Medical drain sensors and systems

Abstract

The technology described herein is directed to devices, systems, kits, and methods relating to detecting the contents and characteristics of a fluid in a medical drain.

Description

MEDICAL DRAIN SENSORS AND SYSTEMSCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit under 35 U.S.C. § 119 of U.S. Provisional Application No. 63 / 677,000 filed July 30. 2024, the contents of which are incorporated herein by reference in their entirety.SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on July 25, 2025. is named 002806-000137WOPT_SL.txt and is 7,824 bytes in size.TECHNICAL FIELD

[0003] The technology described herein relates to measuring and montoring the contents and characteristics of fluids in medical drains.BACKGROUND

[0004] Medical drains and catheters are frequently used for treatment of a number of conditions. For example, the external ventricular drain (EVD) system is routinely employed in the neurological intensive care unit (ICU) and serves as a temporary method for draining the excess cerebrospinal fluid (CSF) from the brain ventricles, where the excess CSF is accumulated. Despite the popularity of these devices, their used carries a notable risk of risk of infection. Failure to promptly identify and treat infections can result in exacerbating consequences, prolonged treatment, and escalated healthcare costs. Such systems can also experience mechanical failure and blockage.

[0005] Existing approaches for detecting infections require clinical observation of patient systems or providing samples to medical laboratories. These approaches are slow and labor-intensive.SUMMARY

[0006] The inventors have designed and tested drain sensors that provide non-invasive and continuous monitoring of drain fluid, e.g., to detect infection or drain failure. The devices described herein, with integrated flow7sensors promptly alert healthcare providers to failures and changes patient status.

[0007] In one aspect of any of the embodiments, described herein is a drain sensor comprising: a) at least one fluid channel comprising an inflow port and an outflow port; and b) at least one sensing element in fluid communication with the fluid channel between the inflow port and outflow port; wherein each of the at least one sensing elements is: i) a constituent sensing element that detects a constituent of a fluid, the constituent sensing element comprising: a) a working electrode comprising a constituent-responsive element.b) a reference electrode, and c) a counter electrode; or ii) a flow rate sensing element that detects a flow rate of a fluid, the flow rate sensing element comprising: a) a heater element; b) a pair of sensing electrodes, wherein the heater is located closer to an end of the fluid channel connected to the inflow port than the pair of sensing electrodes.

[0008] In some embodiments of any of the aspects, each of the working electrode, the reference electrode, and the counter electrode is in fluid communication with the fluid channel.

[0009] In some embodiments of any of the aspects, the constituent is a biomolecule and the constituent-responsive element comprises: a moiety that binds to the working electrode, a moiety that binds specifically to the biomolecule constituent, and a moiety comprising a redox reporter. In some embodiments of any of the aspects, the moiety that binds to the working electrode is a thiol and the working electrode comprises gold, platinum, iridum, and / or stainless steel. In some embodiments of any of the aspects, the moiety that binds to the working electrode is a thiol and the working electrode comprises gold. In some embodiments of any of the aspects, the moiety that binds specifically to the biomolecule constituent is an aptamer. In some embodiments of any of the aspects, the moiety' comprising a redox reporter comprises methylene blue, ferrocene, anthraquinone, viologen, Atto MB2, and / or Nile Blue. In some embodiments of any of the aspects, the moiety' comprising a redox reporter comprises methylene blue.

[0010] In some embodiments of any of the aspects, the constituent is H+and the constituent- responsive element comprises a pH responsive material. In some embodiments of any of the aspects, the pH responsive material comprises polydopamine, poly (methacrylic acid) (PMAAc), poly [(2- dimethylamino)ethyl methacrylate] (PDMA), poly(2-acrylamido-2-methylpropane sulfonic acid) (PAMPS) and poly(4-sty renesulfonic acid) (PSSA), Polyacrylic acid (PAA), PVA or PVBA, Polyvinyl benzoic acid, Polyvinyl acid, poly(L-glutamic acid) PLGA, Alginic acid, Hyaluroinic acid (HA), or a combination thereof. In some embodiments of any of the aspects, the pH responsive material comprises polydopamine. In some embodiments of any of the aspects, the pH responsive material comprises a poly dopamine film. In some embodiments of any of the aspects, the pH responsive material comprises a coating on the working electrode.

[0011] In some embodiments of any of the aspects, the working electrode of the constituent sensing element comprises gold. In some embodiments of any of the aspects, the reference electrode of the constituent sensing element comprises gold. In some embodiments of any of the aspects, the counter electrode of the constituent sensing element comprises silver and silver chloride.

[0012] In some embodiments of any of the aspects, each of the pair of sensing electrodes is in fluid communication with the fluid channel.

[0013] In some embodiments of any of the aspects, the heater element is in fluid communication with the fluid channel. In some embodiments of any of the aspects, the heater element is not in fluid communication with the fluid channel. In some embodiments of any of the aspects, the heater element is in thermal communication with the fluid channel. In some embodiments of any of the aspects, the heater element is an electrical heater element. In some embodiments of any of the aspects, the electrical heater element comprises copper. In some embodiments of any of the aspects, the electrical heater element is serpentine in shape. In some embodiments of any of the aspects, the heater element and pair of sensing electrodes are attached to a flexible polymer base. In some embodiments of any of the aspects, the flexible polymer base comprises polyamide. In some embodiments of any of the aspects, the heater element is located at least 1 mm closer to the inflow port than the pair of sensing electrodes. In some embodiments of any of the aspects, the heater element is located about 1 mm closer to the inflow port than the pair of sensing electrodes.

[0014] In some embodiments of any of the aspects, the at least one sensing element collectively detects one or more of: lactate, glucose, glucose ratio, pH, and flow rate.In some embodiments of any of the aspects, the aptamer that binds specifically to glucose comprises: ACGACCGTGTGTGTTGCTCTGTAACAGTGTCCATTGTCGT (SEQ ID NO: 1).In some embodiments of any of the aspects, a sensing element that detects lactate comprises: GACGACGAGTAGCGCGTATGAATGCTTTTCTATGGAGTCGTC (SEQ ID NO:2), or GACGACGCAGGGAGTTTTAACGGCTCTTGCGACTGTGTCGTC (SEQ ID NO: 3).

[0015] In some embodiments of any of the aspects, the drain sensor further comprises a hydrogel in the fluid channel and in contact with the working electrode. In some embodiments of any of the aspects, the hydrogel comprises agarose, polyacrylamide, cellulose, cellulose acetate, agar, sephadex. chitosan, alignate, and / or collagen. In some embodiments of any of the aspects, the hy drogel is an agarose hydrogel. In some embodiments of any of the aspects, the hy drogel is a l%-5% hydrogel. In some embodiments of any of the aspects, the hydrogel further comprises one or more DNAse inhibitors. In some embodiments of any of the aspects, the one or more DNAse inhibitors comprises rutin.

[0016] In some embodiments of any of the aspects, the drain sensor comprises a plurality of sensing elements. In some embodiments of any of the aspects, the plurality of sensing elements are arranged in series. In some embodiments of any of the aspects, the plurality of sensing elements are arranged in parallel. In some embodiments of any of the aspects, the drain sensor comprises a plurality of constituent sensing elements, each constituent sensing element detecting a different constituent of the fluid. In some embodiments of any of the aspects, the drain sensor comprises a flow rate sensing element and at least one constituent sensing element. In some embodiments of any of theaspects, the drain sensor comprises a flow rate sensing element and a plurality of constituent sensing elements, each constituent sensing element detecting a different constituent of the fluid.

[0017] In some embodiments of any of the aspects, the inflow port and / or the outflow port is configured to attach to a drain and / or catheter tube.

[0018] In some embodiments of any of the aspects, the fluid charnel and at least one sensing element are provided in a housing unit. In some embodiments of any of the aspects, the housing unit comprises a biocompatible resin.

[0019] In some embodiments of any of the aspects, the drain sensor is provided in a catheter tube or is permanently affixed to a catheter tube. In some embodiments of any of the aspects, the drain sensor is provided in a drain or is permanently affixed to a drain. In some embodiments of any of the aspects, the drain is an internal ventricular drain, an external ventricular drain, a shunt, a cerebral shunt, a cerebrospinal fluid shunt, a lumbar-peritoneal shunt, a peritoneovenous shunt, a passive drain (e.g., a penrose drain), a urinary catheter, a chest tube or thoracostomy catheter, an abdominal drain (e.g., Jackson-Pratt or Blake drain), a central venous catheter, a biliary drain, a nephrostomy drain, a gastrointestinal drain, a gastrointestinal drain, a peritoneal catheter, a wound drain, a sump drain, a hemovac drain, a silicone drain, a redon drain, a pleural drain, a pigtail catheter connected to any bodily cavity and comprising an external portion, a pancreastic drain, a drain connected to a vacuum, an indwelling catheter, and a thoracostomy tube.

[0020] In some embodiments of any of the aspects, the drain sensor further comprises a transmitter or transceiver. In some embodiments of any of the aspects, the drain sensor further comprises a wired transmitter or wired transceiver. In some embodiments of any of the aspects, the drain sensor further comprises a wireless transmitter or wireless transceiver. In some embodiments of any of the aspects, the transmitter or transceiver transmit a signal. In some embodiments of any of the aspects, the the signal comprises the current, voltage, and / or impedance detected by the at least one sensing element.

[0021] In one aspect of any of the embodiments, described herein is a drain monitoring sy stem, comprising a drain sensor as described herein and further comprising a controller.

[0022] In some embodiments of any of the aspects, the controller receives a signal from the at least one sensing element and is configured to calculate the concentration or magnitude of the analyte and / or characteristic from the signal. In some embodiments of any of the aspects, the calculation is based on one or more standards or calibration curves. In some embodiments of any of the aspects, the calculation is based on kinetic differential measurements.

[0023] In some embodiments of any of the aspects, the controller is wirelessly connected to the drain sensor. In some embodiments of any of the aspects, the drain monitoring system further comprises a wired connection between the controller and the drain sensor.In some embodiments of any of the aspects, the dram monitoring system further comprises a display.

[0024] In some embodiments of any of the aspects, the controller is configured to provide an alert if the drain sensor detects i) a specified level or change in a level of constituent and / or the flow rate; and / or ii) a disconnection or a loss of power. In some embodiments of any of the aspects, the controller is configured to transmit a signal to a drain pump or valve if the drain sensor detects a specified level or change in a level of constituent and / or the flow rate.

[0025] In some embodiments of any of the aspects, the drain sensor is located outside of a patient's body and / or configmed to be located outside of a patient’s body. In some embodiments of any of the aspects, the dram sensor is located or attached to an external portion of a drain 51 and / or configured to be located in or attached to an external portion of a drain 51. In some embodiments of any of the aspects, the dram sensor is located or attached to percutaneous port and / or configmed to be located in or attached to an percutaneous port. In some embodiments of any of the aspects, the drain sensor comprising a wireless transmitter or wireless transceiver is located inside of a patient’s body and / or configured to be located inside of a patient’s body. In some embodiments of any of the aspects, the drain sensor is located inside of a patient’s body and / or configmed to be located inside of a patient’s body.

[0026] In one aspect of any of the embodiments, described herein is a kit comprising the drain sensor and / or drain monitoring system described herein and one or more of: one or more drains; one or more catheter tubes; and one or more collection bags. In some embodiments of any of the aspects, the one or more drains are selected from the group consisting of: an internal ventricular drain, an external ventricular drain, a shunt, a cerebral shunt, a cerebrospinal fluid shunt, a hunbar-peritoneal shunt, a peritoneovenous shunt, a passive drain (e.g., a penrose drain), a urinary catheter, a chest tube or thoracostomy catheter, an abdominal drain (e.g., Jackson-Pratt or Blake drain), a central venous catheter, a biliary drain, a nephrostomy drain, a gastrointestinal drain, a gastrointestinal drain, a peritoneal catheter, a woimd drain, a sump drain, a hemovac drain, a silicone drain, a redon drain, a pleural drain, a pigtail catheter comrected to any bodily cavity and comprising an external portion, a pancreastic drain, a dram connected to a vacuum, an indwelling catheter, and a thoracostomy tube.BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figs. 1A-1C depict die implementation and functionality of embodiments of the devices and / or systems described herein, facilitating real-time and continuous cerebrospinal fluid (CSF) monitoring. Fig. 1 A depicts an embodiment of the EVD NeuroSense box housing sensors for flow rate, glucose, lactate, and pH, connecting directly to the EVD catheter to detect these clinical markers in real-time. Fig. IB depicts a schematic of the collected data then being displayed on a monitor, offering insights into biomarker values, and issuing alerts in the event of concerning deviations.

[0028] Figs. 2A-2G depict the fabrication and sensing strategies employed for exemplary embodiments of each of the glucose, lactate, pH, and floe sensors. Fig. 2A depicts a schematic illustrating the fabrication (i) and mechanism of target sensing (ii) for glucose and lactate aptasensors.Figures illustrating die response of the glucose sensor (Fig. 2B) and lactate sensor (Fig. 2C) to vary ing concentrations of glucose and lactate. Fig. 2D depicts a schematic depicting the fabrication (i) and sensing mechanism (ii) of die PDA-based pH sensor. Fig. 2E represents the response of the sensor to different levels of pH. Fig. 2F depicts a schematic showing the fabrication (i), and sensing mechanism (ii) for the flow sensor. Fig. 2G depicts the response of the flow sensor to different flow rates.

[0029] Figs. 3A-3D depict the baseline and modified scan-based and time-resolved stability of the fabricated sensors. Schematic illustrating the mechanism of sensor degradation in the absence (Fig. 3A) and presence (Fig. 3B) of agarose coating. Fig. 3C shows the signal change% in glucose lactate, pH, and flow sensors in response to after subjecting them to multiple scans with tested levels of biomarkers being 5mM for glucose, 2mM for lactate, pH value of 7.3, and flow rate of 160 pL / min and. (Signal Change% = Sensor’s response at each scan - Sensor’s response at first scan / Sensor’s response at first scan). Fig. 3D shows the signal change % associated with glucose, lactate, and pH sensors over time in agarose coated and non-coated sensors. The error bar represents the standard deviation (SD), and line is a connecting line.

[0030] Figs. 4A-4F depict the performance of all sensors in the EVD NeuroSense box exemplary embodiment and during flow. Fig. 4A is a schematic showing the steps that involves in the fabrication of the EVD NeuroSense device (i), and pictures showing the set-up simulating CSF flow' via catheters (ii). Figures showing the response of glucose (Fig. 4B). lactate (Fig. 4C), pH (Fig. 4D), and flow (Fig. 4E) sensors to varying concentrations of their respective targets while CSF is flow ing through the EVD NeuroSense box. The dots represent each data point and the line shows the fit line. Fig. 4F depicts the single-plexed detection of the biomarkers.

[0031] Figs. 5-6 depict exemplary schematics of drain sensors described herein.

[0032] Figs. 7A-7B depict time-resolved stability.

[0033] Fig. 8A depicts a schematic illustrating the fabrication (i) and mechanism of target sensing (ii) for IL-6. Fig. 8B depicts the response of the IL-6 sensor to vary ing concentrations of IL-6.

[0034] Figs. 9A-9B depict schematic illustrations of exemplary' embodiments of a constituent sensing element.

[0035] Figs. 10A-10B depict schematic illustrations of implementation and functionality' of the NeuroSense system, permitting real-time and continuous cerebrospinal fluid (CSF) monitoring, compared to conventional methods. (Fig. 10A) The EVD system is connected to the neuropathological patients who require CSF drainage. Current conventional methods for monitoring CSF and EVD patency involve manual CSF collection, transportation to clinical laboratories, sample processing and analysis, and subsequent reporting of results for clinical decision-making. This process often takes over 48 horns, potentially delaying timely treatment. (Fig. 10B) The NeuroSense system addresses these limitations by integrating directly into EVD catheters, enabling in-line CSF collection and real-time analysis. The system provides continuous, real-time data collection (i). It includessensors for glucose, lactate, pH, and flow rate, allowing multiplexed monitoring of these (bio)markcrs (ii). Each sensor has a distinct mechanism for sensing its target of interest, but eventually all sensors translate the changes in their respective targets to an electrochemical signal, which reports the level of the targets, alerting care providers in the event of concerning deviations (iii). The schematics were created using BIORENDER™.

[0036] Figs. 11 A-l 1H depict fabrication and sensing strategies for glucose, lactate, pH, and flow sensors. (Fig. 11 A) Schematic diagrams illustrating the fabrication process (i) and sensing mechanism (ii) of the glucose and lactate EABs. (Fig. 11B) Glucose EAB response to varying glucose concentrations with R2values for the non-linear fits of 0.80 and (Fig. 11C) its associated specificity test. (Fig. 11D) Lactate EAB response to varying glucose concentrations with R2values for the nonlinear fits of 0.83 and (Fig. 1 IE) its associated specificity test. Normalized KDM = (KDMtarget - KDMblank) KDMblank . The concentrations of non-specific and specific targets used for specificity tests corresponds to the physiological levels present in the CSF which are 150 mM, 1.5 mM. 3 mM, 100 pM, 1.4 mM, 0.2 mM, 2mM and 5 mM for Na+ , Mg2+ , K+ , creatinine, Ca2+ , albumin, lactate, and glucose, respectively. The result for one-way ANOVA (a = 0.05) was found significant (P < 0.05), and the post hoc Bonferroni test also presented significant differences in the response to the specific targets compared to the non-specific ones where the significances are shown in GP style (0.1234 (ns). 0.0332 (*), 0.0021 (**), 0.0002 (*** ), p < 0.0001 (**** )). (Fig. 1 IF) Schematic diagrams showing the fabrication process (i)and sensing mechanism (ii) of the PDA-based pH sensor. (Fig. 11G) Response of the pH sensor to different pH levels, with an R2value of 0.84 for the linear fit (P < 0.0001). (Fig. 11H) Schematic diagrams illustrating the fabrication process (i) and sensing mechanism (ii) of the flow sensor. (Fig. 1 II) Response of the flow sensor to varying flow rates, with an R2value of 0.91 for the linear fit (P < 0.0001). All data points represent the mean values, with error bars indicating standard deviation (SD) (n > 3). The schematics were created using BIORENDER™.

[0037] Figs. 12A-12M depict the evaluation and improvement of sensor stability under different conditions. Schematic illustrating the mechanism of sensor degradation in the absence (Fig. 12A) and presence of agarose coating (Fig. 12B). Figures displaying the stability of baseline and modified glucose (Fig. 12C), lactate (Fig. 12D), pH (Fig. 12E), and flow (Fig. 12F) sensors incubated in hCSF for up to 21 days. Signal change (%)= ((Sensor response dayx - Sensor response da O) / Sensor responsedayO)) x 100. Figures representing the signal change (%) of sensors subjected to multiple scans for glucose (Fig. 12G). lactate (Fig. 12H), pH (Fig. 121), and flow (Fig. 12J) sensors in noncoated and agarose-coated conditions. Signal change (%)= ((Sensor response scanx - Sensor responsescan 1) / Sensor response scanl)) x 100. The hCSF in both time-based and scan-based stability experiment was spiked with 5 mM of glucose and 2 mM of lactate. The pH of hCSF was 7.8. and tested flow rate was 0.16 mL / min. Figures illustrating the shelf-life stability7of glucose (Fig.12K), lactate (Fig. 12L), and pH (Fig. 12M) sensors up to 30 days post fabrication where the sensorshave been fabricated and packaged, then at each test day the package was open and the experiment was performed in aCSF spiked with 5 mM glucose (for glucose EAB), 2 rnM lactate (for lactate E B), and pH 7.5 (for pH sensor) throughout the 30 days. The error bar represents the SD with n>3. The schematics were created using BIORENDER™.

[0038] Figs. 13A-13F depict performance of the non-sterilized (baseline) and ETO-sterilized NeuroSense in detecting targets under both single-plexed and multiplexed conditions. (Fig. 13 A) Experimental setup for in vitro validation of the Nemo Sense, designed to simulate CSF flow through EVD catheters. Sensor responses for glucose (fig. 13B), lactate (Fig. 13C), pH (Fig. 13D), and flow rate (fig. 13E) to varying levels of their respective targets under baseline and ETO-sterilized conditions, with aCSF flowing through the NeuroSense. The normalized signal for glucose and lactate represents the normalized KDM. calculated as ((KDM - KDMblank) / KDMblank)) . The line displays the linear fit for the baseline and ETO Sterilized sensors, with R2 of 0.9 and 0.95. 0.93 and 0.94, 0.9 and 0.91. and 0.97 and 0.98 for the glucose, lactate. pH. and flow sensors, respectively. Graphs display mean values, and error bars indicate SD with n>3. (Fig. 13F) Performance table showing the detection of multiple analytes at physiological and pathological levels. The "Spiked" column indicates the concentration of each analyte introduced into aCSF, while the "Interpolated" column reports the detected levels (mean ±STD, n > 3) (F). Recovery (%)=(Interpolated level (mM) / Introduced levels (mM)) x 100.

[0039] Figs. 14A-14P depict the evaluation of the NeuroSense for monitoring patients with EVD in intensive care unit. (Fig. 14A) Images illustrate the integration of the NeuroSense with the EVD catheter (i) and the individual components of the device (ii). Graphs show the Pearson correlation between the clinical reference measurements and the NeuroSense for glucose (Fig. 14B), lactate (Fig. 14C) , pH (Fig. 14D), and flow rate (Fig. 14E), with correlation coefficients (r) of 0.97, 0.965, 0.87, and 0.98, respectively (P < 0.0001). Time-course graphs display changes in glucose (Fig. 14F), lactate (Fig. 14G), pH (Fig. 14H), and flow rate (Fig. 141) levels for Patient#2 over a 14-day monitoring period. Data points represent the mean (n > 3 scans) with SD as error bars, and lines comiect the data points. Graphs represent fluctuations in glucose (Fig. 14J), lactate (Fig. 14K), pH (Fig. 14L). and flow rate (Fig. 14M) levels for Patient#2 over a 24-hour period, with measurements taken at 4-hour intervals. (Fig. 14N) The data is presented as the mean (n > 3 scans) with SD as error bars, and comrecting lines illustrate trends. Mean absolute relative difference (MARD %) was calculated as ((NeuroSense measurement - clinical measurement) / clinical measurement) x 100 and was used to assess the accuracy of the NeuroSense. Shaded areas indicate a ±10% range, and the dashed line connects the points. Bar graphs show glucose (Fig. 140) and lactate (Fig. 14P) levels for all patients and for Patient #2 on different days. Dashed lines represent the nonnal ranges of CSF glucose and lactate. Bars indicate the mean and error bars represent the SD.

[0040] Figs. 15A-15B depict CV curves of the pH sensor. (Fig. 15 A) CV of a bare gold electrode (dashed line) and pH sensor (solid line) tested in acetic acid at pH 5.0. The oxidation peak of the PDA-coated pH sensor is outlined in dashed line circle, and no relevant peak is observed for the bare electrode. (Fig. 15B) The CV scans of the pH sensor in aCSF with varying pH.

[0041] Fig. 16 depicts the changes in impedance over time at varying flow rates.

[0042] Fig. 17 depicts a schematic illustrating Hie fabrication process of the NeuroSense sensing boxes.

[0043] Figs. 18A-18F depict in-patient validation of Hie NeuroSense in Patient#5 and #6. Timecourse graphs display changes in glucose, lactate, pH in pateint#5 (top row. Figs. 18A-18C) and patient#6 (bottom row. Fig. 18D-18F).

[0044] Fig. 19 depicts EVD NeuroSense component description. Table representing the components that form the EVD NeuroSense and the materials they have been made of WE: Working electrode. RE: reference electrode, and CE: counter electrode.DETAILED DESCRIPTION

[0045] Current technologies for monitoring performance of medical drains, and the emergence of infections in patients with medical drains are slow and labor-intensive, often requiring days to obtain test results. Particularly in the case of ICU patients, 48 hour delays in diagnosis are dangerous and carry grave risks of treatment failure or devastating complications. Additionally, many biomarkers of infection currently require highly invasive testing procedures. For example, in CSF, lactate, glucose, and pH are all valuable indicators of infection or other conditions. However, achieving accurate glucose, lactate, and / or pH measurement often necessitates the averaging of multiple lumbar punctures, a procedure associated with an inherent risk of infection.

[0046] Described herein are drain sensors and systems that can provide real-time, continuous moni toring of the drain fluid flow, detecting both markers such as glucose, lactate, and / or pH as well as flow rates that reflect drain function. The sensors described herein provide quantitative, immediate outputs and patient status information, reducing labor, tune, and costs necessary while providing much earlier detection of an array of possible problems or complications in drain patients.

[0047] In one aspect of any one of the embodiments, described herein is a drain sensor 100 comprising: a) at least one fluid channel 10 comprising an inflow port 11 and an outflow port 12; and b) at least one sensing element 20 in fluid communication with the fluid channel 10 between the inflow port 11 and outflow port 12; wherein each of the at least one sensing elements 20 is: i) a constituent sensing element 30 that detects a constituent of a fluid, the constituent sensing element 30 comprising:a) a working electrode 31 comprising a constituent-responsive element 32, b) a reference electrode 33, and c) a counter electrode 34; or ii) a flow rate sensing element 40 that detects a flow rate of a fluid, the flow rate sensing element 40 comprising: c) a heater element 41 ; d) a pair of sensing electrodes 42, wherein the heater is located closer to an end of the fluid channel 10 connected to the inflow port 11 than the pair of sensing electrodes 42.

[0048] As used herein, “drain” refers to device that creates a channel from a biological site or cavity (the proximal end of the drain) to a destination site or cavity (the distal end of the drain). A drain can take, at least in part, the form of a tube or catheter. Drains are typically used to remove fluids from the biological site or cavity to avoid undesired fluid accumulation. The destination site or cavity can be a second site or cavity' in a subject (e.g., an internal drain), or an external site such as collection container (e.g.. an external drain). Drains can be passive or active, e.g., by use of vacuums. Drains are well known in the art and exemplary drains are discussed elsewhere herein.

[0049] As used herein, “drain sensor” refers to a device that can be placed, or is in communication with, the channel of a drain such that the fluid in the drain channel contacts the fluid channel 10 of the drain sensor 100 and one or more aspects of the fluid in the drain channel can be detected by the drain sensor 100. A drain sensor as described herein comprises at least one fluid channel 10, comprising an inflow port 11 and an outflow port 12. Illustrative embodiments are shown in Figs. 5, 6. and 7.

[0050] As used herein, the term “channel” refers to any pathways (whether straight, curved, single, multiple, in a network, etc.) through a medium (e g., substrate) that allow for movement of liquids and / or gasses. A channel can be a capillary, channel, tube, or groove that is deposed within or upon a medium or substrate. A channel can be a microchannel; i.e. a channel that is sized for passing through microvolumes of liquid. Channels can connect other components, i.e., keep components "in communication" and more particularly, "in fluidic communication."

[0051] In some embodiments of any of the aspects, the drain sensor 100 comprises one fluid channel 10. In some embodiments of any of the aspects, the drain sensor 100 comprises tw o fluid channels 10. In some embodiments of any of the aspects, the drain sensor 100 comprises three fluid channels 10. In some embodiments of any of the aspects, the drain sensor 100 comprises four fluid channels 10. In some embodiments of any of the aspects, the drain sensor 100 comprises five fluid channels 10. In some embodiments of any of the aspects, the drain sensor 100 comprises six fluid channels 10. In some embodiments of any of the aspects, the drain sensor 100 comprises at least sixfluid channels 10. In some embodiments of any of the aspects, the drain sensor 100 comprises a plurality of fluid channels 10.

[0052] As used herein, the term “port” refers to a portion of a drain sensor 100 described herein which provides a means for fluid to enter and / or exit a fluid channel 10. The port can be of a size and shape to accept and / or secure a connection with tubes, comiections. or adaptors of a drain and allow passage of fluid when attached to the drain. Ports for such uses are known in the art and can include luer locks, luer slips, graduated adaptors, stepped connectors, T-connectors. and the like. When reference is made to an inflow port 11 and an outflow port. 12 the inflow port 11 and outflow port 12are arranged such that fluid entering the inflow port 11 can pass through at least a portion of the fluid channel 10 before exiting through the outflow port 12.

[0053] A drain sensor 100 as described herein further comprises at least one sensing element 20 in fluid communication with the fluid channel 10, between the inflow port 11 and outflow port 12.

[0054] As used herein, “sensing element” refers to an element, component, or portion of the drain sensor 100 that can detect a constituent or characteristic of a fluid in the fluid channel 10. Specific configurations of sensing elements 20 are described further herein.

[0055] As used herein, “detect” refers to identifying the presence, absence, and / or amount of the object, constituent, and / or characteristic to be detected. Detection can be qualitative or quantitative. In some embodiments of any of the aspects, detection comprises measuring.

[0056] As used herein, “in communication” refers to any form of interaction between two or more elements or entities, including mechanical, electrical, magnetic, electromagnetic, fluidic, and thermal interaction. Being in communication does not require direct physical touching or contact of the two elements or entities. In some embodiments of any of the aspects, the communication is fluid communication, e.g., fluid in or at a first element / entity / location is able to travel or traverse to a second element / entity / location. In some embodiments of any of the aspects, the communication is thermal communication, e.g., heat or thermal energy in or at a first element / entity / location is able to be convey ed to or raise the temperature at a second element / entity / location. In some embodiments, tw o elements / entities which are in communication, are in contact with each other. As used herein, “in contact with” means that two elements / entities are physically arranged such that the elements / entities themselves are touching, e.g., at least one surface of each element / entity are touching or forming a junction.

[0057] In some embodiments of any of the aspects, a drain sensor 100 as described herein comprises one sensing element 20. In some embodiments of any of the aspects, a drain sensor 100 as described herein comprises two sensing elements 20. In some embodiments of any of the aspects, a drain sensor 100 as described herein comprises three sensing elements 20. In some embodiments of any of the aspects, a drain sensor 100 as described herein comprises four sensing elements 20. In some embodiments of any of the aspects, a drain sensor 100 as described herein comprises fivesensing elements 20. In some embodiments of any of the aspects, a drain sensor 100 as described herein comprises six sensing elements 20. In some embodiments of any of the aspects, a drain sensor 100 as described herein comprises at least six sensing elements 20. In some embodiments of any of the aspects, a drain sensor 100 as described herein comprises a plurality of sensing elements 20.

[0058] In some embodiments of any of the aspects, wherein the drain sensor 100 comprises more than one sensing element 20 (e.g.. a plurality of sensing elements), the sensing elements 20 can be arranged in parallel, e.g., with respect to fluid flow through the sensing elements. In such embodiments, the fluid channel 10 can be bifurcated. Alternatively or in addition, the drain sensor 100 can comprise two or more fluid channels 10, each comprising an inflow port 11 and outflow port 12.

[0059] In some embodiments of any of the aspects, wherein the drain sensor 100 comprises more than one sensing element 20 (e.g., a plurality of sensing elements), the sensing elements 20 can be arranged in series, e.g., with respect to fluid flow through the sensing elements 20. In such embodiments, the more than one sensing elements 20 can be arranged in a singular fluid channel 10.

[0060] In some embodiments of any of the aspects, described herein is a drain sensor 100 comprising: a fluid channel 10 comprising an inflow port 11 and an outflow port 12; and a sensing element 20 in fluid communication with the fluid channel 10 between the inflow port 11 and outflow port 12.

[0061] In some embodiments of any of the aspects, described herein is a drain sensor 100 comprising: a fluid chamrel 10 comprising an inflow port 11 and an outflow port 12; and a plurality of sensing elements 20 in fluid communication with the fluid channel 10 between the inflow port 11 and outflow port 12, wherein the plurality of sensing elements 20 is arranged in series with respect to each other.

[0062] In some embodiments of any of the aspects, described herein is a drain sensor 100 comprising: a plurality of fluid channels 10, each fluid chamrel 10 comprising an inflow port 11 and an outflow port 12; and a plurality' of sensing elements 20 in fluid communication with the fluid channel 10 between the inflow port 11 and outflow port 12, wherein each fluid channel 10 comprises one sensing element 20, and wherein the plurality of sensing elements 20 is arranged in parallel with respect to each other.

[0063] In some embodiments of any of the aspects, a fluid channel 10 can be bifurcated, e.g., after the inflow port 11, the fluid channel 10 splits into two parallel fluid channels 10. In some embodiments of any of the aspects, a fluid channel 10 can be bifurcated, e.g., after the inflow port 11, the fluid channel 10 splits into two parallel fluid channels 10 and the two parallel fluid channels 10 each tenninate at a different outflow port 12. In some embodiments of any of the aspects, a fluid channel 10 can be bifurcated, e.g., after the inflow port 11. the fluid channel 10 splits into two parallelfluid channels 10 and the two parallel fluid channels 10 then merge before the fluid channel 10 terminates at a single outflow port 12.

[0064] Multiple types of sensing elements 20 are described herein, e g., constituent sensing elements 30 and flow rate sensing elements 40.

[0065] As described herein, a constituent sensing element 30 is a sensing element that detects a constituent of a fluid. As used herein, “constituent” refers to physical entity, element, or molecule that is present in a fluid. Exemplary constituents comprise biomolecules, salts, ions, small molecules, drugs, proteins, fats, dissolved gasses, and the like. In some embodiments of any of the aspects, the constituent comprises a salt. In some embodiments of any of the aspects, the constituent comprises an ion. In some embodiments of any of the aspects, the constituent comprises a small molecule. In some embodiments of any of the aspects, the constituent comprises a drug. In some embodiments of any of the aspects, the constituent comprises a protein. In some embodiments of any of the aspects, the constituent comprises a fat. In some embodiments of any of the aspects, the constituent comprises a dissolved gas.

[0066] In some embodiments of any of the aspects, a constituent comprises a biomolecule. In some embodiments of any of the aspects, a constituent is a biomolecule. As used herein, “biomolecule” refers to refers to any molecule that is part of, produced by. or from a living organism. Exemplary biomolecules include chemicals; small organic or inorganic molecules; signaling molecules; nucleic acids; nucleic acid analogues; proteins; peptides; enzymes; aptamers; peptidomimetic, peptide derivative, peptide analogs, antibodies; intrabodies; biological macromolecules, extracts made from biological materials such as bacteria, plants, fungi, or animal cells or tissues; and functional fragments of the foregoing. In some embodiments of any of the aspects, the biomolecule is a protein or polypeptide. In some embodiments of any of the aspects, the biomolecule is a nucleic acid. In some embodiments of any of the aspects, the biomolecule is a polysaccharide. In some embodiments of any of the aspects, the biomolecule is a sugar. In some embodiments of any of the aspects, the biomolecule is a carboxylic acid and / or conjugate base thereof.

[0067] In embodiments of drain sensors 100 comprising multiple sensing elements 20, each sensing element 20 can detect a different constituent of a fluid. In embodiments of drain sensors 100 comprising multiple sensing elements 20, the drain sensor 100 can detect different constituents of a fluid. In some embodiments of any of the aspects, a drain sensor 100 comprises a plurality of sensing elements 20 and more than one of the sensing elements 20 detects the same constituent of a fluid, e.g., to provide redundancy.

[0068] In some embodiments of any of the aspects, a constituent sensing element 30 comprises a working electrode 31 comprising a constituent-responsive element 32, a reference electrode 33, and acounter electrode 34. As used herein “electrode” refers to a conductor which through which an electrical current enters or leaves an object or area.

[0069] A constituent sensing element 30 a working electrode 31, a reference electrode 33, and a counter electrode 34 is a form of a three-electrode electrochemical cell which analyzes the current and / or voltage which flows through the working electrode 31. This current and / or voltage will vary depending on whether (and to what degree), the constituent-responsive element 32 detects a constituent.

[0070] For example, as described in the Examples and herein below, a constituent-responsive element 32 that detects a biomolecule can comprise a moiety that binds to the working electrode 35, a moiety that binds specifically to the biomolecule constituent 36, and a moiety comprising a redox reporter 37. The constituent-responsive element 32 can be a single part element (e.g., in which each part is connected to at least one other by a covalent bond) or divided into multiple parts that can bind or associate reversibly (e.g., by hydrogen bonding between two separate chains (e.g., polypeptide or nucleic acid chains)). An exemplary one-part arrangement is illustrated in Fig. 9B, and an exemplary two-part arrangement is illustrated in Fig. 9A. When the biomolecule is not present, the redox reporter 37 is distant from the working electrode 31 surface and a low current is observed. When the biomolecule is present and bound by the moiety that binds specifically to the biomolecule 36. the redox reporter 37 is moved closer to the working electrode 31 and a higher current will be observed. In a further embodiment, a constituent-responsive element 32 that detects H+(pH) can comprise a pH responsive material in contact with the working electrode 31, or as part of the working electrode 31. As the concentration of H+ increases, in the presence of cyclic voltammetry7, a larger voltage is required to drive an oxidation reaction in the pH responsive material.

[0071] In some embodiments of any of the aspects, the working electrode 31. the reference electrode 33, and the counter electrode 34 of the constituent sensing element 30 each comprises gold, silver, and / or silver chloride.

[0072] In some embodiments of any of the aspects, the working electrode 31 of the constituent sensing element 30 comprises gold. In some embodiments of any of the aspects, the working electrode 31 of the constituent sensing element 30 consists of gold. In some embodiments of any of the aspects, the working electrode 31 of the constituent sensing element 30 consists essentially of gold.

[0073] In some embodiments of any of the aspects, the reference electrode 33 of the constituent sensing element 30 comprises gold. In some embodiments of any of the aspects, the reference electrode 33 of the constituent sensing element 30 consists of gold. In some embodiments of any of the aspects, the reference electrode 33 of the constituent sensing element 30 consists essentially of gold.

[0074] In some embodiments of any of the aspects, the counter electrode 34 of the constituent sensing element 30 comprises silver and silver chloride. In some embodiments of any of the aspects,the counter electrode 34 of the constituent sensing element 30 consists of silver and silver chloride. In some embodiments of any of the aspects, the counter electrode 34 of the constituent sensing element 30 consists essentially of silver and silver chloride.

[0075] The drain sensor 100 described herien, wherein each of the working electrode 31, the reference electrode 33, and the counter electrode 34 is in fluid communication with the fluid channel 10. In some embodiments of any of the aspects of the drain sensor 100 described herien, each of the working electrode 31, the reference electrode 33, and the counter electrode 34 is in fluid communication with the fluid chamiel 10.

[0076] A constituent sensing element 30 comprises a constituent-responsive element 32. A constituent-responsive element is an element that changes conformation and / or electrochemical properties when it is in contact or communication with a constituent. In some embodiments of any of the aspects, the constituent-responsive element 32 changes conformation and / or electrochemical properties as the concentration of the constituent changes. In some embodiments of any of the aspects, the constituent-responsive element 32 changes conformation and / or electrochemical properties in response to a specific constituent (e.g., the constituent-responsive element 32 is a constituent species-responsive element). In some embodiments of any of the aspects, the constituent- responsive element 32 changes conformation and / or electrochemical properties in response to a group of constituents (e.g.. the constituent-responsive element 32 is a constituent genus-responsive element).

[0077] In some embodiments of any of the aspects, the constituent is a biomolecule and the constituent-responsive element 32 comprises: a moiety that binds to the working electrode 35. a moiety that binds specifically to the biomolecule constituent 36. and a moiety comprising a redox reporter 37. In some embodiments of any of the aspects, the constituent is a biomolecule and the constituent-responsive element 32 consists of: a moiety that binds to the working electrode 35, a moiety that binds specifically to the biomolecule constituent 36, and a moiety comprising a redox reporter 37. In some embodiments of any of the aspects, the constituent is a biomolecule and the constituent-responsive element 32 consists essentially of: a moiety that binds to the working electrode 35, a moiety that binds specifically to the biomolecule constituent 35, and a moiety comprising a redox reporter 37.

[0078] In some embodiments of any of the aspects, the constituent is a biomolecule and tire constituent-responsive element 32 comprises: a moiety that binds specifically to the biomolecule constituent 36. a moiety’ that binds to the working electrode 35 conjugated or attached to a first end of the moiety that binds specifically to the biomolecule constituent 36, and a moiety comprising a redox reporter 37 conjugated or attached to a second end of the moiety that binds specifically to the biomolecule constituent 36.

[0079] In some embodiments of any of the aspects, the constituent is a biomolecule and tire constituent-responsive element 32 comprises: a nucleic acid moiety that binds specifically to thebiomolcculc constituent 36, a moiety that binds to the working electrode 35 conjugated or attached to the 5’ end of the nucleic acid moiety 36, and a moiety comprising a redox reporter 37 conjugated or attached to the 3’ end of the nucleic acid moiety 36. In some embodiments of any of the aspects, the constituent is a biomolecule and the constituent -responsive element 32 comprises: a nucleic acid moiety that binds specifically to tire biomolecule constituent 36, a moiety that binds to the working electrode 35 conjugated or attached to the 3’ end of the nucleic acid moiety 36, and a moiety comprising a redox reporter 37 conjugated or attached to the 5‘ end of the nucleic acid moiety 36.

[0080] A moiety that binds to the working electrode 35 can be any moiety that forms a chemical bond (e.g. a covalent, ionic, or hydrogen bond), chemisorption interaction, or physisorption interaction with the working electrode 31. A moiety that binds to the working electrode 35 can bind to a metal in the working electrode 31, or to a binding moiety provided in or on the working electrode 31. Exemplary moieties that bind to a working electrode 35 include but are not limited to thiol groups. In some embodiments of any of the aspects, the moiety that binds to the working electrode 35 is a thiol and the working electrode 31 comprises at least one of gold, platinum, iridium, and stainless steel. In some embodiments of any of the aspects, the moiety that binds to the working electrode 35 is a thiol and the working electrode 31 comprises gold, platinum, iridium, or stainless steel. In some embodiments of any of the aspects, the moiety' that binds to the working electrode 35 is a thiol and the working electrode 31 comprises gold.

[0081] Exemplar) moieties that bind specifically to a biomolecule 36 include but are not limited to antibody reagents and aptamers. In some embodiments of any of the aspects, the moiety that binds specifically to the biomolecule constituent 36 is an aptamer. Aptamers are well known in the art and aptamers that bind specifically to a desired biomolecule are readily selected by one of ordinary skill in the art. For example aptamers can be selected from Apta-index (available on the world wide web at aptagen.com), the UTexas Aptamer Database (available on the world wide web at sites.utexas.edu / aptamerdatabase), or AptaDB (available on the world wide web at lmmd.ecust.edu.cn / aptadb / ).

[0082] In some embodiments of any of the aspects, an aptamer that binds specifically to glucose comprises: ACGACCGTGTGTGTTGCTCTGTAACAGTGTCCATTGTCGT (SEQ ID NO: 1). In some embodiments of any of the aspects, an aptamer that binds specifically to glucose consists of SEQ ID NO: 1. In some embodiments of any of the aspects, an aptamer that binds specifically to glucose consists essentially of SEQ ID NO: 1.

[0083] In some embodiments of any of the aspects, an aptamer that binds specifically to lactate comprises GACGACGAGTAGCGCGTATGAATGCTTTTCTATGGAGTCGTC (SEQ ID NO:2). In some embodiments of any of the aspects, an aptamer that binds specifically to lactate consists of SEQ ID NO: 2. In some embodiments of any of the aspects, an aptamer that binds specifically to lactate consists essentially of SEQ ID NO: 2.

[0084] In some embodiments of any of the aspects, an aptamer that binds specifically to lactate comprises GACGACGCAGGGAGTTTTAACGGCTCTTGCGACTGTGTCGTC (SEQ ID NO: 3). In some embodiments of any of the aspects, an aptamer that binds specifically to lactate consists of SEQ ID NO: 3. In some embodiments of any of the aspects, an aptamer that binds specifically to lactate consists essentially of SEQ ID NO: 3.

[0085] In some embodiments of any of the aspects, an aptamer that binds specifically to lactate comprises SEQ ID NO: 2 or SEQ ID NO: 3. In some embodiments of any of the aspects, an aptamer that binds specifically to lactate consists of SEQ ID NO: 2 or SEQ ID NO: 3. In some embodiments of any of the aspects, an aptamer that binds specifically to lactate consists essentially of SEQ ID NO: 2 or SEQ ID NO: 3.

[0086] As used herein "redox reporter" refers to any chemical moiety capable of undergoing a reduction (accepting of an electron(s)) or oxidation (donation of an electron(s)) in the course of transferring electrons to or from an electrode. Exemplary redox reporters include, but are not limited to, metallocenes, metallocene derivatives, quinones, polycyclic aromatic hydrocarbons, redox-active organic molecules, phenazines, organosulfur compounds, radical acceptors, or a combination thereof.

[0087] In some embodiments of any one of the aspects described herein, the redox reporter is selected from the group consisting of ferrocene, ferrocene derivatives. 3,3',5,5'-tetramethylbenzidine (TMB), o-phenylenediamine dihydrochloride (OPD). N,N.N',N'-tetramethyl-p-phenylenediamine, viologens 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), p-nitrophenyl Phosphate (PNPP), 3.3'-diaminobenzidine (DAB), 4-chloro-l -naphthol (4-CN), 5-bromo-4-chloro-3-indolyl- phosphate (BCIP), nitro blue tetrazolimn (NBT). methylene blue, tetrathialfulvaene. 2,6- dichloroindophenol (DCIP), 2, 6-dichloroindophenyl phosphate, riboflavin 5 '-monophosphate (RMP). ethyl viologen (l,T-bis(ethyl)-4,4'-bipyridinium or BEBP), Paraquat, hexaamine ruthenium, 1,4- naphthoquione, resorufme, cyanomethylviologen, diquat, triquat, l.l'-bis(2-sulfoethyl)-4,4'- bipyridinium, l,l'-dibenzyl-4,4'-bipyridinium, 4.4'-dicarboxy-2.2'-bipyridyl. 1 -hydroxybenzotriazole, veratryl alcohol, violuric acid, 2 -methoxy -phenothiazone, 3 -hy droxy anthranilic acid, anthraquinone 2,6-disulfonic acid, N-hydroxyacetanilide, phenol red, 3,3',5,5'-tetramethyl benzidine, dichlorophenol red, 2,2',6,6'-tetramethylpiperidine-N-oxyl radical, syringaldehyde and acetosyringone, 2, 2,6,6- tetramethylpiperidin-l-yl)oxyl (TEMPO), 2,2'7,7'-tetrakis-(N,N-di-p-methoxyphenyl-amine)-9,9'- spirobifluorene (spiro-MeOTAD), sodium anthraquinone-2,6-di sulphonate (AQDS), benzoquinones, 2.2'-biimidazole, 2-(2-pyridyl)imidazole, 2,2'-bipyridine, tetracyanoquinodimethane (TCNQ), and combinations thereof.

[0088] In some embodiments of any one of the aspects described herein, the redox reporter is ferrocene or a derivative thereof. As used herein, the tenn “ferrocene derivative” refers to a molecule containing an optionally substituted ferrocene group (e.g., optionally substituted ferrocenyl radical or ferrocene nucleus). Some exemplary ferrocene derivatives include, but are not limited to.aminofcrroccnc, ferrocene monocarboxylic acid, ferrocyanide, I . I '-ferrocene dicarboxylic acid, 1,1'- dimethylferrocene (DMF), polyvinylferrocene, [N-ferrocenoyl]-4-aminophenyl phosphate, ferrocenyhnethyl methacrylate, P-ferrocenyl-propenoic acid, and ferrocene monocarboxylic acid (FMCA). In some embodiments of any one of the aspects described herein, the redox mediator is aminoferrocene .

[0089] In some embodiments of any of the aspects, the redox reporter is methylene blue, ferrocene, anthraquinone, viologen. Atto MB2, or Nile Blue. In some embodiments of any of the aspects, the redox reporter is methylene blue.

[0090] In some embodiments of any of the aspects, the drain sensor 100 can comprise a plurality of biomolecule constituent sensing elements and each biomolecule constituent element comprises a different redox reporter. In some embodiments of any of the aspects, the drain sensor 100 can comprise a plurality of biomolecule constituent sensing elements and each biomolecule constituent element comprises the same different redox reporter.

[0091] In some embodiments of any of the aspects, the drain sensor 100 can comprise a plurality of biomolecule constituent sensing elements that detect the same biomolecule and each of these biomolecule constituent elements comprises a different redox reporter. In some embodiments of any of the aspects, the drain sensor 100 can comprise a plurality of biomolecule constituent sensing elements that detect the same biomolecule and each of these biomolecule constituent elements comprises a different redox reporter.

[0092] In some embodiments of any of the aspects, the drain sensor 100 can comprise a plurality of biomolecule constituent sensing elements that detect the same biomolecule and each of these biomolecule constituent elements comprises a different moiety that binds specifically to the biomolecule. In some embodiments of any of the aspects, the drain sensor 100 can comprise a plurality of biomolecule constituent sensing elements that detect the same biomolecule and each of these biomolecule constituent elements comprises the same moiety that binds specifically to the biomolecule.

[0093] In some embodiments of any of the aspects, the drain sensor 100 can comprise a plurality of biomolecule constituent sensing elements and each biomolecule constituent element comprises a different moiety that binds to the working electrode 35. In some embodiments of any of the aspects, the drain sensor 100 can comprise a plurality of biomolecule constituent sensing elements and each biomolecule constituent element comprises the same moiety that binds to the working electrode 35.

[0094] In some embodiments of any of the aspects, the constituent of a fluid is H+, e.g., the constituent sensing element 30 is a pH sensing element. In some embodiments of any of the aspects, the constituent of a fluid is H+and the constituent-responsive element 32 comprises a pH responsive material. As used herein, "pH responsive material” refers to a material which exhibits different electrochemical characteristics as the concentration of H+changes. In some embodiments of any ofthe aspects, a pH responsive material exhibits different rates of oxidation at different H+concentrations. In some embodiments of any of the aspects, a pH responsive material exhibits different rates of oxidation in response to cyclic voltammetry at different H+concentrations.

[0095] Exemplary pH responsive materials include but are not limited to polydopamine, poly (methacrylic acid) (PMAAc), poly [(2-dimethylamino)ethyl methacrylate] (PDMA), poly (2- acrylamido-2 -methylpropane sulfonic acid) (PAMPS) and poly(4-styrenesulfonic acid) (PSSA), Polyacrylic acid (PAA), PVA or PVBA, Polyvinyl benzoic acid, Polyvinyl acid, poly(L-glutamic acid) PLGA, Alginic acid, Hyaluroinic acid (HA), and combinations thereof. In some embodiments of any of the aspects, the pH responsive material comprises catechol moieties. In some embodiments of any of the aspects, the pH responsive material comprises poly dopamine. In some embodiments of any of the aspects, the pH responsive material consists of polydopamine. In some embodiments of any of the aspects, the pH responsive material consists essentially of poly dopamine. In some embodiments of any of the aspects, the pH responsive material comprises a polydopamine film. In some embodiments of any of the aspects, the pH responsive material consists of a poly dopamine film. In some embodiments of any of the aspects, the pH responsive material consists essentially of a polydopamine film.

[0096] In some embodiments of any of the aspects, the pH responsive material comprises a coating on the working electrode 31. In some embodiments of any of the aspects, the pH responsive material is a coating on the working electrode 31. In some embodiments of any of the aspects, the pH responsive material is provided as a coating on the working electrode 31.

[0097] A hydrogel can reduce degradation and / or fouling of a constituent sensing element 30. Accordingly, a drain sensor 100 can be further provided with a hydrogel. In some embodiments of any of the aspects, a constituent sensing element 30 can further comprise a hydrogel in the contact with at least the working electrode 31. In some embodiments of any of the aspects, a constituent sensing element 30 can further comprise a hydrogel in the contact with the working electrode 31, the reference electrode 33, and the counter electrode 34. In some embodiments of any of the aspects, a drain sensor 100 further comprises a hydrogel in the fluid channel 10 and in contact with at least the working electrode 31. In some embodiments of any of the aspects, a drain sensor 100 further comprises a hydrogel in the fluid channel 10 and in contact with the working electrode 31, the reference electrode 33, and the counter electrode 34.

[0098] In some embodiments of any of the aspects, the drain sensor 100 does not comprise a hydrogel in contact with the pair of sensing electrodes of a flow rate sensing element 40. In some embodiments of any of the aspects, the flow rate sensing element 40 does not comprise a hydrogel. In some embodiments of any of the aspects, the flow rate sensing element 40 does not comprise a hydrogel in contact with the pair of sensing elements 42.

[0099] As used herein, the term “hydrogel’’ refers to a three -dimensional polymeric structure that is insoluble in water, but which is capable of absorbing and retaining large quantities of water to form a stable, often soft and pliable, structure. In some embodiments of any of the aspects, water can penetrate in betw een the polymer chains of tire polymer network, subsequently causing swelling and the formation of a hydrogel. In general, hydrogels are superabsorbent. Hydrogels are highly permeable to water, ions, and small molecules.

[0100] Exemplary hydrogels are known in the art and include but are not limited to hyaluronic acid hydrogels, chitosan hydrogels, heparin hydrogels, alginate hydrogels, gelatin hydrogels, fibrin hydrogels, polyvinyl alcohol hydrogels, polyethylene glycol hydrogels, sodium poly acrylate hydrogels, acrylate polymers hydrogels, copolymer hydrogels, collagen hydrogels, and the like. In some embodiments of any of the aspects, the hydrogel comprises at least one of agarose, polyacrylamide, cellulose, cellulose acetate, agar, sephadex, chitosan, alignate, and collagen. In some embodiments of any of the aspects, the hydrogel comprises agarose, polyacrylamide, cellulose, cellulose acetate, agar, sephadex, chitosan, alignate, or collagen. In some embodiments of any of the aspects, the hydrogel comprises agarose. In some embodiments of any of the aspects, the hydrogel consists of agarose and water. In some embodiments of any of the aspects, the hydrogel consists essentially of agarose and water.

[0101] In some embodiments of any of the aspects, the hydrogel is a 0.1% to 50% hydrogel. In some embodiments of any of the aspects, the hydrogel is a 0.5% to 50% hydrogel. In some embodiments of any of the aspects, the hydrogel is a 1% to 50% hydrogel. In some embodiments of any of the aspects, the hydrogel is a 0.1% to 10% hydrogel. In some embodiments of any of the aspects, the hydrogel is a 0.1% to 5% hydrogel. In some embodiments of any of the aspects, the hydrogel is a 1% to 5% hydrogel.

[0102] In some embodiments of any of the aspects, the hydrogel is a 0.1% to 50% agarose hydrogel. In some embodiments of any of the aspects, the hy drogel is a 0.5% to 50% agarose hydrogel. In some embodiments of any of the aspects, the hydrogel is a 1% to 50% agarose hydrogel. In some embodiments of any of the aspects, the hy drogel is a 0.1% to 10% agarose hydrogel. In some embodiments of any of the aspects, the hydrogel is a 0.1% to 5% agarose hydrogel. In some embodiments of any of the aspects, the hydrogel is a 1% to 5% agarose hydrogel.

[0103] In some embodiments of any of the aspects, the hydrogel can further comprise one or more DNAse inhibitors. DNAse inhibitors can reduce and / or prevent degradation of an aptamer when the moiety that binds specifically to a biomolecule constituent is an aptamer. DNAse inhibitors are well known in the art and readily available from commercial sources. Exemplary DNAse inhibitors include but are not limited to rutin (rutoside, quercetin-3-O-rutinoside or sophorin), somatostatin, actin, actinomycin D, nogalamycin. daunomycin, neomycin B, paromomycin. 2 -Nitro-5 - thiocyanobenzoic acid (NTCB), and 2-nitro-5-thiosulfobenzoic acid (NTSB). In some embodimentsof any of the aspects, the one or more DNAse inhibitors comprise rutin. In some embodiments of any of the aspects, the one or more DNAse inhibitors consist of rutin. In some embodiments of any of the aspects, the one or more DNAse inhibitors consist essentially of rutin.

[0104] As described herein, a flow rate sensing element 40 is a sensing element that detects a flow rate of a fluid.

[0105] In some embodiments of any of the aspects, a flow rate sensing element 40 comprises a heater element 41 and a pair of sensing electrodes 42. The heater element 41 can be located closer to the inflow port 11 than the pair of sending electrodes. The heater element 41 transfers heat to the fluid in the fluid channel 10. The higher the temperature of the fluid, the lower the impedance of the electrodes. At a higher fluid flow rate, the less heat the fluid will be able to absorb while in the fluid channel 10, and therefore higher fluid flow rates will result in higher impedance than lower fluid flow rates.

[0106] In some embodiments of any of the aspects, each of the pair of sensing electrodes 42 is in fluid communication with the fluid channel 10. In some embodiments of any of the aspects, the heater element 41 is in fluid communication with the fluid channel 10. In some embodiments of any of the aspects, the heater element 41 is not in fluid communication with the fluid channel 10. In some embodiments of any of the aspects, the heater element 41 is in thermal communication with the fluid channel 10.

[0107] The heater element 41 can be any design or material that can supply thermal energy into the fluid channel 10, e.g.. can change the temperature of a fluid in the fluid channel 10. Heater elements 41 are known in the art, e.g.. electrical heater elements, resistive heaters, and infrared heaters. Shapes and materials for heater elements 41 are well known in the art.

[0108] In some embodiments of any of the aspects, the heater element 41 is an electrical heater element. In some embodiments of any of the aspects, the heater element 41 is an electrical resistive heater element. An electrical heater element can be electrically coimected to a controllable power source for apply ing a current across the element. Control of the power source can be carried out by an appropriately programmed processor device (e.g., such as a computer).

[0109] In some embodiments of any of the aspects, the electrical heater element comprises copper. In some embodiments of any of the aspects, the electrical heater element consists of copper. In some embodiments of any of tire aspects, the electrical heater element consists essentially of copper.

[0110] In some embodiments of any of the aspects, the heater element 41 is serpentine in shape.

[0111] In some embodiments of any of the aspects, the heater element 41 is serpentine in shape, the heater element 41 and the pair of sensing electrodes 42 are attached to a flexible polymer base 43.

[0112] Exemplary polymers include, but are not limited to, collagen. poly(alpha esters) such as poly(lactate acid), poly(gly colic acid), poly orthoesters and polyanhydrides and their copolymers.poly glycolic acid and polyglactin, cellulose ether, cellulose, cellulosic ester, fluorinated polyethylene, phenolic, poly-4-methylpentene, polyacrylonitrile, polyamide, polyamideimide, polyacrvlatc. poly benzoxazole, polycarbonate, polycyanoarylether, polyester, polyestercarbonate, polyether, polyetheretherketone, polyetherimide, polyetherketone, polyethersulfone, polyethylene, polyfluoroolefln, polyimide, polyolefin, polyoxadiazole, polyphenylene oxide, polyphenylene sulfide, polypropylene, polystyrene, polysulfide, polysulfone, polytetrafluoroethylene, polythioether, polytriazole, polyurethane, polyvinyl, polyvinylidene fluoride, regenerated cellulose, silicone, ureaformaldehyde. polyglactin. or copolymers or physical blends of these materials. In some embodiments of any of the aspects, the flexible polymer base 43 comprises polyamide. In some embodiments of any of the aspects, the flexible polymer base 43 consists of polyamide. In some embodiments of any of the aspects, the flexible polymer base 43 consists essentially of polyamide.

[0113] In some embodiments of any of the aspects, the heater element 41 is located at least 1 mm closer to the inflow port 11 than the pair of sensing electrodes 42. In some embodiments of any of the aspects, the heater element 41 is located about 1 mm closer to the inflow port 11 than the pair of sensing electrodes 42. In some embodiments of any of the aspects, the heater element 41 is located 1 mm + 0.5 mm. closer to the inflow port 11 than the pair of sensing electrodes 42. In some embodiments of any of the aspects, the heater element 41 is located 1 mm + 0.2 mm. closer to the inflow port 11 than the pair of sensing electrodes 42. In some embodiments of any of the aspects, the heater element 41 is located 1 mm + 0.1 mm, closer to the inflow port 11 than the pair of sensing electrodes 42.

[0114] In some embodiments of any of the aspects, the drain sensor 100 comprises a plurality of sensing elements 20. In some embodiments of any of the aspects, the drain sensor 100 comprises a plurality of sensing elements 20 and the plurality of sensing elements 20 are arranged in series. In some embodiments of any of the aspects, the drain sensor 100 comprises a plurality of sensing elements 20 and the plurality of sensing elements 20 are arranged in parallel.

[0115] In some embodiments of any of the aspects, the drain sensor 100 comprises at least one flow rate sensing element 40 and at least one constituent sensing element 30. In some embodiments of any of the aspects, the drain sensor 100 comprises one flow rate sensing element 40 and at least one constituent sensing element 30. In some embodiments of any of the aspects, the drain sensor 100 comprises one flow rate sensing element 40 and a plurality of constituent sensing elements 30, wherein the plurality of constituent sensing elements 30 detect a plurality of constituents.

[0116] In some embodiments of any of the aspects, the drain sensor 100 comprises at least one flow rate sensing element 40 and at least one constituent sensing element 30 and the at least one flow rate sensing element 40 is arranged in parallel to die at least one constituent sensing element 30. In some embodiments of any of the aspects, the drain sensor 100 comprises at least one flow rate sensingelement 40 and at least one constituent sensing element 30 and the at least one flow rate sensing element 40 is arranged in series to the at least one constituent sensing element 30.

[0117] In some embodiments of any of the aspects, the drain sensor 100 comprises at least one sensing element 20 and the at least one sensing element detects one or more of: lactate, glucose, glucose ratio, pH, and flow rate.

[0118] In some embodiments of any of the aspects, the drain sensor 100 comprises at least one flow rate sensing element 40 and at least one constituent sensing elements 30 and the sensing elements collectively detect flow rate and one or more of: lactate, glucose, glucose ratio, and pH.

[0119] In some embodiments of any of the aspects, one or more electrodes of a drain sensor 100 are connected to a power source. In some embodiments of any of the aspects, the power source can be or comprise a battery, e.g., a battery in the sensor or system. In some embodiments of any of the aspects, the power source can comprise a cord or other means of connection to an electrical power source, such as electrical outlet. The power source can be connected in a wired or wireless manner.

[0120] The signals generated at the at least one sensing element 20 can be communicated to the controller. In some embodiments of any of the aspects, the controller is a computer system, e.g., a a bench top electrochemical workstation (e.g.. potentiostat). In some embodiments of any of the aspects, the controller is a microprocessor. In some embodiments of any of the aspects, the drain monitoring system comprises housing unit 50 comprising: a drain sensor 100, a microprocessor, and a display.

[0121] The inflow port 11 and / or outflow port 12 of a drain sensor 100 described herein can be configured to attach to a drain and / or catheter tube 51. Configmations to permit attachment to a drain and / or catheter tube 51 are well known in the art and include, by way of non-limiting example luer locks, luer slips, graduated adaptors, stepped connectors, T-connectors, and the like.

[0122] In some embodiments of any of the aspects, the fluid channel 10 and at least one sensing element 20 are provided in a housing unit 50. A housing unit 50 can take the form of a substrate, a box, a container, a platform, or the like. In some embodiments of any of the aspects, the housing unit encloses the fluid channels 10 and sensing elements 20 of the dram sensor 100, while permitting access to tire inflow port 11 and outflow port 12.

[0123] In some embodiments of any of the aspects, the housing unit 50 comprises a biocompatible resin. In some embodiments of any of the aspects, the housing unit 50 consists of a biocompatible resin. In some embodiments of any of the aspects, the housing unit 50 consists essentially of a biocompatible resin. In some embodiments of any of the aspects, the fluid channel 10 is formed in or by the biocompatible resin, e.g., the walls or surfaces of the fluid channel are formed at least in part by the biocompatible resin.

[0124] In some embodiments of any of the aspects, the drain sensor 100 is provided in a catheter tube. In some embodiments of any of the aspects, the drain sensor 100 is permanently affixed to a catheter tube.

[0125] In some embodiments of any of the aspects, the drain sensor 100 is provided in a drain. In some embodiments of any of the aspects, the drain sensor 100 is permanently affixed to a drain.

[0126] A dram can be any drain known in the art. Exemplary drains include but are not limited to an internal ventricular drain, an external ventricular drain, a shunt, a cerebral shunt, a cerebrospinal fluid shunt, a lumbar-peritoneal shunt, a peritoneovenous shunt, a passive drain (e.g., a penrose drain), a urinary catheter, a chest tube or thoracostomy catheter, an abdominal drain (e.g.. Jackson-Pratt or Blake drain), a central venous catheter, a biliary drain, a nephrostomy drain, a gastrointestinal drain, a gastrointestinal drain, a peritoneal catheter, a wound drain, a sump drain, a hemovac drain, a silicone drain, a redon drain, a pleural drain, a pigtail catheter connected to any bodily cavity and comprising an external portion, a pancreastic drain, a drain connected to a vacuum, an indwelling catheter, and a thoracostomy tube. In some embodiments of any of the aspects, the drain is an internal ventricular drain, an external ventricular drain, a shunt, a cerebral shunt, a cerebrospinal fluid shunt, a lumbar- peritoneal shunt, or a peritoneovenous shunt. In some embodiments of any of the aspects, the drain is an internal ventricular drain. In some embodiments of any of the aspects, the drain is an external ventricular drain. In some embodiments of any of the aspects, the drain is a shunt. In some embodiments of any of the aspects, the drain is a cerebral shunt. In some embodiments of any of the aspects, the drain is a cerebrospinal fluid shunt. In some embodiments of any of the aspects, the drain is a lumbar-peritoneal shunt. In some embodiments of any of the aspects, the drain is a peritoneovenous shunt.

[0127] In some embodiments of any of the aspects, the entire fluid flow through a drain will pass through the drain sensor 100. In some embodiments of any of the aspects, only a portion of the fluid flow through a drain will pass through the drain sensor 100, e.g., a portion of the fluid flow is shunted or directed into the drain sensor 100 in parallel to the remainder of the fluid flow of the drain.

[0128] In some embodiments of any of the aspects, the drain sensor 100 further comprises a transmitter and / or transceiver 52. In some embodiments of any of the aspects, the drain sensor 100 further comprises a transmitter 52. In some embodiments of any of the aspects, the drain sensor 100 further comprises a transceiver 52.

[0129] As used herein, “transmitter” refers to a device that generates a signal, e.g., RF current, electromagnetic, optical, audio, or radio wave signals. In some embodiments, a transmitter is a RF transmitter. As used herein, “transceiver” refers to a device that both generates and receives a signal, e.g., RF current, electromagnetic, optical, audio, or radio wave signals. In some embodiments, a transceiver is a RF transceiver.

[0130] In some embodiments of any of the aspects, the transmitter and / or transceiver is wired. In some embodiments of any of the aspects, the transmitter and / or transceiver is wireless.

[0131] The transmitter and / or transceiver transmits a signal. Exemplary signals include but are not limited to the current, voltage, and / or impedance detected by the at least one sensing element 20.

[0132] In some embodiments of any of the aspects, the drain sensor 100 comprises a transmitter and / or transceiver for each of the at least one sensing elements 20, e.g., each transmitter and / or transceiver transmits a signal for one sensing element 20. In some embodiments of any of the aspects, the drain sensor 100 comprises one transmitter and / or transceiver which transmits signals for all of the at least one sensing elements 20.

[0133] In one aspect of any of the embodiments, described herein is a drain monitoring system, comprising a drain sensor 100 as described herein and a controller 53.

[0134] As used herein, “controller” or computing device refers to a non-human apparatus that is capable of accepting a structured input, processing the structured input according to prescribed rules, and producing results of the processing as output. The controller can include any suitable processing device, such as general purpose computer systems, microprocessors, digital signal processors, microcontrollers, application specific integrated circuits (ASICs), programmable logic devices (PLDs) field programmable logic devices (FPLDs). programmable gate arrays (PGAs). field programmable gate arrays (FPGAs), mobile devices such as mobile telephones, personal digital assistants (PDAs), or tablet computers, local servers, remote servers, wearable computers, or the like. In some embodiments, the controller can comprise or be comiected to (or in communication with) a memory device. The memory device can include any suitable memory' device and / or machine-readable medium that is capable of storing, encoding, and / or carrying a set of instructions for execution by a processing device and that cause the processing device to perform and / or implement any of the features discussed herein, including solid-state memories, optical media, magnetic media, random access memory' (RAM), read only memory' (ROM), a floppy disk, a hard disk, a CD ROM, a DVD ROM, flash memory , or other computer readable medium that is read from and / or written to by a magnetic, optical, or other reading and / or writing system that is coupled to the processing device, can be used for the memory' or memories.

[0135] In some embodiments of any of the aspects, the system comprises a computing device, a server, a network, and / or a database. In some embodiments, the computing device and server can be comiected by a network and the network can be comiected to various other devices, servers, or network equipment for implementing the present disclosure. A computing device can be connected to a display 54. Computing device can be any suitable computing device, including a desktop computer, server (including remote servers), mobile device, or other suitable computing device. In some examples, algorithm(s) as described herein and other software can be stored in database and run onserver. Additionally, data and data processed or produced by said algorithms or programs can be stored in a database.

[0136] It should be understood that the disclosure herein can be implemented with any type of hardware and / or software and can be a pre-programmed general purpose computing device. For example, the system can be implemented using a server, a personal computer, a portable computer, a thin client, or any suitable device or devices. The disclosure and / or components thereof can be a single device at a single location, or multiple devices at a single, or multiple, locations that are connected together using any appropriate communication protocols over any communication medium such as electric cable, fiber optic cable, or in a wireless manner.

[0137] It should also be noted that the disclosure can be illustrated and discussed herein as having a plurality of modules which perform particular functions. It should be understood that these modules are merely schematically illustrated based on their function for clarity purposes only, and do not necessary represent specific hardware or software. In this regard, these modules can be hardware and / or software implemented to substantially perform the particular functions discussed. Moreover, the modules can be combined together within the disclosure or divided into additional modules based on the particular function desired. Thus, the disclosure should not be construed to limit the present technology as disclosed herein, but merely be understood to illustrate one exemplary implementation thereof.

[0138] The computing system can include clients and servers. A client and server are generally remote from each other and typically interact through a communication network. The relationship of client and server arises by virtue of computer programs running on the respective computers and having a client-server relationship to each other. In some implementations, a server transmits data (e.g., an HTML page) to a client device (e.g., for purposes of displaying data to and receiving user input from a user interacting with the client device). Data generated at the client device (e.g., a result of the user interaction) can be received from the client device at the server. Implementations of the subject matter described herein can be implemented in a computing system that includes a back end component, e.g., as a data server, or that includes a middleware component, e.g., an application server, and / or that includes a front end component, e.g., a client computer having a graphical user interface or a Web browser through w hich a user can interact with an implementation of the subject matter described in this specification, or any combination of one or more such back end, middleware, or front end components. The components of the system can be interconnected by any form or medium of digital data communication, e.g., a communication netw ork. Examples of communication networks include a local area network (“LAN”) and a wide area network (“WAN”), an inter-network (e.g., the Internet), and peer-to-peer networks (e.g., ad hoc peer to-peer networks).

[0139] Implementations of the subject matter and the operations described herein can be implemented in digital electronic circuitry, or in computer software, firmware, or hardware, includingthe structures disclosed herein and their structural equivalents, or in combinations of one or more of them. Implementations of the subject matter described herein can be implemented as one or more computer programs, e.g., one or more modules of computer program instructions, encoded on computer storage medium for execution by, or to control the operation of. data processing apparatus. Alternatively or in addition, the program instructions can be encoded on an artificially generated propagated signal, e.g., a machine-generated electrical, optical, or electromagnetic signal that is generated to encode information for transmission to suitable receiver apparatus for execution by a data processing apparatus. A computer storage medium can be. or be included in, a computer-readable storage device, a computer-readable storage substrate, a random or serial access memory array or device, or a combination of one or more of them. Moreover, while a computer storage medium is not a propagated signal, a computer storage medium can be a source or destination of computer program instructions encoded in an artificially generated propagated signal. The computer storage medium can also be. or be included in, one or more separate physical components or media (e.g.. multiple CDs. disks, or other storage devices).

[0140] The operations described in this specification can be implemented as operations performed by a ‘"data processing apparatus” on data stored on one or more computer-readable storage devices or received from other sources. The term "‘data processing apparatus” encompasses all kinds of apparatus, devices, and machines for processing data, including by way of example a programmable processor, a computer, a system on a chip, or multiple ones, or combinations, of the foregoing. The apparatus can include special purpose logic circuitry, e.g., an FPGA (field programmable gate array) or an ASIC (application specific integrated circuit). The apparatus can also include, in addition to hardware, code that creates an execution environment for die computer program in question, e.g., code that constitutes processor firmware, a protocol stack, a database management system, an operating system, a cross-platform rimtime environment, a virtual machine, or a combination of one or more of them. The apparatus and execution enviromnent can realize various different computing model infrastructures, such as web services, distributed computing, and grid computing infrastructures.

[0141] A computer program (also known as a program, softw are, softw are application, script, or code) can be written in any form of programming language, including compiled or interpreted languages, declarative or procedural languages, and it can be deployed in any form, including as a standalone program or as a module, component, subroutine, object, or other unit suitable for use in a computing environment. A computer program can, but need not, correspond to a file in a file system. A program can be stored in a portion of a file that holds other programs or data (e.g., one or more scripts stored in a markup language document), in a single file dedicated to the program in question, or in multiple coordinated files (e.g., files that store one or more modules, sub programs, or portions of code). A computer program can be deployed to be executed on one computer or on multiplecomputers that arc located at one site or distributed across multiple sites and interconnected by a communication network.

[0142] The processes and logic flows described in this specification can be performed by one or more programmable processors executing one or more computer programs to perform actions by operating on input data and generating output. The processes and logic flows can also be performed by, and apparatus can also be implemented as. special purpose logic circuitry, e.g., an FPGA (field programmable gate array) or an ASIC (application specific integrated circuit).

[0143] Processors suitable for the execution of a computer program include, by way of example, both general and special purpose microprocessors, and any one or more processors of any kind of digital computer. Generally, a processor can receive instructions and data from a read only memory or a random access memory or both. The essential elements of a computer are a processor for performing actions in accordance with instructions and one or more memory devices for storing instructions and data. Generally, a computer will also include, or be operatively coupled to receive data from or transfer data to, or both, one or more mass storage devices for storing data, e.g., magnetic, magneto optical disks, or optical disks. However, a computer need not have such devices. Moreover, a computer can be embedded in another device, e.g.. a mobile telephone, a personal digital assistant (PDA), a mobile audio or video player, a game console, a Global Positioning System (GPS) receiver, or a portable storage device (e.g., a universal serial bus (USB) flash drive), to name just a few. Devices suitable for storing computer program instructions and data include all forms of nonvolatile memory, media and memory devices, including by way of example semiconductor memory devices, e.g.. EPROM, EEPROM, and flash memory devices; magnetic disks, e.g.. internal hard disks or removable disks; magneto optical disks; and CD ROM and DVD-ROM disks. The processor and the memory can be supplemented by, or incorporated in. special purpose logic circuitry .

[0144] In some embodiments of any of the aspects, the controller receives at least one signal from the at least one sensing element 20 and is configured to calculate the concentration or magnitude of the analyte and / or characteristic from the signal. Such calculations are known in the art and are readily selected and / or programmed by one of skill in the art depending upon, e.g., the ty pe of signal transmitted, what analyte or characteristic the sensing element 20 is detecting, and whether concentration, presence, absence and / or magnitude is the desired output. In some embodiments of any of the aspects, the calculation is based on one or more standards or calibration curves. In some embodiments of any of the aspects, the calculation is based on kinetic differential measurements.

[0145] In some embodiments of any of the aspects, the controller is wirelessly connected to the drain sensor 100. In some embodiments of any of the aspects, the drain monitoring system further comprises a wired connection between the controller and the drain sensor 100.

[0146] In some embodiments of any of the aspects, the drain monitoring system further comprises a display. A display can comprise a computer monitor, a tablet, a phone screen, printablemedia, an app (e.g., on a smart phone or other device), or a web browser. The display can be any suitable device configured to receive from the controller and display computer readable information to a user.

[0147] In some embodiments of any of the aspects, the controller is configured to provide an alert if the drain sensor 100 detects a specified level or change in a level of constituent and / or the flow rate. An alert can comprise an audible alert, a visual alert, an alert on the display, an email or text message, a “push” to a smart phone or similar device, or any other means of notifying a user that the specified level or change has been detected. The specified level can be pre-set, or selected by a user, e.g., by interacting with the controller and / or display to select or alter an alert setting.

[0148] In some embodiments of any of the aspects, the controller is configured to transmit a signal to a drain pump or valve 55 if the drain sensor 100 detects a specified level or change in a level of constituent and / or the flow rate. Th signal can cause the drain pump to start or stop. The signal can cause the valve to open or close. The specified level can be pre-set, or selected by a user, e.g.. by interacting with the controller and / or display to select or alter an alert setting. The action directed by the signal can be pre-set, or selected by a user. e.g.. by interacting with the controller and / or display to select or alter a signal setting.

[0149] In some embodiments of any of the aspects, the controller is configured to provide an alert if the drain sensor 100 detects a disconnection or a loss of power. In some embodiments of any of the aspects, the controller is configured to provide an alert if there is a disconnection or a loss of power.

[0150] In some embodiments of any of the aspects, the drain sensor 100 is located outside of a patient’s body and / or configured to be located outside of a patient’s body. In some embodiments of any of the aspects, the drain sensor 100 is located or attached to an external portion of a drain and / or configured to be located in or attached to an external portion of a drain. In some embodiments of any of the aspects, the drain sensor 100 is located or attached to percutaneous port and / or configured to be located in or attached to a percutaneous port.

[0151] In some embodiments of any of the aspects, the drain sensor 100 is located inside of a patient’s body and / or configmed to be located inside of a patient's body.

[0152] In one aspect of any of the embodiments, described herein is a kit comprising the drain sensor 100 and / or drain monitoring system described herein and one or more of: one or more drains; one or more catheter tubes: and one or more collection bags. In some embodiments of any of the aspects, the one or more drains are selected from the group consisting of: an internal ventricular drain, an external ventricular drain, a shunt, a cerebral shunt, a cerebrospinal fluid shunt, a lumbar-peritoneal shunt, a peritoneovenous shunt, a passive drain (e.g., a penrose drain), a urinary catheter, a chest tube or thoracostomy catheter, an abdominal drain (e.g., Jackson-Pratt or Blake drain), a central venous catheter, a biliary drain, a nephrostomy drain, a gastrointestinal drain, a gastrointestinal drain, aperitoneal catheter, a wound drain, a sump drain, a hcmovac drain, a silicone drain, a redon drain, a pleural drain, a pigtail catheter comrected to any bodily cavity and comprising an external portion, a pancreastic drain, a drain connected to a vacuum, an indwelling catheter, and a thoracostomy tube.

[0153] A kit is any manufacture (e.g., a package or container) comprising at least one sensor, system, or device described herein, e.g.. a drain sensor 100, the manufacture being promoted, distributed, or sold as a unit for performing the methods described herein. Hie kits described herein can optionally comprise additional components useful for performing the methods described herein. By way of example, the kit can comprise fluids and compositions (e.g., buffers, needles, syringes etc.) suitable for performing one or more of the administrations, placements, methods, or monitoring activities according to the methods described herein, an instructional material which describes performance of a method as described herein, and the like. Additionally, the kit may comprise an instruction leaflet.

[0154] The structures of the sensors and systems described herein (e.g. the channels, ports and / or the sensing elements) can be formed, such as by etching, 3-D printing, machining, micro-machining, solvent casting, compression molding, filament drawing, meshing, leaching, weaving, and coating. These shaping techniques may be employed in combination, for example, a polymeric matrix may be weaved, compression molded and glued together. Furthermore different polymeric materials shaped by different processes may be joined together to form a composite shape. The composite shape may be a laminar structure. For example, a polymeric matrix may be attached to one or more polymeric matrixes to form a multilayer polymeric matrix structure. The attachment may be performed by gluing with a liquid polymer or by suturing. In addition, a polymeric matrix may be formed as a solid block and shaped by laser or other standard machining techniques to its desired final form.

[0155] The drain sensors 100 and systems described herein can be made of a biocompatible flexible material or a biocompatible non-flexible material according to the design and application requirements. It should be noted that the designs depicted in die Figures are exemplar}’ and the sensors and sy stems described herein is not limited to the configurations shown in the Figures. The drain sensor 100 or system and / or portions thereof can be made of a flexible material, including but not limited to, a biocompatible material such as poly dimethyl siloxane (PDMS). polyurethane or polyimide. The drain sensor 100 or system and / or portions thereof can also be made of non-flexible materials like glass, silicon, poly sulfone, hard plastic, and the like, as well as combinations of these materials.

[0156] A biocompatible polymer refers to materials which do not have toxic or injurious effects on biological functions. Biocompatible polymers include natural or synthetic polymers. Examples of biocompatible polymers include, but are not limited to, collagen, poly(alpha esters) such as poly(lactate acid), poly(gly colic acid), poly orthoesters and polyanhydrides and their copolymers. poly glycolic acid and polyglactin, cellulose ether, cellulose, cellulosic ester, fluorinated polyethylene,phenolic, poly-4-mcthylpcntcnc, polyacry lonitrile, polyamide, polyamidcimidc, polyacrylatc, poly benzoxazole, polycarbonate, polycyanoarylether, polyester, polyestercarbonate, polyether, polyetheretherketone, polyetherimide, polyetherketone, polyethersulfone, polyethylene, polyfluoroolefin, polyimide, polyolefin, polyoxadiazole, polyphenylene oxide, polyphenylene sulfide, polypropylene, polystyrene, polysulfide, polysulfone, polytetrafluoroethylene, poly thioether, polytriazole, poly methane, polyvinyl, polyvinylidene fluoride, regenerated cellulose, silicone, ureaformaldehyde. polyglactin, or copolymers or physical blends of these materials.

[0157] A biocompatible material can also be, for example, ceramic coatings on a metallic substrate. But any type of coating material and the coating can be made of different types of materials: metals, ceramics, polymers, hydrogels, or a combination of any of these materials. Biocompatible materials include, but are not limited to an oxide, a phosphate, a carbonate, a nitride or a carbonitride. Among the oxide the following ones are preferred: tantalum oxide, aluminum oxide, iridium oxide, zirconium oxide or titanium oxide. Substrates are made of materials such as metals, ceramics, polymers, or a combination of any of these. Exemplary metals include but are not limited to stainless steel, Nitinol, titanium, titanium alloys, or aluminum and ceramics such as zirconia, alumina, or calcium phosphate.

[0158] In one respect, the present invention relates to the herein described compositions, methods, and respective component(s) thereof, as essential to the technology, yet open to the inclusion of unspecified elements, essential or not ("comprising). In some embodiments of any of the aspects, other elements to be included in the description of the composition, method or respective component thereof are limited to those that do not materially affect the basic and novel characteristic (s) of the technology (e.g., the composition, method, or respective component thereof “consists essentially of’ the elements described herein). This applies equally to steps within a described method as well as compositions and components therein. In other embodiments of any of the aspects, the compositions, methods, and respective components thereof, described herein are intended to be exclusive of any element not deemed an essential element to the component, composition, or method (e.g., the composition, method, or respective component thereof “consists of’ the elements described herein). This applies equally to steps within a described method as well as compositions and components therein.

[0159] For convenience, the meaning of some terms and phrases used in the specification, examples, and appended claims, are provided below. Unless stated otherwise, or implicit from context, the following terms and phrases include the meanings provided below. The definitions are provided to aid in describing particular embodiments, and are not intended to limit the claimed invention, because the scope of the invention is limited only by the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. If there is an apparent discrepancybetween the usage of a tenn in the art and its definition provided herein, the definition provided within the specification shall prevail.

[0160] The terms “decrease" “reduced", “reduction", or “inhibit" are all used herein to mean a decrease by a statistically significant amount. In some embodiments, “reduce,” “reduction" or “decrease" or “inhibit” typically means a decrease by at least 10% as compared to a reference level (e.g. the absence of a given treatment or agent) and can include, for example, a decrease by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%. at least about 98%, at least about 99% , or more. As used herein, “reduction” or “inhibition” does not encompass a complete inhibition or reduction as compared to a reference level. "Complete inhibition” is a 100% inhibition as compared to a reference level. A decrease can be preferably down to a level accepted as within the range of normal for an individual without a given disorder.

[0161] The terms “increased”, “increase”, “enhance”, or “activate” are all used herein to mean an increase by a statistically significant amount. In some embodiments, the terms “increased”, “increase”, “enhance”, or “activate” can mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%. or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level. In the context of a marker or symptom, an “increase” is a statistically significant increase in such level.

[0162] As used herein, a "subject" means a human or animal. Usually the animal is a vertebrate such as a primate, rodent, domestic animal, or game animal. Primates include chimpanzees, cynomolgus monkeys, spider monkeys, and macaques, e.g., Rhesus. Rodents include mice, rats, woodchucks, ferrets, rabbits, and hamsters. Domestic and game animals include cows, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cat, canine species, e.g., dog, fox, wolf, avian species, e.g., chicken, emu. ostrich, and fish, e.g., trout, catfish, and salmon. In some embodiments, the subject is a mammal, e.g., a primate, e.g., a human. The terms, “individual," “patient” and “subject” are used interchangeably herein.

[0163] Preferably, the subject is a mammal. The mammal can be a human, non-human primate, mouse, rat, dog, cat, horse, or cow, but is not limited to these examples. Mammals other than humans can be advantageously used as subjects that represent animal models of drain use. A subject can be male or female.

[0164] A subject can be one who has been previously diagnosed with or identified as suffering from or having a condition in need of treatment (e.g., excess fluid) or one or more complications related to such a condition, and optionally, have already undergone treatment for the condition or the one or more complications related to the condition. Alternatively, a subject can also be one who has not been previously diagnosed as having the condition or one or more complications related to the condition. For example, a subject can be one who exhibits one or more risk factors for the condition, or one or more complications related to the condition or a subject who does not exhibit risk factors.

[0165] As used herein, the term “specific binding” refers to an interaction between two molecules, compounds, cells and / or particles wherein the first entity binds to the second entity with greater specificity and affinity than it binds to a third entity. A first entity specifically bound to a second entity is not displaced by a non-similar competitor. In certain embodiments, a first entity is said to specifically bind a second entity when it preferentially recognizes the second entity in a complex mixture of proteins and / or macromolecules. In some embodiments, specific binding can refer to an affinity of the first entity for the second entity which is at least 10 times, at least 50 times, at least 100 times, at least 500 times, at least 1000 times or greater than the affinity for the third entity. In some embodiments, specific binding refers to the ability of a first entity to bind to a second entity with a KD IO5M (10000 nM) or less, e.g., 10’6M, 10’7M. 10’8M. 10~9M, 10~10M. 10nM, 10~12M, or less. The person of ordinary skill in the art can determine appropriate conditions under which a first entity7(e.g., an aptamer or an antibody described herein) selectively binds a second entity (e.g., an antigen or biomolecule) using any suitable methods, such as titration of an entity in a suitable binding assay. In some embodiments, specific binding does not refer to covalent bonding.

[0166] By “conjugated” is meant the covalent linkage of at least two molecules.

[0167] As used herein, the term “antibody reagent” refers to a polypeptide that includes at least one immunoglobulin variable domain or immunoglobulin variable domain sequence and which specifically binds a given antigen. An antibody reagent can comprise an antibody or a polypeptide comprising an antigen-binding domain of an antibody. In some embodiments of any of the aspects, an antibody reagent can comprise a monoclonal antibody or a polypeptide comprising an antigen-binding domain of a monoclonal antibody. For example, an antibody can include a heavy' (H) chain variable region (abbreviated herein as VH), and a light (L) chain variable region (abbreviated herein as VL). In another example, an antibody includes two heavy (H) chain variable regions and two light (L) chain variable regions. The term “antibody reagent” encompasses antigen-binding fragments of antibodies (e.g., single chain antibodies. Fab and sFab fragments, F(ab‘)2. Fd fragments, Fv fragments, scFv, and domain antibodies (dAb) fragments as well as complete antibodies.

[0168] As used herein, the terms “protein" and “polypeptide" are used interchangeably herein to designate a series of amino acid residues, connected to each other by peptide bonds between the alpha-amino and carboxy groups of adjacent residues. The terms "protein", and "polypeptide" refer toa polymer of amino acids, including modified amino acids (c.g., phosphorylated, glycated, glycosylated, etc.) and amino acid analogs, regardless of its size or function. "Protein" and “polypeptide” are often used in reference to relatively large polypeptides, whereas the term "peptide" is often used in reference to small polypeptides, but usage of these terms in the art overlaps. The terms "protein" and "polypeptide" are used interchangeably herein when referring to a gene product and fragments thereof. Thus, exemplary polypeptides or proteins include gene products, naturally occurring proteins, homologs, orthologs, paralogs, fragments and other equivalents, variants, fragments, and analogs of the foregoing.

[0169] As used herein, the term “nucleic acid” or “nucleic acid sequence” refers to any molecule, preferably a polymeric molecule, incorporating units of ribonucleic acid, deoxyribonucleic acid, or an analog thereof. The nucleic acid can be either single-stranded or double-stranded. A single-stranded nucleic acid can be one nucleic acid strand of a denatured double- stranded DNA. Alternatively, it can be a single-stranded nucleic acid not derived from any double-stranded DNA. In one aspect, the nucleic acid can be DNA. In another aspect, the nucleic acid can be RNA. Suitable DNA can include, e.g.. genomic DNA or cDNA. Suitable RNA can include, e.g., mRNA.

[0170] As used herein, “contacting" refers to any suitable means for delivering, or exposing, a first entity / element / agent to at least a second entity / element / agent. Exemplary7delivery methods include, but are not limited to, direct delivery to cell culture medium, perfusion, injection, or other delivery method well known to one skilled in the art. In some embodiments, contacting comprises physical human activity, e.g., an injection; an act of dispensing, mixing, and / or decanting; and / or manipulation of a delivery device or machine.

[0171] The term “statistically significant" or “significantly" refers to statistical significance and generally means a two-standard deviation (2SD) or greater difference.

[0172] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term “about.” The term “about” when used in connection with percentages can mean ±1%.

[0173] As used herein, the term “comprising” means that other elements can also be present in addition to the defined elements presented. The use of “comprising” indicates inclusion rather than limitation.

[0174] The term "consisting of' refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.

[0175] As used herein the term "consisting essentially of' refers to those elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.

[0176] The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. The abbreviation, "e.g." is derived from the Latin exempli gratia and is used herein to indicate a non-limiting example. Thus, the abbreviation "e.g." is synonymous with the term "for example."

[0177] Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Each group member can be referred to and claimed individually or in any combination with other members of the group or other elements found herein. One or more members of a group can be included in. or deleted from, a group for reasons of convenience and / or patentability. When any such inclusion or deletion occurs, the specification is herein deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.

[0178] Unless otherwise defined herein, scientific, and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art to which this disclosure belongs. It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can vary. The terminology7used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present invention, which is defined solely by the claims. Definitions of common terms in biology can be found in The Merck Manual of Diagnosis and Therapy, 20th Edition, published by Merck Sharp & Dolrnie Corp., 2018 (ISBN 0911910190, 978-0911910421); Bruce Alberts et al., Molecular Biology' of the Cell, published by W.W. Norton & Company, 2022 (ISBN 0393884821, 978-0393884821); John M. Lackie eat al. (eds.), The Dictionary of Cell and Molecular Biology, 5thEdition, published by Academic Press, 2013 (ISBN 0123849314, 978- 0123849311); Nalini Chandar et al., Lippincott Illustrated Reviews: Cell and Molecular Biology, 3rdEdition, published by LWW, 2023 (ISBN 1975180895, 978-1975180898); Teresa Atwood et al., Oxford Dictionary of Biochemistry and Molecular Biology , 2ndEdition, published by Oxford University' Press, 2006; Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd.. 1999-2012 (ISBN 9783527600908); Johnathan Law et al., (eds.), A Dictionary of Chemistry, 8thEdition, published by Oxford University Press, 2020 (ISBN 9780198841227, 9780191876783); Robert C. King et al. (eds.), A Dictionary of Genetics, 8thEdition, published by Oxford University Press, 2013 (ISBN 9780199766444, 9780199376865); Richard Cammack et al. (eds.), Oxford Dictionary of Biochemistry and Molecular Biology, 2ndEdition, published by Oxford University Press, 2006 (ISBN 9780198529170, 9780191727641); John Lackie et al. (eds.), A Dictionary of Biomedicine. 2ndEdition, published by Oxford University Press. 2019 (ISBN 9780191829116); Lodish et al., Molecular Cell Biology. 8thEdition, published by W.H. Freeman, 2016 (ISBN 1464183392, 978-1464183393); Abul K. Abbas ct al., Cellular and Molecular Immunology, 10thEdition, published by Elsevier, 2021 (ISBN 0323757480, 978-0323757485); Kenneth M. Murphy et al., Janeway's Immunobiology. 10thEdition, published by W. W. Norton & Company, 2022 (ISBN 0393884899, 978-0393884890); Lewin's Genes XI, published by Jones & Bartlett Publishers, 2014 (ISBN-1449659055); Michael Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y., USA (2012) (ISBN 1936113414); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 0444569464); Laboratory Methods in Enzymology: DNA. Jon Lorsch (ed.) Elsevier, 2013 (ISBN 0124199542); Frederick M. Ausubel (ed.), Current Protocols in Molecular Biology (CPMB), John Wiley and Sons, 1987-2010 (ISBN 047150338X, 9780471503385); Current Protocols in Protein Science (CPPS), John E. Coligan (ed.). John Wiley and Sons, Inc.. 2005; and Current Protocols in Immunology (CPI) (John E. Coligan, ADA M Kruisbeek, David H Margulies. Ethan M Shevach. Warren Strobe, (eds.) John Wiley and Sons, Inc., 2003 (ISBN 0471142735, 9780471142737), the contents of which are all incorporated by reference herein in their entireties.

[0179] Other terms are defined herein within the description of the various aspects of the invention.

[0180] All patents and other publications; including literature references, issued patents, published patent applications, and co-pending patent applications; cited throughout this application are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the technology described herein. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.

[0181] The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize. For example, while method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or functions may be performed substantially concurrently. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the disclosure can be modified, if necessary, to employ the compositions,functions and concepts of the above references and application to provide yet further embodiments of the disclosure. These and other changes can be made to the disclosure in light of the detailed description. All such modifications are intended to be included within the scope of the appended claims.

[0182] Specific elements of any of the foregoing embodiments can be combined or substituted for elements in other embodiments. Furthermore, while advantages associated with certain embodiments of the disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the disclosure.

[0183] In some embodiments, the present technology may be defined in any of the following numbered paragraphs:1. A drain sensor comprising: a) at least one fluid channel comprising an inflow port and an outflow port; and b) at least one sensing element in fluid communication with the fluid channel between the inflow port and outflow port; wherein each of the at least one sensing elements is: i) a constituent sensing element that detects a constituent of a fluid, the constituent sensing element comprising: a) a working electrode comprising a constituent-responsive element, b) a reference electrode, and c) a corm ter electrode; or ii) a flow rate sensing element that detects a flow rate of a fluid, the flow rate sensing element comprising: a) a heater element; and b) a pair of sensing electrodes, wherein the heater is located closer to an end of the fluid channel connected to the inflow port than the pair of sensing electrodes.2. The drain sensor of any one of the preceding paragraphs, wherein each of the working electrode, the reference electrode, and the counter electrode is in fluid communication with the fluid channel.3. The drain sensor of any one of the preceding paragraphs, wherein the constituent is a biomolecule and the constituent-responsive element comprises: a moiety that binds to the working electrode. a moiety that binds specifically to the biomolecule constituent, and a moiety comprising a redox reporter.The drain sensor of any one of the preceding paragraphs, wherein the moiety that binds to the working electrode is a thiol and the working electrode comprises gold, platinum, iridum, and / or stainless steel. The drain sensor of any one of the preceding paragraphs, wherein the moiety that binds to the working electrode is a thiol and the working electrode comprises gold. The drain sensor of any one of the preceding paragraphs, wherein the moiety that binds specifically to the biomolecule constituent is an aptamer. The drain sensor of any one of the preceding paragraphs, wherein the moiety comprising a redox reporter comprises methylene blue, ferrocene, anthraquinone, viologen, Atto MB2, and / or Nile Blue. The drain sensor of any one of the preceding paragraphs, wherein the moiety comprising a redox reporter comprises methylene blue. The drain sensor of any one of the preceding paragraphs, wherein the constituent is H+and the constituent-responsive element comprises a pH responsive material. The drain sensor of paragraph 9. wherein the pH responsive material comprises polydopamine, poly(methacrylic acid) (PMAAc). poly[(2-dimethylamino)ethyl methacrylate] (PDMA), poly(2-acrylamido-2-methylpropane sulfonic acid) (PAMPS) and poly(4- styrenesulfonic acid) (PSSA). Polyacrylic acid (PAA), PVA or PVBA, Polyvinyl benzoic acid. Polyvinyl acid, poly(L-glutamic acid) PLGA, Alginic acid, Hyaluroinic acid (HA), or a combination thereof. The drain sensor of paragraph 9 or 10. wherein the pH responsive material comprises poly dopamine. The drain sensor of any one of paragraphs 9-11, wherein the pH responsive material comprises a polydopamine film. The drain sensor of any one of paragraphs 9-12, wherein the pH responsive material comprises a coating on the working electrode. The drain sensor of any one of the preceding paragraphs, wherein the working electrode of the constituent sensing element comprises gold. The drain sensor of any one of the preceding paragraphs, wherein the reference electrode of the constituent sensing element comprises gold. The drain sensor of any one of the preceding paragraphs, wherein the counter electrode of the constituent sensing element comprises silver and silver chloride. The drain sensor of any one of the preceding paragraphs, wherein each of the pair of sensing electrodes is in fluid communication with the fluid channel. The drain sensor of any one of the preceding paragraphs, wherein the heater element is in fluid communication with the fluid channel.The drain sensor of any one of the preceding paragraphs, wherein the heater element is not in fluid communication with the fluid channel. The drain sensor of any one of the preceding paragraphs, wherein the heater element is in thermal communication with the fluid channel. The drain sensor of any one of the preceding paragraphs, wherein the heater element is an electrical heater element. The drain sensor of paragraph 21. wherein the electrical heater element comprises copper. The drain sensor of paragraph 22. wherein the electrical heater element is serpentine in shape. The drain sensor of any one of the preceding paragraphs, wherein the heater element and pair of sensing electrodes are attached to a flexible polymer base. The drain sensor of paragraph 24. wherein the flexible polymer base comprises polyamide. The drain sensor of any one of the preceding paragraphs, wherein the heater element is located at least 1 mm closer to the inflow port than the pair of sensing electrodes. The drain sensor of any one of the preceding paragraphs, wherein the heater element is located about 1 mm closer to the inflow port than the pair of sensing electrodes. The drain sensor of any of the preceding paragraphs, wherein the at least one sensing element collectively detects one or more of: lactate, glucose, glucose ratio. pH. and flow rate. The drain sensor of any one of the preceding paragraphs, wherein the aptamer that binds specifically to glucose comprises:ACGACCGTGTGTGTTGCTCTGTAACAGTGTCCATTGTCGT (SEQ ID NO: 1) The drain sensor of any one of the preceding paragraphs, wherein a sensing element that detects lactate comprises:GACGACGAGTAGCGCGTATGAATGCTTTTCTATGGAGTCGTC (SEQ IDNO:2), orGACGACGCAGGGAGTTTTAACGGCTCTTGCGACTGTGTCGTC (SEQ ID NO: 3). The drain sensor of any one of the preceding paragraphs, further comprising a hydrogel in the fluid channel and in contact with the working electrode. The drain sensor of paragraph 31, wherein the hydrogel comprises agarose, polyacrylamide, cellulose, cellulose acetate, agar, sephadex, chitosan, alignate, and / or collagen. The drain sensor of paragraph 31. wherein the hydrogel is an agarose hydrogel. The drain sensor of any one of paragraphs 31-33, wherein the hydrogel is a l%-5% hydrogel. The drain sensor of any one of paragraphs 31-34, wherein the hydrogel further comprises one or more DNAse inhibitors. The drain sensor of paragraph 35. wherein the one or more DNAse inhibitors comprises rutin.The drain sensor of any one of the preceding paragraphs, comprising a plurality of sensing elements. The drain sensor of paragraph 37, wherein the plurality of sensing elements are arranged in series. The drain sensor of paragraph 37, wherein the plurality of sensing elements are arranged in parallel. The drain sensor of any one of the preceding paragraphs, comprising a plurality of constituent sensing elements, each constituent sensing element detecting a different constituent of the fluid. The drain sensor of any one of the preceding paragraphs, comprising a flow rate sensing element and at least one constituent sensing elements. The drain sensor of any one of the preceding paragraphs, comprising a flow rate sensing element and a plurality of constituent sensing elements, each constituent sensing element detecting a different constituent of the fluid. The drain sensor of any of the preceding paragraphs, wherein the inflow port and / or the outflow port is configured to attach to a drain and / or catheter tube. The drain sensor of any of the preceding paragraphs, wherein the fluid channel and at least one sensing element are provided in a housing unit. The drain sensor of paragraph 44, wherein the housing unit comprises a biocompatible resin. The drain sensor of any one of the preceding paragraphs, wherein the drain sensor is provided in a catheter tube or is permanently affixed to a catheter tube. The drain sensor of any one of the preceding paragraphs, wherein the drain sensor is provided in a drain or is permanently affixed to a drain. The drain sensor of paragraph 47, wherein the drain is an internal ventricular drain, an external ventricular drain, a shunt, a cerebral shunt, a cerebrospinal fluid shunt, a lumbar- peritoneal shunt, a peritoneovenous shunt, a passive drain (e.g., a penrose drain), a urinary catheter, a chest tube or thoracostomy catheter, an abdominal drain (e.g., Jackson-Pratt or Blake drain), a central venous catheter, a biliary drain, a nephrostomy drain, a gastrointestinal drain, a gastrointestinal drain, a peritoneal catheter, a wound drain, a sump drain, a hemovac drain, a silicone drain, a redon drain, a pleural drain, a pigtail catheter comiected to any bodily cavity and comprising an external portion, a pancreastic drain, a drain connected to a vacuum, an indwelling catheter, and a thoracostomy tube. The drain sensor of any one of the preceding paragraphs, further comprising a transmitter or transceiver. The drain sensor of any one of the preceding paragraphs, further comprising a wired transmitter or wired transceiver.The drain sensor of any one of the preceding paragraphs, further comprising a wireless transmitter or wireless transceiver. The drain sensor of any one of paragraphs 49-51, wherein the transmitter or transceiver transmit a signal. The drain sensor of paragraph 52, wherein the signal comprises the current, voltage, and / or impedance detected by the at least one sensing element. A drain monitoring system, comprising the drain sensor of any one of the preceding paragraphs and further comprising a controller. The drain monitoring system of paragraph 54, wherein the controller receives a signal from the at least one sensing element and is configured to calculate the concentration or magnitude of the analyte and / or characteristic from the signal. The drain monitoring system of paragraph 55. wherein the calculation is based on one or more standards or calibration curves. The drain monitoring system of paragraph 55 or 56, wherein the calculation is based on kinetic differential measurements. The drain monitoring system of any one of paragraphs 54-57, wherein the controller is wirelessly connected to the drain sensor. The drain monitoring system of any one of paragraphs 54-57, further comprising a wired comrection between the controller and the drain sensor. The drain monitoring system of any one of paragraphs 54-59, further comprising a display. The drain monitoring system of any one of paragraphs 54-60, wherein the controller is configured to provide an alert if the drain sensor detects i) a specified level or change in a level of constituent and / or the flow rate; and / or ii) a disconnection or a loss of power. The drain monitoring system of any one of paragraphs 54-61, wherein the controller is configured to transmit a signal to a drain pump or valve if the drain sensor detects a specified level or change in a level of constituent and / or the flow rate. The drain sensor or drain monitoring system of any one of the preceding paragraphs, wherein the drain sensor is located outside of a patient's body and / or configured to be located outside of a patient’s body. The drain sensor or drain monitoring system of paragraph 63, wherein the drain sensor is located or attached to an external portion of a drain and / or configured to be located in or attached to an external portion of a drain. The drain sensor or drain monitoring system of paragraph 63, wherein the drain sensor is located or attached to percutaneous port and / or configured to be located in or attached to an percutaneous port.66. The drain sensor or drain monitoring system of any one of the preceding paragraphs, wherein the drain sensor comprising a wireless transmitter or wireless transceiver is located inside of a patient’s body and / or configured to be located inside of a patient's body.67. The drain sensor or drain monitoring system of any one of the preceding paragraphs, wherein the drain sensor is located inside of a patient’s body and / or configured to be located inside of a patient’s body.68. A kit comprising the drain sensor and / or drain monitoring system of any one of the preceding paragraphs and one or more of: one or more drains; one or more catheter tubes; and one or more collection bags.69. The kit of paragraph 68, wherein the one or more drains are selected from the group consisting of: an internal ventricular drain, an external ventricular drain, a shunt, a cerebral shunt, a cerebrospinal fluid shunt, a lumbar-peritoneal shunt, a peritoneovenous shunt, a passive drain (e.g., a penrose drain), a urinary catheter, a chest tube or thoracostomy catheter, an abdominal drain (e.g., Jackson-Pratt or Blake drain), a central venous catheter, a biliary drain, a nephrostomy drain, a gastrointestinal drain, a gastrointestinal drain, a peritoneal catheter, a wound drain, a sump drain, a hemovac drain, a silicone drain, a redon drain, a pleural drain, a pigtail catheter connected to any bodily cavity and comprising an external portion, a pancreastic drain, a drain comrected to a vacuum, an indwelling catheter, and a thoracostomy tube.

[0184] The technology described herein is further illustrated by the following examples which in no way should be construed as being further limiting.EXAMPLESExample 1

[0185] The external ventricular drain (EVD) system is routinely employed in the neurological intensive care unit (ICU) and senes as a temporary method for draining the excess cerebrospinal fluid (CSF) from the brain ventricles, where the excess CSF is accumulated ’. EDV is particularly crucial for maintaining intracranial pressure (ICP) in patients with acute brain injuries such as patients with traumatic brain injury, intracerebral hemorrhage, hydrocephalus, or other conditions that are associated with elevated ICP2. Additionally, patients undergoing neurosurgical procedures may require temporary CSF drainage via EVD to manage postoperative complications or monitor ICP3.

[0186] Despite the popularity of the EVD system as the gold standard method for maintaining ICP, EVD implementation carries a notable risk of risk of infection4EVD-related infection isreported in 5-20% of patients with EVD5. Failure to promptly identify and treat infections can result in exacerbating consequences, such as severe meningitis, which can lead to neural damage, cognitive impairments, permanent disability , and death67. Furthermore, patients with delayed detection of EVD-related infection can experience prolonged ICU stays and escalated healthcare costs ‘, x. The EVD system is also prone to mechanical failure and blockage, indicated by a decrease or complete disappearance of CSF flow9Thus, continuous monitoring of CSF fluid for signs of infection and vigilance in assessing the EVD system for any indications of malfunction are highly important10

[0187] Existing approaches for detecting EVD-related infection primarily entail either clinical observation of symptoms or biochemical and microbiological analysis performed in medical laboratories6’7. However, relying solely on clinical signs may lack accuracy, as infection symptoms can overlap with other disease manifestations. Conversely, laboratory' -based methods are labor- intensive. with a lengthy turnaround time of 48 hours, limiting their ability to provide timely identification of infection71f Moreover, these methods do not offer the hourly temporal resolution necessary for rapid detection, further hindering effective intervention7,1*. The identification of EVD failure currently relies on subjective manual assessments by healthcare providers, resulting in inherent inaccuracies and a lack of real-time detection capability.

[0188] Specific biomarkers present in the CSF can serv c as indicators of infection, offering valuable diagnostic and prognostic insights. For example, lactate exhibits a 98% accuracy in identifying infection and distinguishing between bacterial and non-bacterial meningitis, thereby informing antibiotic treatment decisions12. Elevated CSF lactate levels may also signify conditions such as severe cerebral hypoxia, intracranial hemorrhage, and epilepsy13,14. The CSF: Blood glucose ratio represents another important marker commonly utilized in clinical settings for patients with neuropathological conditions14. However, achieving accurate glucose detection often necessitates die averaging of multiple lumbar punctures, a procedure associated with an inherent risk of infection15. Nonetheless, low CSF glucose levels and altered CSF: blood glucose ratios serve as valuable indicators for diagnosing microbial meningitis16and may also signal nervous system inflammation or the presence of a tumor17. CSF pH also serves as a key health marker, with reduced levels observed in patients with meningitis18,19. Conversely, an elevation in CSF pH may signify diminished brainblood flow, resulting in decreased consciousness18,19.

[0189] To address the need for non-invasive and continuous monitoring of critical biomarkers for infection prediction and EVD failure, described herein are devices, e.g., a sensing box (certain embodiments being referred to as “EVD NcuroScnsc"). capable of performing simultaneous detection of glucose, lactate, and pH as well as flow rate. By incorporating sensors for these clinically significant biomarkers, the devices described herein facilitate early infection detection. Moreover, its integrated flow sensor promptly alerts healthcare providers to potential EVD system failures by monitoring CSF flow rate and reporting any reductions or elevation.

[0190] Table 1. Table representing the components that form some embodiments of the devices and / or systems described herein (e.g., the EVD NeuroSense) and the materials they have been made of. WE: Working electrode, RE: reference electrode, and CE: counter electrode.

[0191] Results and Discussion

[0192] The EVD NeuroSense System and Its Sensing Strategy

[0193] The EVD NeuroSense comprises a 3D-printed box holder, crafted from biocompatible resin, which seamlessly integrates sensors for detecting four key indicators: flow rate, glucose, lactate, and pH. As illustrated in Figs. 1A-1B, the EVD NeuroSense connects directly to EVD tubing, enabling non-invasive and continuous monitoring of CSF biomarkers and flow. The collected data, encompassing flow rate, pH values, and levels of glucose and lactate, is then displayed on a monitor, facilitating real-time and continuous patient surveillance. The panels in Figs. 1A-1B represent the output data from each of the sensors which will be used to draw the levels of glucose, lactate, pH, and flow rate along with alerts for abnormal readings.

[0194] Measurement of CSF lactate is highly beneficial in indicating infection. Specifically, elevated CSF lactate levels serve as a sensitive biomarker, aiding clinicians in distinguishing between bacterial and non-bacterial meningitis, thereby guiding appropriate antibiotic therapy20,21. Monitoring CSF glucose levels is also important as a decline in the CSF glucose level is an important indicator for diagnosis of neural system infection and carcinoma22,23. The ratio of CSF: blood glucose also can be a sign of impaired blood flow to brain ventricles18. Therefore, described herein is the development of electrochemical aptamer-based lactate and glucose sensors capable of real-time and continuous monitoring of lactate and glucose. The electrochemical lactate and glucose aptamer-based sensors were fabricated using screen-printed electrodes with three -electrode systems (silver / silver chloride (Ag / AgCl) reference electrode as well as gold (Au) counter and working electrodes (WE). The WE surface was functionalized with the previously reported lactate or glucose aptamer probes24,25whose one end was conjugated with thiol and the other end was labeled with methylene blue (MB), a redox reporter (Fig. 2A. i). The thiol group enables aptamer immobilization on the gold surface through gold-thiol self-assembled chemistry26The MB redox reporter signals the presence of the target of interest27,28. In the absence of lactate or glucose, the MB redox reporter is distanced from the electrode surface; thus, the electron transfer happens slowly, and a lower current is observed (Fig. 2A, ii). Once the aptamers recognize and bind to their respective targets, they undergo a conformational change that brings the MB-modified terminus of the aptamer closer to the surface of the electrode, leading to a faster electron transfer and producing a higher electrochemical response27,28(Fig. 2A, ii). Square wave voltammetry (SWV) was used to capture the generated electrochemical signal and the difference in the charge transfer kinetics between tire bound and unbound states of tire aptamers was used to calculate the kinetic differential measurement (KDM)29. This method, previously developed for aptamer-based biosensors, effectively reduces sensor-to-sensor variability, corrects signal drift, and enhances the signal-to-noise ratio30,31. The fabricated lactate and glucose sensors were tested for detection of lactate, and glucose in spiked artificial CSF (aCSF), respectively. The performance of these two sensors is presented in Fig. 2B and Fig. 2C. The physiological levels of glucose and lactate in CSF are 2.5 mM - 4 mM and 1.1 mM - 2.4 mM, respectively. Importantly, these glucose and lactate aptasensors showed the limit of detections (LOD) of 0.088 mM, and 0.99 mM, respectively, and could successfully detect glucose and lactate at their physiological ranges. They are also able to cover the pathological ranges of glucose and lactate, tire former being 2.5Mm - 20 mM and the latter being 1 mM -10 mM (Figs. 2B-2C).

[0195] Monitoring the level of CSF pH is also of significant importance, as patients with infection, intracranial hemorrhage, and declined brain-blood flow may experience altered pH levels compared to normal values32. To enable real-time pH detection, a pH sensor is described herein that displays electrochemical responses to changes in pH33. The sensor is fabricated by electrochemically depositing a thin film of polydopamine (PDA), a biocompatible pH responsive material, on thesurface of WE. For pH sensor fabrication also the screen-printed electrodes with a silver reference and gold counter electrode were used34(Fig. 2D, i). The deposited PDA thin film has catechol moieties that are electrically oxidized when subjected to cyclic voltammetry (CV) (Figs. 7A-7B and Fig. 2D). In other word, at high pH, due to the low concentration of H+, the forward oxidation reaction is favorable and happens at lower voltages, however, when the pH value is low, the oxidation reaction is not as favorable, thus larger voltage is required and an increase in voltage is observed (Figs. 7A-7B and Fig. 2D, ii). Therefore, the level of pH can be detennined based on the electro-oxidation voltage. The nonnal level of CSF pH is 7.28 - 7.32, with values lower than 7.28 and higher than 7.32 calling for further clinical examination. Importantly, the developed pH sensor displayed a sensitivity of 0.05 (slope of linear line = 0.05) meaning it can respond to pH changes as low as 0.05 within the range of 6 - 8; thereby, enabling evaluations of physiological and pathological ranges (Fig. 2F).

[0196] Different events like hematoma (blood clot in ventricles), ventricular debris, or catheter displacement can lead to catheter obstruction and impair CSF drainage35, leading to detrimental consequences like elevated ICP3\ To monitor EVD catheters for blockage a flow sensor was developed and integrated in the EVD NeuroSense system3637. As depicted in Fig. 2F, the flow sensor has a flexible polyamide base, and consists of two main parts, the first part is a copper serpentineshaped heater that is connected to the voltage sources and heats the flowing CSF, and the second part is a pair of square-shaped copper electrodes located in 1mm distance of the heater (Fig. 2F, ii). The flow sensor operates based on transporting heat from the resistant heater to the pair of sensing electrodes (Fig. 2F, ii). At higher temperatures, the electrode's impedance (Z) decreases; this decrease happens faster when the flow rate is larger. As soon as the flow starts after a period of stagnation, the impedance decreases, an event that happens at faster rates in high How rates (data not shown). Therefore, to draw a calibration curve, we use the slope of the decrease line (otherwise known as the rate of impedance reduction) as a function of different How rates (Figs. 2A-2G). The normal CSF flow' rate within the EVD system in 150 - 400 pL / min, with values outside this range signaling an issue and the complete disappearance of flow reporting blockage, requiring immediate intervention!. this flow' sensor shows great sensitivity to flow changes as low as 0.0002 (sensitivity = slope of linear line) and its detection range covers both normal and abnormal flow rates (Fig. 2G). Altogether, these data show' that the developed sensors are capable of detecting their respective biomarkers at their normal and abnormal ranges.

[0197] Enabling Durable Sensing via EVD NeuroSense

[0198] To permit continuous monitoring of CSF via EVD NeuroSense device, the sensors should perform stably after application of several scans. Therefore, the response of each of the fabricated glucose, lactate. pH. and flow sensors was tested while they were subjected to multiple consequent scans. To resemble the real environment that the sensors would perform at, the sensors were incubated in human CSF (hCSF). hCSF contains large protein and cells, as well as DNA hydrolyses (DNAse);thus, induces sensor degradation via causing fouling, displacing the aptamers and PDA, and degrading aptamer nucleic acid strands38 39(Fig. 3A). To prevent sensor degradation, die sensors were coated with a thin layer of 3% agarose hydrogel post fabrication 28(Fig. 3B). The agarose layer is porous and acts like a filter, impeding the passage of large molecules and nucleic acid hydrolyses, thereby, protecting the sensors from decay28 40(Fig. 3B). Agarose is also highly biocompatible, alleviating possible toxicity concerns40,41. Agarose coating had been previously used to produce durable electrochemical aptamer-based sensors28. To ensure this method would produce same results on the glucose and lactate sensors, both non-coated and agarose-coated sensors were tested when subjected to more than 100 scans (Figs. 3C-3D). As shown, in the absence of the coating (pink data on Fig. 3C), glucose sensor’s response to 5mM glucose in hCSF is highly variable, with a 40% decline during the first 50 scans, followed by another major decline during the last 100 scans. However, the agarose coated glucose sensor (blue line on Fig. 3C) displayed a stable signal with less than 5% deviation from the initial signal, confirming the positive impact of agarose coating on glucose sensor’s durability. The lactate senor also showed a larger variation in signal changes when the agarose coating was absent, but the difference between the agarose-coated and non-coated sensors were not as significant as glucose sensors. This is likely because the lactate aptamer, when bounded to its target, experiences a higher degree of folding, making it more resistant to degradation24,23,42

[0199] The pH sensor’s response to a pH of 7.3 also drifted more than 50% by the thirtieth scan (pink line Fig. 3E). Interestingly, this signal drift was only 25% in agarose-coated pH sensors, likely because the agarose had prevented the passage of large molecules and the consequent PDA displacement33(Fig. 3E). The performance of the flow sensor was also examined over 30 scans and proved to be stable with less than 20% variation in signals when compared to the initial signal (Fig. 3F).

[0200] The EVD systems are changed every 5-10 days; therefore, for the instant sensors to be compatible with EVD, they should display long-term stability of up to 5-10 days43. To test the time- resolved stability of glucose and lactate sensors, they were fabricated as usual, were either coated with agarose or left uncoated and scanned in target-spiked hCSF right after fabrication (known as the base signal, later used to determine the signal change). Subsequently, they were stored in target-spiked hCSF and tested every couple of days up to the point the point that they were not showing any signal. The non-agarose-coated glucose and lactate sensors lasted for 7 and 3 days, respectively (Figs. 3G- 3H). The agarose coating could extend the length of operations to 11 and 21 days for glucose and lactate sensors, respectively (Figs. 3G-3H). Furthermore, when a plant based and edible DNAse inhibitor (rutin) was incorporated inside2544the agarose coating on glucose sensors, the glucose sensor’s function was prolonged to 17 days (Fig. 4G). Conclusively, these data indicate the durability of fabricated sensors in both scan-based (after application of multiple scans) and time-resolved (after storage for multiple days) fashions.

[0201] Testing the Performance of EVD NeuroSense in a Simulated Environment

[0202] After developing and testing the glucose, lactate, pH, and flow sensors for functionality and stability, the EVD NeuroSense box embodiment was fabricated. The EVD NeuroSense box is composed of a 3D printed box made form biocompatible resin, with an inlet for the incoming catheter, an outlet for the outgoing catheter, and four openings (each for one of the sensors) (Fig. 4 A, i). After inserting the electrodes, all the opening is sealed by applying epoxy and curing it via UV radiation (Fig. 4A, i). The EVD NeuroSense box is designed to interface with EVD catheters, allowing CSF to pass through the box while sensors within detect the biomarkers. These sensors monitor not only the flow rate but also the concentrations of lactate, glucose, and pH in the CSF. To replicate the physiological environment and induce flow, a syringe pump housing a syringe that contains CSF spiked with the target analytes was employed (Fig. 4A, ii). This pump is connected to the inlet of the EVD NeuroSense via a 3mm diameter tube, mirroring the dimensions of EVD catheters, to facilitate the flow of CSF into the box (Fig. 4A, ii). Within the system, sensors are connected to a bench top electrochemical workstation (called potentiostat), which conducts electrochemical scanning and reading. To ensure that these sensors would maintain accuracy for detecting targets in this system, the aCSF was spiked with different concentrations of glucose or lactate, the syringe filled with that, and the fluid run to the box with the flow rate of 160 pL / min (resembling a physiologically relevant flow rate) (Fig. 4). The glucose and lactate sensors responded to changes in the levels of glucose and lactate with a high correlation of 0.98 and 0.93, indicating their ability to accurately detect glucose and lactate even during flow (Figs. 4B-4C). Similarly, the syringe was filled with CSF that holds different pH values, and the pH sensors were employed to determine the pH levels. As depicted in Fig. 4D, the response of the pH sensor closely aligns with the fluctuations in pH values, demonstrating a strong correlation coefficient of 0.9. The flow sensor also displayed a good response to the changes in flow rate with a good correlation or 0.95 (Fig. 4E). Altogether, the EVD NeuroSense had showed a good accuracy and sensitivity in detecting the clinically important targets of glucose, lactate, pH, and flow rate in the depicted set up, which simulates the EVD.

[0203] Discussion

[0204] Described herein is a sensing box (e g., EVD NeuroSense), that seamlessly comiects to the EVD catheters, and monitors the levels of lactate, glucose, pH, and flow rate in the flowing CSF in a real time manner. The real time identification of lactate, glucose and pH will report about lifethreatening ventricular pathologies, a major one being the occurrence EVD-related infection ’. The placement of flow sensor also allows for fast identification of mechanical failures in EVD system, thereby, enabling quick interventions and preventing elevated ICP as well as its detrimental consequences like such as brain hemorrhage, impaired blood flow, and necrosis which can cause permanent disability and death, if left unattended2Monitoring the level of biomarkers in CSF also allows clinicians to assess the effectiveness of therapeutic interventions and allows for personalizedtreatment optimization based on individual patient's physiological responses11 18. Importantly, the EVD NeuroSense system is designed as a modular system, enabling easy integration into the EVD and other surgical drains, including Jackson-Pratt (JP) drain, a drainage system that is placed in wounds during surgery . The EVD NeuroSense is a tool to inform clinicians about patient’s neural health near their bedside.

[0205] Reference:1. Muralidliaran, R. External ventricular drains: Management and complications. Surg Neurol Int6, S271-S274 (2015).2. Shim, Y. et al. Intracranial Pressure Monitoring for Acute Brain Injured Patients: When.How, What Should We Monitor. Korean J Neurotrauma 19, 149-161 (2023).3. — +"t Rooks, M.G and Garrett, W.S, 2016.HHS Public Access. PhysiolBehav 176, 139-148 (2017).4. Choo, Y. H. et al. Significant Reduction in External Ventricular Drain-Related Infections After Introducing a Novel Bundle Protocol: A Before and After Trial. J Korean Med Sci 38, 1-13 (2023).5. Beer, R., Lackner, P., Pfausler, B. & Schmutzhard, E. Nosocomial ventriculitis and meningitis in neurocritical care patients. J Neurol 255, 1617-1624 (2008).6. Hagel, S. et al. External ventricular drain infections: Risk factors and outcome. Interdiscip Perspect Infect Dis 2014, (2014).7. Benninger, F. & Steiner, I. John Bennett, Raphael Dolin, Martin J. Blaser. Mandell, Douglas, and Bennett’s Principles and Practice of Infectious Diseases. 8th Ed. Saunders. 2014. 3904 p. (2020).8. Hersh, E. H. et al. Patterns of Health Care Costs Due to External Ventricular Drain Infections. World Neurosurg 128, e31-e37 (2019).9. Pandit, A. S., Palasz, J., Nachev, P. & Toma, A. K. Mechanical Complications of External Ventricular and Lumbar Drains. World Neurosurg 166, el40-el54 (2022).10. Soler, G. J. et al. A review of cerebral shunts, current technologies, and future endeavors.Yale Journal of Biology and Medicine 91. 313-321 (2018).11. Gordon. M. et al. Diagnosing external ventricular drain-related ventriculitis by means of local inflammatory response: Soluble triggering receptor expressed on myeloid cells-1. Crit Care 18, 1-8 (2014).12. Huy, N. T. et al. 1 Cerebrospinal fluid lactate concentration to distinguish bacterial from aseptic meningitis: A systemic review and meta-analysis. Crit Care 14, R240 (2010).13. Wit, C. J. De. Engelen, B. G. Van & Willemsen, M. A. Child Neurology : Differential diagnosis of a low CSF glucose in children and young adults. (2013).14. Gouvca Bogossian, E. et al. Ccrcbro-spinal fluid glucose and lactate concentrations changes in response to therapies in patients with primary brain injury: the START-TRIP study. Crit Care 27, 1-11 (2023).15. Shi, K. et al. Measuring blood glucose before or after lumbar puncture. 1-9 (2023) doi:10.7717 / peerj.15544.16. Baud, M. O. et al. Pleocytosis is not fully responsible for low CSF glucose in meningitis. Neurol Neuroimmunol Neuroinflamm 5, 1-8 (2018).17. Nigg, J. T. SPublic Access. Bone 23. 1-7 (2008).18. Hrishi, A. P. & Sethuraman, M. Cerebrospinal fluid (CSF) analysis and interpretation in neurocritical care for acute neurological conditions. Indian Journal of Critical Care Medicine 23, S115-S119 (2019).19. Milner, A. D.. Lagercrantz. H. & Wickstrom, R. Control of breathing. Neonatal Respiratory Disorders, Second Edition 38 49 (2003) doi:10.3109 / 9780203427583-12.20. Stephani. C.. Choi, A. H. K. & Moerer, O. Point-of-care detection of lactate in cerebrospinal fluid. Intensive Care Medicine Experimental 9. (2021).21. Wang. Q., Wang. Y. F.. Yang. Y.. Kong. Y. X. & Peng, Y. The value of elevated cerebrospinal fluid lactate concentrations in post-neurosurgical bacterial meningitis. BMC Neurol 23, 1-8 (2023).22. Johnston, M. G. Relationship between cerebrospinal fluid and extracanial lymph. Lymphology 33, 1-3 (2000).23. Tan. Q. C. et al. Correlation between blood glucose and cerebrospinal fluid glucose levels in patients with differences in glucose metabolism. Front Neurol 14, 1-6 (2023).24. Huang, P. J. J. & Liu, J. Simultaneous Detection of L-Lactate and D-Glucose Using DNA Aptamers in Human Blood Serum. Angewandte Chemie - International Edition 62, 1-5 (2023).25. Nakatsuka, N. et al. Aptamcr-ficld-cffcct transistors overcome Debye length limitations for small-molecule sensing. Science (1979) 362, 319-324 (2018).26. Zhang, X. & Yadavalli, V. K. Surface immobilization of DNA aptamers for biosensing and protein interaction analysis. Biosens Bioelectron 26, 3142-3147 (2011).27. Nguyen. M. D. et al. Electrochemical Aptamer-Based Biosensors for Measurements in Undiluted Human Saliva. ACS Sens 8, 4625-4635 (2023).28. Li, S. et al. Implantable Hydrogel-Protective DNA Aptamer-Based Sensor Supports Accurate, Continuous Electrochemical Analysis of Drugs at Multiple Sites in Living Rats. ACS Nano 17. 18525-18538 (2023).29. Ferguson, B. S. et al. Real-Time, Aptamer-Based Tracking of Circulating Therapeutic Agents in Living Animals. Sci TranslMed 5. (2013).30. Reynoso, M. et al. 3D-printcd, aptamer-based micronccdlc sensor arrays using magnetic placement on live rats for pharmacokinetic measurements in interstitial fluid. Biosens Bioelectron 244, 956-5663 (2023).31. Wu, Y. et al. Microneedle Aptamer-Based Sensors for Continuous, Real-Time Therapeutic Drug Monitoring. Anal Chem 94, 8335-8345 (2022).32. Royston, D. Nunn's Applied Respiratory Physiology. British journal oj' anaesthesia : BJA 85, 180 (2000).33. Amiri, M., Amali, E., Nematollahzadeh, A. & Salehniya. H. Poly-dopamine films: Voltammetric sensor for pH monitoring. Sens Actuators B Chem 228. 53-58 (2016).34. Szewczyk, J., Aguilar-Ferrer. D. & Coy, E. Polydopamine films: Electrochemical growth and sensing applications. Eur Polym J 174, (2022).35. Mottolese. C.. Beuriat. P.-A.. Szathmari, A. & Di Rocco. F. Complications Related to the Treatment of Hydrocephalus with Extrathecal Cerebrospinal Fluid Shunts, in 681-704 (Springer International Publishing, Cham). doi:10.1007 / 978-3-319-72168-2_33.36. Kim, B. J. et al. Parylene MEMS patency sensor for assessment of hydrocephalus shunt obstruction. Biomed Microdevices 18. 1-13 (2016).37. Baldwin. A., Yu. L. & Meng, E. An Electrochemical Impedance-Based Thermal Flow Sensor for Physiological Fluids. Journal of Microelectromechanical Systems 25, 1015-1024 (2016).38. Buckell, M. Enzymes in the Cerebrospinal Fluid. Proceedings of the Association of Clinical Biochemists 5, 33-34 (1968).39. Schilde, L. M. et al. Protein variability in cerebrospinal fluid and its possible implications for neurological protein biomarker research. PLoS One 1-19 (2018).40. Russo, M. J. et al. Antifouling Strategies for Electrochemical Biosensing: Mechanisms and Performance toward Point of Care Based Diagnostic Applications. ACS Sens 6, 1482-1507 (2021).41. FERNANDEZ-COSSIO, S., LEON-MATEOS, A., GUDE SAMPEDRO, F. & CASTANO OREJA, M. T. Biocompatibility of agarose gel as a dermal filler : Histologic evaluation of subcutaneous implants. Plastic and reconstructive surgery (1963) 120, 1161-1169 (2007).42. Kratschmer, C. & Levy, M. Effect of Chemical Modifications on Aptamer Stability in Serum. Nucleic Acid Ther 27, 335-344 (2017).43. Katzir, M. et al. Decreasing External Ventricular Drain-Related Infection Rates with Duration-Independent, Clinically Indicated Criteria for Drain Revision: A Retrospective Study. World Neurosurg 131, e474-e481 (2019).44. Kolarevic. A. et al. Rutin as Deoxyribonuclease I Inhibitor. Chem Biodivers 16, el900069-n / a (2019).Example 2: Smart shunt for chemical and physical sensing of body fluids.

[0206] Medical shunts arc implantable devices used to create artificial pathways for bodily fluids. They are commonly employed to treat conditions where fluid flow needs to be redirected, such as in cerebrospinal fluid shunts for hydrocephalus, vascular shunts for blood flow diversion, or dialysis shunts for kidney patients. These devices play a critical role in maintaining or restoring the normal flow and balance of bodily fluids, improving patient health and well-being.

[0207] Cerebrospinal fluid (CSF) shunts are medical devices utilized in the clinical management of hydrocephalus, a condition marked by an abnonnal buildup of CSF within the brain's ventricles. These shunts consist of a one-way valve and tubing system. They are surgically implanted to divert excess CSF away from the brain, ensuring it is absorbed in another part of the body, typically the abdominal cavity. By maintaining a controlled flow and reducing intracranial pressure, CSF shunts alleviate or prevent the symptoms associated with hydrocephalus, such as headaches, nausea, and vision problems. Regular monitoring and potential adjustments are required to ensure the shunt remains effective in improving the patient's quality of life.

[0208] The most common uses for cerebrospinal fluid (CSF) shunts are:1. Hydrocephalus Management: CSF shunts are primarily used to treat hydrocephalus, a condition characterized by an excess buildup of CSF in the brain's ventricles. Shunts divert and regulate CSF flow to relieve intracranial pressure, preventing brain damage and alleviating symptoms like headaches and nausea.2. Intracranial Pressure Control: In cases of traumatic brain injuries, intracranial hemorrhages, or infections. CSF shunts can help control intracranial pressure by draining excess fluid, reducing the risk of neurological damage.3. Pseudotumor Cerebri: Shunts may be employed to manage pseudotumor cerebri (idiopathic intracranial hypertension), a condition characterized by increased intracranial pressure, often without an obvious cause, which can lead to vision problems and severe headaches.4. Cyst Drainage: CSF shunts can be used to drain or manage cerebrospinal fluid in cysts or lesions within the brain, spinal cord, or other parts of the central nervous system, aiding in diagnosis and symptom relief.5. Spina Bifida: In cases of myelomeningocele or spina bifida, CSF shunts may be used to manage hydrocephalus and prevent further complications related to the spinal cord's exposure.These shunts play a vital role in preserving neurological health and quality of life by regulating CSF flow and intracranial pressure in various clinical scenarios.

[0209] A dram is a sterile, flexible conduit designed to facilitate the controlled and aseptic removal of bodily fluids, exudates, or gases from a body cavity or wound, serving to mitigate fluid accumulation, prevent infection, and optimize healing following surgical procedures or in pathological states. These conduits, typically consisting of catheters or tubes, play an instrumental role in the preservation of physiological homeostasis and the facilitation of therapeutic interventions.

[0210] Catheters arc widely used as drains in the medical world for various purposes:1. Urinary Catheters: Urinary catheters are frequently used to drain urine from the bladder in patients who are unable to urinate naturally due to medical conditions such as urinary retention, surgery, or paralysis. Indwelling (Foley) catheters, intermittent catheters, and suprapubic catheters are common types used for urinary drainage.2. Chest Tubes: Chest tubes, or thoracostomy catheters, are inserted into the pleural space to drain air, blood, or fluids, typically following thoracic surgery, trauma, or in cases of pneumothorax (collapsed lung) and pleural effusion (excess fluid in the chest cavity).3. Abdominal Drains: Abdominal catheters, such as Jackson-Pratt or Blake drains, are used to remove fluid and blood from the abdominal cavity following surgery, particularly after procedures like abdominal or gynecological surgery, where excess fluids can accumulate.4. Central Venous Catheters (CVCs): CVCs. including peripherally inserted central catheters (PICCs) and central lines, are used for various medical purposes, such as administering medications, parenteral nutrition, and drawing blood. They can also be used for drainage when necessary, such as in the removal of pleural or pericardial effusion.5. Biliary Drains: Biliary catheters, also known as T-tubes or biliary stents, are used to drain bile from the common bile duct, often following surgery for gallbladder disease or when there is a blockage in the biliary system.6. Nephrostomy Tubes: Nephrostomy catheters are placed directly into the kidney to drain urine when there is an obstruction in the urinary tract, such as kidney stones, tumors, or urinary’ tract infections.7. Gastrointestinal Drains: Gastrointestinal catheters, such as nasogastric tubes and gastrostomy tubes (G-tubes), are used to drain stomach contents or provide enteral nutrition. They may also be employed for drainage in cases of gastric outlet obstruction or gastrointestinal bleeding.8. Peritoneal Catheters: Peritoneal catheters are used in peritoneal dialysis to drain and infuse dialysate fluid for the treatment of end-stage renal disease. They provide continuous renal replacement therapy by filtering waste products and excess fluids from the blood.9. Wound Drains: Wound drains, often in the form of closed-suction drains or Penrose drains, are used to remove excess fluid from surgical or traumatic wounds, reducing the risk of infection and promoting healing.

[0211] Challenges with Drains, Catheters, and Shunts:

[0212] The presence of blocks, clogs, and an inability to sense fluid flow within catheters and shunts poses significant clinical challenges. Blockages can occur due to factors like blood clots, tissue debris, or microbial biofilms, impeding the intended drainage or infusion of fluids. These obstructions can compromise the effectiveness of the medical device, potentially leading to fluid accumulation, infection, or organ damage. Furthermore, the inability to sense fluid flow in real-time may hinderearly detection of complications, such as shunt malfunction or catheter displacement, necessitating more invasive interventions and posing a risk to patient safety.

[0213] Description of Exemplary Embodiments:

[0214] A smart shunt, as described herein can incorporate a multi-sensor array capable of realtime molecular analysis, permitting the detection and quantification of specific analytes within the CSF, blood or other bodily fluids. The smart shunt also integrates flow and pressure sensors to continuously monitor fluid dynamics, offering precise control and adjustment of shunt / catheter settings to optimize patient-specific therapy.

[0215] In some embodiments, impedance and aptamer-based sensing on a series of pads comrectorized electrically to a digital / analog sensor can be used. The series of pads can replicate measurements. These pads can be fabricated on flexible or rigid PCB supports positioned inside a reservoir or a flow-through region of the tubing. This sensorized portion may be internalized or externalized to the patient. If internalized, wireless or percutaneous transfer of data can be utilized to read out the biomarkers. If externalized, it can be directly connected to alarm systems. If externalized, various sensor boards specific to different diseases or health states can be swapped in to treat / monitor patients in a more personalized fashion.

[0216] During drug dosage trials, this sensor board may act as an analyte sensor to characterize the bioavailability of a given drug in localized circulation.

[0217] It can have analog and / or digital data transfer capabilities to enhance patient care by facilitating early detection of anomalies, personalized treatment strategies, and improved patient outcomes.

[0218] Described herein are:1 : A smart shunt system comprising a multi-sensor array capable of detecting and quantifying specific molecules, metabolites, or biomarkers in real-time within the CSF, blood, and interstitial fluid, said system further incorporating flow and pressure sensors for continuous monitoring of fluid dy namics.2: A smart shunt of embodiment 1, wherein the multi-sensor array includes biosensors, chemosensors, or microfluidic devices, permitting the simultaneous measurement of glucose levels, electrolyte concentrations, and other analytes in CSF, blood, and interstitial fluid.3: A smart shunt of embodiment 1, equipped with an integrated telemetry system for wireless data transmission to external devices, facilitating remote monitoring and alerting healthcare providers to abnonnal fluid composition or flow dynamics.4: A smart shunt of embodiment 1, configured to adapt shunt valve settings based on real-time sensor data to optimize fluid flow rates, maintain homeostasis, and prevent overdrainage or underdrainage of CSF, blood, or interstitial fluid.5: A method for monitoring and controlling fluid dynamics and molecular composition in a patient's intracranial and systemic circulation, utilizing the smart shunt system of embodiments 1-4, said method enabling personalized therapeutic interventions and improving patient outcomes.6: A smart shunt system of embodiment 1, further comprising sensors capable of detecting and quantifying specific proteins, biomarkers, immune markers, drugs, and vitamins within the CSF, providing valuable diagnostic information for the patient's medical condition and treatment efficacy.7: A smart shunt system of embodiment 1, integrated with a microfluidic analysis component, enabling the real-time measurement of CSF compositionand quantification of analytes, thus facilitating timely adjustments to the shunt settings and personalized treatment.8: A method for monitoring and controlling the composition of cerebrospinal fluid, utilizing the smart shunt system of embodiments 6-7, thereby enhancing the diagnosis and management of neurological disorders, optimizing therapeutic interventions, and improving patient well-being.EXAMPLE 3 - NeuroSense: Advanced Real-Time Monitoring of Cerebrospinal Fluid Dynamics andBiomarkers in Neurocritical Care

[0219] The NeuroSense device provides real-time monitoring of multiple indicators through integration with external ventricular drainage systems to monitor patients in critical neurological conditions. The NeuroSense module is capable of providing real-time monitoring of multiple clinically relevant biomarkers and parameters via integration with external ventricular drainage systems to aid in the care of neurocritical care patients.

[0220] Abstract

[0221] Continuous monitoring of cerebrospinal fluid (CSF) is essential in intensive care units (ICUs) to efficiently manage complications such as infections and mechanical malfunctions in patients with external ventricular drainage (EVD) sy stems. Current methods rely on intermittent CSF sampling and centralized laboratory analysis, leading to delayed reporting and clinical intervention, which can significantly increase the risk of morbidity and mortality. To overcome these challenges, we developed NeuroSense, a multiplexed sensing platform that integrates seamlessly with standard EVD systems. This system enables real-time, continuous monitoring of critical CSF (bio)markers, including glucose, lactate, pH, and flow rate, which are essential for detecting infections and identifying drain malfunctions.

[0222] NeuroSense employs advanced sensor technologies: glucose and lactate detection via aptamer-based electrochemical biosensing, pH measurement using a poly dopamine nanomaterial, and flow rate monitoring through impedance changes induced by CSF heat transfer. Validation of the platform in spiked solutions, simulated conditions, and in ICU patients (N = 7) demonstrated robustcorrelations with clinical reference values, minimal signal interference in multiplexed settings, and sustained sensor stability over extended use. By permitting continuous, bedside monitoring, NeuroSense eliminates delays inherent in conventional workflows, allowing faster detection of complications and supporting personalized patient management.

[0223] INTRODUCTION

[0224] The external ventricular drain (EVD) system is routinely utilized in the neurological intensive care unit (ICU) for the temporary drainage of excess cerebrospinal fluid (CSF) from the brain ventricles (1). In the United States alone, approximately 25,000 EVDs are placed annually (2, 3), underscoring their importance in critical care and neurosurgical settings. EVDs are particularly crucial for maintaining intracranial pressure (ICP) in patients suffering from different neurological conditions such as traumatic brain injury, intracerebral hemorrhage, hydrocephalus, or other conditions that are associated with elevated ICP (4). Additionally, EVDs are often employed in neurosurgical procedures to facilitate temporary CSF drainage, manage postoperative complications, and allow for ICP monitoring (5). (2, 3)

[0225] Despite their effectiveness as the gold standard method for ICP management. EVDs carry a nontrivial risk of infection (6). with infection rates as high as 5-20% of patients (7). EVD-related infections pose serious clinical and economic challenges, including a significantly prolonged median ICU stay — 17 days longer for infected patients compared to non-infected patients (30 days vs. 13 days) — and substantially increased healthcare costs (8). Failure to diagnose the infection rapidly can have severe clinical consequences, such as severe meningitis, which can lead to neural damage, cognitive impairments, permanent disability, and even death (9, 10). Unfortunately, related clinical symptoms such as headaches, nausea, and drowsiness, are often non-specific, complicating detection The current common practice to diagnose infection in patients with EVD, is to first collect CSF samples (performed every 48 hours) followed by transporting the samples to the laboratory for analysis; where the cell count, gram stain(s), glucose, lactate and protein concentrations are measured, and cultures are initiated. Performing these tests in the conventional way is labor-intensive and expensive and have long-turnaround times (more than 48 hours).

[0226] Additionally, frequent access of the CSF can pose the risk of infection and is dangerous, further limiting frequent monitoring. (9, 11). EVD systems are also susceptible to mechanical failures, including catheter obstruction caused by intraventricular hematomas, ventricular debris, or catheter displacement (12). These events can impair CSF drainage and lead to complications such as elevated ICP, with mechanical failure typically indicated by reduced or absence of CSF flow (13). It is critical to sense obstructions in a timely fashion to minimize the downstream consequences such as heighted ICP and identity’ the need to replace the EVD (1). Other factors such as altered ICP, over drainage, infection, and brain hematoma can also alter the CSF flow rate (1). Therefore, it is imperative to create real-time and continuous EVD monitoring technologies that enable early detection of infectionsand provide real-time assessment of EVD system’s patency'. These improvements have the potential to reduce patient morbidity, enhance clinical outcomes, and alleviate the economic burden on healthcare systems. Continuous or on-demand tracking of CSF for infection markers offers a precise method for early detection of infections. During bacterial infections, metabolic biomarkers such as glucose and lactate exhibit significant changes: glucose levels tend to decrease, while lactate levels increase (14, 15). A decline in the CSF glucose levels is a critical diagnostic indicator for infections of neural system and certain carcinomas (16, 17). Lactate levels, on the other hand, demonstrate 98% accuracy in identifying infections and distinguishing between bacterial and non-bacterial meningitis, thereby guiding antibiotic therapy (18- -20). Elevated CSF lactate concentrations are also associated with a wide range of other conditions, including seizures, malignancies, and other metabolic disorders (21). The physiological levels of glucose and lactate in CSF typically range from 2.5 to 4.0 mM and 1.1 to 2.4 mM, respectively. CSF glucose concentrations below 2.2 mM or lactate levels above 2.6 mM can indicate infections or other abnormalities (22). Additionally, monitoring CSF pH level provides valuable diagnostic information, as patients with infection, intracranial hemorrhage, or compromised brain-blood barrier often experience altered pH levels (23-25). Infections can lead to metabolic acidosis and a decrease in CSF pH levels, while an elevation in CSF pH may signify' diminished brain-blood barrier, resulting in a decreased consciousness (26, 27). Table 2 summarizes the normal and abnormal levels of these biomarkers as well as the causes and consequences of their abnormal levels.

[0227] Table 2. Summary of the normal and abnormal biomarker levels as well as the causes for an abnormal level and the following consequences.

[0228] The current continuous glucose and lactate biosensors predominantly employ enzymes as recognition elements, which react with their specific targets. Despite their utility , enzymaticbiosensors have a limited shelf-life and require specific handling and storage conditions (29). For instance, commercial continuous glucose monitoring technologies, such as those developed by Medtronic and Dexcom, report lifespans of six and seven days, respectively (30). Enzymatic continuous lactate biosensors have also only been tested for several horns, and to the best of our knowledge, have not yet demonstrated functionality for extended periods, such as days (31-34). The relative instability of enzymatic biosensors, along with their reliance on specialized storage and handling, remains a significant barrier to their widespread adoption for continuous sensing, specifically in complex media like CSF. Additionally, enzy matic biosensors are only viable for specific targets with stable and readily available enzymes, further limiting their applicability (35). In contrast, aptamer-based biosensors offer a versatile design, improved stability, and longer shelf-life, addressing the limitations associated with enzymatic sensors. Importantly, aptamer-based biosensors have shown week-long stability' in the complex biofluidic such as blood (36, 37).

[0229] To address the need for non-invasive and continuous monitoring of critical biomarkers for early infection detection and EVD failure in neurological ICU patients, described herein is a sensing platform, called NeuroSense, capable of continuous and simultaneous detection of glucose, lactate, pH, and flow rate (Fig. 10A-10LB). By incorporating electrochemical aptamer-based biosensors for glucose and actate (glucose / lactate EAB), as well as a pH sensor, the NeuroSense facilitates early infection detection (Fig. 10A-10B). Additionally, its integrated flow sensor promptly alerts the potential EVD system failures by continuous monitoring of CSF flow rate. Described herein is the development and validation of each sensor, including their enhanced stability for measurements in complex human CSF and an evaluation of their shelf-life under storage conditions. Finally, described herein is the validation of the NeuroSense in ICU-hospitalized patients with EVDs.

[0230] RESULTS

[0231] The NeuroSense Design and Sensing Strategy

[0232] The NeuroSense, an exemplary embodiment of the devices and systems described herein, comprises an outer housing hosting four sensing pads dedicated to the flow rate, glucose, lactate, and pH , and coimectors to interface with the EVD tubing. The entire system is plugged into an electrochemical analyzer that sends data to a graphical user interface (GUI) which inform the clinician about deviations from the normal levels of glucose, lactate, and pH as well as EVD malfunction (Figs. 10A-10B). Electrochemical aptamer-based biosensors (EAB) for lactate and glucose (38) were adapted for real-time, continuous monitoring in CSF.

[0233] Glucose / lactate EABs were fabricated using screen-printed electrodes with a three- electrode system, comprising a silver / silver chloride (Ag / AgCl) reference electrode and gold (Au) counter and working electrodes (WE). The WE surface was functionalized with previously reported lactate or glucose aptamer probes (39, 40) where one end of the aptamer was conjugated with a thiol group and the other end was labeled with methylene blue (MB), a redox reporter (Fig. 11 A, i). Thethiol group enables aptamer immobilization on the gold surface through gold-thiol self-assembled chemistry (41), while the MB signals the presence of the target molecule (37, 42). In the absence of lactate or glucose, the MB is distanced from the electrode surface, resulting in slow electron transfer and a lower current (Fig. 11 A, ii). When the aptamers recognize and bind to their respective targets, they undergo a conformational change that brings the MB-modified terminus of the aptamer closer to the electrode surface, leading to a faster electron transfer and producing a higher electrochemical response (37, 42) (Fig. 11A, ii). Square wave voltammetry (SWV) was used to measure the generated electrochemical signal, and the difference in charge transfer kinetics between the bound and unbound states of the aptamers was utilized to calculate the kinetic differential measurement (KDM) (43). This method, previously developed for EAB. effectively reduces sensor-to-sensor variability, minimizes signal drift, and enhances the signal-to-noise ratio (44, 45). The fabricated glucose and lactate EABs were tested for detection of glucose and lactate in spiked artificial CSF (aCSF). Additionally, the specificity of the glucose and lactate EABs was quantified by exposing the sensors to aCSF spiked with various non-specific targets commonly found in CSF. The glucose E AB demonstrated a limit of detection (LOD) of 0.09 mM and successfully detected glucose within its physiological (2.5 mM - 4 mM) and pathological ranges (4 mM - 20 mM) (Fig. 11B). Furthermore, the glucose EAB exhibited specificity towards glucose, as its response to glucose (5 mM) was significantly higher than its response to non-specific interfering targets (P < 0.0001) (Fig. 11C).

[0234] The lactate EAB was also tested for detecting 0-20 mM lactate as well as its specificity towards lactate was examined (Fig. 1 ID and 1 IE). It exhibited an LOD of 0.99 mM and successfully detected lactate within its physiological (1.1 mM - 2.4 mM) and pathological ranges (2.5 mM -20 mM) (Fig. 11D). Furthermore, when the response of the lactate E AB to non-specific and specific targets was compared with its response to blank aCSF (presented as normalized KDM), only lactate (2 mM) produced a significant increase (P < 0.05) in response (Fig 2E).

[0235] To permit real-time pH monitoring, a thin film layer of poly dopamine (PDA), a well- characterized biocompatible pH responsive material, was electrodeposited onto the WE surface of the screen-printed electrodes (Fig. 1 IF, i). The deposited PDA thin film contains catechol moieties that are electrically oxidized when subjected to cyclic voltammetry (CV) scanning (Fig. 15A and Fig.1 IF). At high pH, due to the low concentration of H+ . the forward catechol oxidation reaction is favorable and occurs at lower potentials. However, at lower pH, the oxidation reaction becomes less favorable, requiring a larger potential, which results in an increase in oxidation potential (Fig. 15B and Fig. 1 IF, ii). Therefore, the pH level can be determined based on the catechol oxidation potential. The nonnal pH range of CSF is 7.28 - 7.36. pH values below 7.28 or above 7.36 would require immediate clinical evaluations (46). Importantly, the developed pH sensor displayed a sensitivity of 0.05 V / pH (sensitivity = slope of the linear range), denoting it can detect pH changes as small as 0.05within the range of 6 - 8. enabling evaluations of both physiological and pathological pH ranges (Fig. 11G).

[0236] To monitor EVD catheters for blockage, a flow sensor was integrated into the NeuroSense system (47, 48). As depicted in Fig. 11H, the flow sensor has a flexible polyamide base and consists of two main parts: the first part is a copper serpentine-shaped heater coimected to a voltage source which heats the flowing CSF; the second part is a pair of square-shaped copper electrodes located 1 mm distance of the heater (Fig. 11H, ii). The flow sensor operates by transporting the heated electrolyte (CSF) from the heater to the pair of sensing electrodes (Fig. 11H, ii). At higher temperatures, the electrolyte becomes more conductive, and its resistance decreases, leading to a subsequent decrease in the impedance (Z) between the two sensing electrodes)^. This decrease occurs more rapidly when the CSF flows at a higher rate (48). As shown in Fig. 16, as soon as the flow starts after a period of stagnation, the impedance decreases, and this event happens at a faster rate at higher flow rates (Fig. 16). Therefore, to construct a calibration curve, the slope of the decrease in impedance was used as a function of flow rates (Fig. 111). The normal CSF flow rate within the EVD system is 150 - 400 pL / min, with values outside this range indicating a potential issue, and the complete cessation of flow signifying a blockage that requires immediate intervention (1). The fabricated flow sensor showed a sensitivity of 0.24 0 / mL (sensitivity = slope of the linear range) (Fig. 111). The collected data demonstrate that the developed sensors are capable of detecting their respective CSF (bio)markers at both normal and abnormal ranges.

[0237] Stable Sensing via NeuroSense and Testing the Shelf Life of the Sensors

[0238] In 1CU, EVD systems remain in place for 5-10 days; therefore, for our sensors to be compatible with EVD, they must demonstrate stability within this time frame (49). A key advantage of the NeuroSense sensors is their replaceability , which ensures continued functionality should sensor performance degrade during this period. Nevertheless, to minimize the need for sensor replacements — which could introduce infection — it's imperative to have biosensors with enhanced stability, capable of maintaining performance for minimum of 10 days. Additionally, to permit continuous CSF monitoring using the NeuroSense device, the sensors must perfonn reliable measurements after multiple scans. To replicate the operational environment, the sensors were incubated in human CSF (hCSF). which contains proteins, cells, and DNases that can cause fouling as well as aptamer and PDA degradation and severely impact sensor performance (50, 51) (Fig. 12A). To mitigate sensor degradation, the sensors were coated with a thin layer of 3% agarose hydrogel post-fabrication (37)(Fig. 12B). The agarose layer is porous and acts as a filter, impeding the passage of large molecules and nucleic acid hydrolyses, thereby protecting the sensors from degradation (37, 52) (Fig. 12B). Agarose is a biocompatible material, mitigating toxicity concerns (52, 53).

[0239] To evaluate the long-term stability of glucose and lactate EABs over days (referred to as time-based-stability), the sensors were fabricated and either coated with agarose or left uncoated. TheEABs were tested in target-spiked hCSF immediately after fabrication (referred to as the baseline signal, later used to calculate the percentage of signal change). Subsequently, die sensors were stored in target-spiked hCSF and re-tested frequently over 21 days or until the signal was no longer detectable. The non-agarose-coated glucose and lactate EABs maintained functionality for 7 and 3 days, respectively (Fig. 12C and Fig. 12D). In contrast, agarose-coated sensors exhibited extended operational stability, lasting for 11 and 21 days with the highest mean percent changes of -4.3% and 18% for glucose and lactate EABs, respectively (Fig. 12C and Fig. 12D). The agarose coating had a more pronounced effect on the lactate EAB. likely due to the lactate aptamer’s increased resistance to degradation when bound to its target, which induces greater structural folding (39, 40, 54). Furthermore, incorporating a plant-based and edible DNase inhibitor (rutin) within the agarose coating of glucose EAB further extended its operational stability to 17 days with the largest mean signal change of 34% occurring on day 13 (Fig. 12C) (40, 55).

[0240] For pH sensors, the uncoated sensors lost functionality after 3 days of hCSF incubation, while agarose -coated sensors retained functionality but showed a 40% signal reduction by day 3 (Fig. 13E). Since the PDA coating on pH sensors is prone to oxidation, a third approach was tested, wherein fabricated pH sensors were stored in sealed chambers designed to protect against oxidation. These sealed sensors exhibited reduced signal variation over a 10-day period, indicating that protection from oxidation may be a more effective method for enhancing pH sensor stability (Fig. 13E). Lastly, the flow sensors-maintained stability' over the 21-day incubation period in hCSF, with the largest signal variation being 14.7% on day 21 (Fig. 13F).

[0241] The performance of non-coated and agarose-coated sensors under multiple measurement conditions was studied (15-100 scans, referred to as scan-based stability). The glucose EAB demonstrated relatively stable performance over 100 scans, with the highest signal change reaching 10% in the absence of agarose coating and only 5% with the coating applied (Fig. 12G). Similarly, the lactate EAB exhibited low variability, with the highest signal change reaching 15% in the final scans for non-coated sensors and less than 5% for agarose-coated sensors (Fig. 12H).

[0242] The pH sensor’s response to an hCSF solution at pH of 7.3 showed significant drift, with a more than 50% signal change by the 30th scan for uncoated sensors (pink line, Fig. 121). In contrast, agarose-coated pH sensors experienced a 25% signal drift, likely because the agarose layer inhibited the passage of large molecules and reduced the displacement of PDA (56) (Fig. 121). The flow sensor's performance was also evaluated over 30 scans and proved stable, with less than 20% signal variation observed after the 15th scan relative to the initial signal (Fig. 12F). These findings underscore the stabilizing effect of agarose coating on the sensors and demonstrate the durability of the fabricated sensors in both scan-based (after multiple measurements) and time -based (after prolonged storage) conditions.

[0243] To translate the NeuroSense for clinical applications, it was essential to evaluate the shelf-life of its sensors. For glucose, lactate, and pH sensors, the reagents deposited on their surfaces during fabrication (such as aptamers or PDA) are critical for functionality, making shelf-life analysis particularly important. To assess shelf-life, sensors were fabricated, packaged in sterilization bags or aluminum-laminated films (for pH sensors), stored for 30 days, and subsequently tested in aCSF spiked with known concentrations of the target analytes. The recorded sensor responses were compared to those of freshly fabricated sensors, and the percentage of signal change was calculated. As shown in Figures 12K and 12L, the glucose and lactate EABs exhibited signal changes of less than 10% and 8%, respectively, over a 30-day testing period. This stability is largely due to the inherent robustness of aptamers, which as deoxyribonucleic (DNA) probes, are highly stable, making glucose and lactate EABs advantageous compared to less stable enzymatic glucose and lactate biosensors. The pH sensor also demonstrated minimal signal variation, with the largest signal change of 12% occurring after 20 days of storage (Fig. 13M). These results indicate that the sensors maintain acceptable performance for at least 30 days of storage. It is worth noting that the flow sensor fabrication is purely based on screen printing, with no components that undergo degradation.Therefore, shelf-life testing was not required for this sensor.

[0244] Testing the Performance of NeuroSense in a Simulated Environment

[0245] After developing and testing the glucose, lactate, pH, and flow sensors for functionality and stability, the NeuroSense device was fabricatef. Tire NeuroSense comprises two 3D-printed boxes made form biocompatible resin, each featuring an inlet for the incoming fluid, an outlet for the outgoing fluid, and openings for the sensors, all designed for easy integration with EVD catheters (Fig. 17). One box houses the flow sensor, while the other accommodates the glucose, lactate, and pH sensors. To minimize thermal transfer from the flow sensor to the other sensor pads, the two boxes were separated. The NeuroSense is designed to interface with EVD catheters, allowing CSF to flow through the box while the embedded sensors detect the biomarkers and monitor their fluctuation in real-time. To simulate the physiological environment and induce flow, a syringe pump containing aCSF samples spiked with target analytes was used (Fig. 13A).

[0246] The pump was connected to the NeuroSense inlet via a 3 mm diameter tube, matching the dimensions of EVD catheters to facilitate CSF flow into the device. Sensors within the system were connected to a benchtop electrochemical workstation for scanning and reading.

[0247] To sterilize the device, the FDA-approved method of ethylene oxide (ETO) sterilization was utilized (57).. Next, the sensor's performance was validated in the EVD-simulated set-up (Fig. 13A) as well as post-sterilization. For this purpose, aCSF solutions spiked with varying levels of glucose, lactate, or pH were introduced into the NeuroSense at a physiologically relevant flow rate of 0.16 mL / min (Fig. 13B-13D). Additionally, the flow sensor’s response to varying flow rates poststerilization was evaluated (Fig. 13E). Sensor responses to their respective targets were measuredbefore and after ETO-stcrilizcd, with prc-stcrilization data serving as the baseline (Fig. 13B-13E). Linear regression analysis was performed to evaluate the correlation between sensor responses and target levels. The regression slopes were significantly non-zero for all sensors in both conditions (p < 0.05), demonstrating a strong correlation between target levels and sensor outputs. The glucose EAB exhibited R-squared values of 0.99 and 0.95 for baseline and post-ETO sterilization, respectively (Fig. 13B). Similarly, the lactate EAB showed R-squared values of 0.93 and 0.95 (Fig. 13C), while the pH sensor demonstrated R-squared value of 0.9 under both conditions (Fig. 13E).

[0248] For the flow sensor, R-squared values of 0.97 and 0.98 were calculated for baseline and sterilized conditions, respectively. These results confirm that incorporating the sensors into 3D- printed boxes and utilizing them in the EVD-simulated setup does not compromise their functionality. Furthermore, ETO sterilization does not negatively impact sensor performance, making it a viable sterilization method for clinical applications of NeuroSense.

[0249] The NeuroSense was evalutated for multiplexed, simultaneous detection of glucose, lactate, pH, and flow rate. To this end, aCSF was spiked with physiological CSF concentrations of glucose (3 mM) and lactate (2 mM). adjusted to a pH of 7.3, and flowed through the NeuroSense at the physiological rate of 0.16 mL / min (Fig. 13F). The output signals from each sensor was interpolated using their respective calibration curves and compared to the introduced levels using the recovery (%) equation:Recovery (%) = (Interpolated level / Introduced level) * 100 (58, 59).

[0250] At physiological levels, the recovery rates for glucose, lactate, pH, and flow sensors were 108%. 105%, 100.1%, and 97.5%, respectively. Similarly, when pathological levels were introduced, recovery rates of 103%, 95%. 99.4%, and 82% were observ ed for glucose, lactate, pH, and flow sensors, respectiv ely (Fig. 13F). These results demonstrate the NeuroSense's capability to simultaneously and accurately detect multiple targets under both physiological and pathological conditions.

[0251] In-patient Evaluation of NeuroSense

[0252] The performance of the NeuroSense device was evaluated in ICU-hospitalized patients who had an EVD. For this purpose the NeuroSense was connected to the EVD drains via a three-way valve (Fig. 14A). Four individual patients were tested with EVD, including one (Patient#2) who was monitored over several days and continuously for 24 hours, with measurements taken every 4 hours. Simultaneous with each measurement, CSF samples were collected and analyzed in the laboratory for comparison with NeuroSense readings. In addition to the four patients, three CSF samples collected from other patients were tested for glucose, lactate, and pH. The glucose, lactate, pH, and flow rate measurements obtained from the NeuroSense sensors were compared to corresponding clinical values, and correlations were assessed using Pearson's correlation. Strong correlations were observed between the sensor measurements and clinical data(r = of 0.97 for glucose, 0.97 for lactate. 0.87 for pH. and0.98 for flow rate (P < 0.0001)) (Fig. 14B-14E), indicating that the NeuroSense is a reliable method for monitoring the CSF (bio)markers in EVD systems.

[0253] To monitor Patient #2 over a 14-day period, the NeuroSense was coimected to the patient at 1-day, 2-days. 3-days, 6-days, and 14-days post-EVD implantation. The glucose, lactate, pH, and CSF flow rate measurements were recorded using both the NeuroSense and standard clinical methods. Changes in these (bio)markers over the 14-day period are shown in Fig. 14F-14I. Glucose levels were elevated in the initial days, followed by a gradual decrease (Fig. 14F). Similarly, lactate levels were high from days 1 to 6 but declined by day 14 (Fig. 14G). pH levels remained relatively stable throughout the period (Fig. 14H). In contrast, CSF flow rate fluctuated significantly (Fig. 141). possibly due to intraventricular lysis treatment used to break down blood clots during days 1-3 (60). Other factors such as patient head position and EVD placement may also have contributed to these fluctuations.

[0254] The NeuroSense was further utilized for continuous monitoring of glucose, lactate, pH, and flow rate in Patient#2 over a 24-hour period, with measurements taken every 4 hours. CSF samples were simultaneously collected and analyzed using standard clinical methods. Temporal fluctuations in glucose, lactate, pH, and flow rate were recorded and compared (Fig. 14J-14M). Trends in glucose, lactate, and flow rate from the NeuroSense closely matched the clinical measurements, while some discrepancies in pH were noted. These discrepancies may be attributed to CO2 exchange altering the CSF pH when samples were exposed to air during clinical analysis (Fig. 14L).

[0255] To quantify the difference between NeuroSense readings and clinical laboratory data, the mean absolute relative difference (MARD) was calculated for all measurements, presented as MARD (%) (Fig. 14N). An ideal MARD is below 10%, while values under 14% are considered acceptable (61). The results showed that 87% of glucose, 85% of lactate, 100% of pH, and 67% of flow measurements fell below the 10% MARD threshold. Additionally, 93% of glucose and lactate readings and 86% of flow measurements had MARD values below 15%, while 100% of glucose and lactate measurements had MARD values below than 25%. The higher MARD values for flow rate reflects differences in tire measurement timing: clinically, flow rate is averaged over 24 hours, while NeuroSense provides real-time, minute-by-minute data. Given the significant variation in CSF flow due to factors such as patient head position, sleep / wake cycles, EVD placement, and phy sical activity, these findings underscore the importance of continuous monitoring.

[0256] Clinical data from four patients with different neurological conditions revealed clinically- relevant variations in glucose and lactate levels (Fig. 140- 14P). Measurements from the NeuroSense and standard clinical methods were analyzed alongside patient diagnoses and other biomarkers such as procalcitonin (PCT) to investigate correlations with conditions like ventriculitis, intraventricular hemorrhage, and infections. For example. Patient #1 exhibited nonnal glucose levels and slightlyelevated lactate (2.6 mM clinically vs. 3.08 mM by NeuroSense). This patient was initially suspected of having ventriculitis but exhibited no intraventricular hemorrhage and tested negative for bacterial culture, however, had elevated PCT (0.144 ng / mL; normal <0.03 ng / mL), aligning with the slight lactate elevation. Patient #2 displayed high glucose and lactate levels early in the monitoring period (5 mM) that decreased over time, correlating with resolution of intraventricular hemorrhage following lysis treatment and a reduction in PCT levels (from 0.35 to 0.056 ng / mL).

[0257] Patient #3 showed nonnal glucose and lactate levels consistent with the absence of infection or hemorrhage. In contrast, Patient #4 had elevated glucose (5 mM clinically, 4.88 mM byNeuroSense) and lactate levels (5 mM clinically, 6.05 mM by NeuroSense), likely attributable to intraventricular hemorrhage.

[0258] To evaluate user experience with the NeuroSense, healthcare providers and clinicians participated in a survey assessing various aspects of the device. All respondents (100%) reported confidence in using the device for taking measurements and reporting data. Additionally, 100% found it easy to learn and use.

[0259] DISCUSSION

[0260] EVD systems are widely used in neurological ICUs to manage excess CSF accumulation in patients. Continuous monitoring of E VD-associated complications, particularly infections and mechanical failures, is critical for timely intervention and improved patient outcomes. Current methods lack the capability to perform continuous cerebrospinal fluid (CSF) monitoring, with screenings typically conducted at intervals of 48 hours at best, even in well-resourced hospitals.

[0261] To address this, described herein is NeuroSense, a novel, multiplexed sensing platform that seamlessly integrates with standard EVD catheters. NeuroSense permits real-time, continuous monitoring of CSF glucose, lactate, pH, and flow rate. The measurements of lactate, glucose, and pH facilitate infection screening, while flow rate monitoring allows for early identification of complications such as elevated ICP, over drainage, and EVD malfunctions.

[0262] The performance of NeuroSense was sy stematically validated under singular and multiplexed spiked conditions, in simulated laboratory and ICU settings. Sensor outputs demonstrated strong correlation with target concentration, confinning their reliability. Notably, in multiplexed spiked experiments, NeuroSense achieved signal recovery with less than 8% signal loss, demonstrating minimal cross-reactivity or interference. Testing on ICU patients with active EVDs further validated the platform’s performance and usability, as sensor data showed strong correlations with reference clinical measurements. To ensure signal stability across multiple scans and extended incubation in CSF. agarose coatings were used for lactate and pH sensors, DNase inhibitors for the glucose sensor, and a one-month shelf life was demonstrated for the sensors with an active reactant (glucose, lactate, and pH sensors). These findings establish NeuroSense as a reliable and practical alternative to current clinical methods for continuous CSF monitoring in ICU settings.

[0263] All sensors in the NeuroSense arc electrochemical and correlate the presence and levels of their target analytes into measurable electrochemical signals. The glucose and lactate sensors utilize aptamers tagged with methylene blue redox reporters to detect and report analyte levels. Tire pH sensor employs poly dopamine as a nanomaterial to facilitate pH detection, while the flow sensor operates by measuring the transfer of heated CSF and tire corresponding decrease in electrode impedance. These mechanisms enable reagent-free, real-time, and on-demand target detection. Compared to traditional clinical practices — which involve CSF sample collection, transport to centralized laboratories, sample processing and analysis, and subsequent reporting to healthcare providers — NeuroSense offers significant advantages. It provides seamless, continuous, on-site monitoring, thereby eliminating delays associated with sample handling and analysis. This facilitates rapid clinical screening and medical intervention, ultimately improving patient outcomes through earlier detection and management of EVD-associated complications.

[0264] Beyond its ability to screen for infections and EVD malfunctions, the NeuroSense allows clinicians to evaluate therapeutic interventions and optimize personalized treatments based on individual patient responses. Moreover, the NeuroSense is designed as a modular system, enabling easyintegration with EVD systemand other surgical drains and lines, such as the Jackson-Pratt (JP). Penrose. Blake, and Channel drains, commonly placed to remove fluid from body after surgery. By providing near -bedside, actionable insights into patients’ neurological health, the NeuroSense holds significant potential to enhance clinical decision-making and improve patient care.

[0265] MATERIALS AND METHODS

[0266] Study design. The objective of this study was to develop a tool that enables real-time, on- demand, and continuous monitoring of patients with EVD. Therefore, a sensing box capable of seamless integration into the EVD system was designed, which contains four distinct types of biosensors for monitoring glucose, lactate, pH, and flow rate. The first three biomarkers screen for infection and other CSF-associated complications, while the flow rate reports the changes in CSF flow and EVD malfunction. The performance and specificity’ of each sensor in spiked aCSF were tested. Further, their stabilities under multiple consecutive scans and extended incubation in hCSF were examined. Specific design strategies, such as agarose coating and DNase inhibitor incorporation, were implemented to increase sensor stability . Each sensor's shelflife was assessed for up to 30 days.

[0267] After fabricating and testing each sensor, the EVD NeuroSense box housing all four sensors was fabricated, and the performance of each sensor was examined in a simulated in-vitro setup. The EVD NeuroSense performance after ETO sterilization, a common medical device sterilization method, was also investigated. Subsequently, the device was evaluated on the actual EVD system in a neurological ICU. The in-patient experiments were conducted in collaborations with the University’ Medical Centre Rostock, upon patients consents. All participants provided complete,informed, signed consent before participating in the experiments, and no participants or outliers were excluded from the analysis.

[0268] For this purpose, the EVD NeuroSense was coimected to the catheters of the EVD on patients in the neurological ICU, and glucose, lactate, pH, and CSF flow rate were monitored using the EVD NeuroSense. Simultaneously, CSF samples were collected and sent to clinical laboratories to obtain reference values for comparison. The EVD NeuroSense was also used on one patient to monitor CSF biomarker fluctuations over 24 hours and 2 weeks. In addition to the four patients tested, three CSF samples from patients were analyzed with the EVD NeuroSense, and their values were compared to reference values to calculate the correlation coefficient between the two methods. Healthcare providers were surveyed about their satisfaction with various aspects of the EVD NeuroSense.

[0269] Material

[0270] The lactate aptamer’ s sequence is 5 ’ - thiol-GACGAC GAGT AGCGCGTATGA ATGCTT TCTATGA GT-MB-CGT-3’ (“GACGAC GAGTAGCGCGTATGAATGCTT TCTATGA GT” disclosed as SEQ ID NO: 4) and the glucose aptamer sequence is 5’-thiol-AGGACGGGTGA-MB- TTOTATACARTGTCCATTCAT-3’ (“AGGACGGGTGA” disclosed as SEQ ID NO: 5 and “TTOTATACARTGTCCATTCAT” disclosed as SEQ ID NO 6). Phosphate buffer solution (PBSfl.O M, pH 7.4)). anhydrous calcium chloride (CaCl 2 ), magnesiumsulfate (MgSO 4 ). sodium hydroxide (NaOH). sodium L-lactate, glucose, magnesium chloride (MgCl 2 ), sodiumchloride (NaCl), potassium chloride (KC1), 6-mercapto-l -hexanol (MCH,99%), tris(2-carbo.xyethyl)phosphine hydrochloride (TCEP), human serum albumin (HSA), UV-VIS light curable resin (Aldrich 900160), Rutin DNase inhibitor were purchased from Sigma Aldrich. Sulfuric acid (98%) and 2-propanol (99.5%) were purchased from Caledon Laboratories. Hydrochloric acid (HC1; 37% w / w) was purchased from LabChem. Artificial cerebrospinal fluid (aCSF) was purchased form BioChemazone. Human cerebrospinal fluid (11CSF) used in stability tests was purchased from Biochemed. Aluminium laminated pouch was purchased from Tob machine. Screen printed electrodes were purchased from Conductive Technologies Inc. Clear V4 Resin was purchased from Form Lab.

[0271] EAB sensor fabrications and operation. To fabricate the glucose and lactate EAB the previously reported protocol was followed (1). Briefly, screen printed electrodes were rinsed in isopropanol and electrochemically cleaned. The reduced glucose / lactate aptamer solutions were then deposited on their working electrodes for overnight and in dark. After the aptamer deposition, the working electrodes were incubated with 100 mM MCH for 10 min in the dark at room temperature. Subsequently, the chips were washed with a buffer solution, airdried and stored in dark ambient condition until further use.To draw their associated calibration curves, the fabricated glucose and lactate E AB were tested with different concentrations of their respective targets spiked in the aCSF. For this purpose, same fabricated chip was exposed to aCSF containing different concentrations ofglucosc / lactatc, and the resulting electrochemical signal was recorded via square wave voltomctcry (SWV) at two frequencies of signal-on and signal-off (being 80 Hz and 5 Hz for glucose EAB and 200 Hz and 15 Hz for lactate EAB), over a potential range of -0.1V to 0.5V. The response for the EABes is then reported as kinetic differential measurement (KDM) (2-5). The electrochemical SWV measurements were performed with CHI Instruments or the Pahnsene 4 potentiates. To test the specificity of the glucose and lactate E AB, aCSF spiked with the non-specific targets commonly present in CSF were introduced to the fabricated EABs and the EAB’s response (KDM) to them was recorded. The EAB’s response to the non-specific targets were then normalized to average of the EAB’s response to blank aCSF via the Normalized KDM = (KDMtarget - KDMblank) / KDMblank equation and were compared to the normalized EAB’s response to specific targets via one-way ANOVA and the Bonferroni post hoc test.

[0272] pH sensor fabrication and operation. To fabricate the pH sensors, a previously established protocol was followed (6, 7). Briefly, a 1 mg mL-1 solution of dopamine hydrochloride was prepared in lx PBS and corrected to pH 7.4. The dopamine was then electropolymerized on the electrode surface under dark conditions via 30 cyclic voltammetry (CV) cycles with a potential range between -0.5 V and 0.5 V and at a scan rate of 0.05 V s-1 and a sampling interval of 0.005 V (6, 7). The PDA-coated pH sensors were rinsed, dried, and stored in dark and in an anoxic for until use. The electrochemical CV measurements were performed with CHI Instruments or the Palmsene 4 potentiates.

[0273] Flow sensor fabrication and operation. The printed circuit board (PCB) for the flow sensor was designed with Altium software and fabricated by PCB Way on a polyamide flexible substrate. The flow sensor compromises a resistive heater with the length of 498 mm, and the width of 0.06mm made from copper and two copper square-shaped impedance electrodes with 0.45 mm in 0.45 mm dimensions. This flexibleflow sensor was cleaned with isopropanol before use and integrated into 3D printed flow chambers. The PCB was positioned flat against the bottom of the chamber and seemed with 3 lay ers of nanotapes. To seal the chamber and prevent fluid leakage, UV-VIS curable resin was applied incrementally between the tape layers followed by UV curing for 5 minutes per layer. To operate the flow sensor for in vitro studies, first a dispensing tube from a syringe pump was connected to the inlet hole of the flow chamber, and an outlet hole was connected to a waste beaker. The heater w as powered by a DC pow er supply set to 0.5 V, ensuring the current output remained between 60-70 mA. To record the changes in impedance during different flow rates, the impedance sensing electrodes were connected to a Palm sense 4 potentiates were the impedance spectroscopy with a fixed frequency of 10A6. DC voltage of -0.25. and AC voltage of 0.25 and was performed for 160 seconds. Typically, the syringe pump flow was initiated 30 seconds into the scan to establish a baseline impedance (Z0), which was later used to normalize the impedance values observed during flow time (Zt). To perform the time-based stability’ tests on the flow sensor. hCSF was added to thechamber, ensuring complete coverage of the heater and electrodes, and the chamber was scaled with parafilm.

[0274] Agarose coating. To coat the sensors with agarose, 3 wt% of agarose in lx PBS was stirred in a 95 °C water bath until all agarose was dissolved. Next, the agarose mixture’s temperature was decreased to 60 °C. The fabricated sensors were dipped in the agarose solution for 3 seconds and left to dry for 1 minute, hi total, each sensor was dipped in agarose three times. Those not immediately tested after fabrication were stored under dark and humid conditions. To incorporate DNase inhibitor, rutin, into the agarose coating for glucose EAB. first it was dissolved in buffer, and added to the stirring agarose with a final concentration of 150 pM, followed by dipping the glucose EAB into the agarose + rutin mixture.

[0275] Testing the sensor’s stability over time, several consequent scans, and shelf life. To test the sensors stability over tune the fabricated sensors were incubated with hCSF spiked with certain concentrations of targets (5 mM for glucose EAB, 2 mM for Lactate E AB. and the pH of hCSF was measured right before every use) for days in a humid chamber and at dark andambient condition and tested once right after fabrication (known as dayO), and then every 3-4 days. The flow sensor was also incubated in hCSF, and its response to a flow rate 0.16 mL / min was recorded at every test day. The sensors response was recorded and compared to the responses observed in the freshly made biosensor on day 0 via the following equation: Signal change (%)= ((Sensor response dayx - Sensor response dayO)) / Sensor response day0)x 100 equation.

[0276] To test the sensors stability' in response to multiple scans, first hCSF spiked with same levels of targets as above were added to the fabricated sensors, followed by subjecting the sensors to several consecutive measurements (100 measurements for the glucose and lactate EAB, and 30 scans for the pH and flow sensors). The sensors response at each scan was compared to the responses at the first scans via the following equation: Signal change(%)= ((Sensor response scanx - Sensor response scan 1) I Sensor response scanl) x 100.

[0277] To determine the shelf life of the glucose / lactate EAB es. they were fabricated, and stored in dark and at ambient condition for up to 30 days. During these 30 days, a new set was unpacked every 2-4 days and their response to aCSF spiked with 5 mM glucose, or 2 mM lactate were recorded. To determine the pH sensor’s shelf life, the pH sensors were fabricated, placed in the NeuroSense boxes and stored in aluminium laminated films for 30 days. Similar to the EABs, every 2-4 days a new box (housing 6 pH sensors) was unpacked and tested in aCSF with an adjusted pH of 7.5. The sensor’s responses at each day were recorded and compared to the responses from freshly fabricated pH sensors via the following equation: Signal change (%)= ((Sensor response dayx - Sensor response fresh sensor) / Sensor response fresh sensor) x 100.

[0278] Fabricating the EVD NeuroSense. The EVD NeuroSense boxes that house the sensors were 3D printed from a biocompatible clear V4 Resin and with a Form 3+ 3D printer. The boxes thatcontain glucose, lactate, and pH sensor have 6 openings in addition to two holes acting as the inlet and outlet for the tubing (which are silicon tubes with 3 mm inner diameters). They contain 2 glucose sensors, 2 lactate sensors, and 2 pH sensors. The Flow sensing box that contains the flow sensor has one opening and contains a flow sensor. The sensors were integrated into the boxes via nano tape and to provide a complete sealing, all openings were sealed using UV-Vis curable resin, which was then cured via ultraviolet radiation which ensured a secure and leak-proof assembly (Figure ((S3).

[0279] In-vitro testing the EVD NeuroSense. To test the performance of the EVD NeuroSense box in a set up that simulates the physiological condition, the boxes were connected syringes filled with target-spiked aCSF on a syringe pump. The syringe pump enables the control of the flow rate. The sensors within the box were connected to the CHI electrochemical workstation for scanning and reading. For the single-plex tests, all sensors within the box were of the same type, and the aCSF was spiked with different concentrations of the target analyte (glucose or lactate, or aCSF adjusted to different pH levels) and ran through the box with a flow rate of 0.16 mL / min (which represents the typical flow rate in the EVD systems). The signals from each sensor during aCSF flow were collected with a 20-minute delay to allow for complete filling / res-substitution of the boxes. The associated calibration curve for each sensor was drawn which shows the response of each sensor as a function of various target concentration. The sensor boxes that have undergone ETO sterilization were also tested and their associated calibration curves were drawn.

[0280] For the multiplexed tests, the sensors of different types were incorporated into the box, and the aCSF was spiked with all targets (glucose, lactate, and pHes of different values) at two ranges of physiological (3 mM glucose, 2mM lactate, pH of 7.3. and 0.16 mL / min flow rate) and non- physiological (2 mM glucose, 5 mM lactate. pH of 7.2. and 0.05 mL / min flow rate) levels. All sensors were connected to the electrochemical workstation (CHI potentiostat) and their signal were recorded. To determine each sensor’s ability to recover its respective analyte in the presence of other interfering targets, the senso’s responses were interpolated into the calibration curves from the single plex tests. The interpolated concentration was then compared to the known introduced concentration via the following equation: Recovery' (%)= (Interpolated level (mM) / Introduced levels (mM)) x 100, which reports the recovery (%).

[0281] Evaluating the EVD NeuroSense performance in patients and with real CSF samples. To evaluate the performance of the developed NeuroSense for monitoring patients with EVD. the sensing box was integrated into the EVD system. To facilitate the connection of the EVDNeuroSense device to the EVD system, a three-way valve was added to the valve located between the implanted catheter and the collection bag. The three-way valve was initially opened to fill the chamber housing the glucose, lactate, and pH sensors, followed by filling the flow-sensing chamber. Once the flow-sensing chamber was filled, the valve to the flow' sensor was closed, and the heating of CSF in sensing chamber was initiated for 20 minutes (the heating period is required forimpedance measurements). During the heating period, glucose, lactate, and pH measurements were recorded. Simultaneous with the measurements done by the EVD NeuroSense, the CSF samples were collected and sent to hospital’s laboratory where the glucose and lactate levels were tested, the values of which were considered as the reference. The reference values for pH were measured with pH meter, while the reference values for the flow sensor are an average of reported flow rates in 24 hours and the manual measurement (recording the CSF volume over certain period of time) performed concurrent with each measurement.

[0282] To determine glucose, lactate, pH, and flow rate values, the response from each sensor was interpolated into the sensor’s calibration curves drawn from testing the ETO-sterilized sensors and were correlated to the reference values by rumring Pearson correlation coefficient. Four individual patients (patient#l-4) with EVD were tested, and one patient (patient#2) was tested at different days over a 2-week period, wherein at each day a new NeuroSense box was unpacked and connected to the EVD. The patient#2 also was tested every 4-hours over a 24-hours period, with the same Neuro Sense box. In addition to testing the patients with EVD, three CSF samples drawn from neuropathological patients were tested with the developed NeuroSense box. Similarly, the value reported by the NeuroSense was compared and correlated with the reference values.

[0283] Automated SWV signal analysis. While operating the glucose and lactate sensors, a large amount of data was produced, which required processing and analysis. To automate this task, a PYTHON™ program was developed (10.5281 / zenodo.13891458). As a user, the peak variables were provided (voltage range of interest, desired smooth value, and minimum height) as the inputs, which were used to automatically scan the raw data. Tire application then generates associated graphs, detects the peaks, and reports the peak height (SWV signal magnitude). The peak data is saved into a common file as a summary for the user.

[0284] Statistical analysis: All statistical analyses were conducted using GraphPad™ Prism. Nonlinear regression analy sis was performed to evaluate the relationship betw een EAB responses and analyte concentrations. The goodness-of-fit was assessed using the coefficient of determination (R2) and was reported for each EAB. Simple linear regression analysis was also conducted to examine the relationship betw een die sensor responses and the level of pH and flow rate for the pH sensor and flow sensor. The goodness-of-fit was evaluated using the R2and is reported for the pH and flow sensors. The slope for both sensors signiflcandy deviated from zero (P < 0.0001). Simple linear regression analysis was also performed to examine die relationship between the sensor’s responses assembled into the NeuroSense box and different values of glucose, lactate, pH and flow rate while flowing the aCSF.

[0285] To assess the correlation between the glucose, lactate, pH, and flow rate measurements obtained from the NeuroSense box and the reference clinical values, the Pearson's correlation coefficient test was used. The correlations were found significantly strong (P < 0.0001) with thefollowing r values (r = of 0.97 for glucose, 0.97 for lactate, 0.87 for pH, and 0.98 for flow rate (P < 0.0001)).

[0286] The statistical difference between groups in specificity test was analyzed using ordinary one-way ANOVA with Bonferroni multiple comparison test. The significance of statistical difference was calculated w ith 95% confidence interval (alpha threshold = 0. 05) and shown in GP style ((0.1234 (ns), 0.0332 (*), 0.0021 (**), 0.0002 (***), p < 0.0001 (**** )) in graphs.

[0287] Table 3: Clinical characteristics for patients monitored with EVD NeuroSense. SAB: subaraclmoid bleeding; H&H: Hunt and Hess scale; IV: intraventricular; PCOM: posterior communicating artery: ICH: intracerebral hemorrhage; PCT: procalcitonin; UTI: urinary tract infection, CSF: cerebrospinal fluid.

[0288] References and Notes1. R. Muralidharan, External ventricular drains: Management and complications. Surg Neurol Int 6. S271-S274(2015).2. O. Atallah, J. K. Krauss, E. J. Hermann, External ventricular drainage in pediatric patients: indications, management, and shunt conversion rates. Child’s Nervous System 40, 2071-2079 (2024).3. R. F. Sekula, D. B. Cohen, P. M. Patek, P. J. Jannetta, M. Y. Oh, Epidemiology of ventriculostomy in the United States from 1997 to 2001. Br J Neurosurg 22, 213-218 (2008).4. Y. Shim, J. Kim, H. S. Kim, J. Oh, S. Lee, E. J. Ha, Intracranial Pressure Monitoring for Acute Brain Injured Patients: When, How, What Should We Monitor. Korean J Neurotrauma 19, 149-161 (2023).5. 2016 — +s Rooks. M.G and Garrett, W.S,HHS Public Access. Physiol Behav176, 139-148 (2017).6. Y. H. Choo, Y. Shim, H. Kim, H. Y. Goh, S. J. Kim, E. J. Kim, C. K. Kang, E. J. Ha, Significant Reduction in External Ventricular Drain-Related Infections After Introducing a Novel Bundle Protocol: A Before and After Trial. J Korean Med Sci 38, 1-13 (2023).7. R. Beer, P. Lackncr, B. Pfauslcr, E. Schmutzhard, Nosocomial ventriculitis and meningitis in neurocritical care patients. J Neurol 255, 1617-1624 (2008).8. E. H. Hersh, K. A. Yaeger, S. N. Neifert, J. Kim, N. S. Dangayach, N. Weiss, Patterns of Health Care Costs Due to External Ventricular Drain Infections. World Neurosurg 128. e31-e37 (2019).9. S. Hagel, T. Bruns, M. W. Pletz, C. Engel, R. Kalff, C. Ewald, External ventricular drain infections: Risk factors and outcome. Interdiscip Perspect Infect Dis 2014 (2014), doi: 10.1155 / 2014 / 708531.10. F. Benninger, I. Steiner, John Bennett, Raphael Dolin, Martin J. Blaser. Mandell, Douglas, and Bennett’s Principles and Practice of Infectious Diseases. 8th Ed. Saunders. 2014. 3904 p. (2020).11. E. H. Hersh, K. A. Yaeger, S. N. Neifert, J. Kim, N. S. Dangayach, N. Weiss, Patterns of Health Care Costs Due to External Ventricular Drain Infections. World Neurosurg 128. e31-e37 (2019).12. C. Mottolese, P.-A. Beuriat, A. Szathmari. F. Di Rocco, in (Springer International Publishing, Cham), pp. 681-704.13. A. S. Pandit. J. Palasz, P. Nachev. A. K. Toma, Mechanical Complications of External Ventricular and Lumbar Drains. World Neurosurg 166, el40-el54 (2022).14. Q. C. Tan, X. W. Xing, J. T. Zhang, M. W. He. Y. B. Ma. L. Wu, X. Wang, H. F. Wang, S. Y. Yu, Correlation between blood glucose and cerebrospinal fluid glucose levels in patients with differences in glucose metabolism. Front Neurol 14 (2023), doi:10.3389 / fneur.2023.1103026.15. Q. Wang, Y. F. Wang, Y. Yang. Y. X. Kong. Y. Peng, The value of elevated cerebrospinal fluid lactate concentrations in post-neurosurgical bacterial meningitis. BMC Neurol 23 (2023). doi:10.1186 / sl2883-023-03428-8.16. M. G. Johnston, Relationship between cerebrospinal fluid and extracanial lymph. Lymphology 33. 1-3 (2000).17. Q. C. Tan, X. W. Xing, J. T. Zhang, M. W. He, Y. B. Ma, L. Wu, X. Wang, H. F. Wang, S. Y. Yu, Correlation between blood glucose and cerebrospinal fluid glucose levels in patients with differences in glucose metabolism. Front Neurol 14, 1-6 (2023).18. C. Stephani, A. H. K. Choi, O. Moerer, Point-of-care detection of lactate in cerebrospinal fluid. Intensive Care Medicine Experimental 9 (2021), doi:10.1186 / s40635-021-00385-9.19. Q. Wang, Y. F. Wang, Y. Yang, Y. X. Kong, Y. Peng, The value of elevated cerebrospinal fluid lactate concentrations in post-neurosurgical bacterial meningitis. BMC Neurol 23, 1-8 (2023).20. N. T. Huy, N. T. H. Thao, D. T. N. Diep, M. Kikuchi, J. Zamora, K. Hirayama, 1 Cerebrospinal fluid lactate concentration to distinguish bacterial from aseptic meningitis: A systemic review and meta-analysis. Crit Care 14, R240 (2010).21. S. L. Chow, Z. J. Rooney, M. A. Cleary, P. T. Clayton. J. V. Leonard. The significance of elevated CSF lactate. Arch Dis Child 90, 1188-1189 (2005).22. W. G. Leen, M. A. Willemsen, R. A. Wevers, M. M. Verbeek, Cerebrospinal fluid glucose and lactate: Age-specific reference values and implications for clinical practice. PLoS One 1 (2012),doi : 10.1371 / j oumal.ponc .0042745.23. D. Royston, Nunn's Applied Respiratory' Physiology. British journal of anaesthesia : BJA 85, 180 (2000).24. C. E. Johanson, J. A. Duncan, P. M. Klinge, T. Brinker, E. G. Stopa, G. D. Silverberg,Multiplicity of cerebrospinal fluid functions: New challenges in health and diseas Cerebrospinal Fluid Res 5 (2008), doi:10.1186 / 1743-8454-5-10.25. J. R. Wahl, A. Vivek, S. M. Palomino, M. Almuslim, K. E. Cottier, P. R. Langlais. J. M. Streicher, T. W. Vanderah. E. Liktor-Busa, T. M. Largent-Milnes, Extracellular Alterations in pH and K+ Modify the Murine Brain Endothelial Cell Total and Phospho-Proteome. Pharmaceutics 14 (2022), doi:10.3390 / pharmaceuticsl4071469.26. A. D. Milner, H. Lagercrantz. R. Wickstrom, Control of breathing. Neonatal Respiratory Disorders, Second Edition , 38-49 (2003).27. A. P. Hrishi. M. Sethuraman. Cerebrospinal fluid (CSF) analysis and interpretation in neurocritical care for acute neurological conditions. Indian Journal of Critical Care Medicine 23, SI 15— SI 19 (2019).28. W. G. Leen, M. A. Willemsen, R. A. Wevers, M. M. Verbeek. Cerebrospinal fluid glucose and lactate: Age-specific reference values and implications for clinical practice. PLoS One 7 (2012), doi : 10.1371 / j oumal.pone .0042745.29. M. Govindaraj. A. Srivastava. M. K. Muthukumaran. P.-C. Tsai, Y.-C. Lin, B. K. Raja. J. Rajendran, V. K. Ponnusamy, J. Arockia Selvi, Current advancements and prospects of enzymatic and non-enzymatic electrochemical glucose sensors. Int J Biol Macromol 253. 126680 (2023).30. G. Cappon, M. Vettoretti. G. Sparacino, A. Facchinetti. Continuous glucose monitoring sensors for diabetes management: A review of technologies and applications. Diabetes Metab J 43, 383-397 (2019).31. D. M. E. Freeman, D. K. Ming, R. Wilson, P. L. Herzog, C. Schulz, A. K. G. Felice, Y.-C. Chen, D. O’Hare, A. H. Holmes, A. E. G. Cass, Continuous Measurement of Lactate Concentration in Human Subjects through Direct Electron Transfer from Enzymes to Microneedle Electrodes. ACS Sens 8, 1639-1647 (2023).32. M. Yang, H. Wang, J. Cheng. Continuous monitoring of multiple biomarkers with an ultrasensitive 3D-structured wearable biosensor. Cell Reports Methods 3 (2023), doi:10.1016 / j.crmeth.2023.100579.33. X. Xuan, C. Chen, C. Perez-Rafols, M. Swaren, L. Wedhohn, M. Cuartero, G. A. Crespo, A Wearable Biosensor for Sweat Lactate as a Proxy for Sport Performance Monitoring. Analysis and Sensing 3 (2023), doi : 10.1002 / anse .202200047.34. X. Xuan, C. Pcrcz-Rafols, C. Chen, M. Cuartcro, G. A. Crespo, Lactate Biosensing for Reliable On-Body Sweat Analysis. A CS Sens 6, 2763-2771 (2021).35. J. I. Reyes-De-Corcuera, H. E. Olstad, R. Garcia-Torres, Stability and Stabilization of Enzyme Biosensors: The Key to Successful Application and Commercialization. On: Wed 28, 59 (2024).36. G. Wu, E. T. Zhang, Y. Qiang, C. Esmonde, X. Chen, Z. Wei, Y. Song, X. Zhang, M. J. Schneider, H. Li, 14. Sim, Z. Weng, S. Santaniello. J. I4e. R. Y. Lai. Y. Li, M. R. Brachas, Y. Zhang, Long-Term In Vivo Molecular Monitoring Using Aptamer-Graphene Microtransistors (2023), doi:10.1101 / 2023.10.18.562080.37. S. Li, J. Dai. M. Zhu. N. Arroyo-Curras. H. Li, Y. Wang. Q. Wang, X. Lou, T. E. Kippin, S. Wang, K. W. Plaxco, H. Li, F. Xia. Implantable Hydrogel-Protective DNA Aptamer-Based Sensor Supports Accurate, Continuous Electrochemical Analysis of Drags at Multiple Sites in Living Rats. ACS Nano 17. 18525-18538 (2023).38. F. Bakhshandeh. H. Zheng. N. G. Barra. S. Sadeghzadeh, I. Ausri, P. Sen. F. Keyvani. F. Rahman, J.Quadrilatero. J. Liu, J. D. Schertzer, L. Soleymani, M. Poudineh, Wearable Aptalyzer Integrates Microneedle and Electrochemical Sensing for In Vivo Monitoring of Glucose and Lactate in Live Animals. Advanced Materials 36 (2024), doi: 10.1002 / adma.202313743.39. P. J. J. Huang, J. Liu, Simultaneous Detection of L-Lactate and D-Glucose Using DNA Aptamers in Human Blood Serum. Angewandte Chemie - International Edition 62, 1-5 (2023).40. N. Nakatsuka, K. A. Yang, J. M. Abendroth, K. M. Cheung, X. Xu, H. Yang, C. Zhao, B. Zhu, Y. S. Rim, Y. Yang, P. S. Weiss, M. N. Stojanovic, A. M. Andrews, Aptamer-field-effect transistors overcome Debye length limitations for small-molecule sensing. Science (1979) 362, 319-324 (2018).41. X. Zhang, V. K. Yadavalli, Surface immobilization of DNA aptamers for biosensing and protein interaction analysis. Biosens Bioelectron 26, 3142-3147 (2011).42. M. D. Nguyen, K. N. Nguy en, S. Malo, I. Banerjee, D. Wu, L. Du-Thumm, P. Dauphin- Duchanne,Electrochemical Aptamer-Based Biosensors for Measurements in Undiluted Human Saliva. ACS Sens 8. 4625-4635 (2023).43. B. S. Ferguson, D. A. Hoggarth, D. Maliniak, K. Ploense, R. J. White, N. Woodward, K. Hsieh, A. J. Bonham, M. Eisenstein, T. E. Kippin, K. W. Plaxco. H. T. Soh, Real-Time, Aptamer-Based Tracking of Circulating Therapeutic Agents in Living Animals. Sci Transl Med 5 (2013) (available at https : / / www. science.org) .44. M. Reynoso. A.-Y. Chang, Y. Wu, R. Murray. S. Suresh. Y. Dugas. J. Wang, N. Arroyo-Curras, 3D-printed, aptamer-based microneedle sensor arrays using magnetic placement on live rats for pharmacokinetic measurements in interstitial fluid. Biosens Bioelectron 244, 956-5663 (2023).45. Y. Wu, F. Tchrani, H. Tcymourian, J. Mack, A. Shaver, M. Reynoso, J. Kavner, N. Huang, A. Furmidge, A. Duvvuri, Y. Nie, L. M. Laffel, F. J. Doyle III, M.-E. Patti, E. Dassau, J. Wang, N. Arroyo-Curras, Microneedle Aptamer-Based Sensors for Continuous. Real-Time Therapeutic Drug Monitoring. Anal Chem 94, 8335-8345 (2022).46. E. H. COLES, in Clinical Biochemistry of Domestic Animals (Third Edition) , J. J. KANEKO, Ed. (Academic Press, 1980), pp. 719-748.47. B. J. Kim, W. Jin, A. Baldwin, L. Yu, E. Christian. M. D. Krieger, J. G. McComb, E. Meng, Parylene MEMS patency sensor for assessment of hydrocephalus shunt obstruction. Biomed Microdevices 18, 1-13 (2016).48. A. Baldwin, L. Yu, E. Meng, An Electrochemical Impedance- Based Thermal Flow Sensor for Physiological Fluids. Journal of Microelectromechanical Systems 25, 1015-1024 (2016).49. M. Katzir. J. J. Lefkowitz, D. Ben-Reuven, S. J. Fuchs. K. Hussein. G. E. Sviri, Decreasing External Ventricular Drain-Related Infection Rates with Duration-Independent. Clinically Indicated Criteria for Drain Revision: A Retrospective Study. World Neurosurg 131, e474-e481 (2019).50. M. Buckell, Enzymes in the Cerebrospinal Fluid. Proceedings of the Association of Clinical Biochemists 5, 33-34 (1968).51. L. M. Schilde, S. Steinbach. K. Schork, L. M. Schilde, S. Ko, M. E. Id, S. Galozzi, M. Turewicz, K. Barkovits, B. Mollenhauer, K. Marcus, C. M. Id, Protein variability in cerebrospinal fluid and its possible implications for neurological protein biomarker research. PLoS One , 1-19 (2018).52. M. J. Russo, M. Han, P. E. Desroches, C. S. Manasa, J. Dennaoui. A. F. Quigley, R. M. I. Kapsa, S. E. Moulton, R. M. Guijt. G. W. Greene, S. M. Silva. Antifouling Strategies for Electrochemical Biosensing: Mechanisms and Performance toward Point of Care Based Diagnostic Applications. ACS Sens 6, 1482-1507 (2021).53. S. FERNANDEZ -COSSIO, A. LEON-MATEOS, F. GUDE SAMPEDRO, M. T. CASTANO OREJA, Biocompatibility of agarose gel as a dermal filler : Histologic evaluation of subcutaneous implants. Plastic and reconstructive surgery (1963) 120, 1161-1169 (2007).54. C. Kratschmer, M. Levy , Effect of Chemical Modifications on Aptamer Stability' in Serum. Nucleic Acid Ther 27, 335-344 (2017).55. A. Kolarevic, A. Pavlovic, A. Djordjevic, J. Lazarevic, S. Savic, G. Kocic, M. Anderluh, A. Smelcerovic, Rutin as Deoxyribonuclease I Inhibitor. Chem Biodivers 16. el900069-n / a (2019).56. M. Amiri, E. Amali, A. Nematollahzadeh, H. Salehniya, Poly-dopamine films: Voltammetric sensor for pH monitoring. Sens Actuators B Chem 228, 53-58 (2016).57. W. A. Rutala, D. J. Weber, Disinfection and Sterilization in Health Care Facilities: What Clinicians Need to Know. Clinical infectious diseases 39, 702-709 (2004).58. B. Liu, B. Zhang, Y. Cui. H. Chen, Z. Gao, D. Tang. Multifunctional Gold-Silica Nanostructures forUltrasensitive Electrochemical Immunoassay of Streptomycin Residues. ACS Appl Mater Interfaces3, 4668-4676 (2011).59. M. Majdinasab, M. Yaqub, A. Rahim, G. Catanante, A. Hayat, J. L. Marty , An overview on recent progress in electrochemical biosensors for antimicrobial drug residues in Animal-Derived food& sors (Switzerland) 17 (2017), doi:10.3390 / sl7091947.60. W. C. Ziai, J. Muschelli, C. B. Thompson. P. M. Keyl, K. Lane, S. Shao, D. F. Hanley, Factors Affecting Clot Lysis Rates in Patients With Spontaneous Intraventricular Hemorrhage. Stroke (1970) 43, 1234-1239 (2012).61. L. Heinemann. M. Schoemaker. G. Schmelzeisen-Redecker, R. Hinzmaim, A. Kassab, G. Freckmann, F. Reiterer, L. Del Re, Benefits and Limitations of MARD as a Performance Parameter for Continuous Glucose Monitoring in the Interstitial Space. J Diabetes Sci Technol 14, 135-150 (2020).

Claims

1. What is claimed herein is:

1. A drain sensor comprising: a) at least one fluid channel comprising an inflow port and an outflow port; and b) at least one sensing element in fluid communication with the fluid channel between the inflow port and outflow port; wherein each of the at least one sensing elements is: i) a constituent sensing element that detects a constituent of a fluid, the constituent sensing element comprising:A) a working electrode comprising a constituent-responsive element,B) a reference electrode, andC) a counter electrode; or ii) a flow rate sensing element that detects a flow rate of a fluid, the flow rate sensing element comprising:D) a heater element; andE) a pair of sensing electrodes, wherein the heater is located closer to an end of the fluid channel connected to the inflow port than the pair of sensing electrodes.

2. The drain sensor of any one of the preceding claims, wherein each of the working electrode, the reference electrode, and the counter electrode is in fluid communication with the fluid channel.

3. The drain sensor of any one of the preceding claims, wherein the constituent is a biomolecule and the constituent-responsive element comprises: a moiety that binds to the working electrode, a moiety that binds specifically to the biomolecule constituent, and a moiety comprising a redox reporter.

4. The drain sensor of any one of the preceding claims, wherein the moiety that binds to tire working electrode is a thiol and the working electrode comprises gold, platinum, iridum, and / or stainless steel.

5. The drain sensor of any one of the preceding claims, wherein the moiety that binds to the working electrode is a thiol and the working electrode comprises gold.

6. The drain sensor of any one of the preceding claims, wherein the moiety that binds specifically to the biomolecule constituent is an aptamer.

7. The drain sensor of any one of the preceding claims, wherein the moiety comprising a redox reporter comprises methylene blue, ferrocene, anthraquinone, viologen, Atto MB2, and / or Nile Blue.

8. The drain sensor of any one of the preceding claims, wherein the moiety comprising a redox reporter comprises methylene blue.

9. The drain sensor of any one of the preceding claims, wherein the constituent is H+and the constituent-responsive element comprises a pH responsive material.

10. The drain sensor of claim 9, wherein the pH responsive material comprises poly dopamine, polytynethacrylic acid) (PMAAc). poly[(2-dimethylamino)ethyl methacrylate] (PDMA), poly(2-acrylamido-2-methylpropane sulfonic acid) (PAMPS) and poly(4-stvrcncsulfonic acid) (PSSA), Polyacrylic acid (PAA), PVA or PVBA. Polyvinyl benzoic acid, Polyvinyl acid, poly(L-glutamic acid) PLGA, Alginic acid. Hyaluroinic acid (HA), or a combination thereof.

11. The drain sensor of claim 9 or 10, wherein the pH responsive material comprises poly dopamine.

12. The drain sensor of any one of claims 9-11, wherein the pH responsive material comprises a polydopamine film.

13. The drain sensor of any one of claims 9-12, wherein the pH responsive material comprises a coating on the working electrode.

14. The drain sensor of any one of the preceding claims, wherein the working electrode of the constituent sensing element comprises gold.

15. The drain sensor of any one of the preceding claims, wherein the reference electrode of the constituent sensing element comprises gold.

16. The drain sensor of any one of the preceding claims, wherein the counter electrode of the constituent sensing element comprises silver and silver chloride.

17. The drain sensor of any one of the preceding claims, wherein each of the pair of sensing electrodes is in fluid communication with the fluid channel.

18. The drain sensor of any one of the preceding claims, wherein the heater element is in fluid communication with the fluid channel.

19. The drain sensor of any one of the preceding claims, wherein the heater element is not in fluid communication with the fluid channel.

20. The drain sensor of any one of the preceding claims, wherein the heater element is in thermal communication with the fluid channel.

21. The drain sensor of any one of the preceding claims, wherein the heater element is an electrical heater element.

22. The drain sensor of claim 21, wherein the electrical heater element comprises copper.

23. The drain sensor of claim 22, wherein the electrical heater element is serpentine in shape.

24. The drain sensor of any one of the preceding claims, wherein the heater element and pair of sensing electrodes are attached to a flexible polymer base.

25. The drain sensor of claim 24, wherein the flexible polymer base comprises polyamide.

26. The drain sensor of any one of the preceding claims, wherein the heater element is located at least 1 mm closer to the inflow port than the pair of sensing electrodes.

27. The drain sensor of any one of the preceding claims, wherein the heater element is located about 1 mm closer to the inflow port than the pair of sensing electrodes.

28. The drain sensor of any of the preceding claims, wherein the at least one sensing element collectively detects one or more of: lactate, glucose, glucose ratio. pH. and flow rate.

29. The drain sensor of any one of the preceding claims, wherein the aptamer that binds specifically to glucose comprises:ACGACCGTGTGTGTTGCTCTGTAACAGTGTCCATTGTCGT (SEQ ID NO: 1)30. The drain sensor of any one of the preceding claims, wherein a sensing element that detects lactate comprises:GACGACGAGTAGCGCGTATGAATGCTTTTCTATGGAGTCGTC (SEQ ID NO:2), or GACGACGCAGGGAGTTTTAACGGCTCTTGCGACTGTGTCGTC (SEQ ID NO: p3).

31. The drain sensor of any one of the preceding claims, further comprising a hydrogel in the fluid channel and in contact with the working electrode.

32. The drain sensor of claim 31, wherein the hydrogel comprises agarose, polyacrylamide, cellulose, cellulose acetate, agar, sephadex, chitosan, alignate, and / or collagen.

33. The drain sensor of claim 31, wherein the hydrogel is an agarose hydrogel.

34. The drain sensor of any one of claims 31-33, wherein the hydrogel is a l%-5% hydrogel.

35. The drain sensor of any one of claims 31-34, wherein the hydrogel further comprises one or more DNAse inhibitors.

36. The drain sensor of claim 35. wherein the one or more DNAse inhibitors comprises rutin.

37. The drain sensor of any one of the preceding claims, comprising a plurality of sensing elements.

38. The drain sensor of claim 37, wherein the plurality of sensing elements are arranged in series.

39. The drain sensor of claim 37, wherein the plurality of sensing elements are arranged in parallel.

40. The drain sensor of any one of the preceding claims, comprising a plurality of constituent sensing elements, each constituent sensing element detecting a different constituent of the fluid.

41. The drain sensor of any one of the preceding claims, comprising a flow rate sensing element and at least one constituent sensing elements.

42. The drain sensor of any one of the preceding claims, comprising a flow rate sensing element and a pl ura li ty of constituent sensing elements, each constituent sensing element detecting a different constituent of the fluid.

43. The drain sensor of any of the preceding claims, wherein the inflow port and / or the outflow port is configured to attach to a drain and / or catheter tube.

44. The drain sensor of any of the preceding claims, wherein the fluid channel and at least one sensing element are provided in a housing unit.

45. The drain sensor of claim 44, wherein the housing unit comprises a biocompatible resin.

46. The drain sensor of any one of the preceding claims, wherein the drain sensor is provided in a catheter tube or is permanently affixed to a catheter tube.

47. The drain sensor of any one of the preceding claims, wherein the drain sensor is provided in a drain or is permanently affixed to a drain.

48. The drain sensor of claim 47, wherein the drain is an internal ventricular drain, an external ventricular drain, a shunt, a cerebral shunt, a cerebrospinal fluid shunt, a lumbar-peritoneal shunt, a peritoneovenous shunt, a passive drain (e.g., a penrose drain), a urinary catheter, a chest tube or thoracostomy catheter, an abdominal drain (e g., Jackson-Pratt or Blake drain), a central venous catheter, a biliary drain, a nephrostomy dram, a gastrointestinal drain, a gastrointestinal drain, a peritoneal catheter, a wound drain, a sump drain, a hemovac drain, a silicone drain, a redon drain, a pleural drain, a pigtail catheter connected to any bodily cavity and comprising an external portion, a pancreastic drain, a drain connected to a vacuum, an indwelling catheter, and a thoracostomy tube.

49. The drain sensor of any one of the preceding claims, further comprising a transmitter or transceiver.

50. The drain sensor of any one of the preceding claims, further comprising a wired transmitter or wired transceiver.

51. The drain sensor of any one of the preceding claims, further comprising a wireless transmitter or wireless transceiver.

52. The drain sensor of any one of claims 49-51, wherein the transmitter or transceiver transmit a signal.

53. The drain sensor of claim 52, wherein the signal comprises the current, voltage, and / or impedance detected by the at least one sensing element.

54. A drain monitoring system, comprising the drain sensor of any one of the preceding claims and further comprising a controller.

55. The drain monitoring system of claim 54, wherein the controller receives a signal from the at least one sensing element and is configured to calculate the concentration or magnitude of the analyte and / or characteristic from the signal.

56. The drain monitoring system of claim 55. wherein the calculation is based on one or more standards or calibration curves.

57. The drain monitoring system of claim 55 or 56. wherein the calculation is based on kinetic differential measurements.

58. The drain monitoring system of any one of claims 54-57, wherein the controller is wirelessly comrected to the drain sensor.

59. The drain monitoring system of any one of claims 54-58, further comprising a wired connection between the controller and the drain sensor.

60. The drain monitoring system of any one of claims 54-59, further comprising a display.

61. The drain monitoring system of any one of claims 54-60, wherein the controller is configured to provide an alert if the drain sensor detects i) a specified level or change in a level of constituent and / or the flow rate; and / or ii) a disconnection or a loss of power.

62. The drain monitoring system of any one of claims 54-61, wherein the controller is configured to transmit a signal to a drain pump or valve if the drain sensor detects a specified level or change in a level of constituent and / or the flow rate.

63. The drain sensor or drain monitoring system of any one of the preceding claims, wherein tire drain sensor is located outside of a patient’s body and / or configured to be located outside of a patient’s body.

64. The drain sensor or drain monitoring system of claim 63. wherein the drain sensor is located or attached to an external portion of a drain and / or configured to be located in or attached to an external portion of a drain.

65. The drain sensor or drain monitoring system of claim 63. wherein the drain sensor is located or attached to percutaneous port and / or configured to be located in or attached to an percutaneous port.

66. The drain sensor or drain monitoring system of any one of the preceding claims, wherein tire drain sensor comprising a wireless transmitter or wireless transceiver is located inside of a patient’s body and / or configured to be located inside of a patient's body.

67. The drain sensor or drain monitoring system of any one of the preceding claims, wherein the drain sensor is located inside of a patient’s body and / or configured to be located inside of a patient’s body.

68. A kit comprising the drain sensor and / or drain monitoring system of any one of the preceding claims and one or more of: one or more drains; one or more catheter tubes; and one or more collection bags.

69. The kit of claim 68, wherein the one or more drains are selected from the group consisting of: an internal ventricular drain, an external ventricular drain, a shunt, a cerebral shunt, a cerebrospinal fluid shunt, a lumbar-peritoneal shunt, a peritoneovenous shunt, a passive drain (e.g., a penrose drain), a urinary catheter, a chest tube or thoracostomy catheter, an abdominal drain (e.g., Jackson-Pratt or Blake drain), a central venous catheter, a biliary drain, a nephrostomy drain, a gastrointestinal drain, a gastrointestinal drain, a peritoneal catheter, a wound drain, a sump drain, a hemovac drain, a silicone drain, a redon drain, a pleural drain, a pigtail catheter connected to any bodily cavity and comprising an external portion, a pancreastic drain, a drain comrected to a vacuum, an indwelling catheter, and a thoracostomy tube.

Images