim 19, wherein the target sequence comprises a drug resistant gene.

22. The method of claim 19, wherein the target sequence comprises a portion of a gene selected from: rpoB, katG,fabGl-inhA, embB, and pncA.

23. The method of claim 17, further comprising, prior to step a), a lysis step by introducing the biological sample into a lysis solution.

24. The method of claim 22, wherein the lysis step is carried out at a temperature between 20 and 100°C for a predetermined period of time.

25. The method of claim 17, wherein step a) is carried out at a temperature between roomtemperature and 100°C for a predetermined period of time.

26. The method of claim 17, wherein the nucleotide amplification reagents include primers targeting a first DNA or RNA sequence from a species of interest, and the CRISPR reagents include gRNA capable of hybridizing with a second DNA or RNA sequence from said species of interest, a reporter, and a CRISPR effector protein.

27. The method of claim 26, wherein the gRNA comprises one or more single nucleotide polymorphisms of drug resistant strains of a pathogen of interest.

28. The method of claim 26, wherein the CRISPR effector protein is EnGenLba Casl2a.

29. The method of claim 26, wherein the test strip further comprises dried lysis buffer.

30. A test strip for detecting a pathogen, wherein the test strip comprises CRISPR reagents immobilized thereon.

31. The test strip of claim 30, wherein the test strip is made of paper, cotton, fiber, sponge, or a combination thereof.

32. The test strip of claim 30, wherein the CRISPR reagents comprise a nucleotide amplification reagent, a CRISPR Cas protein, a guide RNA (gRNA), and an optical probe.

33. The test strip of claim 32, wherein the nucleotide amplification reagent comprises primers targeting a portion of DNA or RNA from Homo Sapiens, Borrelia burgdorferi, Mycobacterium tuberculosis, Mycobacterium abscessus, Mycobacterium avium, Mycobacterium kansasii, Zaire ebolavirus, Pneumocystis jirovecii, or Treponema pallidum.

34. The test strip of claim 33, wherein the gRNA comprises one or more single nucleotide polymorphisms (SNP) of drug resistant strains of a pathogen of interest.

35. The test strip of claim 34, wherein the SNP comprises one or more sequences, each with at least 80% homology to one of SEQ ID NOs. 1-26.

36. The test strip of claim 30, further comprising dried lysing buffer.

37. A lab-in-tube device, comprising: a) a cap having a top hole and a bottom opening;b) a push stem having a top button and a bottom sawtooth opening, wherein the top button is sized to fit through the top hole of the cap; c) a rotating pin sized to couple with the bottom sawtooth opening of the push stem; d) a target zone lock mounted on the cap; and e) a plunger passing through the target zone lock; f) wherein the target zone lock and the plunger are mechanically coupled together.

38. The lab-in-tube device of claim 37, wherein the cap has notches to allow for proper sample alignment in the device.

Citation Information

Patent Citations

  • Portable fluorescence detection system and microassay cartridge

    US20150346097A1

  • Self- administrable diagnostic test with integrated swab

    US20210293815A1