Method for preparing extracellular vesicles of lactobacillus with increased aglycone isoflavone content and composition for preventing hair loss

Abstract

The present invention relates to a method for preparing extracellular vesicles of Lactobacillus cells with increased aglycone isoflavone content, and a composition for preventing hair loss using same. The Lactobacillus of the present invention enables the effective extraction of aglycone isoflavones contained in legumes through a fermentation process, and the extracellular vesicles secreted from the Lactobacillus exhibit anti-inflammatory and immunomodulatory properties and can be expected to have the effects of promoting scalp health and preventing hair loss. Owing to their small size and excellent intercellular delivery capability, the extracellular vesicles can act effectively in deep layers of the skin and scalp. In addition, the extracellular vesicles have high biocompatibility and fewer side effects, and can be used more safely than conventional chemical compositions.

Description

Method for producing lactobacillus extracellular vesicles with increased non-glycosylated isoflavone content and composition for preventing hair loss

[0001] The present invention was made under the support of the Ministry of SMEs and Startups of the Republic of Korea under the task identification number 1425180372 and detailed task number 00261231. The task management specialized organization of the said task is the Small and Medium Business Technology Information Promotion Agency, the research project name is “Startup Growth Technology Development”, the research project name is “Development of vegan microbiome raw materials and products with hair loss alleviation effect using Lactobacillus strain culture technology and eco-friendly fermentation and purification process”, the task performing organization is Layer Cosmetic Co., Ltd., and the research period is 2023.09.01-2023.12.31.

[0002] This patent application claims priority to Republic of Korea Patent Application No. 10-2024-0101187, filed with the Korean Intellectual Property Office on July 30, 2024, the disclosure of which is incorporated herein by reference.

[0003] The present invention relates to a method for producing Lactobacillus extracellular vesicles having increased non-glycosidic isoflavone content and a composition for preventing hair loss using the same.

[0004]

[0005] Soybeans are a food containing a variety of bioactive compounds beneficial to health, with isoflavones attracting particular attention as key components. Isoflavones primarily exist in glycoside form, and the process of converting them into aglycone is becoming a key technology in the health supplement and cosmetics industries. Aglycone isoflavones are highly absorbable in the human body and possess various health benefits, including antioxidant, anti-inflammatory, and anti-cancer properties, leading to extensive research and product development.

[0006] Conventional isoflavone manufacturing techniques primarily involve extracting soybeans and converting them to aglycones through hydrolysis. This process requires enzymatic or chemical treatment, and the efficiency and stability of isoflavones have become a major issue. In particular, chemical treatment can cause residual chemicals and environmental problems, while enzymatic treatment is expensive and time-consuming. These issues make the stable and efficient production of aglycone isoflavones difficult, necessitating the development of new methods. Therefore, the present inventors sought to provide a method that can achieve high conversion efficiency of aglycone isoflavones while also being environmentally friendly and safe.

[0007] Meanwhile, hair loss is a problem that affects many people, regardless of gender, and various medications and treatments have been developed to address it. Representative hair loss treatments include minoxidil and finasteride, which are used to prevent and treat hair loss by promoting hair growth and regulating hormones, respectively. However, these existing treatments have limitations, such as limited efficacy, side effects, and the need for long-term use. Therefore, safer, more effective new treatments are needed to overcome these limitations.

[0008] The ideal hair loss treatment must meet the following criteria: safety, efficacy, and ease of use. To meet these requirements, research into new treatments utilizing natural ingredients or bioactive substances is actively underway.

[0009]

[0010] To address the aforementioned issues, the inventors of the present invention have diligently researched and developed a method for producing non-glycosylated isoflavones that is highly efficient, environmentally friendly, and safe, as well as a method for treating hair loss using natural ingredients. As a result, they discovered that a fermented soybean lactic acid bacteria extract significantly increased the isoflavone content and exhibited excellent hair loss prevention and hair growth promotion effects, thereby completing the present invention.

[0011] Accordingly, an object of the present invention is to provide a cosmetic composition for promoting hair growth or preventing hair loss, which comprises a fermented extract of lactic acid bacteria derived from soybeans selected from the group consisting of soybeans, black soybeans, and black sesame seeds.

[0012] Another object of the present invention is to provide a scalp soothing cosmetic composition comprising a fermented extract of soybeans derived from lactic acid bacteria selected from the group consisting of soybeans, black soybeans, and black sesame seeds.

[0013] Another object of the present invention is to provide a method for producing the soybean-derived lactic acid bacteria fermentation extract.

[0014]

[0015] According to one aspect of the present invention, the present invention provides a cosmetic composition for promoting hair growth or preventing hair loss, comprising a fermented extract of soybeans derived from lactic acid bacteria selected from the group consisting of soybeans, black soybeans, and black sesame seeds.

[0016] According to another aspect of the present invention, the present invention provides a scalp soothing cosmetic composition comprising a fermented extract of soybeans derived from lactic acid bacteria selected from the group consisting of soybeans, black soybeans, and black sesame seeds.

[0017] In one embodiment of the present invention, the lactic acid bacteria may be lactic acid bacteria of the genus Lactobacillus.

[0018] In a specific embodiment of the present invention, the lactic acid bacteria of the genus Lactobacillus are selected from the group consisting of Lactobacillus rhamnosus, Lactobacillus casei, and Lactobacillus plantarum.

[0019] In one embodiment of the present invention, the fermented extract comprises an aglycone isoflavone selected from the group consisting of genistein, daidzein, and glycitein.

[0020] In the present invention, "isoflavone" is a phytochemical naturally present in soybeans and is a type of "phytoestrogen." The isoflavones contained in soybeans are structurally similar to the female hormone estrogen and have similar biological functions, so they are also called phytoestrogens. Phytoestrogens have been found to provide potential alternative therapies for hormone-dependent diseases, including cancer, menopausal syndrome, cardiovascular disease, and osteoporosis. Chemically, soy isoflavones collectively refer to flavonoid compounds found in abundance in soybeans, particularly in the hypocotyl (soybean germ) region.

[0021] The above isoflavones are compounds with a 3-phenylchrome skeleton. The most well-known isoflavones are genistein, daidzein, formononetin, biochanin A, and coumestrol.

[0022] It is known that there are 12 types of isoflavones in soybeans, and soybean isoflavones are classified into glycosides and aglycones depending on their chemical structure.

[0023] There are three types of aglycones in soybeans: genistein, daidzein, and glycitein. Glycosides include daidzin and genistin, which are 7-O-glucosides in which a carbohydrate is attached to the 7th carbon of daidzein and genistein, respectively. 6'-O-acetylglucosides in which a carbohydrate is attached to the 6th carbon include 6'-O-acetyl daidzin and 6'-O-acetylgenistin. Furthermore, there are 6'-O-malonylglucosides in which 6'-O-malonyl daidzin and 6'-O-malonyl genistin are also present.

[0024] Glycosides, such as 7'-O-glucosides, 6'-O-acetylglucosides, and 6'-O-malonylglucosides, which are in the form of sugars, are converted into aglycones, which are free isoflavones with the sugars removed, by an enzyme called β-glucosidase secreted by intestinal microorganisms. The glycosides can also be hydrolyzed by gastric acid in the stomach to become free.

[0025] In one embodiment of the present invention, the fermented extract includes extracellular vesicles of lactic acid bacteria.

[0026] Extracellular vesicles (EVs) are nano-sized vesicles surrounded by a lipid bilayer that all cells secrete into the external environment. Depending on their origin, secretion mechanism, and size, these vesicles are known by various names, including exosomes, microvesicles, ectosomes, microparticles, membrane vesicles, nanovesicles, and outer membrane vesicles. The secretion of these extracellular vesicles is known to be an evolutionarily conserved phenomenon across all biological systems, from bacteria (Gram-negative and Gram-positive bacteria), archaea, and eukaryotes.

[0027]

[0028] The components included in the cosmetic composition of the present invention may include, in addition to the soybean-derived lactic acid bacteria fermentation extract as an effective ingredient, components commonly used in hair cosmetic compositions, and include, for example, conventional auxiliary agents and carriers such as stabilizers, solubilizers, vitamins, pigments, and fragrances.

[0029] The above cosmetic composition may contain various bases and additives necessary and appropriate for the formulation of the formulation, and the types and amounts of these ingredients can be easily selected by a person skilled in the art.

[0030] When the formulation of the cosmetic composition of the present invention is a paste, cream or gel, animal fiber, plant fiber, wax, paraffin, starch, tragacanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as a carrier component.

[0031] When the formulation of the cosmetic composition of the present invention is a solution or emulsion, a solvent, solvating agent or emulsifying agent is used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan.

[0032] When the formulation of the cosmetic composition of the present invention is a suspension, a liquid diluent such as water, ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tragacanth, etc. can be used as a carrier component.

[0033]

[0034] When the formulation of the cosmetic composition of the present invention is a surfactant-containing cleansing, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, acethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide ether sulfate, alkylamidobetaine, fatty alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, linolenic derivative, or ethoxylated glycerol fatty acid ester may be used as a carrier component.

[0035] When the cosmetic composition of the present invention is in the form of a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component, and particularly in the case of a spray, a propellant such as chlorofluorohydrocarbon, propane-butane or dimethyl ether may be additionally included.

[0036] When manufactured into a cosmetic product, the soybean-derived lactic acid bacteria fermentation extract of the present invention may be included in a relatively high concentration in wash-off type cosmetics such as makeup removers and cleansers, where the active ingredients remain on the skin for a short period of time. On the other hand, leave-on type cosmetics such as toners, emulsions, creams, and essences, where the active ingredients remain on the skin for a long period of time, may include a lower concentration of the soybean-derived lactic acid bacteria fermentation extract compared to wash-off type cosmetics.

[0037] The soybean-derived lactic acid bacteria fermented extract, which is an effective ingredient of the composition of the present invention, contains extracellular vesicles and non-glycoside isoflavones. The extracellular vesicles and non-glycoside isoflavones exhibit a synergistic effect when used simultaneously.

[0038] According to a specific embodiment of the present invention, the extracellular vesicles and non-glycosylated isoflavones of the present invention, when treated simultaneously, change the expression levels of regulatory factors involved in hair growth and hair loss mechanisms in hair follicle cells.

[0039] In a specific embodiment of the present invention, the hair root cells may be hair papilla cells.

[0040] Growth factors that affect hair growth in hair follicle cells include EGF, EGFF, VEGF, EGFR, HGF / SF, c-MET, FGF, FGFR, IGF, IGF-IR, TGF-β, and TGF-βR, which are known to affect the hair cycle by regulating the activity of hair follicle cells, specifically, hair papilla, or hair follicle cells surrounding the hair papilla.

[0041] In a specific embodiment of the present invention, the extracellular vesicles and non-glycolytic isoflavones of the present invention are characterized by increasing VEGF expression in breast papilla cells.

[0042] In addition, in another specific embodiment of the present invention, the extracellular vesicles and non-glycosylated isoflavones of the present invention exhibit an effect of soothing an irritated scalp when applied to the scalp.

[0043] In addition, in another specific embodiment of the present invention, the extracellular vesicles and non-glycosylated isoflavone of the present invention are characterized in that they exhibit an effect of preventing hair loss when applied to the scalp.

[0044]

[0045] According to another aspect of the present invention, the present invention provides a method for producing a soybean-derived lactic acid bacteria fermentation extract that is an effective ingredient of the above-described composition.

[0046] In one embodiment of the present invention, the manufacturing method comprises the following steps:

[0047] (a) A step of inoculating lactic acid bacteria into a culture medium containing soybean powder selected from the group consisting of soybeans, black beans, and black peas, and cultivating the same;

[0048] (b) a step of separating extracellular vesicles and non-glycolytic isoflavones derived from lactic acid bacteria from the culture; and

[0049] (c) A step of mixing the extracellular vesicles and non-glycosylated isoflavones.

[0050]

[0051] The present invention is described step by step below.

[0052]

[0053] Step (a): Step of inoculating lactic acid bacteria into a culture medium containing soybean powder and culturing it.

[0054] This step is a step of inoculating lactic acid bacteria in a culture medium containing soybean powder as a culture material for lactic acid bacteria and culturing it, thereby producing extracellular vesicles derived from lactic acid bacteria and non-glycoside isoflavones through lactic acid bacteria fermentation through fermentation by the proliferated lactic acid bacteria.

[0055] In one embodiment of the present invention, the beans are selected from the group consisting of soybeans, black beans, and black soybeans.

[0056] In one embodiment of the present invention, the culture medium contains soybean powder.

[0057] In a specific embodiment of the present invention, the soybean powder is included in the medium at a concentration of 1 to 10%, 1 to 8%, 1 to 7%, 1 to 6%, 1 to 5%, 3 to 10%, 3 to 8%, 3 to 7%, 3 to 6%, 3 to 5%, 5 to 10%, 5 to 8%, 5 to 7%, 5 to 6%.

[0058] In one embodiment of the present invention, the culture medium comprises rice bran powder. The rice bran powder serves as a nitrogen source for lactic acid bacteria.

[0059] In a specific embodiment of the present invention, the culture medium contains glucose at a concentration of 0.1 to 10%, 0.1 to 8%, 0.1 to 7%, 0.1 to 5%, 0.1 to 4%, 0.1 to 3%, 0.1 to 2%, 0.1 to 1%, 0.5 to 10%, 0.5 to 8%, 0.5 to 7%, 0.5 to 5%, 0.5 to 4%, 0.5 to 3%, 0.5 to 2%, 0.5 to 1%, 1 to 10%, 1 to 8%, 1 to 7%, 1 to 5%, 1 to 4%, 1 to 3%, or 1 to 2%.

[0060] In one embodiment of the present invention, the culture medium may be treated with cellulase. The cellulase may be inactivated after treatment.

[0061] In a specific embodiment of the present invention, the cellulase may be cellulase derived from Trichoderma reesei.

[0062] The above Trichoderma reesei-derived cellulase is a complex enzyme that can increase the isoflavone content of the soybeans of the present invention and play a role in destroying lactic acid bacteria.

[0063] The term "cellulase" as used herein refers to an enzyme that hydrolyzes cellulose and produces glucose, cellobiose, and cellooligosaccharides as primary products. The term "cellulose" as used herein refers to a polymer compound in which D-glucose is linked in a straight chain shape by a (1->4)-β-type glycosidic bond.

[0064] According to one embodiment of the present invention, the cellulase of the present invention comprises at least one enzyme selected from the group consisting of endo-β-1,4-glucanase (or carboxymethylcellulase, EG, EC 3.2.1.4), exo-β-1,4-glucan cellobiohydrolase (or exocellobiohydrolase, CBH, EC 3.2.1.91), filter paperase (Fpase) and cellobiase (or β-glucosidase, BG, EC 3.2.1.21).

[0065] In another embodiment of the present invention, the initial pH of the culture medium may be, but is not limited to, 5 to 6, 5.5 to 6, 5 to 5.5, 5, 5.5, or 6.

[0066]

[0067] Step (b): A step for isolating extracellular vesicles and non-glycolytic isoflavones derived from lactic acid bacteria from the culture.

[0068] This step is a step for separating extracellular vesicles and non-glycolytic isoflavones produced through the above culture and fermentation.

[0069] In one embodiment of the present invention, the separation of the extracellular vesicles may be accomplished using, but is not limited to, centrifugation, ultrafiltration, size exclusion chromatography, ion chromatography, or a combination thereof.

[0070] The above centrifugation method separates extracellular vesicles by utilizing differences in size and density.

[0071] The centrifugation method described above can utilize differential centrifugation or isopycnic centrifugation. Differential centrifugation refers to a method in which large cell debris and other impurities are first removed and then increasingly smaller vesicles are separated by gradually increasing the centrifugation speed. Typically, cell debris is removed at 2,000 g, microvesicles are removed at 10,000-20,000 g, and extracellular vesicles are separated at 100,000 g or higher. The isopycnic centrifugation method uses sugar or cesium iodide to form a density gradient, and then centrifugation is used to separate extracellular vesicles of different densities.

[0072] The above ultrafiltration method separates extracellular vesicles based on their size. Ultrafiltration uses a filter of a specific size to remove large particles and proteins, allowing only extracellular vesicles of the desired size to pass through.

[0073] Size-exclusion chromatography (SEC) separates extracellular vesicles using size-fractionating columns with different pore sizes. Smaller particles pass through the column at greater rates, while larger particles pass through more quickly and are separated.

[0074] Ion chromatography, a type of liquid chromatography, is a technique for qualitatively and quantitatively analyzing ionic substances in a solution. Ion chromatography techniques include ion exchange, ion exclusion, and reversed-phase ion pair chromatography.

[0075] In a specific embodiment of the present invention, the separation of the extracellular vesicles may be accomplished by obtaining a fraction having a molecular weight of 100 kDa or more through ultrafiltration.

[0076]

[0077] In one embodiment of the present invention, the separation of the non-glycosylated isoflavone may be accomplished using, but is not limited to, ultrafiltration, liquid-liquid extraction, solid phase extraction, HPLC, or a combination thereof.

[0078] The above ultrafiltration method allows molecules below a certain size to pass and filters out larger molecules, and can also be used to separate non-glycosylated isoflavones.

[0079] The molecular weight of isoflavones is typically around 200-300 daltons. To filter out other components, including molecules similar to or larger than isoflavones, an ultrafiltration membrane with a molecular weight of 1-5 kDa can be selected. Passing the filtrate of the fermented product through an ultrafiltration device allows low-molecular-weight compounds (including non-glycoside isoflavones) to pass through and high-molecular-weight substances to be filtered out, thereby removing impurities such as proteins and polysaccharides.

[0080] The above liquid-liquid extraction method is a method that uses an organic solvent to further purify the ultrafiltered filtrate. Any organic solvent suitable for separating isoflavones in the art can be used without limitation. Ethyl acetate can be used as the organic solvent. Specifically, the ultrafiltered filtrate is mixed with water and ethyl acetate to extract non-glycoside isoflavones into the organic layer, and the organic layer is collected and the organic solvent is evaporated using a rotary evaporator to obtain concentrated isoflavones.

[0081] The above solid-phase extraction (SPE) can be used for further purification and can selectively separate non-glycosylated isoflavones.

[0082] The above HPLC can be adopted as a method for quantifying and purifying non-glycosylated isoflavones.

[0083] As described above, the above processes can be adjusted depending on the composition and target purity of the fermented product, and may require multiple purification steps to obtain high purity non-glycoside isoflavones.

[0084] In a specific embodiment of the present invention, the separation of the non-glycosylated isoflavone may be accomplished by obtaining a fraction having a molecular weight of 5 kDa or less through ultrafiltration.

[0085]

[0086] Step (c): Mixing extracellular vesicles and non-glycosylated isoflavones.

[0087] The above step is a step of preparing the composition of the present invention by mixing the prepared extracellular vesicles and non-glycolytic isoflavones.

[0088]

[0089] The present invention relates to a method for producing Lactobacillus extracellular vesicles with increased aglycone isoflavone content and a hair loss prevention composition using the same. The Lactobacillus of the present invention enables the effective extraction of aglycone isoflavones contained in legumes through a fermentation process, and the extracellular vesicles secreted from Lactobacillus possess anti-inflammatory and immunomodulatory properties, thereby promoting scalp health and preventing hair loss. The extracellular vesicles are small in size and have excellent intercellular transport capabilities, enabling them to effectively penetrate deep into the skin and scalp. Furthermore, the extracellular vesicles exhibit high biocompatibility, resulting in fewer side effects and enabling safer use compared to existing chemical compositions.

[0090]

[0091] Figure 1 is a diagram showing the number of viable cells cultured at 37°C for 2 days under different glucose concentrations (0.5, 1.0, 3.0, and 5.0%) and initial pH conditions (pH 5.0, 5.5, 6.0, and 7.0) in a culture solution containing 5% soybeans to confirm the optimal conditions for culturing Lactobacillus rhamnosus of the present invention.

[0092] FIG. 2 is a diagram showing the results of sampling and measuring the number of viable cells, pH, and glucose at 4-hour intervals during inoculation of the Lactobacillus rhamnosus strain into a medium containing 5% soybean, 3% rice bran, and 1% glucose, and culturing at 37°C, 250 rpm, 0.5 vvm, and 40 hours to confirm the optimal conditions for culturing the Lactobacillus rhamnosus of the present invention.

[0093] Figure 3 is a diagram showing the proliferation rate when the composition of the present invention is treated on mammary papilla cells.

[0094] Figure 4 is a diagram showing the VEGF expression rate when the composition of the present invention is treated on mammary papilla cells.

[0095] Figure 5 is a diagram showing the a*-value (redness) of a test area subjected to physical stimulation before and after use of the product to confirm the scalp soothing effect of the composition of the present invention.

[0096] Figure 6 is a diagram showing the results of measuring the number of hair loss before and after use of the product to confirm the hair loss prevention effect of the composition of the present invention.

[0097]

[0098] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples, in accordance with the gist of the present invention.

[0099]

[0100] Example

[0101]

[0102] Throughout this specification, "%" used to indicate the concentration of a particular substance is (weight / weight) % for solid / solid, (weight / volume) % for solid / liquid, and (volume / volume) % for liquid / liquid, unless otherwise noted.

[0103]

[0104] Example 1: Selection of fermented material (soybean) and strain containing isoflavones

[0105] The inventors of the present invention compared the expected effects and contents of 7 types of natural soybeans (Gangnam soybeans, chickpeas, Seoritae, rat-eye beans, soybeans, white beans, and black beans) containing isoflavones by conducting research on theses, literature surveys, folk remedies, and internet searches, and selected 5 types of soybeans (soybeans, rat-eye beans, Seoritae, white beans, and black beans) as experimental subjects and subjected them to lactic acid bacteria application experiments.

[0106] The strains used in this fermentation experiment were six strains of the genus Lactobacillus, as shown in Table 1 below. The strains were supplied by Pohang Nodaji Village Co., Ltd. and Bambi Cola Co., Ltd., and a culture suitability test was conducted by applying them to soybeans, black beans, black soybeans, white beans, and black beans.

[0107] Lactobacillus spp. strain name strain characteristics mass fraction bacterial concentration Lactobacillus casei 16~20% 10 7 ~10 8 cfu / mLLactobacillus fermentum13~16%10 8 ~10 9 cfu / mLLactobacillus acidophilus 22-27%10 8 ~10 9 cfu / mL Lactobacillus rhamnosus 12-14% 10 8 ~10 9 cfu / mL Lactobacillus buchneri 18-22% 10 8 ~10 9 cfu / mL Lactobacillus plantarum 5-7% 10 7 ~10 8 cfu / mL

[0108] As a result, soybeans, soybeans, and black soybeans were confirmed to be suitable soybeans for culturing lactic acid bacteria, and the results of strains suitable for cultivation for each type of soybean are shown in Table 2.

[0109] Selection of 5 types of soybeans and strains suitable for cultivation completed. Soybean type. Suitable lactic acid bacteria. Soybean. Lactobacillus rhamnosus. Lactobacillus casei. Lactobacillus plantarum. Rat's eye soybean. Lactobacillus casei. Lactobacillus plantarum. Frost bean. Lactobacillus casei.

[0110] As shown in Table 2, in the case of soybeans, the cultivability was the best when Lactobacillus rhamnosus, Lactobacillus casei, and Lactobacillus plantarum strains were applied. In addition, in the case of soybeans, the cultivability was the best when Lactobacillus casei and Lactobacillus plantarum strains were applied, and in the case of seoritae, the cultivability was the best when Lactobacillus casei strain was applied.

[0111]

[0112] Example 2: Optimization of Lactobacillus Cultivation Conditions for Soybean Application

[0113] The present inventors conducted the following experiments to derive optimal conditions for culturing Lactobacillus using soybeans.

[0114]

[0115] 2-1. Optimization of Lactobacillus Cultivation Conditions for Soybean Application

[0116] First, raw materials were prepared by grinding soybeans into powder using a grinder and by grinding rice bran into fine powder using a grinder. 5.0% of the prepared soybean powder, 3.0% of rice bran powder, and 1.0% of glucose were added to deionized water, and the pH was adjusted to 5.5. 1 L of the above culture solution was added with or without 50 g of Trichoderma reesei-derived cellulase powder, and the reaction was performed at 45°C for 12 hours and 160 rpm, followed by sterilization at 121°C for 30 minutes. 5% of Lactobacillus rhamnosus was inoculated into the sterilized solution, and then cultured at 37°C for 2 days.

[0117] The results are shown in Table 3.

[0118] Before and after cellulase treatment, pH and viable cell count in culture medium Conditions pH Viable cell count in culture medium Cellulase untreated 2.5 3 1.80 X 10 9 CFU / mlCellulase treatment2.402.00 X 10 9 CFU / mL

[0119] As shown in Table 3, it was found that the pH in the culture medium of the cellulase-treated group was lower and the number of viable cells increased compared to the group without cellulase treatment. In addition, in order to confirm the optimal conditions for the cultivation of Lactobacillus rhamnosus, the concentration of nitrogen source (rice bran) (0.5, 1.0, 3.0, 5.0%) was changed in the culture medium containing 5% soybean, and the number of viable cells was confirmed by culturing at 37℃ for 2 days. As a result, the number of viable cells was 1.30 X 10 at a rice bran concentration of 3.0%. 9 It was confirmed as the most appropriate concentration by being confirmed as CFU / mL.

[0120]

[0121] In addition, in order to confirm the optimal conditions for culturing Lactobacillus rhamnosus, the culture solution containing 5% soybeans was cultured at 37°C for 2 days under different glucose concentrations (0.5, 1.0, 3.0, and 5.0%) and initial pH conditions (pH 5.0, 5.5, 6.0, and 7.0), and the number of viable cells was confirmed.

[0122] The results are shown in Fig. 1.

[0123] As shown in Figure 1, the optimal glucose concentration is 1.0%, and the number of viable cells is 8.90 X 10 8 It was confirmed as the most appropriate concentration by being confirmed as CFU / mL.

[0124] Finally, the culture conditions were set as 5% soybean, 1.0% glucose, 3.0% rice bran, initial pH 5.5, and cellulase enzyme treatment.

[0125]

[0126] 2-2. Results of Lactobacillus plantarum culture applied to soybeans

[0127] The Lactobacillus rhamnosus strain, which is applicable to soybeans, was cultured in a 5 L fermenter. The culture medium and conditions were as set in Example 2-1 above. The Lactobacillus rhamnosus strain was inoculated into a medium containing 5% soybeans, 3% rice bran, and 1% glucose, and cultured at 37°C, 250 rpm, 0.5 vvm, for 40 hours. After the completion of the culture, the viable cell count, pH, and glucose were sampled and measured at 4-hour intervals.

[0128] The results are shown in Fig. 2.

[0129] As shown in Fig. 2, the result of culturing in a 5L fermenter showed that the number of viable cells was 3.60 X 10 after 16 hours of cultivation. 9 It reached its maximum value of CFU / mL.

[0130]

[0131]

[0132] Example 3: Isolation of extracellular vesicles and analysis of isoflavone content in soybean-derived Lactobacillus culture solution.

[0133] The present inventors isolated extracellular vesicles from the soybean-applied Lactobacillus culture solution and analyzed the content of isoflavones.

[0134] Specifically, 50 g of Trichoderma reesei-derived Cellulase powder was added to 1 L of the Lactobacillus rhamnosus culture solution obtained in Example 2, and the enzyme reaction was performed at 45-55°C for 3-12 hours, followed by heat treatment at 121°C for 30 minutes to sterilize and remove cellulase activity. The culture solution was collected, centrifuged at 3000 g and 4°C for 30 minutes to remove bacterial cells, and the supernatant was obtained and filtered using a 0.22 μm filter. The filtered supernatant was ultrafiltered at 100 kDa to obtain extracellular vesicles from the supernatant, and the filtrate was further filtered using a 5 kDa ultrafiltration membrane to separate isoflavones. To analyze the isoflavone content, HPLC was used to confirm the contents of isoflavone glycosides and aglycones in the sample.

[0135] The results are shown in Table 4.

[0136] Isoflavone typeBefore fermentationResultAfter fermentationGenistin(mg / 100g)16.31Not detectedDaidzein(mg / 100g)4.7630.49Daidzin(mg / 100g)14.373.26Genistein(mg / 100g)4.7830.26Soy isoflavone (as non-glycosides)(mg / 100g)9.5470.99

[0137] As shown in Table 4, the content of isoflavones before and after fermentation and after separation of extracellular vesicles was compared, and the content of non-glycoside isoflavones, daidzein and genistein, significantly increased after fermentation.

[0138] In the following experiment, the fractions obtained through ultrafiltration were classified as follows and the effects of hair growth promotion, hair loss prevention, and scalp soothing were confirmed.

[0139] Comparative sample 1: Lactic acid bacteria lysate

[0140] Comparative sample 2: Lactic acid bacteria lysate fraction less than 5 kDa (isoflavone concentrate)

[0141] Comparative sample 3: Lactic acid bacteria lysate 5-100 kDa fraction

[0142] Comparative sample 4: Lactic acid bacteria lysate 100 kDa or larger fraction (extracellular vesicle concentrate)

[0143] Sample 1 of the present invention: Lactic acid bacteria lysate fraction of 5 kDa or less and 100 kDa or more

[0144]

[0145]

[0146] Example 4: Effect of the composition of the present invention on mammary papilla cells (in vitro)

[0147]

[0148] 4-1. Proliferation effect of mammary papilla cells

[0149] The cell proliferation effect was measured using Human Follicle Dermal Papilla cells (HFDPCs; CEFO, Korea). For the culture of HFDPCs, Human Dermal Papilla Basal Medium (CEFO, Korea) containing Supplements (CEFO, Korea), Penicillin & Streptomycin (CEFO, Korea) was used, and cultured at 37℃ in a 5% CO2 cell incubator.

[0150] Cell proliferation was measured using the water-soluble tetrazolium salt (WST-1) assay. Human mammary papilla cells were seeded at 1X10 in a 96-well plate. 4Cells were seeded per well and cultured for 24 hours. The test solution was administered at a concentration of 100 μg / ml, and the positive control, Minoxidil, was dissolved in PBS and treated at a concentration of 1 mM, and cultured for another 48 hours. Afterwards, 0.5% of the medium volume of WST-1 assay solution (EZ-CYTOX; DOGEN, Korea) was added, and the reaction was continued for an additional 0.5–1 hour at 37°C, and the absorbance was measured at 450 nm using a Microplate reader system. The reference absorbance was measured at 650 nm and the results were corrected.

[0151] The cell proliferation rate was calculated as a % by correcting it to the proliferation rate of the untreated control group (PBS-treated group), and Minoxidil, known to be effective in promoting the proliferation of breast papilla cells, was used as a positive control sample.

[0152] The results are shown in Fig. 3.

[0153] As shown in Figure 3, a higher effect on the proliferation of mammary papilla cells was observed when the fractions were treated by mixing isoflavones concentrated in 5 kDa or less and extracellular vesicles concentrated in 100 kDa or more.

[0154]

[0155] 4-2. Effect of promoting VEGF expression in breast papilla cells

[0156] The present inventors measured the gene expression effect of vascular endothelial growth factor (VEGF) in the above-mentioned mammary papilla cells using RT-PCR.

[0157] Specifically, mammary papilla cells were cultured for 24 hours in a 5% CO2 cell incubator at 37°C, and then the test sample was added at a concentration of 100 μg / ml and cultured for 18 hours. 1 ml of Trizol (Invitrogen, USA) was added to the cells to isolate RNA, quantify RNA at 260 nm, and then perform RT-PCR. RT-PCR was performed using SYBR TM It was performed using Green Master Mix (Applied Biosystems, USA) and StepOnePlus TM The expression of the corresponding gene was analyzed using M Systems software (Applied Biosystems, USA). The PCR reaction conditions were denaturation at 94°C for 12 minutes, followed by 40 cycles of denaturation (94°C, 30 seconds), annealing (60°C, 30 seconds), and polymerization (72°C, 30 seconds). The gene expression change was expressed as the relative expression level for β-actin gene expression. -△△Ct The analysis was performed using the method. The primer sequences used for real-time PCR are shown in Table 5.

[0158] Real-time PCR Primer Sequence GenePrimerSequence (5' to 3')VEGFForwardCTACCTCCACCATGCCAAGT (SEQ ID NO: 1)ReverseGCGAGTCTGTGTTTTTGCAG' (SEQ ID NO: 2)ß-actinForwardGGATTCCTATGTGGGCGACGA (SEQ ID NO: 3)ReverseCGCTCGGTGAGGATCTTCATG (SEQ ID NO: 4)

[0159] The results are shown in Fig. 4. As shown in Fig. 4, the <5 kDa fraction, which is an isoflavone concentrate, and the ≥100 kDa fraction, which is enriched in extracellular vesicles, showed an effect of increasing VEGF expression in dermal papilla cells. In addition, when the two fractions were mixed, a higher effect of dermal papilla cell proliferation was observed.

[0160]

[0161]

[0162] Example 5: Scalp soothing effect of the composition of the present invention (in vivo)

[0163] In order to confirm the scalp soothing effect of the composition of the present invention, the inventors of the present invention performed tape-stripping on the scalp of 20 test subjects 40-50 times to induce skin damage, and measured the extent of recovery of the damaged skin after using the sample of the present invention once. The sample was prepared as a shampoo formulation containing 0.5% each of the extracellular vesicles and isoflavones of the present invention, totaling 1%.

[0164] Measurements were taken using Antera 3D (Miravex Limited) of the test area before skin damage, immediately after damage, and after sample use, and the a*-value (redness) was analyzed using an image analysis program (Image-Pro). The lower the a*-value (redness), the more the damaged scalp was judged to have calmed down.

[0165] The results are shown in Fig. 5.

[0166] As shown in Figure 5, the redness, which had increased to 50.067 due to external stimulation, decreased to 19.690 after one use of the product, indicating that the product has a scalp soothing effect.

[0167]

[0168]

[0169] Example 6: Effect of the composition of the present invention on improving the number of hair loss (in vivo)

[0170] Twenty test subjects were tested and measured while using the shampoo product once a day for four weeks. The same shampoo product as that used in Example 5 was used, and before, two weeks after, and four weeks after using the product, the subjects were instructed to comb the scalp 20 times each on the center, left, and right sides with a hair brush (total of 60 times) and the hair loss was counted.

[0171] The results are shown in Fig. 6.

[0172] As a result, the number of hairs lost before using the product decreased from 17.8 to 2.6 after 4 weeks of using the product, showing that the product was effective in reducing hair loss.

Claims

1. A cosmetic composition for promoting hair growth or preventing hair loss, comprising a fermented extract of soybeans derived from lactic acid bacteria selected from the group consisting of soybeans, soybeans, and soybeans.

2. A cosmetic composition according to claim 1, wherein the lactic acid bacteria are lactic acid bacteria of the genus Lactobacillus.

3. A cosmetic composition according to claim 2, wherein the lactic acid bacteria of the genus Lactobacillus are selected from the group consisting of Lactobacillus rhamnosus, Lactobacillus casei, and Lactobacillus plantarum.

4. A cosmetic composition according to claim 1, wherein the fermented extract comprises an aglycone isoflavone selected from the group consisting of genistein, daidzein, and glycitein.

5. A cosmetic composition according to claim 1, wherein the fermented extract contains extracellular vesicles of lactic acid bacteria.

6. A cosmetic composition for soothing the scalp, comprising a fermented extract of soybeans derived from lactic acid bacteria selected from the group consisting of soybeans, soybeans, and soybeans.

7. A method for producing a soybean-derived lactic acid bacteria fermentation extract, comprising the following steps: (a) a step of inoculating lactic acid bacteria into a culture medium containing soybean powder selected from the group consisting of soybeans, black beans, and black peas, and cultivating the same; (b) a step of separating extracellular vesicles and non-glycolytic isoflavones derived from lactic acid bacteria from the culture; and (c) A step of mixing the extracellular vesicles and non-glycosylated isoflavones.

8. A manufacturing method according to claim 7, wherein the lactic acid bacteria are lactic acid bacteria of the genus Lactobacillus.

9. A manufacturing method according to claim 7, wherein the separation of the extracellular vesicles is performed using centrifugation, ultrafiltration, size exclusion chromatography, ion chromatography, or a combination thereof.

10. A manufacturing method in claim 7, wherein the separation of the non-glycosylated isoflavone is performed using ultrafiltration, liquid-liquid extraction, solid phase extraction, HPLC, or a combination thereof.

Images