Cardiomyocyte delivery platforms and methods of use

A delivery vehicle with a targeting ligand and PK/PD modulator effectively delivers RNAi agents to cardiomyocytes, addressing non-specific distribution and toxicity issues, enabling therapeutic treatment of cardiomyocyte-related conditions.

WO2026030210A1PCT designated stage Publication Date: 2026-02-05ARROWHEAD PHARMACEUTICALS INC
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/039472
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-29
Filing Date
2025-07-28
Publication Date
2026-02-05

AI Technical Summary

Technical Problem

Existing technologies face challenges in achieving specific and selective delivery of oligonucleotide-based agents, particularly RNAi agents, to cardiomyocytes, due to non-specific distribution and toxicity concerns with current delivery methods like cholesterol conjugates and lipid-nanoparticles.

Method used

A delivery vehicle comprising an oligonucleotide-based agent covalently linked to a targeting ligand with affinity for cardiomyocyte receptors and a PK/PD modulator, enabling selective and efficient gene expression inhibition in cardiomyocytes.

Benefits of technology

The delivery vehicle allows for targeted and effective reduction of gene expression in cardiomyocytes, facilitating therapeutic treatment of conditions mediated by reduced gene expression, such as pulmonary hypertension.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000004_0001
    Figure IMGF000004_0001
  • Figure IMGF000005_0001
    Figure IMGF000005_0001
  • Figure IMGF000005_0002
    Figure IMGF000005_0002
Patent Text Reader

Abstract

The present disclosure relates to delivery vehicles that specifically and efficiently direct payloads to cardiomyocytes in a subject, in vivo. The delivery vehicles disclosed herein include targeting ligands (such as compounds that have affinity for glucagon like peptide receptors, including GLP1R) and pharmacokinetic / pharmacodynamic (PK / PD) modulators, to facilitate the delivery of payloads to cells, including to cardiomyocytes. Suitable payloads for use in the delivery vehicles disclosed herein include RNAi agents, which can be linked or conjugated to the delivery vehicles, and when delivered in vivo, provide for the inhibition of gene expression in cardiomyocytes. Pharmaceutical compositions that include the cardiomyocyte delivery vehicle are also described, as well as methods of use for the treatment of various diseases and disorders where delivery of a therapeutic payload to a cardiomyocyte is desirable.
Need to check novelty before this filing date? Find Prior Art

Description

CARDIOMYOCYTE DELIVERY PLATFORMS AND METHODS OF USE CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority to United States Provisional Patent Application Serial No.63 / 676,671, filed on July 29, 2024, the contents of which are incorporated herein by reference in their entirety. SEQUENCE LISTING

[0002] This application contains a Sequence Listing (in compliance with Standard ST26), which has been submitted in xml format and is hereby incorporated by reference in its entirety. The xml sequence listing file is named 30746-WO_SeqListing.xml, created July 25, 2025, and is 2,222,400 bytes in size. FIELD OF THE INVENTION

[0003] The present disclosure relates to delivery vehicles for the delivery of payloads, such as RNA interference (RNAi) agents, e.g., double stranded RNAi agents, to cardiomyocytes in vivo. The delivery of RNAi agents using the delivery vehicles disclosed herein provide for the inhibition of genes that are expressed in cardiomyocytes. BACKGROUND

[0004] Directing therapeutic or diagnostic payloads to specific tissues of interest in vivo in a subject continues to be a great challenge in the field of medicine. This includes achieving specific and selective delivery to cardiomyocytes, where various diseases and disorders find their origin. The inability to selectively and efficiently deliver payloads, such as therapeutic drug products, to cardiomyocytes prevents many diseases and disorders from being properly treated and addressed.

[0005] Oligonucleotide-based agents, such as for example antisense oligonucleotide compounds (ASOs) and double-stranded RNA interference (RNAi) agents, have shown great promise and the potential to revolutionize the field of medicine and provide for potent therapeutic treatment options. However, the delivery of oligonucleotide-based agents, and double-stranded therapeutic RNAi agents in particular, has long been a challenge in developing viable therapeutic pharmaceutical agents. This is particularly the case when trying to achieve specific and selective delivery of oligonucleotide-based agents to non- hepatocyte cells, such as cardiomyocytes.

[0006] While various attempts over the past several years have been made to direct oligonucleotide-based agents to cardiomyocytes, using, for example, cholesterol conjugates (which are non-specific and have the known disadvantage of distributing to various undesired tissues and organs) and lipid-nanoparticles (LNPs) (which have been frequently reported to have toxicity concerns), none have to date achieved suitable delivery. Thus, there remains a need for a delivery vehicle to specifically and efficiently direct oligonucleotide-based agents, and RNAi agents in particular, to cardiomyocytes. SUMMARY

[0007] Disclosed herein is a delivery vehicle that directs payloads, such as oligonucleotide- based agents including RNA interference (RNAi) agents (also herein termed RNAi agent, RNAi trigger, or trigger; e.g., double-stranded RNAi agents), to cardiomyocytes and facilitates the selective and efficient inhibition of the expression of genes present in cardiomyocytes. Further disclosed herein are compounds comprising an oligonucleotide- based agent (e.g., and RNAi agent) and a delivery vehicle as described herein. Also disclosed herein are compositions that include the delivery vehicle comprising an RNAi agent for inhibiting expression of target genes, wherein the RNAi agent is covalently linked to at least one targeting ligand that has affinity for a cell receptor present on a targeted cell, and at least one pharmacokinetic and / or pharmacodynamic (PK / PD) modulator. Compounds comprising the delivery vehicle disclosed herein can selectively and efficiently decrease or inhibit expression of a target gene in a subject, e.g., a human or animal subject.

[0008] Compounds comprising an oligonucleotide-based agent and the described delivery vehicles can be used in methods for therapeutic treatment (including prophylactic, intervention, and preventative treatment) of conditions and diseases that can be mediated at least in part by the reduction in target gene expression. The compounds comprising RNAi agents disclosed herein can selectively reduce target gene expression in cells in a subject. The methods disclosed herein include the administration of one or more compounds comprising delivery vehicles and RNAi agents, as described herein, to a subject, e.g., a human or animal subject, using any suitable methods known in the art, such as intravenous infusion, intravenous injection, or subcutaneous injection.

[0009] Also described herein are pharmaceutical compositions that include a compound comprising a delivery vehicle and an RNAi agent capable of inhibiting the expression of a target gene, wherein the composition further includes at least one pharmaceutically acceptable excipient. The pharmaceutical compositions that include one or more deliveryvehicles and an RNAi agent are able to selectively and efficiently decrease or inhibit expression of a target gene in vivo. The compositions that include one or more delivery platforms comprising an RNAi agent described herein can be administered to a subject, such as a human or animal subject, for the treatment (including prophylactic treatment or inhibition) of conditions and diseases that can be mediated at least in part by a reduction in target gene expression, including, for example, pulmonary hypertension.

[0010] One aspect described herein is a compound for inhibiting expression of a gene expressed in cardiomyocytes comprising: (a) an RNAi agent comprising: (i) an antisense strand comprising 17-49 nucleotides wherein at least 15 nucleotides are complementary to the mRNA sequence of a gene that is expressed in cardiomyocytes; and a sense strand that is 16- 49 nucleotides in length that is at least partially complementary to the antisense strand; (b) a delivery vehicle comprising: (i) a targeting ligand with affinity for a receptor present on the surface of a cardiomyocyte; wherein the targeting ligand is a glucagon-like peptide 1 receptor (GLP1R) ligand; and (ii) a PK / PD modulator; wherein the RNAi agent is covalently linked to the targeting ligand and to the PK / PD modulator.

[0011] In one aspect, the compounds, or pharmaceutically acceptable salts thereof, are of Formula (I′):wherein: the targeting ligand has affinity for a receptor present on the surface of a cardiomyocyte; the RNAi agent comprises: (i) an antisense strand comprising 17-49 nucleotides wherein at least 15 nucleotides are complementary to the mRNA sequence of a gene that is expressed in cardiomyocytes; (ii) a sense strand that is 16-49 nucleotides in length that is at least partially complementary to the antisense strand; and m is 1, 2, 3, 4, or 5.

[0012] In some aspects, the PK / PD modulators described herein are of Formula (I):or a pharmaceutically acceptable salt thereof, wherein: L1 is a linking moiety; L2is selected from the group consisting of: optionally substituted alkylene, optionally substituted arylene, 2-20 polyethylene glycol (PEG) units optionally interrupted by C(O)NR3, wherein R3is selected from C1-C6alkyl and H, and a bond; Z is selected from the group consisting of: CH (wherein p is 1), CH2(wherein p is 0), N (wherein p is 1), optionally substituted arylene, C(O)NR3(wherein p is 0), heterocyclene, and NR3(wherein p is 0), wherein R3is selected from C1-C6alkyl and H; p is 0 or 1, as valency permits; Y1 and Y2 are each independently selected from the group consisting of: 2-20 polyethylene glycol (PEG) units, optionally substituted alkyl, optionally substituted cycloalkyl, and a bond; X1and X2are each independently selected from the group consisting of: C(O), C(O)NR2 and a bond, wherein R2 is C1-C6alkyl or H; n and m are each independently an integer from 8 to 20; W1 and W2 are each independently selected from the group consisting of: H, COOH a

[0013] In some aspects, the targeting ligands described herein are of Formula (II):or a pharmaceutically acceptable salt thereof, wherein: A is a substituted or unsubstituted carbocyclic or bicyclic ring, or a substituted or unsubstituted arylene ring; B is a substituted or unsubstituted heteroarylene ring;C is a substituted or unsubstituted, monocyclic, bicyclic, or spirocyclic, or heterocyclic ring; or a substituted or unsubstituted heteroarylene ring; Y is –O–, –S–, or –N(Rc)–; L1ais a linker comprising 2-20 PEG units; L2ais a linking moiety; Z1and Z2are each independently –O–, –S–, –N(Rb)–, –C(Ra)2–, –C(=O)–, or – C(=O)N(Rb)–, each instance of Raand Rbis independently hydrogen, substituted or unsubstituted alkyl, or -S(O)2-Rd; wherein Rdis a substituted or unsubstituted carbocyclic ring; and Rcis substituted or unsubstituted alkyl, or a substituted or unsubstituted carbocyclic ring.

[0014] In another aspect, the targeting ligands described herein are of Formula (III):or a pharmaceutically acceptable salt thereof, wherein: R comprises an oligonucleotide-based agent; R1is hydrogen, halogen, alkyl, or –ORd; Rdis substituted or unsubstituted alkyl; L1ais a linker comprising 2-20 PEG units; L2ais a linking moiety.

[0015] Another aspect of the present invention provides a pharmaceutical composition comprising a compound comprising an RNAi agent and a delivery vehicle, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient.

[0016] Another aspect of the present invention provides a method of treating a disease or disorder of a cardiomyocyte in a subject.

[0017] The present disclosure also provides methods of synthesizing a compound described herein (e.g., a compound of Formula (I′)), or a pharmaceutically acceptable salt thereof.

[0018] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although methods andmaterials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0019] Other objects, features, aspects, and advantages of the invention will be apparent from the following detailed description, accompanying figures, and from the claims. DETAILED DESCRIPTION

[0020] Definitions

[0021] As used herein, the terms “oligonucleotide” and “polynucleotide” mean a polymer of linked nucleosides each of which can be independently modified or unmodified.

[0022] As used herein, an “RNAi agent” (also referred to as an “RNAi trigger”) means a composition that contains an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that is capable of degrading or inhibiting (e.g., degrades or inhibits under appropriate conditions) translation of messenger RNA (mRNA) transcripts of a target mRNA in a sequence specific manner. As used herein, RNAi agents may operate through the RNA interference mechanism (i.e., inducing RNA interference through interaction with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) of mammalian cells), or by any alternative mechanism(s) or pathway(s). While it is believed that RNAi agents, as that term is used herein, operate primarily through the RNA interference mechanism, the disclosed RNAi agents are not bound by or limited to any particular pathway or mechanism of action. RNAi agents disclosed herein are comprised of a sense strand and an antisense strand, and include, but are not limited to: short (or small) interfering RNAs (siRNAs), double stranded RNAs (dsRNA), micro RNAs (miRNAs), short hairpin RNAs (shRNA), and dicer substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to the mRNA being targeted. RNAi agents can include one or more modified nucleotides and / or one or more non-phosphodiester linkages.

[0023] As used herein, the terms “silence,” “reduce,” “inhibit,” “down-regulate,” or “knockdown” when referring to expression of a given gene, mean that the expression of the gene, as measured by the level of RNA transcribed from the gene or the level of polypeptide, protein, or protein subunit translated from the mRNA in a cell, group of cells, tissue, organ, or subject in which the gene is transcribed, is reduced when the cell, group of cells, tissue,organ, or subject is treated with the RNAi agents described herein as compared to a second cell, group of cells, tissue, organ, or subject that has not or have not been so treated.

[0024] As used herein, the terms “sequence” and “nucleotide sequence” mean a succession or order of nucleobases or nucleotides, described with a succession of letters using standard nomenclature.

[0025] As used herein, a “base,” “nucleotide base,” or “nucleobase,” is a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, and includes the primary purine bases adenine and guanine, and the primary pyrimidine bases cytosine, thymine, and uracil. A nucleobase may further be modified to include, without limitation, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. (See, e.g., Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphoramidite compounds that include modified nucleobases) is known in the art.

[0026] As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleobase or nucleotide sequence (e.g., RNAi agent sense strand or targeted mRNA) in relation to a second nucleobase or nucleotide sequence (e.g., RNAi agent antisense strand or a single-stranded antisense oligonucleotide), means the ability of an oligonucleotide or polynucleotide including the first nucleotide sequence to hybridize (form base pair hydrogen bonds under mammalian physiological conditions (or similar conditions in vitro)) and form a duplex or double helical structure under certain standard conditions with an oligonucleotide or polynucleotide including the second nucleotide sequence. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are fulfilled. Sequence identity or complementarity is independent of modification. For example, a and Af, as defined herein, are complementary to U (or T) and identical to A for the purposes of determining identity or complementarity.

[0027] As used herein, “perfectly complementary” or “fully complementary” means that in a hybridized pair of nucleobase or nucleotide sequence molecules, all (100%) of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.

[0028] As used herein, “partially complementary” means that in a hybridized pair of nucleobase or nucleotide sequence molecules, at least 70%, but not all, of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of basesin a contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.

[0029] As used herein, “substantially complementary” means that in a hybridized pair of nucleobase or nucleotide sequence molecules, at least 85%, but not all, of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.

[0030] As used herein, the terms “complementary,” “fully complementary,” “partially complementary,” and “substantially complementary” are used with respect to the nucleobase or nucleotide matching between the sense strand and the antisense strand of an RNAi agent, or between the antisense strand of an RNAi agent and a sequence of a target mRNA.

[0031] As used herein, an “oligonucleotide-based agent” is a nucleotide sequence containing about 10-50 (e.g., 10 to 48, 10 to 46, 10 to 44, 10 to 42, 10 to 40, 10 to 38, 10 to 36, 10 to 34, 10 to 32, 10 to 30, 10 to 28, 10 to 26, 10 to 24, 10 to 22, 10 to 20, 10 to 18, 10 to 16, 10 to 14, 10 to 12, 12 to 50, 12 to 48, 12 to 46, 12 to 44, 12 to 42, 12 to 40, 12 to 38, 12 to 36, 12 to 34, 12 to 32, 12 to 30, 12 to 28, 12 to 26, 12 to 24, 12 to 22, 12 to 20, 12 to 18, 12 to 16, 12 to 14, 14 to 50, 14 to 48, 14 to 46, 14 to 44, 14 to 42, 14 to 40, 14 to 38, 14 to 36, 14 to 34, 14 to 32, 14 to 30, 14 to 28, 14 to 26, 14 to 24, 14 to 22, 14 to 20, 14 to 18, 14 to 16, 16 to 50, 16 to 48, 16 to 46, 16 to 44, 16 to 42, 16 to 40, 16 to 38, 16 to 36, 16 to 34, 16 to 32, 16 to 30, 16 to 28, 16 to 26, 16 to 24, 16 to 22, 16 to 20, 16 to 18, 18 to 50, 18 to 48, 18 to 46, 18 to 44, 18 to 42, 18 to 40, 18 to 38, 18 to 36, 18 to 34, 18 to 32, 18 to 30, 18 to 28, 18 to 26, 18 to 24, 18 to 22, 18 to 20, 20 to 50, 20 to 48, 20 to 46, 20 to 44, 20 to 42, 20 to 40, 20 to 38, 20 to 36, 20 to 34, 20 to 32, 20 to 30, 20 to 28, 20 to 26, 20 to 24, 20 to 22, 22 to 50, 22 to 48, 22 to 46, 22 to 44, 22 to 42, 22 to 40, 22 to 38, 22 to 36, 22 to 34, 22 to 32, 22 to 30, 22 to 28, 22 to 26, 22 to 24, 24 to 50, 24 to 48, 24 to 46, 24 to 44, 24 to 42, 24 to 40, 24 to 38, 24 to 36, 24 to 34, 24 to 32, 24 to 30, 24 to 28, 24 to 26, 26 to 50, 26 to 48, 26 to 46, 26 to 44, 26 to 42, 26 to 40, 26 to 38, 26 to 36, 26 to 34, 26 to 32, 26 to 30, 26 to 28, 28 to 50, 28 to 48, 28 to 46, 28 to 44, 28 to 42, 28 to 40, 28 to 38, 28 to 36, 28 to 34, 28 to 32, to 28 to 30, 30 to 50, 30 to 48, 30 to 46, 30 to 44, 30 to 42, 30 to 40, 30 to 38, 30 to 36, 30 to 34, 30 to 32, 32 to 50, 32 to 48, 32 to 46, 32 to 44, 32 to 42, 32 to 40, 32 to 38, 32 to 36, 32 to 34, 34 to 50, 34 to 48, 34 to 46, 34 to 44, 34 to 42, 34 to 40, 34 to 38, 34 to 36, 36 to 50, 36 to 48, 36 to 46, 36 to 44, 36 to 42, 36 to 40, 36 to 38, 38 to 50, 38 to 48, 38 to 46, 38 to 44, 38 to 42, 38 to 40, 40 to 50, 40 to 48, 40 to 46, 40 to 44, 40 to 42, 42 to 50, 42 to 48, 42 to 46, 42 to 44, 44 to 50, 44 to 48, 44 to 46, 46 to 50, 46 to 48, or 48 to 50) nucleotides or nucleotide base pairs. In some embodiments, anoligonucleotide-based agent has a nucleobase sequence that is at least partially complementary to a coding sequence in an expressed target nucleic acid or target gene within a cell. In some embodiments, the oligonucleotide-based agent, upon delivery to a cell expressing a gene, are able to inhibit the expression of the underlying gene, and are referred to herein as “expression-inhibiting oligonucleotide-based agents.” The gene expression can be inhibited in vitro or in vivo.

[0032] “Oligonucleotide-based agents” include, but are not limited to: single-stranded oligonucleotides, single-stranded antisense oligonucleotides, short interfering RNAs (siRNAs), double-strand RNAs (dsRNA), micro RNAs (miRNAs), short hairpin RNAs (shRNA), ribozymes, interfering RNA molecules, and dicer substrates. In some embodiments, an oligonucleotide-based agent is a single-stranded oligonucleotide, such as an antisense oligonucleotide. In some embodiments, an oligonucleotide-based agent is a double- stranded oligonucleotide. In some embodiments, an oligonucleotide-based agent is a double- stranded oligonucleotide that is an RNAi agent.

[0033] As used herein and as would be understood by one skilled in the art, a polyethylene glycol (PEG) unit refers to repeating units of the formula –(CH2CH2O)–. It will be appreciated that, in the chemical structures disclosed herein, PEG units may be depicted as –(CH2CH2O)–, –(OCH2CH2)–, or –(CH2OCH2)–. It will also be appreciated that a numeral indicating the number of repeating PEG units may be placed on either side of the parentheses depicting the PEG units. It will be further appreciated that a terminal PEG unit may be end capped by an atom (e.g., a hydrogen atom) or some other moiety.

[0034] As used herein, the term “substantially identical” or “substantial identity,” as applied to a nucleic acid sequence means the nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% sequence identity or more, e.g., at least 90%, at least 95%, or at least 99% identity, compared to a reference sequence. Percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions at which the same type of nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. In some embodiments, sequence identity, as applicable to a particular nucleotide or amino acid sequence, is calculated by a pairwise alignment using the Needleman-Wunsch algorithm using a generally available alignment program, e.g., the Needle (EMBOSS) program. The inventions disclosed herein encompass nucleotide sequences substantially identical to thosedisclosed herein. In particular embodiments, a nucleic acid sequence is 99% identical to a nucleotide sequence disclosed herein. In particular embodiments, a nucleic acid is 95% identical to a nucleotide sequence disclosed herein. In particular embodiments, an amino acid sequence is 99% identical to a polypeptide sequence disclosed herein. In particular embodiments, an amino acid is 95% identical to a polypeptide sequence disclosed herein.

[0035] As used herein, the terms “treat,” “treatment,” and the like, mean the methods or steps taken to provide relief from or alleviation of the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, “treat” and “treatment” may include the preventative treatment, management, prophylactic treatment, and / or inhibition or reduction of the number, severity, and / or frequency of one or more symptoms of a disease in a subject.

[0036] As used herein, the phrase “introducing into a cell,” when referring to an RNAi agent, means functionally delivering the RNAi agent into a cell. The phrase “functional delivery,” means delivering the RNAi agent to the cell in a manner that enables the RNAi agent to have the expected biological activity, e.g., sequence-specific inhibition of gene expression.

[0037] As used herein, the term “isomers” refers to compounds that have identical molecular formulae, but that differ in the nature or the sequence of bonding of their atoms or in the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are termed “stereoisomers.” Stereoisomers that are not mirror images of one another are termed “diastereomers,” and stereoisomers that are non-superimposable mirror images are termed “enantiomers,” or sometimes optical isomers. A carbon atom bonded to four non- identical substituents is termed a “chiral center.”

[0038] As used herein, unless specifically identified in a structure as having a particular conformation, for each structure in which asymmetric centers are present and thus give rise to enantiomers, diastereomers, or other stereoisomeric configurations, each structure disclosed herein is intended to represent all such possible isomers, including their optically pure and racemic forms. For example, the structures disclosed herein are intended to cover mixtures of diastereomers as well as single stereoisomers.

[0039] As used in a claim herein, the phrase “consisting of” excludes any element, step, or ingredient not specified in the claim. When used in a claim herein, the phrase “consisting essentially of” limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claimed invention.

[0040] The person of ordinary skill in the art would readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or Satoms) in a protonated or deprotonated state, depending upon the environment in which the compound or composition is placed. Accordingly, as used herein, the structures disclosed herein envisage that certain functional groups, such as, for example, OH, SH, or NH, may be protonated or deprotonated. The disclosure herein is intended to cover the disclosed compounds and compositions regardless of their state of protonation based on the environment (such as pH), as would be readily understood by the person of ordinary skill in the art.

[0041] As used herein, the term “lipid” refers to moieties and molecules that are soluble in nonpolar solvents. The term lipid includes amphiphilic molecules comprising a polar, water- soluble head group and a hydrophobic tail. Lipids can be of natural or synthetic origin. Non- limiting examples of lipids include fatty acids (e.g., saturated fatty acids, monounsaturated fatty acids, and polyunsaturated fatty acids), glycerolipids (e.g., monoacylglycerols, diacylglycerols, and triacylglycerols), phospholipids (e.g., phosphatidylethanolamine, phosphatidylcholine, and phosphatidylserine), sphingolipids (e.g., sphingomyelin), and cholesterol esters. As used herein, the term “saturated lipid” refers to lipids that are free of any unsaturation. As used herein, the term “unsaturated lipid” refers to lipids that comprise at least one (1) degree of unsaturation. As used herein, the term “branched lipid” refers to lipids comprising more than one linear chain, wherein each linear chain is covalently attached to at least one other linear chain. As used herein, the term “straight chain lipid” refers to lipids that are free of any branching.

[0042] As used herein, the term “linked” or “conjugated” when referring to the connection between two compounds or molecules means that two molecules are joined by a covalent bond or are associated via noncovalent bonds (e.g., hydrogen bonds or ionic bonds). In some examples, where the term “linked” or “conjugated” refers to the association between two molecules via noncovalent bonds, the association between the two different molecules has a KD of less than 1 x 10-4M (e.g., less than 1 x 10-5M, less than 1 x 10-6M, or less than 1 x 10-7M) in physiologically acceptable buffer (e.g., buffered saline). Unless stated, the terms “linked” and “conjugated” as used herein may refer to the connection between a first compound and a second compound either with or without any intervening atoms or groups of atoms.

[0043] As used herein, a linking group is one or more atoms that connects one molecule or portion of a molecule to a second molecule or second portion of a molecule. Similarly, as used in the art, the term scaffold is sometimes used interchangeably with a linking group. Linking groups may comprise any number of atoms or functional groups. In someembodiments, linking groups may not facilitate any biological or pharmaceutical response, and merely serve to link two biologically active molecules.

[0044] Unless stated otherwise, the symbolas used herein means that any group or groups may be linked thereto that is in accordance with the scope of the inventions described herein.

[0045] As used herein, the term “including” is used to herein mean, and is used interchangeably with, the phrase “including but not limited to.” The term “or” is used herein to mean, and is used interchangeably with, the term “and / or,” unless the context clearly indicates otherwise.

[0046] As used in a claim herein, the phrase “consisting of” excludes any element, step, or ingredient not specified in the claim. When used in a claim herein, the phrase “consisting essentially of” limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claimed invention.

[0047] Modified Nucleotides

[0048] In some embodiments, an RNAi agent contains one or more modified nucleotides. As used herein, a “modified nucleotide” is a nucleotide other than a ribonucleotide (2′-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides can include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides (represented herein as Ab), 2′-modified nucleotides, 3′ to 3′ linkages (inverted) nucleotides (represented herein as invdN, invN, invn), modified nucleobase-comprising nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2′,3′-seco nucleotide mimics (unlocked nucleobase analogues, represented herein as NUNA or NUNA), locked nucleotides (represented herein as NLNAor NLNA), 3′-O-methoxy (2′ internucleoside linked) nucleotides (represented herein as 3′-OMen), 2'-F-Arabino nucleotides (represented herein as NfANA or NfANA), 5'-Me, 2'- fluoro nucleotide (represented herein as 5Me-Nf), morpholino nucleotides, vinyl phosphonate deoxyribonucleotides (represented herein as vpdN), vinyl phosphonate containing nucleotides, and cyclopropyl phosphonate containing nucleotides (cPrpN).2′-modified nucleotides (i.e., a nucleotide with a group other than a hydroxyl group at the 2′ position of the five-membered sugar ring) include, but are not limited to, 2′-O-methyl nucleotides (represented herein as a lower case letter ‘n’ in a nucleotide sequence), 2′-deoxy-2′-fluoro nucleotides (also referred to herein as 2′-fluoro nucleotide, and represented herein as Nf), 2′-deoxy nucleotides (represented herein as dN), 2′-methoxyethyl (2′-O-2-methoxylethyl) nucleotides (also referred to herein as 2′-MOE, and represented herein as NM), 2′-amino nucleotides, and 2′-alkyl nucleotides. It is not necessary for all positions in a given compound to be uniformly modified. Conversely, more than one modification can be incorporated in a single RNAi agent or even in a single nucleotide thereof. The RNAi agent sense strands and antisense strands can be synthesized and / or modified by methods known in the art. Modification at one nucleotide is independent of modification at another nucleotide.

[0049] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me- C), 5-hydroxymethyl cytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyl uracil, 5-propynyl cytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine.

[0050] In some embodiments, all or substantially all of the nucleotides of an RNAi agent are modified nucleotides. As used herein, an RNAi agent wherein substantially all of the nucleotides present are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense strand and the antisense strand being ribonucleotides (i.e., unmodified). As used herein, a sense strand wherein substantially all of the nucleotides present are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand being unmodified ribonucleotides. As used herein, an antisense sense strand wherein substantially all of the nucleotides present are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand being unmodified ribonucleotides. In some embodiments, one or more nucleotides of an RNAi agent is an unmodified ribonucleotide.

[0051] Modified Internucleoside Linkages

[0052] In some embodiments, one or more nucleotides of an RNAi agent are linked by non- standard linkages or backbones (i.e., modified internucleoside linkages or modified backbones). Modified internucleoside linkages or backbones include, but are not limited to,phosphorothioate groups (represented herein as a lower case “s”), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkyl phosphonates (e.g., methyl phosphonates or 3′-alkylene phosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3′-amino phosphoramidate, aminoalkylphosphoramidates, or thionophosphoramidates), thionoalkyl-phosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of boranophosphates, or boranophosphates having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3′-5′ to 5′-3′ or 2′-5′ to 5′-2′. In some embodiments, a modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl inter-sugar linkages, mixed heteroatom and alkyl or cycloalkyl inter-sugar linkages, or one or more short chain heteroatomic or heterocyclic inter- sugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methylene formacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2 components.

[0053] In some embodiments, a sense strand of an RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, an antisense strand of an RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, a sense strand of an RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, an antisense strand of an RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, or 4 phosphorothioate linkages.

[0054] In some embodiments, an RNAi agent sense strand contains at least two phosphorothioate internucleoside linkages. In some embodiments, the at least two phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3 from the 3' end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is at the 5’ end of the sense strand, and another phosphorothioate linkage is at the 3’ end of the sense strand. In some embodiments, two phosphorothioate internucleoside linkage are located at the 5’ end of the sense strand, and another phosphorothioate linkage is at the 3’ end of the sense strand. In some embodiments, the sense strand does not include anyphosphorothioate internucleoside linkages between the nucleotides, but contains one, two, or three phosphorothioate linkages between the terminal nucleotides on both the 5’ and 3’ ends and the optionally present inverted abasic residue terminal caps. In some embodiments, the targeting ligand is linked to the sense strand via a phosphorothioate linkage.

[0055] In some embodiments, an RNAi agent antisense strand contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3 from the 5' end of the antisense strand and between the nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end. In some embodiments, three phosphorothioate internucleoside linkages are located between positions 1-4 from the 5’ end of the antisense strand, and a fourth phosphorothioate internucleoside linkage is located between positions 20-21 from the 5’ end of the antisense strand. In some embodiments, an RNAi agent contains at least three or four phosphorothioate internucleoside linkages in the antisense strand.

[0056] In some embodiments, an RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, a 2′-modified nucleoside is combined with modified internucleoside linkage.

[0057] Pharmacokinetic and / or Pharmacodynamic Modulators

[0058] Delivery vehicles disclosed herein comprise a pharmacokinetic and / or pharmacodynamic (also referred to herein as “PK / PD”) modulator linked to the RNAi agent to facilitate the delivery of the RNAi agent to the desired cells or tissues. PK / PD modulator precursors can be synthetized having reactive groups, such as maleimide or azido groups, to facilitate linkage to one or more linking groups on the RNAi agent. Chemical reaction syntheses to link such PK / PD modulator precursors to RNAi agents are generally known in the art. The terms “PK / PD modulator” and “lipid PK / PD modulator” are used interchangeably herein.

[0059] In some embodiments, PK / PD modulators may include molecules that are fatty acids, lipids, albumin-binders, antibody-binders, polyesters, polyacrylates, poly-amino acids, and linear or branched polyethylene glycol (PEG) moieties having about 20-2000 PEG –(CH2CH2O)– units.

[0060] In some embodiments, the RNAi agent may be conjugated to a lipid PK / PD modulator of Formula (I):or a pharmaceutically acceptable salt thereof, wherein: L1 is a linking moiety; L2 is selected from the group consisting of: optionally substituted alkylene, optionally substituted arylene, 2-20 polyethylene glycol (PEG) units optionally interrupted by C(O)NR3, wherein R3is selected from C1-C6alkyl and H, and a bond; Z is selected from the group consisting of: CH (wherein p is 1), C H2(wherein p is 0), N (wherein p is 1), optionally substituted arylene, C(O)NR3(wherein p is 0), heterocyclene, and NR3(wherein p is 0), wherein R3is selected from C1-C6alkyl and H; p is 0 or 1, as valency permits; Y1 and Y2 are each independently selected from the group consisting of: 2-20 polyethylene glycol (PEG) units, optionally substituted alkyl, optionally substituted cycloalkyl, and a bond; X1and X2are each independently selected from the group consisting of: C(O), C(O)NR2 and a bond, wherein R2 is C1-C6alkyl or H; n and m are each independently an integer from 8 to 20; W1 and W2 are each independently selected from the group consisting of: H, COOHwhereinindicates a point of connection to the remainder of the compound.

[0061] Examples of PK / PD modulators that are covalently linked to the RNAi agents described here are shown in Table 1 below: Table 1: Exemplary PK / PD modulatorsor a pharmaceutically acceptable salt thereof, wherein indicates a point of connection to the remainder of the compound.

[0062] In some embodiments, delivery vehicles may comprise one or more PK / PD modulators. In some embodiments, delivery vehicles comprise one, two, three, four, five, six, seven or more PK / PD modulators. In some embodiments, the one or more PK / PD inhibitors are the same. In some embodiments, the one or more PK / PD inhibitors are different.

[0063] Table 2 shows certain exemplary PK / PD modulator precursors that can be used as starting materials to link to the RNAi agents disclosed herein. The PK / PD modulator precursors may be covalently attached to an RNAi agent using any known method in the art. In some embodiments, maleimide-containing PK / PD modulator precursors may be reacted with a disulfide-containing moiety at a 3’ end of the sense strand of the RNAi agent.

[0064] Table 2: Exemplary PK / PD Modulator Precursors Suitable for Linking to RNAi Agents.

[0065] In certain embodiments, the PK / PD modulator is of the formula:LP-161.

[0066] PK / PD modulator precursors may be conjugated to an RNAi agent using any known method in the art. In some embodiments, PK / PD modulator precursors comprising a maleimide moiety may be reacted with RNAi agents comprising a disulfide linkage to form a compound comprising a PK / PD modulator conjugated to an RNAi agent. The disulfide may be reduced, and added to a maleimide by way of a Michael-Addition reaction. An example reaction scheme is shown below:wherein Compound A is a PK / PD modulator precursor that comprises a maleimide moiety, RNAi comprises an RNAi agent, and indicates a point of connection to any suitable groupknown in the art. In some embodiments of the reaction scheme above,is attached to an alkyl group such as hexyl (C6H13).

[0067] In some embodiments, PK / PD modulator precursors may comprise a sulfone moiety and may react with a disulfide. An example reaction scheme is shown below:wherein Compound B is a PK / PD modulator precursor that comprises a sulfone moiety, RNAi comprises an RNAi agent, and indicates a point of connection to any suitable groupknown in the art. In some instances of the reaction scheme above, is attached to an alkyl group such as hexyl (C6H13).

[0068] In some embodiments, PK / PD modulator precursors may comprise an azide moiety and be reacted with an RNAi agent comprising an alkyne to form a compound comprising a PK / PD modulator conjugated to an RNAi agent according to the general reaction scheme below:wherein Compound C is a PK / PD modulator precursor that comprises an azide moiety, and RNAi comprises an RNAi agent.

[0069] In some embodiments, PK / PD modulators may be conjugated to the 5’ end of the sense or antisense strand, the 3’ end of the sense or antisense strand, or to an internal nucleotide of an RNAi agent. In some embodiments, an RNAi agent is synthesized with a disulfide-containing moiety at the 3’ end of the sense strand, and a PK / PD modulator precursor may be conjugated to the 3’ end of the sense strand using any of the appropriate general synthetic schemes shown above.

[0070] Targeting Ligands and Targeting Groups

[0071] Targeting groups or targeting ligands enhance the pharmacokinetic or biodistribution properties of a conjugate or RNAi agent to which they are attached to improve cell-specific (including, in some cases, organ specific) distribution and cell-specific (or organ specific) uptake of the conjugate or RNAi agent. A targeting group can be monovalent, divalent,trivalent, tetravalent, or have higher valency for the target to which it is directed. Representative targeting groups include, without limitation, compounds with affinity to cell surface molecule, cell receptor ligands, hapten, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity to cell surface molecules. In some embodiments, a targeting group is linked to an RNAi agent using a linker, such as a PEG linker or one, two, or three abasic and / or ribitol (abasic ribose) residues, which in some instances can serve as linkers. In some embodiments, a targeting group comprises one or more GLP1R targeting ligands.

[0072] In some embodiments, RNAi agents described herein are conjugated to targeting groups. In some embodiments, a targeting ligand enhances the ability of the RNAi agent to bind to a particular cell receptor on a cell of interest. In some embodiments, the targeting ligands conjugated to RNAi agents described herein have affinity for GLP receptors. In some embodiments, a suitable targeting ligand for use with the RNAi agents disclosed herein has affinity for GLP1R. Targeting groups comprise two or more targeting ligands.

[0073] In some embodiments, an RNAi agent disclosed herein is linked to one or more targeting ligands (e.g., GLP1R targeting ligands) of Formula (II):or a pharmaceutically acceptable salt thereof, wherein: A is a substituted or unsubstituted carbocyclic or bicyclic ring, or a substituted or unsubstituted arylene ring; B is a substituted or unsubstituted heteroarylene ring; C is a substituted or unsubstituted, monocyclic, bicyclic, or spirocyclic, or heterocyclic ring; or a substituted or unsubstituted heteroarylene ring; Y is –O–, –S–, or –N(Rc)–; L1ais a linker comprising 2-20 PEG units; L2ais a linking moiety; Z1and Z2are each independently –O–, –S–, –N(Rb)–, –C(Ra)2–, –C(=O)–, or – C(=O)N(Rb)–, each instance of Raand Rbis independently hydrogen, substituted or unsubstituted alkyl, or -S(O)2-Rd; wherein Rdis a substituted or unsubstituted carbocyclic ring; Rcis substituted or unsubstituted alkyl, or a substituted or unsubstituted carbocyclic ring; andindicates a point of connection to the remainder of the compound.

[0074] In some embodiments, the compounds described herein comprise an RNAi agent linked to one or more targeting ligands (e.g., GLP1R targeting ligands) of the formula:wherein indicates a point of connection to the remainder of the compound.

[0075] In some embodiments, the compounds described herein comprise an RNAi agent linked to one or more targeting ligands (e.g., GLP1R targeting ligands) of the formula:whereinindicates a point of connection to the remainder of the compound.

[0076] In some embodiments, an RNAi agent disclosed herein is linked to one or more targeting ligands (e.g., GLP1R targeting ligands) of Formula (III):or a pharmaceutically acceptable salt thereof, wherein: R1is hydrogen, halogen, alkyl, or –ORd; Rdis substituted or unsubstituted alkyl; L1ais a linker comprising 2-20 PEG units; L2ais a linking moiety, and indicates a point of connection to the remainder of the compound.

[0077] In certain embodiments, the compounds described herein comprise an RNAi agent linked to one or more targeting ligands (e.g., GLP1R targeting ligands) of the formula:

[0078] In certain embodiments, the compounds described herein comprise an RNAi agent linked to one or more targeting ligands (e.g., GLP1R targeting ligands) of the formula:whereinindicates a point of connection to the remainder of the compound.

[0079] Another aspect of the present invention provides a pharmaceutical composition comprising a compound comprising an RNAi agent and a delivery vehicle, or a pharmaceutically acceptable excipient.

[0080] RNAi agents may comprise more than one targeting ligand. In some embodiments, RNAi agents comprise 1-20 targeting ligands. In some embodiments, RNAi agents comprise from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 targeting ligands to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 targeting ligands. In someembodiments, a targeting ligand may be conjugated at the 5’ or 3’ end of the sense strand of an RNAi agent. In some embodiments, a targeting ligand may be conjugated to an internal nucleotide on an RNAi agent.

[0081] Examples of GLP1R targeting ligands that are covalently linked to the RNAi agent are shown in Table 3 below: Table 3: Exemplary targeting ligandswherein indicates a point of connection to the remainder of the compound.

[0082] In some embodiments, RNAi agents comprise a targeting group, which includes 2 or more targeting ligands. In some embodiments, a targeting group may be conjugated at the 5’ or 3’ end of the sense strand of an RNAi agent. In some embodiments, a targeting group may be conjugated to an internal nucleotide on an RNAi agent. In some embodiments, a targeting group may consist of two targeting ligands linked together, referred to as a “bidentate” targeting group. In some embodiments, a targeting group may consist of three targeting ligands linked together, referred to as a “tridentate” targeting group. In some embodiments, a targeting group may consist of four targeting ligands linked together, referred to as a “tetradentate” targeting group.

[0083] In some embodiments, RNAi agents may comprise both a targeting group conjugated to the 3’ or 5’ end of the sense strand, and additionally targeting ligands conjugated to internal nucleotides. In some embodiments a tridentate targeting group is conjugated to the5’ end of the sense strand of an RNAi agent, and at least one targeting ligand is conjugated to an internal nucleotide of the sense strand. In further embodiments, a tridentate targeting group is conjugated to the 5’ end of the sense strand of an RNAi agent, and four targeting ligands are conjugated to internal nucleotides of the sense strand.

[0084] As mentioned above, in some embodiments, RNAi agents disclosed herein can be linked to one or more targeting ligands and / or one or more targeting groups on internal nucleotides of the sense strand or antisense strand of the RNAi agent to facilitate the delivery of the RNAi agent in vivo. In some embodiments, the targeting ligands or targeting groups are linked or conjugated to one or more internal nucleotides of the sense strand of the RNAi agent. For example, a targeting ligand may be linked to an individual nucleotide at the 2’ position of the ribose ring, the 3’ position of the ribose ring, the G position of the ribose ring or to the nucleobase of the nucleotide, the 4’ position of the ribose ring, the 5’ position of the nucleotide, or to the oxygen atom on the ribose ring. The following depicts a hypothetical ribose nucleotide, with the carbons numbered:

[0085] In some embodiments, to facilitate the linkage of one or more targeting ligands and / or targeting groups to internal nucleotides, 2’-O-propargyl modified nucleotides are incorporated to the nucleotide sequence. The 2’-O-propargyl modified nucleotides, after synthesis of the respective strand, can be linked or conjugated to targeting ligands and / or targeting groups at the 2’ position using standard coupling techniques as known in the art.

[0086] Non-nucleotide Groups

[0087] In some embodiments, an RNAi agent contains or is conjugated to one or more non- nucleotide groups including, but not limited to a linking group or a delivery agent. The non- nucleotide group can enhance targeting, delivery, or attachment of the RNAi agent. Examples of linking groups are provided in Table 4. The non-nucleotide group can be covalently linked to the 3′ and / or 5′ end of either the sense strand and / or the antisense strand. In some embodiments, an RNAi agent contains a non-nucleotide group linked to the 3′ and / or 5′ end of the sense strand. In some embodiments, a non-nucleotide group is linked to the 5′end of an RNAi agent sense strand. A non-nucleotide group can be linked directly or indirectly to the RNAi agent via a linker / linking group. In some embodiments, a non- nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.

[0088] In some embodiments, a non-nucleotide group enhances the pharmacokinetic or biodistribution properties of an RNAi agent or conjugate to which it is attached to improve cell- or tissue-specific distribution and cell-specific uptake of the conjugate. In some embodiments, a non-nucleotide group enhances endocytosis of the RNAi agent.

[0089] The RNAi agents described herein can be synthesized having a reactive group, such as an amino group (also referred to herein as an amine), at the 5′-terminus and / or the 3′- terminus. The reactive group can be used subsequently to attach a targeting moiety using methods typical in the art.

[0090] For example, in some embodiments, the RNAi agents disclosed herein are synthesized having an NH2-C6group at the 5′-terminus of the sense strand of the RNAi agent. The terminal amino group subsequently can be reacted to form a conjugate with, for example, a group that includes a compound having affinity for GLP1R (i.e., a GLP1R ligand) or a PK / PD modulator. In some embodiments, the RNAi agents disclosed herein are synthesized having one or more alkyne groups at the 5′-terminus of the sense strand of the RNAi agent. The terminal alkyne group(s) can subsequently be reacted to form a conjugate with, for example, a group that includes a targeting ligand.

[0091] In some embodiments, a targeting group comprises an GLP1R targeting ligand. In some embodiments, a GLP1R targeting ligand includes a compound that has affinity to GLP1R. The use of an GLP1R targeting ligands can facilitate cell-specific targeting to cells having the respective GLP receptors on its respective surface, and binding of the GLP1R targeting ligand can facilitate entry of the RNAi agent, to which it is linked, into cells such as cardiomyocytes. Targeting ligands, targeting groups, and / or PK / PD modulators can be attached to the 3′ and / or 5′ end of the RNAi agent, and / or to internal nucleotides on the RNAi agent, using methods generally known in the art. The preparation of targeting ligand and targeting groups, such as GLP1R is described in Example 3 below.

[0092] Embodiments of the present disclosure include pharmaceutical compositions for delivering an RNAi agent to a cardiomyocyte in vivo. Such pharmaceutical compositions can include, for example, an RNAi agent conjugated to a targeting group that comprises a GLP1Rtargeting ligand that has affinity for GLP1R. In some embodiments, the targeting ligand is comprised of a compound having affinity for GLP1R.

[0093] In some embodiments, the RNAi agents disclosed herein can reduce gene expression in one or more of the following tissues: heart apex, left ventricle, right ventricle, left atrium, and right atrium.

[0094] In some embodiments, the RNAi agent is synthesized having present a linking group, which can then facilitate covalent linkage of the RNAi agent to a targeting ligand, a targeting group, a PK / PD modulator, or another type of delivery polymer or delivery vehicle. The linking group can be linked to the 3′ and / or the 5′ end of the RNAi agent sense strand or antisense strand. In some embodiments, the linking group is linked to the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5′ or 3′ end of an RNAi agent sense strand. In some embodiments, a linking group is conjugated to the 5′ end of an RNAi agent sense strand. Examples of linking groups, include, but are not limited to: Alk- SMPT-C6, Alk-SS-C6, DBCO-TEG, Me-Alk-SS-C6, and C6-SS-Alk-Me, reactive groups such a primary amines and alkynes, alkyl groups, abasic residues / nucleotides, amino acids, trialkyne functionalized groups, ribitol, and / or PEG units.

[0095] A linker or linking group is a bi-valent connection between two atoms that links one chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as a targeting ligand, targeting group, PK / PD modulator, or delivery agent) or segment of interest via one or more covalent bonds. A labile linkage contains a labile bond. A linkage can optionally include a spacer that increases the distance between the two joined atoms. A spacer may further add flexibility and / or length to the linkage. Spacers include, but are not limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups; each of which can contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art and the preceding list is not meant to limit the scope of the description.

[0096] In some embodiments, targeting groups are linked to RNAi agents without the use of an additional linker. In some embodiments, the targeting group is designed having a linker readily present to facilitate the linkage to an RNAi agent. In some embodiments, when two or more RNAi agents are included in a composition, the two or more RNAi agents can be linked to their respective targeting groups using the same linkers. In some embodiments, when two or more RNAi agents are included in a composition, the two or more RNAi agents are linked to their respective targeting groups using different linkers.

[0097] In some embodiments, a linking group may be conjugated synthetically to the 5’ or 3’end of the sense strand of an RNAi agent described herein. In some embodiments, a linking group is conjugated synthetically to the 5’ end of the sense strand of an RNAi agent. In some embodiments, a linking group conjugated to an RNAi agent may be a trialkyne linking group.

[0098] Examples of certain PK / PD modulators, targeting ligands, modified nucleotides, and linking groups, are provided in Table 4 below. Table 4: Structures Representing Various Modified Nucleotides, Linking Groups, Lipid PK / PD modulators, and targeting ligands.

[0099] Alternatively, other linking groups known in the art may be used.

[0100] In addition or alternatively to linking an RNAi agent to one or more targeting ligands, targeting groups, and / or PK / PD modulators, in some embodiments, a delivery agent may be used to deliver an RNAi agent to a cell or tissue. A delivery agent is a compound that can improve delivery of the RNAi agent to a cell or tissue, and can include, or consist of, but is not limited to: a polymer, such as an amphipathic polymer, a membrane active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane active polyamine.

[0101] In some embodiments, the RNAi agents can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs or other delivery systems available in the art. The RNAi agents can also be chemically conjugated to targeting groups, lipids (including, but not limited to cholesterol and cholesteryl derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, for example WO 2000 / 053722, WO 2008 / 022309, WO 2011 / 104169, and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each of which is incorporated herein by reference), or other delivery systems available in the art.Compounds of Formula (I′)

[0102] In certain aspects, the compounds, or pharmaceutically acceptable salts thereof, are of Formula (I′):wherein: the targeting ligand has affinity for a receptor present on the surface of a cardiomyocyte; the RNAi agent comprises: (iii) an antisense strand comprising 17-49 nucleotides wherein at least 15 nucleotides are complementary to the mRNA sequence of a gene that is expressed in cardiomyocytes; (iv) a sense strand that is 16-49 nucleotides in length that is at least partially complementary to the antisense strand; and m is 1, 2, 3, 4, or 5.

[0103] In certain embodiments, the Targeting Ligand is any one of the formula:and the RNAi agent comprises: (i) an antisense strand comprising 17-49 nucleotides wherein at least 15 nucleotides are complementary to the mRNA sequence of a gene that is expressed in cardiomyocytes; (ii) a sense strand that is 16-49 nucleotides in length that is at least partially complementary to the antisense strand; and m is 1.

[0104] In certain embodiments, the Targeting Ligand is any one of the formula:the PK / PD modulator is of the formula:and the RNAi agent comprises: (iii) an antisense strand comprising 17-49 nucleotides wherein at least 15 nucleotides are complementary to the mRNA sequence of a gene that is expressed in cardiomyocytes; a sense strand that is 16-49 nucleotides in length that is at least partially complementary to the antisense strand; and m is 1.

[0105] In certain embodiments, the present disclosure provides a compound, or a pharmaceutically acceptable salt thereof, of Formula (I-a):wherein: R comprises an oligonucleotide-based agent; L1is a linking moiety; L2 is selected from the group consisting of: optionally substituted alkylene, optionally substituted arylene, 2-20 polyethylene glycol (PEG) units optionally interrupted by C(O)NR3, wherein R3is selected from C1-C6alkyl and H, and a bond; Z is selected from the group consisting of: CH (wherein p is 1), CH2(wherein p is 0), N (wherein p is 1), optionally substituted arylene, C(O)NR3(wherein p is 0), heterocyclene, and NR3(wherein p is 0), wherein R3is selected from C1-C6alkyl and H;p is 0 or 1, as valency permits; Y1and Y2are each independently selected from the group consisting of: 2-20 polyethylene glycol (PEG) units, optionally substituted alkyl, optionally substituted cycloalkyl, and a bond; X1and X2are each independently selected from the group consisting of: C(O), C(O)NR2and a bond, wherein R2is C1-C6alkyl or H; n and m are each independently an integer from 8 to 20; W1and W2are each independently selected from the group consisting of: H, COOH a.

[0106] In some embodiments L1 is selected from the group consisting of -S-, maleimide, C(O)NH, and triazole. In further embodiments,some eL

[0107] In some embodiments, L2 is selected from the group consisting of:

[0108] In some embodiments, Z is selected from the group consisting of:,and N.

[0109] In some embodiments, Y1is selected from the group consisting of:. In some embodiments, Y1and Y2are both:.

[0110] In some embodiments, n is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0111] In one embodiment, the compound has the structure of LP-161-a:wherein R comprises an RNAi agent.

[0112] In another embodiment, the compound has the structure of any one of:

[0113] In certain embodiments, the present disclosure provides a compound, or a pharmaceutically acceptable salt thereof, of Formula (II-a):wherein: R comprises an oligonucleotide-based agent; A is a substituted or unsubstituted carbocyclic or bicyclic ring, or a substituted or unsubstituted arylene ring; B is a substituted or unsubstituted heteroarylene ring; C is a substituted or unsubstituted, monocyclic, bicyclic, or spirocyclic, or heterocyclic ring; or a substituted or unsubstituted heteroarylene ring; Y is –O–, –S–, or –N(Rc)–; L1ais a linker comprising 2-20 PEG units; L2ais a linking moiety; Z1and Z2are each independently –O–, –S–, –N(Rb)–, –C(Ra)2–, –C(=O)–, or – C(=O)N(Rb)–, each instance of Raand Rbis independently hydrogen, substituted or unsubstituted alkyl, or -S(O)2-Rd; wherein Rdis a substituted or unsubstituted carbocyclic ring; and Rcis substituted or unsubstituted alkyl, or a substituted or unsubstituted carbocyclic ring.

[0114] In certain embodiments, A is a substituted or unsubstituted arylene ring. In certain embodiments, A is a substituted or unsubstituted phenylene ring. In certain embodiments, Ais of selected from the group consisting of:, , .In certain embodiments, A is of the formula:.

[0115] In certain embodiments, Z1is O.

[0116] In certain embodiments, B is a substituted or unsubstituted thiazolene ring. In certain embodiments, B is selected from the group consisting of:. In certain embodiments, B is of the formula:.

[0117] In certain embodiments, C is a substituted or unsubstituted, monocyclic, bicyclic, or spirocyclic, heterocyclene ring. In certain embodiments, C is a substituted or unsubstituted, monocyclic heterocyclene ring. In certain embodiments, C is selected from the groupc  f

[0118] In certain embodiments, Y is –N(Rc)–. In certain embodiments, Rcis substituted or unsubstituted alkyl. In certain embodiments, Rcis substituted or unsubstituted ethylene. In certain embodiments, Rcis selected from the group consisting of:, , ,

[0119] In certain embodiments, Z2is –C(Ra)2–. In certain embodiments, Z2is –C(=O)–.

[0120] In certain embodiments, Rais H.

[0121] In certain embodiments, the compounds of Formula (II) disclosed herein are of the formula:wherein R comprises an oligonucleotide-based agent.

[0122] In certain embodiments, the compounds of Formula (II) disclosed herein are of the fwherein R comprises an oligonucleotide-based agent.

[0123] In certain embodiments, provided herein is a compound, or pharmaceutically acceptable salt thereof, of Formula (III-a):wherein: R comprises an oligonucleotide-based agent; R1is hydrogen, halogen, substituted or unsubstituted alkyl, or –ORd; Rdis substituted or unsubstituted alkyl; L1ais a linker comprising 2-20 PEG units; L2ais a linking moiety;

[0124] In certain embodiments, the compounds of Formula (III-a) are of the Formula (III- a1):-a1), wherein:R comprises an oligonucleotide-based agent; R1is hydrogen, halogen, substituted or unsubstituted alkyl, or –ORd; Rdis substituted or unsubstituted alkyl; L1ais a linker comprising 2-20 PEG units; L2ais a linking moiety;

[0125] In certain embodiments, R1is a halogen. In certain embodiments, R1is Br.

[0126] In certain embodiments, L1ais a linker comprising 2-5 PEG units. In certain embodiments, L1ais a linker comprising 4 PEG units. In certain embodiments, L1ais selected from the group consisting of:, , ,. In certain embodiments, L1ais of the formula:.

[0127] In certain embodiments, L2ais of the formula:. In certain embodiments, L2ais of the formula.

[0128] In certain embodiments, the compound, or pharmaceutically acceptable salt thereof, of Formula (III-a) is of the formula:wherein R comprises an oligonucleotide-based agent (e.g., an RNAi agent).

[0129] In certain embodiments, the compound, or pharmaceutically acceptable salt thereof, of Formula (III-a) is of the formula:wherein R comprises an oligonucleotide-based agent (e.g., an RNAi agent).

[0130] In certain embodiments, a compound of Formula (I′) or a pharmaceutically acceptable salt thereof, is of the formula:

[0131] In certain embodiments, R is an RNAi agent. In certain embodiments, the RNAi agent further comprises a lipid PK / PD modulator (e.g., LP-161).

[0132] Another aspect of the invention provides for GLP1R ligand precursors, which can be used to synthesize the compounds disclosed herein. In one embodiment, the ligand precursors have the following structure:O N

[0133] Pharmaceutical Compositions

[0134] In some embodiments, the present disclosure provides pharmaceutical compositions that include, consist of, or consist essentially of, one or more of the delivery compounds comprising RNAi agents disclosed herein.

[0135] As used herein, a “pharmaceutical composition” comprises a pharmacologically effective amount of an Active Pharmaceutical Ingredient (API), and optionally one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients (excipients) are substances other than the Active Pharmaceutical ingredient (API, therapeutic product) that are intentionally included in the drug delivery system. Excipients do not exert or are not intended to exert a therapeutic effect at the intended dosage. Excipients may act to a) aid in processing of the drug delivery system during manufacture, b) protect, support or enhance stability, bioavailability or patient acceptability of the API, c) assist in product identification, and / or d) enhance any other attribute of the overall safety, effectiveness, of delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.

[0136] Excipients include, but are not limited to: absorption enhancers, anti-adherents, anti- foaming agents, anti-oxidants, binders, buffering agents, carriers, coating agents, colors, delivery enhancers, delivery polymers, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavors, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, suspending agents, sustained release matrices, sweeteners, thickening agents, tonicity agents, vehicles, water-repelling agents, and wetting agents.

[0137] The pharmaceutical compositions described herein can contain other additional components commonly found in pharmaceutical compositions. In some embodiments, the additional component is a pharmaceutically active material. Pharmaceutically active materials include, but are not limited to: anti-pruritics, astringents, local anesthetics, or anti- inflammatory agents (e.g., antihistamine, diphenhydramine, etc.), small molecule drug, antibody, antibody fragment, aptamers, and / or vaccines.

[0138] The pharmaceutical compositions may also contain preserving agents, solubilizing agents, stabilizing agents, wetting agents, emulsifiers, sweeteners, colorants, odorants, salts for the variation of osmotic pressure, buffers, coating agents, or antioxidants. They may also contain other agents with a known therapeutic benefit.

[0139] The pharmaceutical compositions can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be made by any way commonly known in the art, such as, but not limited to, topical (e.g., by a transdermal patch), pulmonary (e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer, intratracheal, intranasal), epidermal, transdermal, oral or parenteral. Parenteral administration includes, but is not limited to, intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal (e.g., via an implanted device), intracranial, intraparenchymal, intrathecal, and intraventricular, administration. In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection. The pharmaceutical compositions may be administered orally, for example in the form of tablets, coated tablets, dragées, hard or soft gelatin capsules, solutions, emulsions or suspensions. Administration can also be carried out rectally, for example using suppositories; locally or percutaneously, for example using ointments, creams, gels, or solutions; or parenterally, for example using injectable solutions.

[0140] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration,suitable carriers include physiological saline, bacteriostatic water, Cremophor® EL (BASF, Parsippany, NJ) or phosphate buffered saline. It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0141] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation include vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

[0142] Formulations suitable for intra-articular administration can be in the form of a sterile aqueous preparation of any of the ligands described herein that can be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems can also be used to present any of the ligands described herein for both intra-articular and ophthalmic administration.

[0143] The active compounds can be prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No.4,522,811.

[0144] A pharmaceutical composition can contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to: anti-pruritics, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamine, diphenhydramine, etc.). As used herein, “pharmacologically effective amount,” “therapeutically effective amount,” or simply “effective amount” refers to that amount of an the pharmaceutically active agent to produce a pharmacological, therapeutic or preventive result.

[0145] Medicaments comprising a delivery vehicle and an RNAi agent are also an object of the present invention, as are processes for the manufacture of such medicaments, which processes comprise bringing one or more compounds containing an RNAi agent, and, if desired, one or more other substances with a known therapeutic benefit, into a pharmaceutically acceptable form.

[0146] The described compounds comprising RNAi agents and pharmaceutical compositions comprising compounds comprising RNAi agents disclosed herein may be packaged or included in a kit, container, pack, or dispenser. The compounds comprising RNAi agents and pharmaceutical compositions comprising compounds comprising the RNAi agents may be packaged in pre-filled syringes or vials.

[0147] Methods of Treatment and Inhibition of Expression

[0148] The compounds comprising RNAi agents disclosed herein can be used to treat a subject (e.g., a human or other mammal) having a disease or disorder that would benefit from administration of the RNAi agent. In some embodiments, the compounds comprising RNAi agents disclosed herein can be used to treat a subject (e.g., a human) that would benefit from reduction and / or inhibition in expression of mRNA and / or target protein levels, for example, a subject that has been diagnosed with or is suffering from symptoms related to pulmonary hypertension.

[0149] In some embodiments, the subject is administered a therapeutically effective amount of one or more compounds comprising RNAi agents disclosed herein. Treatment of a subject can include therapeutic and / or prophylactic treatment. The subject can be a human, patient, or human patient. The subject may be an adult, adolescent, child, or infant. Administration of a pharmaceutical composition described herein can be to a human being or animal.

[0150] The compounds comprising RNAi agents described herein can be used to treat at least one symptom in a subject having a disease or disorder relating to a target gene, or having a disease or disorder that is mediated at least in part by the expression of the target gene. In some embodiments, the compounds comprising RNAi agents are used to treat or manage aclinical presentation of a subject with a disease or disorder that would benefit from or be mediated at least in party by a reduction in target mRNA. The subject is administered a therapeutically effective amount of one or more of the compounds comprising RNAi agents or compositions comprising compounds described herein. In some embodiments, the methods disclosed herein comprise administering a composition comprising a compound comprising RNAi agents described herein to a subject to be treated. In some embodiments, the subject is administered a prophylactically effective amount of any one or more of the described compounds comprising RNAi agents, thereby treating the subject by preventing or inhibiting the at least one symptom.

[0151] In certain embodiments, the present disclosure provides methods for treatment of diseases, disorders, conditions, or pathological states mediated at least in part by target gene expression, in a patient in need thereof, wherein the methods include administering to the patient any of the compounds comprising RNAi agents described herein.

[0152] In some embodiments, the gene expression level and / or mRNA level of a target gene in a subject to whom a compound is administered is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the compound or to a subject not receiving the compound. The gene expression level and / or mRNA level in the subject may be reduced in a cell, group of cells, and / or tissue of the subject.

[0153] In some embodiments, the protein level in a subject to whom a compound has been administered is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the compound or to a subject not receiving the compound. The protein level in the subject may be reduced in a cell, group of cells, tissue, blood, and / or other fluid of the subject.

[0154] A reduction in mRNA levels and protein levels can be assessed by any methods known in the art. As used herein, a reduction or decrease in mRNA level and / or protein level are collectively referred to herein as a reduction or decrease in the target gene or inhibiting or reducing the expression of the target gene. The Examples set forth herein illustrate known methods for assessing inhibition of gene expression.

[0155] In some embodiments, compounds comprising RNAi agents may be used in the preparation of a pharmaceutical composition for use in the treatment of a disease, disorder, or symptom that is mediated at least in part by target gene expression. In some embodiments, the disease, disorder, or symptom that is mediated at least in part by target gene expression ispulmonary hypertension.

[0156] In some embodiments, methods of treating a subject are dependent on the body weight of the subject. In some embodiments, compounds comprising RNAi agents may be administered at a dose of about 0.05 mg / kg to about 40.0 mg / kg of body weight of the subject. In other embodiments compounds comprising RNAi agents may be administered at a dose of about 5 mg / kg to about 20 mg / kg of body weight of the subject.

[0157] In some embodiments, compounds comprising RNAi agents may be administered in a split dose, meaning that two doses are given to a subject in a short (for example, less than 24 hour) time period. In some embodiments, about half of the desired daily amount is administered in an initial administration, and the remaining about half of the desired daily amount is administered approximately four hours after the initial administration.

[0158] In some embodiments, compounds comprising RNAi agents may be administered once a week (i.e., weekly). In other embodiments, compounds comprising RNAi agents may be administered biweekly (once every other week).

[0159] In some embodiments, compounds comprising RNAi agents or compositions containing compounds comprising RNAi agents may be used for the treatment of a disease, disorder, or symptom that is mediated at least in part by target gene expression. In some embodiments, the disease, disorder or symptom that is mediated at least in part by target gene expression is pulmonary hypertension.

[0160] Cells, Tissues, and Non-Human Organisms

[0161] Cells, tissues, and non-human organisms that include at least one of the RNAi agents described herein is contemplated. The cell, tissue, or non-human organism is made by delivering the RNAi agent to the cell, tissue, or non-human organism by any means available in the art. In some embodiments, the cell is a mammalian cell, including, but not limited to, a human cell.

[0162] The above provided embodiments and items are now illustrated with the following, non-limiting examples. OTHER EMBODIMENTS

[0163] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following embodiments. Embodiment 1. A compound, or a pharmaceutically acceptable salt thereof, of Formula (I′):wherein: the targeting ligand has affinity for a receptor present on the surface of a cardiomyocyte; the RNAi agent comprises: (i) an antisense strand comprising 17-49 nucleotides wherein at least 15 nucleotides are complementary to the mRNA sequence of a gene that is expressed in cardiomyocytes; (ii) a sense strand that is 16-49 nucleotides in length that is at least partially complementary to the antisense strand; and m is 1, 2, 3, 4, or 5. Embodiment 2. A compound for inhibiting expression of a gene expressed in cardiomyocytes comprising: (a) an RNAi agent comprising: (i) an antisense strand comprising 17-49 nucleotides wherein at least 15 nucleotides are complementary to the mRNA sequence of a gene that is expressed in cardiomyocytes; (ii) a sense strand that is 16-49 nucleotides in length that is at least partially complementary to the antisense strand; and (b) a delivery vehicle comprising: (i) a targeting ligand with affinity for a receptor present on the surface of a cardiomyocyte; and (ii) a PK / PD modulator; wherein the RNAi agent is covalently linked to the targeting ligand and to the PK / PD modulator. Embodiment 3. The compound of embodiment 1 or 2, wherein the PK / PD modulator is of Formula (I):wherein: L1is a linking moiety; L2 is selected from the group consisting of: optionally substituted alkylene, optionally substituted arylene, 2-20 polyethylene glycol (PEG) units optionally interrupted by C(O)NR3, wherein R3is selected from C1-C6alkyl and H, and a bond; Z is selected from the group consisting of: CH (wherein p is 1), CH2(wherein p is 0), N (wherein p is 1), optionally substituted arylene, C(O)NR3(wherein p is 0), heterocyclene, and NR3(wherein p is 0), wherein R3is selected from C1-C6alkyl and H; p is 0 or 1, as valency permits; Y1and Y2are each independently selected from the group consisting of: 2-20 polyethylene glycol (PEG) units, optionally substituted alkyl, optionally substituted cycloalkyl, and a bond; X1and X2are each independently selected from the group consisting of: C(O), C(O)NR2and a bond, wherein R2is C1-C6alkyl or H; n and m are each independently an integer from 8 to 20; W1 and W2 are each independently selected from the group consisting of: H, COOH andwherein indicates a point of connection to the remainder of the compound. Embodiment 4. The compound of embodiment 3, wherein L1 is selected from the group consisting of -S-, maleimide, C(O)NH, and triazole,, , - C(O)-. Embodiment 5. The compound of embodiment 3 or 4, wherein. Embodiment 6. The compound of embodiment 3 or embodiment 4, wherein L1is.Embodiment 7. The compound of any one of embodiments 3-6, wherein L2 is selected from t ,Embodiment 8. The compound of any one of embodiments 3-7, wherein Z is selected from the group consisting of:bond. Embodiment 9. The compound of any one of embodiments 3-8, wherein Y1 is selected fromtEmbodiment 10. The compound of any one of embodiments 3-9, wherein X1is C(O)NR2. Embodiment 11. The compound of embodiment 10, wherein R2 is H. Embodiment 12. The compound of any one of embodiments 3-11, wherein n is 13, 14, 15, or 16. Embodiment 13. The compound of any one of embodiments 3-12, wherein p is 0. Embodiment 14. The compound of any one of embodiments 3-12, wherein p is 1. Embodiment 15. The compound of embodiment 14, wherein Z is N. Embodiment 16. The compound of any one of embodiments 3-15, wherein W1 is H. Embodiment 17. The compound of any one of embodiments 3-16, wherein L2comprises between 2-5 PEG units. Embodiment 18. The compound of any one of embodiments 1-17, wherein the PK / PD modulator is selected from the group consisting of:wherein indicates the point of connection of the PK / PD modulator to the remainder of the compound. Embodiment 19. The compound of any one of embodiments 1-18, wherein the PK / PD modulator is of the formula:(LP161), wherein indicates the point of connection of the PK / PD modulator to the remainder of the compound.Embodiment 20. The compound of any one of embodiments 1-19, wherein the targeting ligand is of Formula (II):or a pharmaceutically acceptable salt thereof, wherein: R comprises an oligonucleotide-based agent; A is a substituted or unsubstituted carbocyclic or bicyclic ring, or a substituted or unsubstituted arylene ring; B is a substituted or unsubstituted heteroarylene ring; C is a substituted or unsubstituted, monocyclic, bicyclic, spirocyclic, or heterocyclic ring; or a substituted or unsubstituted heteroarylene ring; Y is –O–, –S–, or –N(Rc)–; L1ais a linker comprising 2-20 PEG units; L2ais a linking moiety; Z1and Z2are each independently –O–, –S–, –N(Rb)–, –C(Ra)2–, –C(=O)–, or – C(=O)N(Rb)–, each instance of Raand Rbis independently hydrogen, substituted or unsubstituted alkyl, or -S(O)2-Rd; wherein Rdis a substituted or unsubstituted carbocyclic ring; Rcis substituted or unsubstituted alkyl, or a substituted or unsubstituted carbocyclic ring; and indicates a point of connection to the remainder of the compound. Embodiment 21. The compound of embodiment 20, wherein A is a substituted or unsubstituted arylene ring. Embodiment 22. The compound of embodiment 20 or 21, wherein A is a substituted or unsubstituted phenylene ring. Embodiment 23. The compound of embodiment 20, wherein A is selected from the groupconsisting of:.Embodiment 24. The compound of any one of embodiments 20-23, wherein A is of the formula:.Embodiment 25. The compound of any one of embodiments 20-24, wherein Z1is O. Embodiment 26. The compound of any one of embodiments 20-25, wherein B is selectedfrom the group consisting of:Embodiment 27. The compound of any one of embodiments 20-25, wherein B is a substituted or unsubstituted thiazolene ring. Embodiment 28. The compound of any one of embodiments 20-25, wherein B is of the formula:. Embodiment 29. The compound of any one of embodiments 20-28, wherein C is a substituted or unsubstituted, monocyclic, bicyclic, or spirocyclic, heterocyclene ring. Embodiment 30. The compound of any one of embodiments 20-29, wherein C is a substituted or unsubstituted, monocyclic heterocyclene ring. Embodiment 31. The compound of any one of embodiments 20-28, wherein C is selected f ,Embodiment 32. The compound of any one of embodiments 20-28, wherein C is of the formula:. Embodiment 33. The compound of any one of embodiments 20-32, wherein Y is –N(Rc)–.Embodiment 34. The compound of any one of embodiments 20-33, wherein Rcis substituted or unsubstituted alkyl. Embodiment 35. The compound of any one of embodiments 20-33, wherein Rcis selected f. Embodiment 36. The compound of any one of embodiments 20-33, wherein Rcis substituted or unsubstituted ethylene. Embodiment 37. The compound of any one of embodiments 20-33, wherein Rcis of the formula:. Embodiment 38. The compound of any one of embodiments 20-37, wherein Z2is –C(Ra)2–. Embodiment 39. The compound of any one of embodiments 20-37, wherein Z2is –C(=O)–. Embodiment 40. The compound of any one of embodiments 20-39, wherein each instance of Rais H. Embodiment 41. The compound of any one of embodiments 1-9, wherein the targeting ligand is of Formula (III):or a pharmaceutically acceptable salt thereof, wherein: R1is hydrogen, halogen, alkyl, or –ORd; Rdis substituted or unsubstituted alkyl; L1ais a linker comprising 2-20 PEG units; L2ais a linking moiety, and indicates a point of connection to the remainder of the compound. Embodiment 42. The compound of embodiment 41, wherein the targeting ligand is of Formula (III-1):wherein: R1is hydrogen, halogen, substituted or unsubstituted alkyl, or –ORd; Rdis substituted or unsubstituted alkyl; L1ais a linker comprising 2-20 PEG units; and L2ais a linking moiety, and indicates a point of connection to the remainder of the compound. Embodiment 43. The compound of embodiment 41 or 42, wherein R1is a halogen. Embodiment 44. The compound of any one of embodiments 41-43, wherein R1is Br, Cl, or F. Embodiment 45. The compound of embodiment 41 or 42, wherein R1is Br. Embodiment 46. The compound of embodiment 41 or 42, wherein R1is H. Embodiment 47. The compound of embodiment 41 or 42, wherein R1is methyl.Embodiment 48. The compound of embodiment 41 or 42, wherein R1is -OCH3. Embodiment 49. The compound of any one of embodiments 20-48, wherein L1is a linker comprising 2-20 PEG units. Embodiment 50. The compound of any one of embodiments 20-48, wherein L1is selected from the group consisting of:, , ,. Embodiment 51. The compound of any one of embodiments 20-50, wherein L2is of the formula:. Embodiment 52. The compound of any one of embodiments 20-50, wherein L2is of the formula. Embodiment 53. The compound of embodiment 20, wherein the targeting ligand is selected from the group consisting of:wherein indicates a point of connection to the remainder of the compound.Embodiment 54. The compound of embodiment 20, wherein the targeting is selected from the group consisting of:wherein indicates a point of connection to the remainder of the compound.Embodiment 55. The compound of embodiment 41, wherein the targeting ligand is selectedfrom the group consisting of:wherein indicates a point of connection to the remainder of the compound. Embodiment 56. The compound of embodiment 41, wherein the targeting ligand is selected fwherein indicates a point of connection to the remainder of the compound. Embodiment 57. The compound of embodiment 1, or a pharmaceutically acceptable salt thereof, wherein the targeting ligand is selected from the group consisting of:Embodiment 58. The compound of any one of embodiments 1-57, wherein the targeting ligand has affinity for a glucagon like peptide (GLP) receptor. Embodiment 59. The compound of any one of embodiments 1-58, wherein the targeting ligand has affinity for the GLP receptor 1 (GLP1R). Embodiment 60. The compound of any one of embodiments 1-59, wherein the RNAi agent inhibits expression of the mRNA of a human gene in a cardiomyocyte. Embodiment 61. The compound of any one of embodiments 1-60, wherein the pharmaceutically acceptable salt is a sodium salt. Embodiment 62. The compound of any one of embodiments 1-60, wherein the pharmaceutically acceptable salt is a potassium salt. Embodiment 63. A composition comprising the compound of any one of embodiments 1-62. Embodiment 64. A pharmaceutical composition comprising the composition of embodiment 63 and a pharmaceutical excipient. Embodiment 65. The pharmaceutical composition of embodiment 64, wherein the pharmaceutical excipient is selected form water for injection and saline solution.Embodiment 66. The pharmaceutical composition of embodiment 65, wherein the pharmaceutical excipient is saline solution. Embodiment 67. A method of treating a disease or disorder of a cardiomyocyte comprising administering to a subject in need thereof the compound of any one of embodiments 1-62, or a composition or pharmaceutical composition of any one of embodiments 63-66. Embodiment 68. The method of embodiment 67, wherein the disease or disorder is mediated by a gene expressed in a cardiomyocyte. Embodiment 69. Use of the compound of any one of embodiments 1-62, or the composition or pharmaceutical composition of any one of embodiments 63-66, for the delivery of an RNAi agent to a cardiomyocyte. Embodiment 70. The use according to embodiment 69, wherein the cardiomyocyte is within a subject. Embodiment 71. The use according to embodiment 70, wherein the subject is a human subject. Embodiment 72. The use according to any one of embodiments 69-71, wherein the RNAi agent inhibits expression of a target gene in the cardiomyocyte by at least about 50%. Embodiment 73. Use of the compound of any one of embodiments 1-62 or the composition or pharmaceutical composition of any one of embodiments 63-66 for the preparation of a medicament for the treatment of a disease or disorder. Embodiment 74. The use of embodiment 73, wherein the disease or disorder is mediated by a gene expressed in cardiomyocytes. Embodiment 75. A method of making the compound of any one of embodiments 1-62, the method comprising: (i) synthesizing the sense strand; (ii) synthesizing the antisense strand; (iii) annealing the sense strand and the antisense strand; (iv) before or after annealing the sense strand and the antisense strand, conjugating the targeting ligand to the sense strand or the antisense strand; and (v) before or after annealing the sense strand and the antisense strand, and before or after conjugating the targeting ligand to the sense strand or the antisense strand, conjugating the PK / PD modulator to the sense strand or the antisense strand. EXAMPLES

[0164] The following examples are not limiting and are intended to illustrate certain embodiments disclosed herein.

[0165] Unless expressly stated otherwise, numerals used to refer to compounds of a given example are only made with reference to that particular example and may not refer to any other examples disclosed herein. Compounds that are disclosed in various tables throughout the detailed description (e.g., LP161-p, LP161) are referred to consistently throughout the examples herein. Example 1. Synthesis of RNAi agents and Compositions.

[0166] The following describes the general procedures for the syntheses of certain RNAi agents, and conjugates thereof, that are illustrated in the non-limiting Examples set forth herein.

[0167] Synthesis of RNAi Agents. RNAi agents can be synthesized using methods generally known in the art. For the synthesis of the RNAi agents illustrated in the Examples set forth herein, the sense and antisense strands of the RNAi agents were synthesized according to solid phase phosphoramidite technology used in oligonucleotide synthesis. Depending on the scale, a MerMade96E® (Bioautomation), a MerMade12® (Bioautomation), or an Oligopilot 100 (GE Healthcare) was used. Syntheses were performed on a solid support made of controlled pore glass (CPG, 500 Å or 600Å, obtained from Prime Synthesis, Aston, PA, USA) or polystyrene (obtained from Kinovate, Oceanside, CA, USA). All RNA and 2′- modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA), ChemGenes (Wilmington, MA, USA), or Hongene Biotech (Morrisville, NC, USA). Specifically, the following 2′-O-methyl phosphoramidites that were used include the following: (5′-O-dimethoxytrityl-N6-(benzoyl)-2′-O-methyl-adenosine-3′-O-(2-cyanoethyl-N,N- diisopropylamino) phosphoramidite, 5′-O-dimethoxy-trityl-N4-(acetyl)-2′-O-methyl-cytidine- 3′-O-(2-cyanoethyl-N,N-diisopropyl-amino) phosphoramidite, (5′-O-dimethoxytrityl-N2- (isobutyryl)-2′-O-methyl-guanosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, and 5′-O-dimethoxytrityl-2′-O-methyl-uridine-3′-O-(2-cyanoethyl-N,N- diisopropylamino) phosphoramidite. The 2′-deoxy-2′-fluoro-phosphoramidites and 2′-O- propargyl phosphoramidites carried the same protecting groups as the 2′-O-methyl phosphoramidites. 5′-dimethoxytrityl-2′-O-methyl-inosine-3′-O-(2-cyanoethyl-N,N- diisopropylamino) phosphoramidites were purchased from Glen Research (Virginia). The inverted abasic (3′-O-dimethoxytrityl-2′-deoxyribose-5′-O-(2-cyanoethyl-N,N- diisopropylamino) phosphoramidites were purchased from ChemGenes. The following UNAphosphoramidites that were used included the following: 5′-(4,4'-Dimethoxytrityl)-N6- (benzoyl)-2′,3′-seco-adenosine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]- phosphoramidite, 5′-(4,4'-Dimethoxytrityl)-N-acetyl-2′,3′-seco-cytosine, 2′-benzoyl-3′-[(2- cyanoethyl)-(N,N-diiso-propyl)]-phosphoramidite, 5′-(4,4'-Dimethoxytrityl)-N-isobutyryl- 2′,3′-seco-guanosine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and 5′-(4,4'-Dimethoxy-trityl)-2′,3′-seco-uridine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N- diiso- propyl)]-phosphoramidite. In order to introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl 1,2,4-dithiazoline-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile or a 200mM solution of xanthane hydride (TCI America, Portland, OR, USA) in pyridine was employed.

[0168] TFA aminolink phosphoramidites were also commercially purchased (ThermoFisher) to introduce the (NH2-C6) reactive group linkers. TFA aminolink phosphoramidite was dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3Å) were added. 5- Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-Ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as activator solution. Coupling times were 10 min (RNA), 90 sec (2′ O-Me), and 60 sec (2′ F). Trialkyne-containing phosphoramidites were synthesized to introduce the respective (TriAlk#) linkers. When used in connection with the RNAi agents presented in certain Examples herein, trialkyne-containing phosphoramidites were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other amidites were dissolved in anhydrous acetonitrile (50 mM), and molecular sieves (3Å) were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-Ethylthio-1H- tetrazole (ETT, 250 mM in acetonitrile) was used as activator solution. Coupling times were 10 min (RNA), 90 sec (2′ O-Me), and 60 sec (2′ F).

[0169] For some RNAi agents, a linker, such as a C6-SS-C6 or a 6-SS-6 group, was introduced at the 3’ terminal end of the sense strand. Pre-loaded resin was commercially acquired with the respective linker. Alternatively, for some sense strands, a dT resin was used and the respectively linker was then added via standard phosphoramidite synthesis.

[0170] Cleavage and deprotection of support bound oligomer. After finalization of the solid phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 weight (wt.) % methylamine in water and 28% to 31% ammonium hydroxide solution (Aldrich) for 1.5 hours at 30 °C. The solution was evaporated and the solid residue was reconstituted in water (see below).

[0171] Purification. Crude oligomers were purified by anionic exchange HPLC using a TSKgel® SuperQ-5PW 13µm column (available from Tosoh Biosciences) and ShimadzuLC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0 and contained 20% Acetonitrile and buffer B was the same as buffer A with the addition of 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled then run on size exclusion HPLC using a GE Healthcare XK 16 / 40 column packed with Sephadex® G25 fine with a running buffer of 100mM ammonium bicarbonate, pH 6.7 and 20% Acetonitrile or filtered water.

[0172] Annealing. Complementary strands were mixed by combining equimolar RNA solutions (sense and antisense) in 1× PBS (Phosphate-Buffered Saline, 1×, Corning®, Cellgro®) to form the RNAi agents. Some RNAi agents were lyophilized and stored at −15 to −25 °C. Duplex concentration was determined by measuring the solution absorbance on a UV-Vis spectrometer in 1× PBS. The solution absorbance at 260 nm was then multiplied by a conversion factor and the dilution factor to determine the duplex concentration. The conversion factor used was either 0.037 mg / (mL∙cm) or was calculated from an experimentally determined extinction coefficient. Example 2. Synthesis of Linking Groups

[0173] Synthesis of L4

[0174] To a solution of compound 1 (3.00 g) in DMF was added Cs2CO3(7.71 g) at room temperature. Compound 2 (1.85 mL) was then added slowly. The resulting reaction mixture was stirred overnight under N2(g). Approximately full conversion to desired product by LC- MS was then confirmed. The reaction mixture was quenched with NaHCO3 (10 mL). The product was extracted with EtOAc (5 x 10 mL) and then washed with water (3 x 8 mL) and brine (8 mL). The combined organic phases were dried over Na2SO4, filtered, and concentrated. The residue was purified by CombiFlash® using silica gel as the stationary phase with a gradient of hexanes to EtOAc (0-30%), in which the product eluted at 14% B. Compound 3 was concentrated under vacuum to provide a white solid. LC-MS: calculated [M+H]+ 191.06 m / z, observed 191.23 m / z.

[0175] To a solution of compound 3 (2.87 g) in 1:1 THF / water was added LiOH (1.08 g) at room temperature under normal atmosphere. The reaction mixture was stirred until full conversion of compound 3 was observed by LC-MS. Residual starting material was extracted via EtOAc, and then aqueous phase was acidified with 6 N HCl to a pH of ~3. Compound 4 crashed out as a white solid and was filtered over vacuum and washed with water. Due to its wet / sticky nature, solvent was required to transfer the solid to a round bottom flask; material was transferred via MeOH and DCM. Due to poor solvation in either solvent and the combination, the material could not to be dried over Na2SO4. Compound 4 was concentrated under vacuum to provide a white, fluffy crystalline solid and was used directly without further purification. LC-MS: calculated [M+H]+ 177.05 m / z, observed 177.19 m / z.

[0176] To a solution of compounds 4 (1.00 g) and 5 (1.04 g) in DMF (10.0 mL) under N2(g) was added EDC (1.20 g) at room temperature. The reaction mixture was allowed to stir until full conversion was observed by LC-MS. Due to an inability to successfully observe the product after overnight stirring, the reaction mixture was quenched with NaHCO3. The resulting precipitate was confirmed to contain starting materials via LC-MS and was filtered over vacuum, attempted to be re-suspended in MeOH / DCM, and then concentrated under vacuum. The mixture was then re-solvated in DMF, dried over Na2SO4, filtered over vacuum, and rinsed with DMF. EDC was re-added to the filtrate (i.e., compounds 4 and 5) in DMF, and the resultant mixture was allowed to stir overnight at room temperature. The reaction mixture was directly concentrated and azeotroped with MeOH and PhMe for isolation. The residue was purified by CombiFlash® using silica gel as the stationary phase and was eluted with 0-20% MeOH in DCM. L4 eluted at 0% B to provide a white solid. LC- MS: calculated [M+H]+ 325.04 m / z, observed 325.35 m / z. Example 3. Synthesis of GLP1R Targeting Ligands

[0177] The following general procedures were used as indicated throughout the examples provided herein.

[0178] General Procedure I: Amide Coupling

[0179] To a round bottom flask containing carboxylic acid (1 eq) in DCM (0.2 M) was added COMU (1.2 eq) and DIPEA (2.5 eq). The mixture was stirred at room temperature for 30 min. Then, amine (1 eq) was added, and the mixture was continued to stir for 2 hours. After, the reaction mixture was concentrated under reduced pressure, loaded onto celite, and purified using CombiFlash chromatography.

[0180] General Procedure II: Alkylation of Phenols

[0181] To a round bottom flask containing phenol derivative (1 eq) in ACN (0.2 M) was added K2CO3(3 eq) and corresponding alkyl bromide (1.2 eq). The reaction was stirred at 85ºC for 12 hours. After, the reaction was cooled to room temperature, diluted with water (5 mL) and extracted thrice with ethyl acetate (10 mL). The combined organics were dried over Na2SO4, concentrated under reduced pressure, and purified via CombiFlash chromatography.

[0182] General Procedure III: Acylation

[0183] To a round bottom flask containing amine (1 eq) in DCM or THF (0.2 M) was added TEA (2 eq) and corresponding acid chloride, activated ester, or isocyanate (1.2 eq). The mixture was stirred at room temperature. Once LCMS indicated complete reaction, the mixture was concentrated under reduced pressure, loaded onto celite, and purified via CombiFlash chromatography.

[0184] General Procedure IV: Oxidation of Methylthiol to Sulfone

[0185] To a round bottom flask containing methylthiol intermediate (1 eq) in anhydrous DCM (0.2 M) was cooled to 0°C and mCPBA (6 eq) was added. The solution was warmed to room temperature and stirred overnight. Once the reaction was complete, the mixture was quenched with sat. aqueous Na2S2O5solution (10 mL) and continued to stir for 30 min. Then, the mixture was poured in H2O (15 mL) and extracted thrice with DCM (3 x 20 mL). The combined organics were dried over Na2SO4and concentrated under reduced pressure. The crude was dissolved in ethyl acetate (25 mL) and washed twice with NaHCO3 (2 x 20 mL), twice with H2O (2 x 20 mL), and once with brine (20 mL). The organic phase was dried over Na2SO4 and concentrated under reduced pressure. The crude mixture was purified via CombiFlash chromatography.

[0186] General Procedure V: Acidic Deprotection of MOM ethers, Tertbutyl Esters, and Boc-Containing Amines

[0187] To a round bottom flask containing MOM ether, tertbutyl ester, or Boc-protected amine was added a mixture of TFA: DCM (3:1). The reaction was stirred for 1 hour and then neutralized with saturated NaHCO3 solution. The neutralized solution was then extractedthrice with ethyl acetate (10 mL). The combined organics were dried over Na2SO4, concentrated under reduced pressure, and purified via CombiFlash chromatography.

[0188] General Procedure VI: Methyl Ester Hydrolysis with LiOH

[0189] To a round bottom flask containing methyl ester (1 eq) in MeOH: H2O (2:1) was added LiOH (10 eq). The mixture was stirred at room temperature for 12 hours. After, the mixture was concentrated under reduced pressure, diluted with water (5 mL) and acidified to pH = 2 with 6 M HCl to give an off-white precipitate which was collected via vacuum filtration.

[0190] General Procedure VII: Fmoc Deprotection

[0191] To a round bottom flask containing Fmoc protected amine (1 eq) was added a solution of 25% piperidine in DMF (5 mL). The reaction was stirred for 1 hour at room temperature. After, the solution was diluted with H2O (10 mL) and extracted thrice with ethyl acetate (3 x 20 mL). The combined organics were washed once with H2O (10 mL), once with brine (10 mL), dried over Na2SO4, and concentrated under reduced pressure. The crude was purified via CombiFlash chromatography.

[0192] General Procedure VIII: SNAR reaction of a 3-fluoro-4-nitrobenzoate

[0193] To a flame dried flask, 3-fluoro-4-nitrobenzoate (1 eq) and primary amine (1 eq) were dissolved in solvent (0.2 M). Base was added, and the mixture was stirred for 3-16 hours at the indicated temperature. The volatiles were removed under reduced pressure, and the crude material was purified via flash chromatography on silica gel to yield the desired 3-amino-4- nitrobenzoate.

[0194] General Procedure IX: Nitro reduction of a 3-amino-4-nitrobenzoate

[0195] To a flame dried flask was added 3-amino-4-nitrobenzoate (1 eq) and 10% palladium on carbon (10% w / w) in a mixture of 3:1 THF / MeOH (0.2 M). Then, hydrogen gas was bubbled into the suspension for 15 minutes. The reaction continued to stir under an H2atmosphere for 2 hours. The solids were filtered off using a celite plug, which was washed with a 1:1 mixture of MeOH / THF three times. The volatiles were removed to afford the desired 4-amino-3-(methylamino)benzoate.

[0196] General Procedure X: 2-(Chloromethyl)-benzo[d]imidazole-6-carboxylate synthesis

[0197] A 4-amino-3-(methylamino)benzoate (1 eq) was dissolved in MeCN (0.2 M).2- chloro-1,1,1-trimethoxyethane (3 eq) and p-toluenesulfonic acid monohydrate (pTSA^H2O) (0.5 eq) were added, and the reaction was heated to 40-60oC for 2 hours. The volatiles were removed under reduced pressure, and the crude material was purified via flashchromatography on silica gel to afford the desired 2-(chloromethyl)-benzo[d]imidazole-6- carboxylate.

[0198] General Procedure XI: Alkylation of a 3-amino-4-nitrobenzoate

[0199] A 2-(chloromethyl)-benzo[d]imidazole-6-carboxylate (1 eq) and a secondary amine (1.2 eq) were dissolved in MeCN (0.2 M), then K2CO3(5 eq) was added and the reaction heated to 50oC for 3-16 hours. Volatiles were removed under reduced pressure and the crude material was purified via flash chromatography on silica gel to afford the desired ester product.

[0200] General Procedure XII: Ester deprotection and amidation

[0201] To a solution of ester in MeCN (0.2 M) was added a 1 M aqueous solution of 1,5,7- triazabicyclo[4.4.0]-dec-5-ene. The solution stirred for 3-16 hours. The pH of the solution was adjusted to 4 using 1 M HCl, then washed three times with ethyl acetate. The organic layers were combined and dried over sodium sulfate. The volatiles were removed, then the crude material was dissolved in methylene chloride (0.1 M). COMU (2 eq) and DIEA (3 eq) were added, and the reaction stirred for 15 minutes, followed by addition of azido-PEG4- amine. The reaction was stirred for 2 hours, then the volatiles were removed under reduced pressure and the crude material purified via flash chromatography on silica gel to afford the desired GLP1R-SM product.

[0202] General Procedure XIII: Pd Catalyzed C-C Cross Coupling Reaction

[0203] An oven dried 20 mL scintillation vial was charged with boronic ester (1 eq) and 4- (((6-bromopyridin-2-yl)oxy)methyl)-3-fluorobenzonitrile (P1)2(1 eq) in 1,4-dioxane (0.2 M). This solution was sparged with nitrogen gas for 15 minutes. Then, K2CO3(2 eq), Pd(dppf)Cl2 (0.05 eq), and water (1 mL) were added and the mixture was sparged with nitrogen again for 15 minutes. After, the mixture was allowed to stir at 105°C for 16 hours. The mixture was then filtered over celite and eluted with ethyl acetate. The filtrate was evaporated under reduced pressure and the crude was purified via flash chromatography on silica gel.

[0204] General Procedure XIV: Alkene Reduction

[0205] A cyclic alkene was dissolved in Ethyl Acetate (0.01 M) and purged for 15 min with nitrogen gas. Then, 7.5% w / w Pd / C was added. The reaction was purged twice with hydrogen gas for 15 minutes, then allowed to stir for 2 hours under a hydrogen atmosphere. Afterwards, the reaction mixture was filtered over celite, concentrated under reduced pressure, and purified via flash chromatography on silica gel.

[0206] General Procedure XV: Boc Deprotection

[0207] A Boc protected amine was dissolved in a 3:1 TFA / DCM solution. The reaction stirred for 2 hours. The mixture was then carefully poured into 30 mL of saturated NaHCO3(aq) solution. Once neutralized, the aqueous phase was extracted thrice with DCM (3x30 mL). The combined organic layers were dried over Na2SO4and concentrated under reduced pressure to give product as an oil.

[0208] General Procedure XVI: Pd Catalyzed C-N Cross Coupling Reaction

[0209] A stirred solution of a secondary amine (1 eq) and 4-(((6-bromopyridin-2- yl)oxy)methyl)-3-fluorobenzonitrile (P1)2(1.2 eq) in 1,4-dioxane was sparged with nitrogen for 15 minutes. Then, Cs2CO3 (2 eq), phosphine ligand (0.2 eq), and Pd2(dba)3 (0.1 eq) was added, and the reaction was microwaved at 120oC for 2 hours. It was quenched by H2O, extracted with EtOAc (x 2), the combined organic layers washed with brine, dried over MgSO4, filtered, and concentrated under reduced pressure. The crude product was purified by flash chromatography.

[0210] General Procedure XVII: Boc Deprotection Method 2

[0211] The starting material was dissolved in either 4 M HCl / Dioxane or TFA / DCM (3:1) and stirred for 2 hours. The volatiles were removed under reduced pressure and the crude material carried forward without further purification.

[0212] General Procedure XVIII: Ester Deprotection and Amidation Method 2

[0213] The ester starting material was dissolved in 4:1 THF / H2O, then LiOH hydrate (4 eq) was added. The reaction was heated to 55oC and stirred for 16 hours. The THF was removed under reduced pressure and the aqueous layer was adjusted to pH = 4 using 3 N HCl. The aqueous layer was then extracted three times with ethyl acetate and the combined organic layers dried over MgSO4, filtered, and concentrated under reduced pressure. The crude material was then dissolved in dry DMF (0.1 M) and treated with DIEA (3 eq), Azido-PEG4- Amine (2 eq) and HATU (2 eq). The reaction was stirred at room temperature for 2 hours, then quenched with H2O. The mixture was extracted with ethyl acetate three times and the combined organic layers washed with brine. The volatiles were removed under reduced pressure and the crude material purified via prep-HPLC to afford the desired product.

[0214] General Procedure XIX: Ester reduction

[0215] To a stirred suspension of LiAlH4 ( 1.5 eq) in THF (0.5 M) cooled to 0oC was added an ester (1 eq) dropwise. The reaction was then stirred for 1 hour at 0oC. The reaction was quenched via dropwise addition of 15% NaOH. The mixture was then diluted with ethyl acetate and the layers separated. The aqueous layer was extracted with additional ethyl acetate, the organic layers were combined, washed with brine, and dried over MgSO4. Thecrude volatiles were removed under reduced pressure and the crude material purified via column chromatography.

[0216] General Procedure XX: Pd catalyzed C-O cross coupling reaction

[0217] A stirred solution of a primary alcohol (1.2 eq) and 4-(((6-bromopyridin-2- yl)oxy)methyl)-3-fluorobenzonitrile (P2) (1 eq) in 1,4-dioxane (0.2 M) was sparged with nitrogen for 15 minutes. Then, Cs2CO3(2 eq), phosphine ligand (0.2 eq), and Pd2(dba)3(0.1 eq) was added, and the reaction was microwaved at 120oC for 2 hours. The mixture was filtered and concentrated under reduced pressure. The crude material was purified by flash chromatography. Scheme 1. Synthesis of GLP-1R-SM1-p

[0218] Reagents and Conditions: (a) COMU, DIPEA, DCM, rt, 2 hr, 54%

[0219] Synthesis of GLP-1R-SM1-p:

[0220] GLP-1R-SM1 was synthesized following General Procedure I. The product was purified using DCM: MeOH (98:2) to give an oil in 54% yield. LC-MS [M+H]+ 808.4220 m / z, observed 808.4217 m / z. Scheme 2. Synthesis of GLP-1R-SM2-p

[0221] Reagents and Conditions: (a) K2CO3, ACN, 85ºC, 12 hr, 61%

[0222] Synthesis of GLP-1R-SM2-p:

[0223] GLP-1R-SM2 was synthesized following General Procedure II. The product was purified using DCM: MeOH (98:2) to give an oil in 61% yield. LC-MS [M+H]+ 554.2130 m / z, observed 554.2133 m / z. Scheme 3. Synthesis of GLP-1R-SM3-p

[0224] Reagents and Conditions: (a) Cs2CO3, DMF, rt, 12 hr (b) Sodium methanesulfinate, DMF, rt, 3 h, 45%

[0225] Synthesis of I1:

[0226] Cs2CO3 (1.1 eq) and azido-PEG4-amine (1 eq) were added to a solution of 2,3,6,7- tetraquinoxaline (1 eq) in DMF (0.2 M). The reaction was stirred at room temperature overnight. After, the mixture was concentrated and diluted with ethyl acetate (10 mL). The organic layer was washed once with water (5 mL), once with brine (5 mL), dried over Na2SO4, and concentrated under reduced pressure. The crude was used in the next step without any purification. LC-MS [M+H]+ 493.0925 m / z, observed 493.0927 m / z.

[0227] Synthesis of GLP-1R-SM3-p:

[0228] I1 (1 eq) was dissolved in DMF (0.2 M) and sodium methanesulfinate (1.1 eq) was added. The reaction mixture was stirred at room temperature for 3 hours. After, the mixture was concentrated under reduced pressure, diluted with ethyl acetate (15 mL), washed once with water (5 mL), once with brine (5 mL), and concentrated. The crude was purified via CombiFlash chromatography using Hexanes: Ethyl Acetate (70:30) to give product as an oil in 45% yield. LC-MS [M+H]+ 537.1090 m / z, observed 537.1088 m / z.Scheme 4. Synthesis of GLP-1R-SM4-p

[0229] Reagents and Conditions: (a) COMU, DIPEA, DMF, rt, 2 hr, 67%. (b) TFA: DCM (3:1), rt, 1 h, 95%, (c) K2CO3, ACN, 85ºC, 12 hr, 71%

[0230] Synthesis of I2:

[0231] I2 was synthesized following General Procedure I. The product was purified using hexanes: ethyl acetate (80:20) to give an oil in 67% yield. LC-MS [M+H]+ 478.0766 m / z, observed 478.0764 m / z.

[0232] Synthesis of I3:

[0233] I3 was synthesized starting from I2 following General Procedure V to give product as an off-white solid in 95% yield. LC-MS [M+H]+ 434.0504 m / z, observed 434.0501 m / z.

[0234] Synthesis of GLP-1R-SM4-p:

[0235] GLP-1R-SM4 was synthesized from I2 following General Procedure II. The product was purified using DCM: MeOH (98:2) to give an oil in 71% yield. LC-MS [M+H]+ 679.1880 m / z, observed 679.1878 m / z. Scheme 5. Synthesis of GLP-1R-SM6-p

[0236] Reagents and Conditions: (a) MOM-Cl, DIPEA, DCM, 0ºC to rt, 2 h, 98%. (b) LiOH, MeOH: H2O (2:1), rt, 2 h, 94%. (c) COMU, DIPEA, DMF, rt, 2 hr, 57%. (d) LiOH, MeOH: H2O (2:1), rt, 2 h, 91%. (e) COMU, DIPEA, DMF, rt, 2 hr, 61%. (f) TFA: DCM (3:1), rt, 1 h, 95%. (g) K2CO3, ACN, 85ºC, 12 hr, 64%.

[0237] Synthesis of E1:

[0238] To a solution of methyl 3-hydroxybenzoate (1 eq) in anhydrous DCM (0.2 M) at 0ºC was added DIPEA (2 eq) followed by MOM-Cl (1.2 eq). The mixture was then warmed to room temperature and stirred for 2 hours. After, the reaction mixture was diluted with water (10 ml). The organic layer was separated, and the water was washed once with DCM (15 mL). The combined organics were washed once with brine (10 mL), dried over Na2SO4, and concentrated under reduced pressure. The crude was purified via CombiFlash chromatography using 100% hexanes to give product as an oil in 98% yield. LC-MS [M+H]+ 197.0814 m / z, observed 197.0813 m / z.

[0239] Synthesis of I4:

[0240] I4 was synthesized from E1 following General Procedure VI to give product as an off- white solid in 94% yield. LC-MS [M+H]+ 183.0657 m / z, observed 183.0655 m / z.

[0241] Synthesis of E2:

[0242] E2 was synthesized from I4 and methyl 3-aminobenzoate following General Procedure I. The product was purified using hexanes: ethyl acetate (80:20) to give an oil in 57% yield. LC-MS [M+H]+ 316.1185 m / z, observed 316.1183 m / z.

[0243] Synthesis of I5:

[0244] I5 was synthesized from E2 following General Procedure VI to give product as an off- white solid in 91% yield. LC-MS [M+H]+ 302.1028 m / z, observed 302.1030 m / z.

[0245] Synthesis of I6:

[0246] I6 was synthesized from I5 and piperidine following General Procedure I. The product was purified using hexanes: ethyl acetate (70:30) to give an off-white solid in 61% yield. LC-MS [M+H]+ 369.1814 m / z, observed 369.1811 m / z.

[0247] Synthesis of I7:

[0248] I7 was synthesized from I6 following General Procedure V to give product as an off- white solid in 95% yield. LC-MS [M+H]+ 325.1552 m / z, observed 325.1551 m / z.

[0249] Synthesis of GLP-1R-SM6-p:

[0250] GLP-1R-SM6 was synthesized following General Procedure II to give product as an oil in 64% yield. LC-MS [M+H]+ 570.2928 m / z, observed 570.2927 m / z. Scheme 6. Synthesis of GLP-1R-SM19-p

[0251] Reagents and Conditions: (a) K2CO3, ACN, 85ºC, 12 hr, 68%. (b) TFA: DCM (3:1), rt, 1 h, 95%. (c) NHS, EDC^HCl, DCM, 30ºC, 12 h, 73%.

[0252] Synthesis of E3:

[0253] E3 was synthesized according to General Procedure II to give product as an oil in 68% yield. LC-MS [M+H]+ 738.2390 m / z, observed 738.2392 m / z.

[0254] Synthesis of I8:

[0255] I8 was synthesized from E3 following General Procedure V to give product as an off- white solid in 95% yield. LC-MS [M+H]+ 550.0978 m / z, observed 550.0977 m / z.

[0256] Synthesis of GLP-1R-SM19-p:

[0257] To a solution of I8 (1 eq) and NHS (1.1 eq) in DCM (0.2 M) was added EDC^HCl (2 eq). The mixture was stirred at 30°C for 12 hours. Then, the reaction was concentrated under reduced pressure and purified via CombiFlash column chromatography using DCM: MeOH (98:2) to give produce as an off-white solid in 73% yield. LC-MS [M+H]+ 779.1927 m / z, observed 779.1922 m / z. Scheme 7. Synthesis of GLP-1R-SM21-p

[0258] Reagents and Conditions: (a) COMU, DIPEA, DCM, rt, 2 hr, 48%

[0259] Synthesis of GLP-1R-SM21-p:

[0260] GLP-1R-SM21 was synthesized following General Procedure I. The product was purified using DCM: MeOH (96:4) to give an oil in 48% yield. LC-MS [M+H]+ 800.3895 m / z, observed 800.3893 m / z. Scheme 8. Synthesis of GLP-1R-SM-1009-p

[0261] Reagents and conditions: (a) TEA, MeCN, 16h, 69%. (b) 10% w / w Pd / C, H2(g), MeOH / THF, 99%. (c) methyl 2,2,2-trichloroacetimidate, (pTSA ^ H2O), MeCN, 60°C, 29%. (d) DIEA, MeCN, 105°C, 24h, 9%. (e) TFA / DCM followed by DIEA, COMU, azido-PEG4- amine, DCM, 29% over two steps.

[0262] Synthesis of I46:

[0263] Compound I46 was synthesized using General Procedure VIII. The product was purified by flash chromatography (0-50% EA / Hex) to afford a light orange solid (69% yield). LC-MS(ES+): 309.55 [M+H].

[0264] Synthesis of I47:

[0265] Compound I47 was synthesized using General Procedure IX. The product (99% yield) was carried forward without additional purification. LC-MS(ES+): 279.41 [M+H].

[0266] Synthesis of I48:

[0267] To a stirring solution of tert-butyl (S)-4-amino-3-((oxetan-2-ylmethyl)amino)benzoate (I47, 0.385 g, 1.38 mmol) in acetonitrile (7 mL) was added methyl 2,2,2-trichloroacetimidate (0.268, 1.52 mmol) and p-toluenesulfonic acid monohydrate (0.048 g, 0.277 mmol). The solution was heated to 60°C and stirred for 4 hours. Removed volatiles under reduced pressure and purified crude material purified via flash chromatography (25% ethyl acetate / hexanes) to afford I48 as a brown off white solid (0.162 g, 29% yield). LC-MS(ES+): 406.52 m / z [M+H].

[0268] Synthesis of I49:

[0269] To a stirred solution of tert-butyl (S)-1-(oxetan-2-ylmethyl)-2-(trichloromethyl)-1H- benzo[d]imidazole-6-carboxylate ( 0.060 g, 0.148 mmol) and 3-fluoro-4-({[6-(piperidin-4- yl)pyridin-2-yl]oxy}methyl)- benzonitrile TsOH salt (A1, 0.117 g, 0.176 mmol) was added N,N-diisopropylethylamine (0.13 mL). The reaction mixture was sealed under nitrogen and heated to 105°C for 24 hours. The volatiles were removed under reduced pressure and the crude material purified via flash chromatography (5% MeOH / DCM) to afford I49 as a white solid (0.0562 g, 9% yield). LC-MS(ES+): 626.82 m / z [M+H].

[0270] Synthesis of GLP-1R-SM-1009-p:

[0271] To a stirred solution of tert-butyl (S)-2-(4-(6-((4-cyano-2-fluorobenzyl)oxy)pyridin-2- yl)piperidine-1-carbonyl)-1-(oxetan-2-ylmethyl)-1H-benzo[d]imidazole-6-carboxylate (I49, 0.035 g, 0.056 mmol) in 0.3 mL methylene chloride was added 0.3 mL trifluoroacetic acid. The solution was stirred for 2 hours, then the volatiles were removed under reduced pressure. The crude carboxylic acid was then dissolved in 0.3 mL methylene chloride, and N,N- diisopropylethylamine (24 µL) was added, followed by COMU (0.020 g, 0.070 mmol). The solution was stirred under nitrogen for 15 minutes, then azido-PEG4-amine (0.0183 g, 0.070 mmol) was added and the solution stirred an additional 2 hours. The volatiles were removed under reduced pressure and the crude material purified via flash chromatography (11% MeOH / DCM) to afford GLP-1R-SM-1009 (0.0131 g, 29% yield over two steps). LC- MS(ES+): 814.91 m / z [M+H]. Scheme 9. Synthesis of GLP-1R-SM-1010-p

[0272] Reagents and conditions: (a) TEA, MeOH, 60°C, 16h, 63%. (b) 10% w / w Pd / C, H2(g), MeOH / THF, 95%. (c) 2-chloro-1,1,1-trimethoxyethane, (pTSA ^ H2O), MeCN, 40°C, 62%. (d) K2CO3, MeCN, 50°C, 2h, 35%. (e) 1 M 1,5,7-Triazabicyclo[4.4.0]-dec-5-ene(aq), MeCN followed by DIEA, COMU, azido-PEG4-amine, DCM, 52% over two steps.

[0273] Synthesis of I49:

[0274] The nitro intermediate for Compound I49 was synthesized using General Procedure VIII, with heating to 60°C. The crude material purified was via flash chromatography (20% ethyl acetate / hexanes) to afford the product as a yellow solid (63% yield). *Note: compound did not ionize on mass spectrometer, so NMR was used to characterize this compound.1H NMR (250 MHz, CDCl3): δ 8.03 (bs, 1H), 7.91 (d, 1H), 6.94, (d, 1H), 3.78-3.69 (m, 1H), 3.66 (s, 3H), 3.38 (t, 2H), 3.01-2.92 (m, 1H), 2.91-2.73 (m, 2H), 2.55-2.44 (m, 1H). Compound I49 was synthesized using General Procedure IX (The product (95% yield) was carried forward without additional purification. LC-MS(ES+): 253.15 m / z [M+H].

[0275] Synthesis of I50:

[0276] Compound I50 was synthesized using General Procedure X at 40°C. The crude material was purified via flash chromatography (20% ethyl acetate / hexanes) to afford the product as a brown oil (62% yield). LC-MS(ES+): 311.26 m / z [M+H].

[0277] Synthesis of I51:

[0278] Compound I51 was synthesized using General Procedure XI. The crude material was purified via flash chromatography (40% ethyl acetate / hexanes) to afford the product as a light brown solid (35% yield). LC-MS(ES+): 572.86 m / z [M+H].

[0279] Synthesis of GLP-1R-SM-1010-p:

[0280] GLP-1R-SM-1010 was synthesized using General Procedure XII. The crude material was purified via flash chromatography (6% MeOH / DCM) to afford the product as an off- white solid (52% yield over two steps). LC-MS(ES+): 816.99 m / z [M+H]. Scheme 10. Synthesis of GLP-1R-SM-1011-p

[0281] Reagents and conditions: (a) K2CO3, EtOH, 70°C, 16h, 23%. (b) 10% w / w Pd / C, H2(g), MeOH / THF, 97%. (c) 2-chloro-1,1,1-trimethoxyethane, pTSA ^ H2O, MeCN, 50°C, 11%. (d) K2CO3, MeCN, 50°C, 2h, 93%. (e) 1 M 1,5,7-Triazabicyclo[4.4.0]-dec-5-ene(aq), MeCN followed by DIEA, COMU, azido-PEG4-amine, DCM, 22% over two steps.

[0282] Synthesis of I52:

[0283] Compound I52 was synthesized using General Procedure VIII, with heating to 70°C. The crude material was purified via flash chromatography (10% ethyl acetate / hexanes) to afford the product as a white solid (23% yield). LC-MS(ES+): 323.50 m / z [M+H].

[0284] Synthesis of I53:

[0285] Compound I53 was synthesized using General Procedure IX. The product (97% yield) was carried forward without additional purification. LC-MS(ES+): 293.52 m / z [M+H].

[0286] Synthesis of I54:

[0287] Compound I54 was synthesized using General Procedure X at 50°C. The crude material was purified via flash chromatography (50% ethyl acetate / hexanes) to afford the product as a brown oil (11% yield). LC-MS(ES+): 351.32 m / z [M+H].

[0288] Synthesis of I55:

[0289] Compound I55 was synthesized using General Procedure XI. The crude material was purified via flash chromatography (4% MeOH / DCM) to afford the product as a light brown solid (93% yield). LC-MS(ES+): 572.86 [M+H]. LC-MS(ES+): 626.44 m / z [M+H].

[0290] Synthesis of GLP-1R-SM-1011-p:

[0291] GLP-1R-SM-1011 was synthesized using General Procedure XII. The crude material was purified via flash chromatography (8% MeOH / DCM) to afford the product (22% yield over two steps). LC-MS(ES+): 842.99 m / z [M+H]. S

[0292] Reagents and conditions: (a) TEA, MeOH, 70°C, 16h, 82%. (b) 10% w / w Pd / C, H2(g), MeOH / THF, 93%. (c) 2-chloro-1,1,1-trimethoxyethane, (pTSA · H2O) , MeCN, 50°C, 99%. (d) K2CO3, MeCN, 50°C, 2h, 28%. (e) 1 M 1,5,7-Triazabicyclo[4.4.0]-dec-5-ene(aq), MeCN followed by DIEA, COMU, azido-PEG4-amine, DCM, 22% over two steps.

[0293] Synthesis of I56:

[0294] Compound I56 was synthesized using General Procedure VIII, with heating to 70oC. The crude material was purified via flash chromatography (10% MeOH / DCM) to afford the product as an orange solid (82% yield). LC-MS(ES+): 302.23 m / z [M+H].

[0295] Synthesis of I57:

[0296] Compound I57 was synthesized using General Procedure IX. The orange solid product (93% yield) was carried forward without additional purification. LC-MS(ES+): 272.31 m / z [M+H].

[0297] Synthesis of I58:

[0298] Compound I58 was synthesized using General Procedure X at 50oC. The crude material was purified via flash chromatography (18% MeOH / DCM) to afford the product as a brown oil (11% yield). LC-MS(ES+): 330.321 m / z [M+H].

[0299] Synthesis of I59:

[0300] Compound I59 was synthesized using General Procedure XI. The crude material was purified via flash chromatography (10% MeOH / DCM) to afford the product as a light brown solid (28% yield). LC-MS(ES+): 605.66 m / z [M+H].

[0301] Synthesis of GLP-1R-SM-1012-p:

[0302] GLP-1R-SM-1012 was synthesized using General Procedure XII. The crude material was purified via flash chromatography (12% MeOH / DCM) to afford the product as an off- white solid (35% yield over two steps). LC-MS(ES+): 835.01 m / z[M+H]. Scheme 12. Synthesis of GLP-1R-SM-1013-p

[0303] Reagents and conditions: (a) K2CO3, DMF, 90°C, 4h, 67%. (b) 10% w / w Pd / C, H2(g), MeOH / THF, 70%. (c) 2-chloro-1,1,1-trimethoxyethane, (pTSA ^ H2O) , MeCN, 40°C, 67%. (d) K2CO3, MeCN, 50°C, 2h, 72%. (e) 1 M 1,5,7-Triazabicyclo[4.4.0]-dec-5-ene(aq), MeCN followed by DIEA, COMU, azido-PEG4-amine, DCM, 33% over two steps.

[0304] Synthesis of I60:

[0305] Compound I60 was synthesized using General Procedure VIII, with heating to 90°C for 4 hours. The crude material was purified via flash chromatography (45% ethyl acetate / hexanes) to afford the product as a yellow solid (67% yield). LC-MS(ES+): 301.47 m / z [M+H].

[0306] Synthesis of I61:

[0307] Compound I61 was synthesized using General Procedure IX. The off-white solid product (70% yield) was carried forward without additional purification. LC-MS(ES+): 271.30 m / z [M+H].

[0308] Synthesis of I62:

[0309] Compound I62 was synthesized using General Procedure X at 40°C. The crude material was purified via flash chromatography (44% ethyl acetate / hexanes) to afford the product as a clear oil (67% yield). LC-MS(ES+): 329.91 m / z [M+H].

[0310] Synthesis of I63:

[0311] Compound I63 was synthesized using General Procedure XI. The crude material was purified via flash chromatography (58% ethyl acetate / hexanes) to afford the product as a brown solid (72% yield). LC-MS(ES+): 604.72 m / z [M+H].

[0312] Synthesis of GLP-1R-SM-1013-p:

[0313] GLP-1R-SM-1013 was synthesized using General Procedure XII. The crude material was purified via flash chromatography (3% MeOH / DCM) to afford the product as an off- white solid (33% yield over two steps). LC-MS(ES+): 833.87 m / z [M+H]. Scheme 13: Synthesis of GLP-1R-SM-1024-p

[0314] Reagents and conditions: (a) Pd(dppf)Cl2, K2CO3, 1,4-dioxane, 105°C, 77%. (b) 7.5% w / w Pd / C, H2(g), Ethyl acetate, 2h, 71%. (c)TFA, DCM, 94%. (d) K2CO3, MeCN,50°C, 24h, 72%. (e) 1 M 1,5,7-Triazabicyclo[4.4.0]-dec-5-ene(aq), MeCN followed by DIEA, COMU, azido-PEG4-amine, DCM, 36% over two steps.

[0315] Synthesis of I64:

[0316] Compound I64 was synthesized using General Procedure XIII. The crude material was purified via flash chromatography (80% ethyl acetate / hexanes) to afford the desired product (77% yield). LC-MS(ES+): 436.2036 m / z [M+H].

[0317] Synthesis of I65:

[0318] Compound I65 was synthesized using General Procedure XIV. The crude material was purified via flash chromatography (80% ethyl acetate / hexanes) to afford the desired product (71% yield). LC-MS(ES+): 438.2193 m / z [M+H].

[0319] Synthesis of I66:

[0320] Compound I66 was synthesized using General Procedure XV. The crude material (94% yield). was carried forward without further purification. LC-MS(ES+): 338.1669 m / z [M+H].

[0321] Synthesis of I67:

[0322] Compound I67 was synthesized using General Procedure XI at 50°C. The crude material was purified via flash chromatography (90% ethyl acetate / hexanes) to afford the desired product (41% yield). LC-MS(ES+): 596.2673 m / z [M+H].

[0323] Synthesis of GLP-1R-SM-1024-p:

[0324] Compound GLP-1R-SM-1024 was synthesized using General Procedure XII. The crude material was purified via flash chromatography (6% MeOH / DCM) to afford the desired product (36% over two steps). LC-MS(ES+): 826.4051 m / z [M+H]. Scheme 14: Synthesis of GLP-1R-SM-1028-p

[0325] Reagents and conditions: (a) Pd(dppf)Cl2, K2CO3, 1,4-dioxane, 105°C, 86%. (b) 7.5% w / w Pd / C, H2(g), Ethyl acetate, 2h, 54%. (c)TFA, DCM, 55%. (d) K2CO3, MeCN, 50°C, 24h, 29%. (e) 1 M 1,5,7-Triazabicyclo[4.4.0]-dec-5-ene(aq), MeCN followed by DIEA, COMU, azido-PEG4-amine, DCM, 47% over two steps.

[0326] Synthesis of I68:

[0327] Compound I68 was synthesized using General Procedure XIII. The crude material was purified via flash chromatography (80% ethyl acetate / hexanes) to afford the desired product (86% yield). LC-MS(ES+): 452.1985 m / z [M+H].

[0328] Synthesis of I69:

[0329] Compound I69 was synthesized using General Procedure XIV. The crude material was purified via flash chromatography (80% ethyl acetate / hexanes) to afford the desired product (54% yield). LC-MS(ES+): 454.2142 m / z [M+H].

[0330] Synthesis of I70:

[0331] Compound I70 was synthesized using General Procedure XV. The crude material (55% yield). was carried forward without further purification. LC-MS(ES+): 354.1618 m / z [M+H].

[0332] Synthesis of I71:

[0333] Compound I71 was synthesized using General Procedure XI at 50°C. The crude material was purified via flash chromatography (100% ethyl acetate) to afford the desired product (29% yield). LC-MS(ES+): 612.2622 m / z [M+H].

[0334] Synthesis of GLP-1R-SM-1028-p:

[0335] Compound GLP-1R-SM-1028 was synthesized using General Procedure XII. The crude material was purified via flash chromatography (6% MeOH / DCM) to afford the desired product (47% over two steps). LC-MS(ES+): 842.4001m / z [M+H]. Scheme 15: Synthesis of GLP-1R-SM-0750-p

[0336] Reagents and conditions: (a) Pd(dppf)Cl2, K2CO3, 1,4-dioxane, 105°C, 34%. (b) TFA, DCM, 88%. (c) K2CO3, MeCN, 50oC, 12h, 65%. (d) 1 M 1,5,7-Triazabicyclo[4.4.0]- dec-5-ene(aq), MeCN followed by DIEA, COMU, azido-PEG4-amine, DCM, 25% over two steps.

[0337] Synthesis of I72:

[0338] Compound I72 was synthesized using General Procedure XIII. The crude material was purified via flash chromatography (40% ethyl acetate / hexanes) to afford the desired product (34% yield). LC-MS(ES+): 395.1526 m / z [M+H].

[0339] Synthesis of I73:

[0340] Compound I73 was synthesized using General Procedure XV. The crude material (88% yield). was carried forward without further purification. LC-MS(ES+): 295.0990 m / z [M+H].

[0341] Synthesis of I74:

[0342] Compound I74 was synthesized using General Procedure XI at 50°C for 12 hours. The crude material was purified via flash chromatography (30% Ethyl acetate / hexanes) to afford the desired product (65% yield). LC-MS(ES+): 553.2003 m / z [M+H].

[0343] Synthesis of GLP-1R-SM-0750-p:

[0344] Compound GLP-1R-SM-0750 was synthesized using General Procedure XII. The crude material was purified via flash chromatography (4% MeOH / DCM) to afford the desired product (25% over two steps). LC-MS(ES+): 783.3383 m / z [M+H]. S

[0345] Reagents and conditions: (a) Pd(dppf)Cl2, K2CO3, 1,4-dioxane, 105°C, 32%. (b) TFA, DCM, 89%. (c) K2CO3, MeCN, 50°C, 12h, 58%. (d) 1 M 1,5,7-Triazabicyclo[4.4.0]-dec-5- ene(aq), MeCN followed by DIEA, COMU, azido-PEG4-amine, DCM, 30% over two steps.

[0346] Synthesis of I75:

[0347] Compound I75 was synthesized using General Procedure XIII. The crude material was purified via flash chromatography (40% ethyl acetate / hexanes) to afford the desired product (32% yield). LC-MS(ES+): 410.1875 m / z [M+H].

[0348] Synthesis of I76:

[0349] Compound I76 was synthesized using General Procedure XV. The crude material (89% yield). was carried forward without further purification. LC-MS(ES+): 310.1361 m / z [M+H].

[0350] Synthesis of I77:

[0351] Compound I77 was synthesized using General Procedure XI at 50°C for 12 hours. The crude material was purified via flash chromatography (30% ethyl acetate / hexanes) to afford the desired product (58% yield). LC-MS(ES+): 568.2355 m / z [M+H].

[0352] Synthesis of GLP-1R-SM-0741-p:

[0353] Compound GLP-1R-SM-0741 was synthesized using General Procedure XII. The crude material was purified via flash chromatography (4% MeOH / DCM) to afford the desired product (30% over two steps). LC-MS(ES+): 798.3745 m / z [M+H]. S

[0354] Reagents and conditions: (a) K2CO3, THF, 60°C, 12h 76%. (b) 10% w / w Pd / C, H2(g), MeOH / THF, 94%. (c) 2-chloro-1,1,1-trimethoxyethane, (pTSA ^ H2O), MeCN, 60°C80%. (d) K2CO3, MeCN, 12h, 73%. (e) 1 M 1,5,7-Triazabicyclo[4.4.0]-dec-5-ene(aq), MeCN followed by DIEA, COMU, azido-PEG4-amine, DCM, 32% over two steps.

[0355] Synthesis of I78:

[0356] Compound I78 was synthesized using General Procedure VIII, with heating to 60oC for 4 hours. The crude material was purified via flash chromatography (10% ethyl acetate / hexanes) to afford the product (76% yield). LC-MS(ES+): 301.47 m / z [M+H].

[0357] Synthesis of I79:

[0358] Compound I79 was synthesized using General Procedure IX. The solid product (94% yield) was carried forward without additional purification. LC-MS(ES+): 289.1168 m / z [M+H].

[0359] Synthesis of I80:

[0360] Compound I80 was synthesized using General Procedure X at 60°C. The crude material was purified via flash chromatography (20% ethyl acetate / hexanes) to afford the product (80% yield). LC-MS(ES+): 347.0767 m / z [M+H].

[0361] Synthesis of I81:

[0362] Compound I81 was synthesized using General Procedure XI for 12 hours. The crude material was purified via flash chromatography (30% ethyl acetate / hexanes) to afford the product (7% yield). LC-MS(ES+): 622.2448 m / z [M+H].

[0363] Synthesis of GLP-1R-SM-0932-p:

[0364] GLP-1R-SM-0932 was synthesized using General Procedure XII. The crude material was purified via flash chromatography (4% MeOH / DCM) to afford the product (32% yield over two steps). LC-MS(ES+): 852.3820 m / z [M+H]. Scheme 18. Synthesis of GLP-1R-SM-0933-p

[0365] Reagents and conditions: (a) K2CO3, MeCN, 12h, 72%. (b) 1 M 1,5,7- Triazabicyclo[4.4.0]-dec-5-ene(aq), MeCN followed by DIEA, COMU, azido-PEG4-amine, DCM, 31% over two steps.

[0366] Synthesis of I86:

[0367] Compound I86 was synthesized using General Procedure XI at 50°C for 12 hours. The crude material was purified via flash chromatography (30% ethyl acetate / hexanes) to afford the desired product (72% yield). LC-MS(ES+): 501.1938 m / z [M+H].

[0368] Synthesis of GLP-1R-SM-0933-p:

[0369] Compound GLP-1R-SM-0933 was synthesized using General Procedure XII. The crude material was purified via flash chromatography (4% MeOH / DCM) to afford the desired product (31% over two steps). LC-MS(ES+): 731.3317 m / z [M+H]. Scheme 19. Synthesis of GLP-1R-SM-0934-p

[0370] Reagents and conditions: (a) K2CO3, MeCN, 12h, 69%. (b) 1 M 1,5,7- Triazabicyclo[4.4.0]-dec-5-ene(aq), MeCN followed by DIEA, COMU, azido-PEG4-amine, DCM, 31% over two steps.

[0371] Synthesis of I87:

[0372] Compound I87 was synthesized using General Procedure XI at 50°C for 12 hours. The crude material was purified via flash chromatography (30% ethyl acetate / hexanes) to afford the desired product (69% yield). LC-MS(ES+): 517.17 m / z [M+H].

[0373] Synthesis of GLP-1R-SM-0934-p:

[0374] Compound GLP-1R-SM-0934 was synthesized using General Procedure XII. The crude material was purified via flash chromatography (4% MeOH / DCM) to afford the desired product (25% over two steps). LC-MS(ES+): 747.3089 m / z [M+H]. Scheme 20: Synthesis of GLP-1R-SM-1074-p

[0375] Reagents and conditions: (a) Pd2(dba)3, RuPhos, Cs2CO3, 1,4-dioxane, 120°C, 2h 70%. (b) HCl / 1,4-dioxane, 2h >99%. (c) K2CO3, NaI, MeCN, 25°C, 16h, 61%. (d) LiOH hydrate, THF / H2O followed by DIEA, HATU, azido-PEG4-amine, DMF, 30% over two steps.

[0376] Synthesis of I88:

[0377] Compound I88 was synthesized using General Procedure XVI. The crude product was purified by flash chromatography (n-Heptane / EA=15:0 to 4:1) to afford the desired product (59 % yield) as a light-yellow solid. LC-MS(ES+): 339.20m / z [M-Boc].

[0378] Synthesis of I89:

[0379] Compound I89 was synthesized by General Procedure XVII. The crude material (>99% yield) was carried forward without further purification.

[0380] Synthesis of I90:

[0381] Compound I90 was synthesized using a modified version of General Procedure XI, which includes 0.5 eq NaI, at 25°C for 16 hours. The crude material was purified via flash chromatography (EtOAc / EtOH 3:1) to afford the desired product (61% yield). LC-MS(ES+): 597.30 m / z [M+H].

[0382] Synthesis of GLP-1R-SM-1074-p:

[0383] Compound GLP-1R-SM-1074 was synthesized using General Procedure XVIII. The crude material was purified via prep HPLC to afford the desired product (30% over two steps). LC-MS(ES+): 827.4 m / z [M+H].Scheme 21: Synthesis of GLP-1R-SM-1073-p

[0384] Reagents and conditions: (a) Pd2(dba)3, X-Phos, Cs2CO3, 1,4-dioxane, 120°C, 2h, 70%. (b) TFA, DCM, 2h >99%. (c) K2CO3, NaI, MeCN, 25°C, 12h, 93%. (d) LiOH hydrate, THF / H2O followed by DIEA, HATU, azido-PEG4-amine, DMF, 6 hours 33% over two steps.

[0385] Synthesis of I91:

[0386] Compound I91 was synthesized using General Procedure XVI. The crude product was purified by flash chromatography (n-Heptane / EA=15:0 to 5:1) to afford the desired product (70 % yield) as a light-yellow solid.

[0387] Synthesis of I92:

[0388] Compound I92 was synthesized by General Procedure XVII. The crude material (>99% yield) was carried forward without further purification.

[0389] Synthesis of I93:

[0390] Compound I93 was synthesized using a modified version of General Procedure XI, which includes 0.5 eq NaI, at 25°C for 12 hours. The crude material was purified via flash chromatography (EtOAc / EtOH 3:1) to afford the desired product (93% yield). LC-MS(ES+): 583.0 m / z [M+H].

[0391] Synthesis of GLP-1R-SM-1073-p:

[0392] Compound GLP-1R-SM-1073 was synthesized using General Procedure XVIII. The crude material was purified via prep HPLC to afford the desired product (33% over two steps). LC-MS(ES+): 813.4 m / z [M+H]. Scheme 22: Synthesis of GLP-1R-SM-1075-p

[0393] Reagents and conditions: (a) LiAlH4, THF, 0°C, 61%. (b) XantPhos, Pd2(dba)3, Cs2CO3, 1,4-dioxane, 130oC, 1h, 70%. (c) HCl / 1,4-dioxane, 16h >99%. (d) K2CO3, NaI, MeCN, 25°C, 1.5h, 64%. (e) LiOH hydrate, THF / H2O followed by DIEA, HATU, azido- PEG4-amine, DMF, 6 hours 33% over two steps.

[0394] Synthesis of I94:

[0395] Compound I94 was synthesized using General Procedure XIX. The crude product was purified by flash chromatography (n-Heptane / ethyl acetate=8:0 to 5:1) to afford the desired product (61 % yield) as a yellow oil.

[0396] Synthesis of I95:

[0397] Compound I95 was synthesized using General Procedure XX. The crude product was purified by flash chromatography (n-Heptane / EA=15:1) to afford the desired product (70 % yield) as a light-yellow solid.

[0398] Synthesis of I96:

[0399] Compound I96 was synthesized by General Procedure XVII. The crude material (>99% yield) was carried forward without further purification.

[0400] Synthesis of I97:

[0401] Compound I97 was synthesized using a modified version of General Procedure XI, which includes 0.5 eq NaI, at 25°C for 1.5 hours. The crude material was purified via flash chromatography (EtOAc / EtOH 3:1) to afford the desired product (64% yield).

[0402] Synthesis of GLP1R-SM-1075-p:

[0403] Compound GLP-1R-SM-1075 was synthesized using General Procedure XVIII. The crude material was purified via prep-HPLC to afford the desired product (36% over two steps). LC-MS(ES+): 843.4 m / z [M+H].S

[0404] Reagents and conditions: (a) X-Phos, Pd2(dba)3, Cs2CO3, 1,4-dioxane, 100°C, 3h, 95%. (b) HCl / 1,4-dioxane, 2h >99%. (c) K2CO3, MeCN, 25°C, 1.5h, 62%. (d) LiOH hydrate, THF / H2O followed by DIEA, HATU, azido-PEG4-amine, DMF, 6 hours 28% over two steps.

[0405] Synthesis of I98:

[0406] Compound I98 was synthesized using General Procedure XX at 100°C. The crude product was purified by flash chromatography (n-Heptane / EA=15:1 to 8:1) to afford the desired product (95 % yield) as a light-yellow solid.

[0407] Synthesis of I99:

[0408] Compound I99 was synthesized by General Procedure XVII. The crude material (>99% yield) was carried forward without further purification.

[0409] Synthesis of I100:

[0410] Compound I100 was synthesized using General Procedure XI at 25°C for 16 hours. The crude material was purified via flash chromatography (n-heptane / ethyl acetate: 5:1 to 1:1) to afford the desired product as a light yellow solid (62% yield).

[0411] Synthesis of GLP-1R-SM-1076-p:

[0412] Compound GLP-1R-SM-1076 was synthesized using General Procedure XVIII. The crude material was purified via prep HPLC to afford the desired product (28% over two steps). LC-MS(ES+): 843.4 m / z [M+H]. S

[0413] Reagents and conditions: (a) Pd2(dba)3, X-Phos, Cs2CO3, 1,4-dioxane, 120°C, 1h, 68%. (b) HCl / 1,4-dioxane, 16h >99%. (c) K2CO3, NaI, MeCN, 25°C, 16h, 15% (I103), 15% (I104). (d) LiOH hydrate, THF / H2O followed by DIEA, HATU, azido-PEG4-amine, DMF, 6 hours 45% (GLP-1R-SM-1082) over two steps. (e) LiOH hydrate, THF / H2O followed by DIEA, HATU, azido-PEG4-amine, DMF, 6 hours 39% (GLP-1R-SM-1077) over two steps.

[0414] Synthesis of I101:

[0415] Compound I101 was synthesized using General Procedure XVI. The crude product was purified by flash chromatography (n-Heptane / EA=4:1) to afford the desired product (68 % yield) as a light-yellow solid.

[0416] Synthesis of I02:

[0417] Compound I92 was synthesized by General Procedure XVII. The crude material (>99% yield) was carried forward without further purification.

[0418] Synthesis of I103 and I104:

[0419] Compound I93 was synthesized using a modified version of General Procedure XI, which includes 0.5 eq NaI, at 25°C for 16 hours. The crude material was purified via flash chromatography (n-Heptane / EE = 3:1 where EE =EtOAc / EtOH 3:1) to afford the racemic products I103 and I104. The diastereomers were separated via SFC to afford I103 (15% yield) and I104 (15% yield).

[0420] Synthesis of GLP-1R-SM-1077-p:

[0421] Compound GLP-1R-SM-1077 was synthesized from I103 using General Procedure XVIII. The crude material was purified via prep HPLC to afford the desired product (39% over two steps). LC-MS(ES+): 827.4 m / z [M+H].

[0422] Synthesis of GLP-1R-SM-1082-p:

[0423] Compound GLP-1R-SM-1082 was synthesized from I104 using General Procedure XVIII. The crude material was purified via prep HPLC to afford the desired product (45% over two steps). LC-MS(ES+): 827.4 m / z [M+H]. Scheme 25: Synthesis of GLP-1R-SM-1078-p and GLP-1R-SM-1083-pO N N

[0424] Reagents and conditions: (a) H2O2, MeCN, 90°C, 24h, 61%. (b) BnNCO, n-BuLi, THF, -78°C-25°C, 2.5h, 98%. (c) BH3^Me2S, THF, 70°C, 2h, 8.3% yield. (d) Pd / C, MeOH, 60°C, 24h, 76%. (e) TEA, DMF, 25oC, 16h, 90%. (f) Pd / C, THF, 25°C, 1.5h, 98%. (g) pTSA^H2O, MeCN, 60°C, 8h, 83%. (h) K2CO3, NaI, MeCN, 25°C, 3.5h (i) LiOH hydrate, THF / H2O, 50°C, 16h, 32% (I113) and 30% (I114). (j) DIEA, HATU, 25oC, 1h, 40%. (k) DIEA, HATU, 25°C, 1h, 40%. (k) DIEA, HATU, 25°C, 1h, 40%. (k) DIEA, HATU, 25°C, 1h, 47%.

[0425] Synthesis of I105:

[0426] To a solution of thietane (24 g, 323.692 mmol, 1 eq) in MeCN (250 mL) was added 30% H2O2 (84.412 g, 744 mmol, 30% purity, 2.3 eq) the mixture was heated to 90 °C and stirred for 24 h. It was quenched by Na2SO3(20 mL), then the solvents was removed, theresidue was added DCM (50 mL) and stirred for 0.5 h, then filtered and concentrated to afford IM105 (21 g, 198 mmol, 61%) as a white solid.

[0427] Synthesis of I106:

[0428] To a solution of I105 (5 g, 47.106 mmol, 1 eq) in THF (130 mL) was added n-BuLi (19.8 mL, 49.5 mmol, 2.5 M, 1.05 eq) dropwise at -78 °C, after 0.5 h, BnNCO (6.272 g, 47.106 mmol, 1 eq) was added. The mixture was warmed to 25°C and stirred for 2 h. It was then quenched by NH4Cl(aq) (50 mL), then the solvents were removed under reduced pressure and ethyl acetate (200 mL) was added. The solution was stirred for 0.5 h, filtered and concentrated to afford crude I106 (11 g, 98% yield) as a white solid.

[0429] Synthesis of I107:

[0430] To a solution of I106 (11 g,45.969 mmol,1 eq) in THF (100 mL) was added BH3^Me2S (16.1 mL, 161 mmol, 10 M, 3.5 eq) the mixture was stirred at 70 °C for 2 h. It was quenched by MeOH (50 mL) dropwise, then stirred for 0.5 h. The solvents were removed under reduced pressure, and the crude material was dissolved in EtOAc (200 mL) stirred for 0.5 h, then filtered. The filtrate was added to 4 M HCl / dioxane (50 mL). This mixture was stirred for 0.5 h, then concentrated under reduced pressure. The residue was taken up in EtOAc (200 mL), filtered and the volatiles removed under reduced pressure. The resulting crude material was further purified by flash chromatography (silica gel, n-Heptane: EE = 10:1 to 3:1, EE = EtOAc:EtOH 3:1) to afford I107 (1 g, 3.820 mmol, 8.3% yield) as a colorless oil. LC-MS(ES+): 226.1 m / z [M+H].

[0431] Synthesis of I108:

[0432] To a solution of I107 (1 g, 3.820 mmol, 1 eq) in MeOH (10 mL) was added Pd / C (1.000 g, 7.5% purity) under N2 atmosphere. The N2atmosphere was removed under reduced pressure, then the vessel contents were placed under an H2 atmosphere (3 times). The mixture was stirred at 60 °C for 24 h. The mixture was filtered and concentrated to afford crude I108 (0.43 g, 76% yield) as a light-yellow solid. The crude material was carried forward without further purification.

[0433] Synthesis of I109:

[0434] To a solution of I108 (0.43 g, 3.181 mmol, 1 eq) and methyl 3-fluoro-4-nitrobenzoate (0.7 g, 3.515 mmol, 1.1 eq) in DMF (10 mL) was added TEA (321.866 mg, 3.181 mmol, 1 eq). The mixture was stirred at 25 °C for 16 h. It was quenched by H2O (10 mL), extracted with EtOAc (10 mL x 3), and the combined organic phase were concentrated to give a crude residue. The crude residue was purified by flash chromatography (silica gel, n-Heptane: EtOAc = 1:1 to 3:7) to afford I109 (0.9 g, 2.863 mmol, 90% yield) as a light-yellow solid.

[0435] Synthesis of I110:

[0436] To a solution of I109 (0.9 g, 2.863 mmol, 1 eq) in THF (10 mL) was added and Pd / C (0.2 g, 10% w / w) under N2 atmosphere. The N2 atmosphere was removed under reduced pressure, then the vessel contents were placed under an H2atmosphere (3 times). The mixture was stirred at 25 °C for 1.5 h. The mixture was filtered and concentrated to afford crude PCS3534-IM06 (0.8 g, 98% yield) as a light-yellow oil. LC-MS(ES+): 285.1 m / z [M+H].

[0437] Synthesis of I111:

[0438] Compound I111 was synthesized using General Procedure X at 60°C. The crude material was purified via flash chromatography (silica gel, n-Heptane: EE = 2:1 to 1:1, EE = EtOAc:EtOH 3:1) to afford the product as a brown oil (83% yield). LC-MS(ES+): 343.0 m / z [M+H].

[0439] Synthesis of I112:

[0440] Compound I112 was synthesized using a modified version of General Procedure XI, which includes 0.5 eq NaI, at 25°C for 3.5 hours. The crude material was purified via flash chromatography (silica gel, n-Heptane: EE = 3:1 to 1:1, EE = EtOAc:EtOH 3:1) to afford the desired product ((1 g, 1.619 mmol, 69% yield).

[0441] Synthesis of I113 and I114:

[0442] To a solution of I112 (1 g, 1.619 mmol, 1 eq) in THF (10 mL) and H2O (1 mL) was added LiOH hydrate (272 mg, 6.476 mmol, 4.0 eq) . The mixture was stirred at 50 °C for 16 h. The solvents were removed under reduced pressure, then H2O (15 mL) was added to the residue. The mixture was acidified by 1 N citric acid until pH to about 4. The solution was filtered and dried to afford a crude racemic mixture. The crude product was further purified by prep-HPLC to afford I113 (310 mg, 514 μmol, 32% yield) and I114 (290 mg, 480 μmol, 30% yield) as light-yellow solids.

[0443] Synthesis of GLP-1R-SM-1078-p:

[0444] To a solution of I113 (287 mg, 475 μmol, 1 eq) and azido-PEG4-amine (125 mg, 475 μmol, 1 eq) in DMF (5 mL) was added HATU (362 mg, 951 μmol, 2.0 eq) and DIPEA (184 mg, 1.426 mmol, 3.0 eq). The mixture was stirred to 25 °C for 1 h. It was quenched by H2O (10 mL), extracted with EtOAc (10 mL x 3), and the combined organic phase was concentrated to give a crude residue. The residue was purified by prep-HPLC to afford GLP- 1R-SM-1078 (160 mg, 189 μmol, 40% yield) as a light-yellow oil. LC-MS(ES+): 848.4 m / z [M+H].

[0445] Synthesis of GLP-1R-SM-1083-p:To a solution of I114 (260 mg, 431 μmol, 1 eq) and azido-PEG4-amine (113 mg, 431 μmol, 1 eq) in DMF (5 mL) was added HATU (328 mg, 861 μmol, 2.0 eq) and DIPEA (167 mg, 1.426 mmol, 3.0 eq). The mixture was stirred to 25 °C for 1 h. It was quenched by H2O (10 mL), extracted with EtOAc (10 mL x 3), and the combined organic phase was concentrated to give a crude residue. The residue was purified by prep-HPLC to afford GLP-1R-SM-1083 (172 mg, 203 μmol, 47% yield) as a light-yellow oil. LC-MS(ES+): 848.4 m / z [M+H]. Scheme 26: Synthesis of GLP-1R-SM-1079-p

[0446] Reagents and Conditions: (a) Pd / C, EtOAc, 25°C, 5h, 52% (b) HATU, DIEA, THF, 25°C, 1h, 31% (c) XPhos, Pd2(dba)3, Cs2CO3, toluene, 95°C, 1.5h, 21% (d) 1 M 1,5,7- Triazabicyclo[4.4.0]-dec-5-ene(aq), MeCN, 19%.

[0447] Synthesis of I115:

[0448] To a solution of (2-fluoro-4-nitrophenyl)methanol (4.9 g, 28.634 mmol, 1 eq) in EtOAc (50 mL) was stirred Pd / C (980 mg, 7.5% purity) under an N2atmosphere. The N2atmosphere was removed under reduced pressure, then the vessel contents were placed under an H2atmosphere (repeat this step 3 times). The mixture was stirred at 25°C for 5 h. The mixture was filtered and concentrated, then purified by flash chromatography (silica gel, n- Heptane: EtOAc = 7:3,) to afford I115 (2.1 g, 14.879 mmol, 52%) as a yellow solid.

[0449] Synthesis of I116:

[0450] To a solution of I115 (2.1 g, 14.879 mmol, 1 eq) and 1-azido-3,6,9,12- tetraoxapentadecan-15-oic acid (2.167 g,7.439 mmol,0.5 eq) in THF (40 mL) was added HATU (11.315 g,29.757 mmol, 2.0 eq) and DIPEA (5.769 g, 44.636 mmol, 3.0 eq). The mixture was stirred at 25 °C for 1 h. The mixture was concentrated and purified by column chromatography (silica gel, n-Heptane: EE = 3:2, EE = EtOAc:EtOH 3:1) to afford I116 (1.9 g, 4.585 mmol, 31%) as a light-yellow oil.

[0451] Synthesis of I117:

[0452] To a solution of I116 (1.149 g,2.526 mmol,1 eq) and methyl (S)-2-((4-(6- chloropyridin-2-yl)piperidin-1-yl)methyl)-1-(oxetan-2-ylmethyl)-1H-benzo[d]imidazole-6- carboxylate (PC13, 1.57 g, 3.788 mmol, 1.5 eq) in toluene (10 mL) was added and XPhos (241 mg, 505 μmol, 0.2 eq), Pd2(dba)3(231 mg, 253 μmol, 0.1 eq) and Cs2CO3(1.646 g, 5.051 mmol, 2 eq). The mixture was heated at 95°C and stirred for 1.5 h. The mixture was filtered and washed with EE (40 mL, EE = EtOAc:EtOH 3:1), then concentrated under reduced pressure to give a crude residue. The crude product was purified by column chromatography (silica gel, n-Heptane: EE = 1:1) to afford I117 (0.44 g, 528 μmol, 21% yield) as a light-yellow oil.

[0453] Synthesis of GLP-1R-SM-1079-p:

[0454] To a solution of I117 (0.4 g, 480.241 μmol, 1 eq) in MeCN (10 mL) was added 1,5,7- Triazabicyclo[4.4.0]-dec-5-ene (134 mg, 0.960 mmol, 2.0 eq). The mixture was stirred at 25 °C for 16 h. The solvents were removed under reduced pressure. Water (15 mL) was added to dissolve the residue. The mixture was acidified by 1 N citric acid to pH ~4. The mixture was filtered to give a solid residue. This residue was purified by prep-HPLC to afford GLP-1R- SM-1079 (74 mg, 90.366 μmol, 19% yield) as a white solid. LC-MS(ES+): 819.0 m / z [M+H]. Scheme 27: Synthesis of GLP-1R-SM-1080-p

[0455] Reagents and conditions: (a) K2CO3, NaI, MeCN, 25°C, 2.5h, 44%. (b) LiOH hydrate, THF / H2O, 55°C followed by DIEA, HATU, azido-PEG4-amine, DCM, 25°C, 1 h, 25% over two steps.

[0456] Synthesis of I118:

[0457] To a solution of 3-fluoro-4-(((6-(piperidin-4-yl)pyrazin-2-yl)oxy)methyl)benzonitrile (A24, 0.75 g, 2.401 mmol, 1 eq) and methyl (S)-2-(chloromethyl)-1-(oxetan-2-ylmethyl)-1H- benzo[d]imidazole-6-carboxylate (566 mg, 1.921 mmol, 0.8 eq) in MeCN (15 mL) was added K2CO3(996 mg, 7.204 mmol, 3.0 eq) and NaI (180 mg, 1.201 mmol, 0.5 eq). The mixture was stirred at 25 °C for 2.5 h. The mixture was concentrated and purified by column chromatography (silica gel, n-Heptane: EE = 3:1, EE = EtOAc:EtOH 3:1 to 3:2) to afford I118 (0.6 g, 1.052 mmol, 44%) as a yellow oil.

[0458] Synthesis of GLP-1R-SM-1080-p:

[0459] Compound GLP-1R-SM-1080 was synthesized via General Procedure XVIII. The crude material was purified via prep-HPLC to afford the product as a light yellow oil (25% yield over two steps). LC-MS(ES+): 801.4 m / z [M+H]. Scheme 28: Synthesis of GLP-1R-SM-1058-p

[0460] Reagents and conditions: (a) Pd(dppf)Cl2, K2CO3, 1,4-dioxane, 105°C, 86%. (b) 7.5% w / w Pd / C, H2(g), Ethyl acetate, 2h, 94%. (c)TFA, DCM, 91%. (d) K2CO3, MeCN, 50°C, 12h, 78%. (e) 1 M 1,5,7-Triazabicyclo[4.4.0]-dec-5-ene(aq), MeCN followed by DIEA, COMU, azido-PEG4-amine, DCM, 43% over two steps.

[0461] Synthesis of I119:

[0462] Compound I119 was synthesized using General Procedure XIII. The crude material was purified via flash chromatography (20% ethyl acetate / hexanes) to afford the desired product (52% yield). LC-MS(ES+): 478.2505 m / z [M+H].

[0463] Synthesis of I120:

[0464] Compound I120 was synthesized using General Procedure XIV. The crude material (94% yield). was carried forward without further purification. LC-MS(ES+): 480.2662 m / z [M+H].

[0465] Synthesis of I121:

[0466] Compound I121 was synthesized using General Procedure XV. The crude material (91% yield). was carried forward without further purification. LC-MS(ES+): 380.2138 m / z [M+H].

[0467] Synthesis of I122:

[0468] Compound I122 was synthesized using General Procedure XI at 50°C for 12 hours. The crude material was purified via flash chromatography (60% Ethyl acetate / hexanes) to afford the desired product (78% yield). LC-MS(ES+): 638.3142 m / z [M+H].

[0469] Synthesis of GLP-1R-SM-1058-p:

[0470] Compound GLP-1R-SM-1058 was synthesized using General Procedure XII. The crude material was purified via flash chromatography (6% MeOH / DCM) to afford the desired product (43% over two steps). LC-MS(ES+): 868.4512 m / z [M+H]. Scheme 29: Synthesis of GLP-1R-SM-1059-p

[0471] Reagents and conditions: (a) NaH, THF, 0°C-rt, 4h, 4.6%. (b) Pd(dppf)Cl2, K2CO3, 1,4-dioxane, 105°C, 18.5%. (c)TFA, DCM, 93%. (d) K2CO3, MeCN, 50°C, 12h, 32%. (e) 1 M 1,5,7-Triazabicyclo[4.4.0]-dec-5-ene(aq), MeCN followed by DIEA, COMU, azido- PEG4-amine, DCM, 42% over two steps.

[0472] Synthesis of I123:

[0473] Under a nitrogen atmosphere, a tetrahydrofuran solution (16 mL) of 3-fluoro-4- (hydroxymethyl)benzonitrile (4.48 g, 29.64 mmol) at 0°C was treated with NaH (60% w / w, 0.830g, 34.58 mmol) and the solution was allowed to warm to room temperature while stirring for 30 minutes. Then, a THF solution (4 mL) of 2,5-dibromothiazole (6.00 g, 24.70 mmol) was added at room temperature, and the mixture was stirred for 4 hours. The reaction mixture was cooled to 0°C, water was added, and the mixture was extracted 3 times with ethyl acetate. The organic layers were combined, dried over sodium sulfate, and concentrated under reduced pressure. The crude was purified via flash chromatography (10% ethyl acetate / hexanes) to afford I123 (0.356 g, 4.6% yield). LC-MS(ES+): 312.95 [M+H].

[0474] Synthesis of I124:

[0475] A oven dried 20 mL scintillation vial was charged with 4-(((5-bromothiazol-2- yl)oxy)methyl)-3-fluorobenzonitrile (I123, 1 g, 3.19 mmol) and tert-butyl 5-(4,4,5,5- tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydropyridine-1(2H)-carboxylate (0.987 g, 3.19 mmol) in 8 mL of 1,4-dioxane. This solution was sparged with nitrogen gas for 15 minutes. Then, K2CO3(0.905 g, 6.55 mmol), Pd(dppf)Cl2(0.117 g, 0.160 mmol), and water (1 mL) were added and the mixture was sparged with nitrogen again for 15 minutes. After, the mixture was allowed to stir at 105°C for 12 hours. Next, the mixture was filtered over celite and eluted with ethyl acetate. The filtrate was evaporated under reduced pressure and the crude was purified via flash chromatography (20% ethyl acetate / hexanes) to afford I124 as an off-white solid (0.246 g, 18.5% yield). LC-MS(ES+): 416.1444 [M+H].

[0476] Synthesis of I125:

[0477] Compound I124 (0.246 g, 0.5913 mmol) was dissolved in 1 mL methylene chloride, then 3 mL of trifluoroacetic acid was added. The mixture was stirred for 2 hours, then poured into saturated aqueous sodium bicarbonate. Once neutralized, the aqueous phase was extracted thrice with DCM (3x30 mL). The combined organics were dried over sodium sulfate and concentrated under reduced pressure to give I125 as an oil (0.246 g, 93% yield). LC-MS(ES+): 316.09 [M+H].

[0478] Synthesis of I126:

[0479] Compound I126 was synthesized using General Procedure XI at 50°C for 12 hours. The crude material was purified via flash chromatography (40% Ethyl acetate / hexanes) to afford the desired product (32% yield). LC-MS(ES+): 574.1924 m / z [M+H].

[0480] Synthesis of GLP-1R-SM-1059-p:

[0481] Compound GLP-1R-SM-1059 was synthesized using General Procedure XII. The crude material was purified via flash chromatography (4% MeOH / DCM) to afford the desired product (42% over two steps). LC-MS(ES+): 804.3303 m / z [M+H]. Scheme 30: Synthesis of GLP-1R-SM-1163-p, GLP-1R-SM-1158-p, GLP-1R-SM-1155-p

[0482] Reagents and conditions: (a) K2CO3, THF, 16h, 63%. (b) Pd / C, MeOH / THF, H2(g), 25%. (c) 2-chloro-1,1,1-trimethoxyethane, pTSA^H2O, MeCN, 50°C (d) K2CO3, MeCN, 12h, 73%. (e) 1 M 1,5,7-Triazabicyclo[4.4.0]-dec-5-ene(aq), MeCN followed by DIEA, COMU, azido-PEG4-amine, DCM, 25% over two steps. (f) TFA, DCM, 98% (g) TFA / DCM, 1h then pentane-2,4-dione, K2CO3, Pyridine, 50°C, 16h, 29% over two steps (h) 1 M 1,5,7-Triazabicyclo[4.4.0]-dec-5-ene(aq), MeCN followed by DIEA, COMU, azido-PEG4- amine, DCM, 30% over two steps.

[0483] Synthesis of I127:

[0484] Compound I127 was synthesized using General Procedure VIII. The crude material was purified via flash chromatography (30% ethyl acetate / hexanes) to afford the product as a white solid (63% yield). LC-MS(ES+): 482.75 m / z [M+H].

[0485] Synthesis of I128:

[0486] Compound I128 was synthesized using General Procedure IX. The product (25% yield) was carried forward without additional purification. LC-MS(ES+): 452.50m / z [M+H].

[0487] Synthesis of I129 and I130:

[0488] Compound I129 was synthesized using General Procedure X at 50°C. The crude material was carried forward without purification. Compound I130 was then synthesized using General Procedure XI. The crude material was purified via flash chromatography (70% Ethyl acetate / Hexanes) to afford the product as a white solid (68% yield over two steps). LC- MS(ES+): 572.86 [M+H]. LC-MS(ES+): 786.10 m / z [M+H].

[0489] Synthesis of GLP-1R-SM-1155-p:

[0490] GLP-1R-SM-1155 was synthesized using General Procedure XII. The crude material was purified via flash chromatography (7% MeOH / DCM) to afford the product (25% yield over two steps). LC-MS(ES+): 1016.04 m / z [M+H].

[0491] Synthesis of GLP-1R-SM-1163-p:

[0492] GLP-1R-SM-1163 was synthesized using General Procedure XVII to afford the product (97% yield over two steps). LC-MS(ES+): 815.76 m / z [M+H].

[0493] Synthesis of I131:

[0494] Compound I130 was dissolved in 1:1 TFA / DCM and stirred at room temperature for 1 hour. The volatiles were removed, and the crude material was dissolved in pyridine (0.2 M) and K2CO3(5 eq). This solution was placed under nitrogen atmosphere, then pentane-2,4- dione (5 eq) was added. The reaction was heated to 50°C for 16 hours. The volatiles were removed under reduced pressure and the crude material purified via flash chromatography(10% MeOH / DCM) to afford I131 (29% over two steps) as an orange oil. LC-MS(ES+): 649.78 m / z [M+H].

[0495] Synthesis of GLP-1R-SM-1158-p:

[0496] GLP-1R-SM-1158 was synthesized using General Procedure XII. The crude material was purified via flash chromatography (20% MeOH / DCM) to afford the product (30% yield over two steps). LC-MS(ES+): 880.56 m / z [M+H]. Scheme 31: Synthesis of GLP-1R-SM-1156-p

[0497] Reagents and conditions: (a) Pd(dppf)Cl2, K2CO3, 1,4-dioxane, 105°C, 34%. (b) TFA, DCM, 99%. (c) K2CO3, MeCN, 50oC, 12h, 95%. (d) 1 M 1,5,7-Triazabicyclo[4.4.0]- dec-5-ene(aq), MeCN followed by DIEA, COMU, azido-PEG4-amine, DCM, 30% over two steps.

[0498] Synthesis of I132:

[0499] Compound I132 was synthesized using General Procedure XIII. The crude material was purified via flash chromatography (27% ethyl acetate / hexanes) to afford the desired product (34% yield). LC-MS(ES+): 394.16 m / z [M+H].

[0500] Synthesis of I133:

[0501] Compound I133 was synthesized using General Procedure XV. The crude material (99% yield). was carried forward without further purification. LC-MS(ES+): 294.12 m / z [M+H].

[0502] Synthesis of I134:

[0503] Compound I134 was synthesized using General Procedure XI at 50°C for 12 hours. The crude material was purified via flash chromatography (20% MeOH / DCM) to afford the desired product (95% yield). LC-MS(ES+): 609.22 m / z [M+H].

[0504] Synthesis of GLP-1R-SM-1156-p:

[0505] Compound GLP-1R-SM-1156 was synthesized using General Procedure XII. The crude material was purified via flash chromatography (8% MeOH / DCM) to afford the desired product (30% over two steps). LC-MS(ES+): 838.92 m / z [M+H]. Scheme 32: Synthesis of GLP-1R-SM-1157-p

[0506] Reagents and conditions: (a) Pd(dppf)Cl2, K2CO3, 1,4-dioxane, 105°C, 82%. (b) 7.5% w / w Pd / C, H2, Ethyl acetate, 2h, 19%. (c)TFA, DCM, 99%. (d) K2CO3, MeCN, 50°C, 24h, 79%. (e) 1 M 1,5,7-Triazabicyclo[4.4.0]-dec-5-ene(aq), MeCN followed by DIEA, COMU, azido-PEG4-amine, DCM, 98% over two steps.

[0507] Synthesis of I135:

[0508] Compound I135 was synthesized using General Procedure XIII. The crude material was purified via flash chromatography (20% ethyl acetate / hexanes) to afford the desired product (82% yield). LC-MS(ES+): 424.52 m / z [M+H].

[0509] Synthesis of I136:

[0510] Compound I136 was synthesized using General Procedure XIV. The crude material was purified via flash chromatography (80% ethyl acetate / hexanes) to afford the desired product (19% yield). LC-MS(ES+): 426.56 m / z [M+H].

[0511] Synthesis of I137:

[0512] Compound I137 was synthesized using General Procedure XV. The crude material (99% yield). was carried forward without further purification. LC-MS(ES+): 326.47 m / z [M+H].

[0513] Synthesis of I138:

[0514] Compound I138 was synthesized using General Procedure XI at 50°C. The crude material was purified via flash chromatography (12% MeOH / DCM) to afford the desired product (79% yield). LC-MS(ES+): 584.74 m / z [M+H].

[0515] Synthesis of GLP-1R-SM-1157-p:

[0516] Compound GLP-1R-SM-1157 was synthesized using General Procedure XII. The crude material was purified via flash chromatography (7% MeOH / DCM) to afford the desired product (98% over two steps). LC-MS(ES+): 814.91 m / z [M+H]. Scheme 33. Synthesis of GLP-1R-SM-1159-p

[0517] Reagents and conditions: (a) TEA, MeOH, 50°C, 16h, 99%. (b) 10% w / w Pd / C, H2(g), MeOH / THF, 99%. (c) 2-chloro-1,1,1-trimethoxyethane, (pTSA ^ H2O) , MeCN, 50oC, 70%. (d) K2CO3, MeCN, 50°C, 2h, 88%. (e) 1 M 1,5,7-Triazabicyclo[4.4.0]-dec-5- ene(aq), MeCN followed by DIEA, COMU, azido-PEG4-amine, DCM, 25% over two steps.

[0518] Synthesis of I139:

[0519] Compound I139 was synthesized using General Procedure VIII, with heating to 50°C for 16 hours. The crude material was purified via flash chromatography (19% MeOH / DCM) to afford the product as a light yellow solid (99% yield). LC-MS(ES+): 301.38 m / z [M+H].

[0520] Synthesis of I140:

[0521] Compound I140 was synthesized using General Procedure IX. The brown solid product (99% yield) was carried forward without additional purification. LC-MS(ES+): 271.30 m / z [M+H].

[0522] Synthesis of I141:

[0523] Compound I141 was synthesized using General Procedure X at 50°C. The crude material was purified via flash chromatography (20% MeOH / DCM) to afford the product (70% yield). LC-MS(ES+): 328.99 m / z [M+H].

[0524] Synthesis of I142:

[0525] Compound I142 was synthesized using General Procedure XI. The crude material was purified via flash chromatography (18% MeOH / DCM) to afford the product (88% yield). LC-MS(ES+): 604.33 m / z [M+H].

[0526] Synthesis of GLP-1R-SM-1159-p:

[0527] GLP-1R-SM-1159 was synthesized using General Procedure XII. The crude material was purified via flash chromatography (20% MeOH / DCM) to afford the product as a white solid (25% yield over two steps). LC-MS(ES+): 834.71 m / z [M+H]. Scheme 34: Synthesis of GLP-1R-SM-1160-p

[0528] Reagents and Conditions: (a) AcOH, 40°C, 75% (b) DIEA, MeCN, 87°C, 49%. (c) 1 M 1,5,7-Triazabicyclo[4.4.0]-dec-5-ene(aq), MeCN followed by DIEA, COMU, azido- PEG4-amine, DCM, 51% over two steps.

[0529] Synthesis of I143:

[0530] To a solution of ethyl 4-amino-3-((2-(S-methylsulfonimidoyl)ethyl)amino)benzoate (compound I57, 0.577g, 2.23 mmol) in glacial acetic acid (9.2 mL) was added methyl 2,2,2- trichloroacetimidate (0.469 g, 2.66 mmol). The solution was heated to 40oC and stirred for 10 minutes. The volatiles were removed under reduced pressure and the crude material dissolved in ethyl acetate and washed with aqueous saturated sodium bicarbonate. The organic layers were dried over sodium sulfate and the volatiles removed under reduced pressure. The crude material was purified via flash chromatography (90% ethyl acetate / hexanes) to obtain the product I143 as a light yellow solid (0.629 g, 75% yield). LC-MS(ES+): 398.10 [M+H].

[0531] Synthesis of I144:

[0532] To a stirring solution of methyl 1-(2-(S-methylsulfonimidoyl)ethyl)-2- (trichloromethyl)-1H-benzo[d]imidazole-6-carboxylate (compound I143, 0.100 g, 0.251 mmol) and 3-fluoro-4-(((6-(piperidin-4-yl)pyridin-2-yl)oxy)methyl)benzonitrile1 (compound A11, 0.234 g, 0.754 mmol, see note 1 below) in MeCN (10 mL) was added N,N- diisopropylethylamine (0.44 mL, 2.51 mmol). The solution was heated to 87oC and stirred for 16 hours. An additional 5 equivalents of N,N-diisopropylethylamine were added and the reaction continued stirring for an additional 24 hours at 87oC. Volatiles were removed under reduced pressure and the crude material purified via flash chromatography (4% MeOH / DCM) to obtain the product I144 as a light brown solid (0.075 g, 49% yield). LC-MS(ES+): 619.21 [M+H].

[0533] Synthesis of GLP-1R-SM-1160-p:

[0534] To a solution of methyl 2-(4-(6-((4-cyano-2-fluorobenzyl)oxy)pyridin-2- yl)piperidine-1-carbonyl)-1-(2-(S-methylsulfonimidoyl)ethyl)-1H-benzo[d]imidazole-6- carboxylate (compound I144, 1.07 g, 1.725 mmol) in MeCN (17.3 mL) was added a 0.97 M aqueous solution of 1,5,7-Triazabicyclo[4.4.0]-dec-5-ene (10.35 mL, 10.35 mmol). The solution stirred for 3 hours. The acidity of the solution was adjusted to pH = 4 using 1 M HCl, then washed three times with ethyl acetate. The organic layers were combined and dried over sodium sulfate. The volatiles were removed, then the crude material was dissolved in methylene chloride (17.3 mL). COMU (1.26 g, 2.93 mmol) and DIEA (1.5 mL, 8.62 mmol) were added, and the reaction stirred for 15 minutes, followed by addition of azido-PEG4- amine (0.679 g, 2.59 mmol). The reaction was stirred for 2 hours, then the volatiles wereremoved under reduced pressure. The crude material was purified via flash chromatography on silica gel (4% MeOH / DCM) to afford GLP-1R-SM-1160 (0.744 g, 51% yield over two steps). LC-MS(ES+): 849.36 [M+H]. Scheme 35. Synthesis of GLP-1R-SM-1161-p

[0535] Reagents and conditions: (a) K2CO3, THF, 60oC, 16h, 81%. (b) 10% w / w Pd / C, H2(g), MeOH / THF, 88%. (c) 2-chloro-1,1,1-trimethoxyethane, (pTSA ^ H2O) , MeCN, 60°C, 64%. (d) K2CO3, MeCN, 50°C, 12h, 30%. (e) 1 M 1,5,7-Triazabicyclo[4.4.0]-dec-5-ene(aq), MeCN followed by DIEA, COMU, azido-PEG4-amine, DCM, 37% over two steps.

[0536] Synthesis of I145:

[0537] Compound I145 was synthesized using General Procedure VIII, with heating to 60oC for 16 hours. The crude material was purified via precipitation following the addition of water to the reaction mixture to afford the product (99% yield). LC-MS(ES+): 303.0650 m / z [M+H].

[0538] Synthesis of I146:

[0539] Compound I146 was synthesized using General Procedure IX. The solid product (88% yield) was carried forward without additional purification. LC-MS(ES+): 273.0909 m / z [M+H].

[0540] Synthesis of I147:

[0541] Compound I147 was synthesized using General Procedure X at 60oC. The crude material was purified via flash chromatography (60% Ethyl acetate / hexanes) to afford the product (64% yield). LC-MS(ES+): 331.0519 m / z [M+H].

[0542] Synthesis of I148:

[0543] Compound I148 was synthesized using General Procedure XI. The crude material was purified via flash chromatography (70% Ethyl acetate / hexanes) to afford the product (30% yield). LC-MS(ES+): 606.2168 m / z [M+H].

[0544] Synthesis of GLP-1R-SM-1161-p:

[0545] GLP-1R-SM-1161 was synthesized using General Procedure XII. The crude material was purified via flash chromatography (9% MeOH / DCM) to afford the product as a white solid (37% yield over two steps). LC-MS(ES+): 836.87 m / z [M+H]. S

[0546] Reagents and conditions: (a) K2CO3, THF, 60°C, 12h, 76%. (b) 10% w / w Pd / C, H2(g), MeOH / THF, 90%. (c) 2-chloro-1,1,1-trimethoxyethane, (pTSA ^ H2O), MeCN, 60°C, 44%. (d) K2CO3, MeCN, 50°C, 12h, 33%. (e) 1 M 1,5,7-Triazabicyclo[4.4.0]-dec-5-ene(aq), MeCN followed by DIEA, COMU, azido-PEG4-amine, DCM, 19% over two steps.

[0547] Synthesis of I149:

[0548] Compound I149 was synthesized using General Procedure VIII, with heating to 60°C for 12 hours. The crude material was caried forward without further purification (76% yield). LC-MS(ES+): 328.0967 m / z [M+H].

[0549] Synthesis of I150:

[0550] Compound I150 was synthesized using General Procedure IX. The solid product (90% yield) was carried forward without additional purification. LC-MS(ES+): 298.1225 m / z [M+H].

[0551] Synthesis of I151:

[0552] Compound I151 was synthesized using General Procedure X at 60°C. The crude material was purified via flash chromatography (4% MeOH / DCM) to afford the product (44% yield). LC-MS(ES+): 356.0835 m / z [M+H].

[0553] Synthesis of I152:

[0554] Compound I152 was synthesized using General Procedure XI at 50°C. The crude material was purified via flash chromatography (4% MeOH / DCM) to afford the product (33% yield). LC-MS(ES+): 631.2502 m / z [M+H].

[0555] Synthesis of GLP-1R-SM-1162-p:

[0556] GLP-1R-SM-1162 was synthesized using General Procedure XII. The crude material was purified via flash chromatography (12% MeOH / DCM) to afford the product as a white solid (19% yield over two steps). LC-MS(ES+): 861.61 m / z [M+H]. Scheme 37. Synthesis of GLP-1R-SM-1164-p

[0557] Reagents and conditions: (a) methanesulfonamide, AD-mix-α, t-BuOH, H2O, 78%. (b) NaH, CH2Br2, DMF, 0°C, 2h, 72%. (c) KOtBu, 1,4 dioxane, rt-40oC followed by TFA / DCM, 69% over two steps. (d) K2CO3, MeCN, 50°C, 3h, 85%. (e) 1 M 1,5,7- Triazabicyclo[4.4.0]-dec-5-ene(aq), MeCN followed by DIEA, COMU, azido-PEG4-amine, DCM, 57% over two steps.

[0558] Synthesis of I153:

[0559] A biphasic mixture of AD-mix-α (1.40 g, 1.796 mmol), methanesulfonamide (0.085 g, 0.898 mmol) in 1:1 H2O / t-butanol (6 mL) was stirred for 10 minutes at room temperature, then cooled to 0oC. Tert-butyl 6-fluoro-3',6'-dihydro-[2,4'-bipyridine]-1'(2'H)-carboxylate (0.250 g, 0.898 mmol) was added to the mixture. The mixture was allowed to warm to room temperature and was vigorously stirred for 72 hours. Solid sodium sulfite was added, and the mixture stirred an additional hour. The t-butanol was removed under reduced pressure and the water layer extracted three times with ethyl acetate. The combined organic layers were washed with 1 M NaOH, then dried over sodium sulfate. The volatiles were removed under reduced pressure and the crude material purified via flash chromatography (65% ethyl acetate / hexanes) to afford tert-butyl (3S,4S)-4-(6-fluoropyridin-2-yl)-3,4-dihydroxypiperidine-1-carboxylate (I153, 0.219 g, 78% yield) as a colorless oil. LC- MS(ES+): 256.33 [M-tBu].

[0560] Synthesis of I154:

[0561] A stirred solution of tert-butyl (3S,4S)-4-(6-fluoropyridin-2-yl)-3,4- dihydroxypiperidine-1-carboxylate (I153, 0.215 g, 0.688 mmol) in dimethylformamide (3.5 mL) was cooled to 0oC. Sodium hydride (60% w / w, 0.099 g, 4.13 mmol) was added portion- wise over 10 minutes and the suspension was allowed to stir for 10 minutes. Then dibromomethane (0.287 mL, 4.13 mmol) was added dropwise over 10 minutes, then the reaction mixture was allowed to warm to room temperature. After stirring for two hours, the reaction was poured over ice, then the aqueous solution was extracted with ethyl acetate and the organic layers dried over sodium sulfate. The volatiles were removed under reduced pressure and the crude material purified via flash chromatography (55% ethyl acetate / hexanes) to afford tert-butyl (3aS,7aS)-7a-(6-fluoropyridin-2-yl)tetrahydro-[1,3]dioxolo[4,5- c]pyridine-5(4H)-carboxylate (I154, 0.160 g, 72% yield). LC-MS(ES+): 269.09 [M-tBu]

[0562] Synthesis of I155:

[0563] To a stirred solution of 3-fluoro-4-(hydroxymethyl)benzonitrile (0.117 g, 0.771 mmol) in 1,4 dioxane (1.5 mL) was added potassium tert-butoxide (0.088 mg, 0.786 mmol). The reaction stirred for 10 minutes, then tert-butyl (3aS,7aS)-7a-(6-fluoropyridin-2- yl)tetrahydro-[1,3]dioxolo[4,5-c]pyridine-5(4H)-carboxylate (I154, 0.050 g, 0.154 mmol) was added in 0.5 mL 1,4-dioxane dropwise over 5 minutes. After stirring for an additional 15 minutes, the reaction was heated to 40°C for 3 hours. The reaction mixture was diluted with water and ethyl acetate and the layers were separated. The aqueous layer was extracted with ethyl acetate twice more. The organic layers were dried over sodium sulfate and the volatiles removed under reduced pressure. The crude material was purified via flash chromatography (1:1 ethyl acetate / hexanes) to afford tert-butyl (3aS,7aS)-7a-(6-((4-cyano-2- fluorobenzyl)oxy)pyridin-2-yl)tetrahydro-[1,3]dioxolo[4,5-c]pyridine-5(4H)-carboxylate (0.049 g, 70% yield). LC-MS(ES+): 400.40 [M-tBu]. The material was then dissolved in 1:1 dichloromethane / trifluoroacetic acid and stirred for 2 hours. The volatiles were removed and the material was used without further purification (I155, 0.051 g, 69% yield over two steps). LC-MS(ES+): 355.87 [M+1].

[0564] Synthesis of I156:

[0565] Compound I156 was synthesized using General Procedure XI at 50°C for 3 hours. The crude material was purified via flash chromatography (100% Ethyl acetate) to afford the product (85% yield). LC-MS(ES+): 614.62 m / z [M+H].

[0566] Synthesis of GLP-1R-SM-1164-p:

[0567] GLP-1R-SM-1164 was synthesized using General Procedure XII. The crude material was purified via flash chromatography (10% MeOH / DCM) to afford the product as a white solid (57% yield over two steps). LC-MS(ES+): 844.88 m / z [M+H]. Scheme 38. Synthesis of GLP-1R-SM-1165-p

[0568] Reagents and conditions: (a) methanesulfonamide, AD-mix-β, t-BuOH, H2O, 78%. (b) NaH, CH2Br2, DMF, 0°C, 2h, 68%. (c) KOtBu, 1,4 dioxane, rt-40°C followed by TFA / DCM, 77% over two steps. (d) K2CO3, MeCN, 50°C, 3h, 67%. (e) 1 M 1,5,7- Triazabicyclo[4.4.0]-dec-5-ene(aq), MeCN followed by DIEA, COMU, azido-PEG4-amine, DCM, 43% over two steps.

[0569] Synthesis of I157:

[0570] Compound I157 was synthesized in identical manner to I153, except with AD-mix-β (78% yield). LC-MS(ES+): 256.33 [M-tBu].

[0571] Synthesis of I158:

[0572] Compound I158 was synthesized in identical manner to I154 using I157 as the starting material. (68% yield). LC-MS(ES+): 269.21 [M-tBu].

[0573] Synthesis of I159:

[0574] Compound I159 was synthesized in identical manner to I155 using I158 as the starting material. (77% yield over two steps). LC-MS(ES+): 355.72 [M+1].

[0575] Synthesis of I160:

[0576] Compound I160 was synthesized in identical manner to I156 using I159 as the starting material. (67% yield) LC-MS(ES+): 614.80 [M+1].

[0577] Synthesis of GLP-1R-SM-1165:

[0578] Compound GLP-1R-SM-1165 was synthesized in identical manner to GLP-1R-SM- 1164 using I160 as the starting material. (43% yield over two steps) LC-MS(ES+): 844.88 [M+1]. Scheme 39: Synthesis of GLP-1R-SM-1286-p

[0579] Reagents and Conditions: (a) K2CO3, MeCN, 50°C, 34%. (b) 1 M 1,5,7- Triazabicyclo[4.4.0]-dec-5-ene(aq), MeCN followed by DIEA, COMU, azido-PEG4-amine, DCM, 60% over two steps.

[0580] Synthesis of I161:

[0581] Compound I161 was synthesized using General Procedure XI. The product was purified via flash chromatography (8% MeOH / DCM) to afford the product (34% yield) as a yellow solid. LC-MS(ES+): 609.1754 [M+H].

[0582] Synthesis of GLP-1R-SM-1286-p:

[0583] GLP-1R-SM-1286 was synthesized using General Procedure XII. The product was purified via flash chromatography (18% MeOH / DCM) to afford the product (60% yield over two steps) as a light yellow solid. MS(ES+): 839.52 [M+H]. Scheme 40: Synthesis of GLP-1R-SM-1295-p

[0584] Reagents and Conditions: (a) DIEA, MeCN, 87°C, 37%. (c) 1 M 1,5,7- Triazabicyclo[4.4.0]-dec-5-ene(aq), MeCN followed by DIEA, COMU, azido-PEG4-amine, DCM, 40% over two steps.

[0585] Synthesis of I162:

[0586] To a stirred solution of methyl 1-(2-(S-methylsulfonimidoyl)ethyl)-2- (trichloromethyl)-1H-benzo[d]imidazole-6-carboxylate (compound I147, 0.100 g, 0.251 mmol) and 3-fluoro-4-(((5-(1,2,3,6-tetrahydropyridin-4-yl)thiazol-2- yl)oxy)methyl)benzonitrile (compound I125, 0.237 g, 0.752 mmol) in MeCN (11 mL) was added N,N-diisopropylethylamine (0.44 mL, 2.51 mmol). The solution was heated to 87oC and stirred for 16 hours. An additional 5 equivalents of N,N-diisopropylethylamine were added and the reaction continued for an additional 24 hours. Volatiles were removed under reduced pressure and the crude material purified via flash chromatography (4% MeOH / DCM) to obtain the product as a light brown solid (0.057 g, 37% yield). LC-MS(ES+): 623.15 [M+H].

[0587] Synthesis of GLP-1R-SM-1295-p:

[0588] To a solution of methyl 2-(4-(2-((4-cyano-2-fluorobenzyl)oxy)thiazol-5-yl)-1,2,3,6- tetrahydropyridine-1-carbonyl)-1-(2-(S-methylsulfonimidoyl)ethyl)-1H-benzo[d]imidazole-6- carboxylate (compound I162, 0.090 g, 0.145 mmol) in MeCN (1.45 mL) was added a 0.97 M aqueous solution of 1,5,7-Triazabicyclo[4.4.0]-dec-5-ene (0.867 mL, 0.867 mmol). The solution stirred for 3 hours. The acidity of the solution was adjusted to pH = 4 using 1 M HCl, then extracted three times with ethyl acetate. The organic layers were combined and dried over sodium sulfate. The volatiles were removed, then the crude material was dissolved in methylene chloride (1.45 mL). COMU (0.105 g, 0.246 mmol) and DIEA (0.13 mL, 0.723 mmol) were added, and the reaction stirred for 15 minutes, followed by addition of azido- PEG4-amine (0.057 g, 0.217 mmol). The reaction was stirred for 2 hours, then the volatiles were removed under reduced pressure. The crude material was purified via flash chromatography on silica gel (14% MeOH / DCM) to afford GLP-1R-SM-1295 (0.0597 g, 40% yield over two steps). Example 4. Synthesis of Lipids

[0589] If lipids described herein are not included in Example 4, it is to be assumed that the compounds are commercially available or may be readily obtained by contracting with standard commercial manufacturers. For example, LP-183-p and LP-396-p were purchased commercially. Scheme 41. Synthesis of LP-161-p

[0590] Reagents and Conditions: (a) MeI, TEA, THF, rt, 2 h, 97%. (b) K2CO3, ACN, 85ºC, 12 h, 73%. (c) TFA: DCM (3:1), rt, 1 h, 94%. (d) TEA, DCM, rt, 12 h, 57%. (e) mCPBA, DCM, rt, 12 h, 76%.

[0591] Synthesis of I9:

[0592] To a solution of 4-(5-mercapto-1,3,4-oxadiazol-2-yl)phenol (1 eq) in anhydrous THF (0.2 M) was added TEA (1.2 eq) and MeI (1.1 eq) at 0°C under N2gas. The mixture was allowed to warm to room temperature and stirred for 2 hours. After, the reaction was diluted with water (50 mL) and extracted thrice with ethyl acetate (3 x 50 mL). The combined organics were dried over Na2SO4and concentrated under reduced pressure. Product was obtained as an off-white solid by trituration with Et2O in 97% yield. LC-MS [M+H]+ 209.0385 m / z, observed 209.0389.

[0593] Synthesis of I10:

[0594] I10 was synthesized from I9 and N-Boc-PEG3-bromide following General Procedure II. The product was purified using hexanes: ethyl acetate (50:50) to give product as an oil in 73% yield. LC-MS [M+H]+ 484.2117 m / z, observed 484.2122.

[0595] Synthesis of I11:

[0596] I11 was synthesized from I10 following General Procedure V to give product as an oil in 94% yield. LC-MS [M+H]+ 384.1593 m / z, observed 384.1585.

[0597] Synthesis of I12:

[0598] I12 was synthesized from I11 & Palmitoyl chloride following General Procedure III. The product was purified using hexanes: ethyl acetate (30:70) to give product as an oil in 57% yield. LC-MS [M+H]+ 622.3890 m / z, observed 622.3884.

[0599] Synthesis of LP-161-p:

[0600] LP-161 was synthesized from I12 following General Procedure IV. The product was synthesized using DCM: MeOH (96:4) to give an off-white solid in 76% yield. LC-MS [M+H]+ 654.3788 m / z, observed 654.3785. Scheme 42. Synthesis of LP-194-p

[0601] Reagents and Conditions: (a) COMU, DIPEA, DCM, rt, 2 h, 44%. (b) 25% piperidine in DMF. Rt.1 h, 90%. (c) COMU, DIPEA, DCM, rt, 2 h, 54%. (d) TFA: DCM (3:1), rt, 1 h, 96%.

[0602] Synthesis of E4:

[0603] E4 was synthesized following General Procedure I. The compound was purified using hexanes: ethyl acetate (80:20) to give product as an oil in 44% yield. LC-MS [M+H]+ 576.2710 m / z, observed 576.2709 m / z.

[0604] Synthesis of E5:

[0605] E5 was synthesized from E4 following General Procedure VII. The compound was purified using DCM: MeOH (96:4) to give product as an oil in 90% yield. LC-MS [M+H]+ 354.2029 m / z, observed 354.2030 m / z.

[0606] Synthesis of E6:

[0607] E6 was synthesized from E5 and 18-(tert-butoxy)-18-oxooctadecanoic acid following General Procedure I. The compound was purified using DCM: MeOH (96:4) to give product as an oil in 54% yield. LC-MS [M+H]+ 706.5006 m / z, observed 706.5008 m / z. S

[0608] To a 40 mL vial with stir bar and under N2 was added N-(2-aminospiro[3.3]hept-6- yl)carbamic acid tert-butyl ester (350 mg, 1.55 mmol), DCM (10 mL), and triethylamine (0.65 mL, 4.65 mmol). The reaction was stirred and cooled in an ice bath for 10 min and then palmitoyl chloride (0.51 mL, 1.7 mmol) was added dropwise over 30 seconds. A whiteprecipitate immediately formed, and the reaction was stirred on ice for 10 minutes. The ice bath was removed and the reaction was stirred overnight, warming to room temperature. TLC (ninhydrin) confirmed reaction completion. The reaction was dry loaded with silica onto a 24 g silica gel column and purified with flash chromatography (EtOAc / hexanes, 0-70% over 35 min, ELS detection). After this duration, the column was flushed with 20% MeOH / DCM to expedite elution of product. Fractions were pooled and concentrated under reduced pressure to give 1 (602 mg) as a white solid in 84% yield. LC / MS (ESI+) calculated m / z 464.40 (M), found 465.64 (M + H+).

[0609] To a 40 mL vial with stir bar was added intermediate 1 (165 mg, 0.355 mmol) and 4 M HCl in dioxanes (30 mL, 128.8 mmol). The vial was tightly capped and stirred for 2 h. The reaction immediately turned orange and then a white precipitate formed within 10 minutes. Reaction completion was confirmed by LCMS. The reaction was concentrated under reduced pressure, azeotroped with PhMe (5 mL), and dried overnight to give 2 (142 mg) as a white solid HCl salt in quantitative yield. Intermediate 2 (142 mg, 0.354 mmol) was suspended in DCM (10 mL) and triethylamine (0.15 mL, 1.06) and stir bar were added. NHS-PEG2- NHBoc (145 mg) was added last and the reaction was stirred for 2 h under N2. Reaction completion was confirmed by LCMS. The reaction was diluted with DCM and washed with saturated NaHCO3 (x 2), brine, dried over MgSO4, filtered, and concentrated under reduced pressure to give crude material that was dissolved in DCM (8 mL) and dry loaded onto a 12 g silica column and purified with flash chromatography (MeOH / DCM 0-5%, ELS detection) to give intermediate 3 (172 mg) as a white solid in 78% yield. LC / MS (ESI+) calculated m / z 623.49 (M), found 624.78 (M + H+).

[0610] Intermediate 3 (170 mg, 0.272 mmol) was stirred in 4 M HCl in dioxane (7 mL, 27.2 mmol) in a sealed RB flask for 2 h. LCMS confirmed reaction completion. The reaction was concentrated under reduced pressure, azeotroped with PhMe (5 mL), and dried overnight to give 4 (154 mg) as a white solid HCl salt in quantitative yield. LC / MS (ESI+) calculated m / z 523.43 (M), found 524.60 (M + H+).

[0611] To an oven dried 40 mL with stir bar and under N2 was added intermediate 4 (75 mg, 0.135 mmol), sieve dried THF (3 mL), and triethylamine (0.12 mL, 0.815 mmol).2,3,4,5,6- Pentafluorophenyl 4-[5-(methylsulfonyl)-1,3,4-oxadiazol-2-yl]benzoateSulfone (71 mg, 0.0163 mmol) was added and the reaction was stirred for 2 h. The reaction slowly became very heterogeneous. A small aliquot was taken, diluted with MeCN, and analyzed with LCMS to confirm reaction completion. The reaction was dry loaded with celite onto a 12 g silica gel column and purified with flash chromatography (MeOH / DCM 0-8% over 45 min,ELS detection) to give LP-361-p (52 mg) as a white solid in 52% yield. LC / MS (ESI+) calculated m / z 773.44 (M), found 775.11 (M + H+). Scheme 44. Synthesis of LP-371-p

[0612] Compound 1 (palmitic acid, 2.50 g) was dissolved in 60 mL DMF. Then TBTU (3.44 g) and DIPEA (6.9 mL) were added. The reaction was stirred for 10 minutes then compound 2 (2.66 g in DMF) was added. The reaction was complete after 1 hour. The mixture was diluted with 300 mL EtOAc and washed with 3% citric acid (3x60 mL), H2O (2x60 mL), and NaCl (1x60 mL), then dried over Na2SO4. The product was filtered and concentrated on rotary evaporator and high vacuum. The product was purified using column chromatography (loaded in DCM (15 mL) with a drop of MeOH onto a 80G RediSep Gold Rf column, mobile phase MeOH / DCM, 0-5% over 30 minutes. Yield 4.094 g. LC-MS: calculated [M+H] 486.74, found 488.11.

[0613] Compound 1 (4.094 g) was dissolved in 4M HCl in dioxane (28 mL) at 0°C for 10 minutes. The reaction was allowed to warm to room temperature then stirred for 2 hours. The product was concentrated on rotary evaporator and high vacuum. Yield 3.485 g. LC-MS: calculated [M+H] 386.57, found 388.02.

[0614] Compound 1 (2.3 g) was dissolved in 80 mL THF. Then TEA (4.975 mL) and compound 2 (3.10 g) were added. The reaction was stirred for 1 hour. The reaction was dry loaded with Celite 545, the mixture was concentrated in a 28°C water bath and placed on high vacuum to fully dry. The product was purified with flash chromatography (MeOH / DCM, 0-6% over 40 min.) Yield 2.905 g. LC-MS: calculated [M+H] 636.85, found 637.95. S

[0615] Reagents and Conditions: (a) K2CO3, ACN, 85ºC, 12 h, 73%. (b) TFA: DCM (3:1), rt, 1 h, 94%. (c) TEA, DCM, rt, 12 h, 57%. (d) mCPBA, DCM, rt, 12 h, 76%.

[0616] Synthesis of I13:

[0617] I13 was synthesized from I9 and tert-butyl (2-bromoethyl)carbamate following General Procedure II. The product was purified using hexanes: ethyl acetate (70:30) to give product as an oil in 73%. LC-MS [M+H]+ 352.1331 m / z, observed 352.1328.

[0618] Synthesis of I14:

[0619] I14 was synthesized from I13 following General Procedure V to give product as an oil in 94% yield. LC-MS [M+H]+ 252.0806 m / z, observed 252.0808.

[0620] Synthesis of I15:

[0621] I15 was synthesized from I14 & Cholesteryl chloride following General Procedure III. The product was purified using DCM: MeOH (98:2) to give product as an off-white solid in 57% yield. LC-MS [M+H]+ 664.4148 m / z, observed 664.4147.

[0622] Synthesis of LP-204-p:

[0623] LP-204 was synthesized from I15 following General Procedure IV. Product was purified using DCM: MeOH (96:4) to give an off-white solid in 76% yield. LC-MS [M+H]+ 696.4046 m / z, observed 696.4045. Scheme 46. Synthesis of LP-209-p

[0624] Reagents and Conditions: (a) TEA, DCM, rt, 12 h, 56% (b) mCPBA, DCM, rt, 12 h, 69%.

[0625] Synthesis of I16:

[0626] I16 was synthesized from I14 & Palmitoyl chloride following General Procedure III. The product was purified using hexanes: ethyl acetate (80:20) to give an off-white solid in 56% yield. LC-MS [M+H]+ 490.3103 m / z, observed 490.3100.

[0627] Synthesis of LP-209:

[0628] LP-209 was synthesized from I16 following General Procedure IV. The product was purified using DCM: MeOH (98:2) to give an off-white solid in 69% yield. LC-MS [M+H]+ 522.3002 m / z, observed 522.3001. Scheme 47. Synthesis of LP-389-p

[0629] Reagents and Conditions: (a) COMU, DIPEA, DCM, rt, 2 h, 47% (b) TFA: DCM (3:1), rt, 1 h, 93%.

[0630] Synthesis of E10:

[0631] E10 was synthesized from E5 and 11-(4-(tert-butoxycarbonyl)phenoxy)undecanoic acid following General Procedure I. Product was obtained using DCM: MeOH (98:2) to give an oil in 47% yield. LC-MS [M+H]+ 714.4330 m / z, observed 714.4329.

[0632] Synthesis of LP389-p:

[0633] LP389-p was synthesized from E10 following General Procedure V to give product as an off-white solid in 93% yield. LC-MS [M+H]+ 602.3077 m / z, observed 602.3079. Scheme 48. Synthesis of LP-400-p

[0634] Reagents and Conditions: (a) TEA, THF, rt, 3 h, 63%

[0635] Synthesis of LP-400-p:

[0636] LP-400 was synthesized from Sulfone TFP Ester and hexadecan-1-amine following General Procedure III. The product was obtained using DCM: MeOH (98:2) to give an off- white solid in 63% yield. LC-MS [M+H]+ 492.2896 m / z, observed 492.2897. Scheme 49. Synthesis of LP-415-p

[0637] Reagents and Conditions: (a) TEA, THF, rt, 12 h, 54%. (b) TFA: DCM (3:1), rt, 1 h, 95%. (c) TEA, THF, rt, 3 h, 41%.

[0638] Synthesis of I23:

[0639] I23 was synthesized from Sulfone TFP Ester and N-Boc-Amino-PEG3-Amine following General Procedure III. The product was isolated using DCM: MeOH (96:4) to give an oil in 54% yield. LC-MS [M+H]+ 543.2125 m / z, observed 543.2124.

[0640] Synthesis of I24:

[0641] I24 was synthesized from I23 following General Procedure V to give product as an oil in 95% yield. LC-MS [M+H]+ 443.1600 m / z, observed 443.1603.

[0642] Synthesis of LP-415:

[0643] LP-415 was synthesized from I25 & Cholesteryl chloride following General Procedure III. The product was isolated using DCM: MeOH (96:4) to give an off-white solid in 41% yield. LC-MS [M+H]+ 855.4942 m / z, observed 855.4941. Scheme 50. Synthesis of LP-416-p

[0644] Reagents and Conditions: (a) TEA, THF, rt, 3 h, 53%.

[0645] Synthesis of LP-416-p:

[0646] LP416-p was synthesized from I24 & palmitoyl chloride following General Procedure III. The product was isolated using DCM: MeOH (96:4) to give an off-white solid in 53% yield. LC-MS [M+H]+ 695.4054 m / z, observed 695.4052. Scheme 51. Synthesis of LP-476-p

[0647] Reagents and Conditions: (a) TEA, THF, rt, 3 h, 84%

[0648] Synthesis of LP-476-p:

[0649] LP-473 was synthesized from Amino-PEG4-Azide and palmitoyl chloride following General Procedure III. Product was isolated using DCM: MeOH (96:4) to give an off-white solid in 84% yield. LC-MS [M+H]+ 501.4016 m / z, observed 501.4015. Scheme 52. Synthesis of LP-477-p

[0650] Reagents and Conditions: (a) NaN3, DMF, 60ºC, 12 h, 62%

[0651] Synthesis of LP-477-p:

[0652] To a round bottom flask containing 1-bromohexadecane (1 eq) in DMF (0.2 M) was added sodium azide (1.22 eq). The reaction was stirred at 60°C for 12 hours. After, the reaction was allowed to cool to room temperature and poured into cold water (20 mL). This solution was extracted thrice with ethyl acetate (3 x 30 mL). The combined organics were washed once with water (10 mL), once with brine (10 mL), dried over Na2SO4, and concentrated under reduced pressure to give product as an oil in 84% yield. LC-MS [M+H]+ 268.2753 m / z, observed 268.2758. Scheme 53. Synthesis of LP-481-p

[0653] Reagents and Conditions: (a) COMU, DIPEA, DCM, rt, 2 h, 61% (b) TFA: DCM (3:1), rt, 1 h, 95%. (c) TEA, DCM, rt, 12 h, 39%. (d) mCPBA, DCM, rt, 12 h, 81%.

[0654] Synthesis of I23:

[0655] I23 was synthesized from I11 and 6-((tert-butoxycarbonyl)amino)spiro[3.3]heptane-2- carboxylic acid following General Procedure I. Product was isolated using hexanes: ethyl acetate (70:30) to give an oil in 61% yield. LC-MS [M+H]+ 621.2958 m / z, observed 621.2960.

[0656] Synthesis of I24:

[0657] I24 was synthesized from I23 following General Procedure V to give product as an oil in 95% yield. LC-MS [M+H]+ 521.2434 m / z, observed 521.2433.

[0658] Synthesis of I25:

[0659] I25 was synthesized from I24 and palmitoyl chloride following General Procedure III. The product was isolated using DCM: MeOH (96:4) to give an oil in 39% yield. LC-MS [M+H]+ 759.4730 m / z, observed 759.4732. Synthesis of LP-481-p:

[0660] LP-481 was synthesized from I25 following General Procedure IV. Product was isolated using DCM: MeOH (96:4) to give an off-white solid in 81% yield. LC-MS [M+H]+ 791.4629 m / z, observed 791.4628. Scheme 54. Synthesis of LP-482-pHReagents and Conditions: (a) COMU, DIPEA, DCM, rt, 2 h, 58% (b) TFA: DCM (3:1), rt, 1 h, 95%. (c) TEA, DCM, rt, 12 h, 44%. (d) mCPBA, DCM, rt, 12 h, 76%.

[0661] Synthesis of I26:

[0662] I26 was synthesized from I11 and 3-((tert- butoxycarbonyl)amino)bicyclo[1.1.1]pentane-1-carboxylic acid following General Procedure I. Product was isolated using hexanes: ethyl acetate (70:30) to give an oil in 58% yield. LC- MS [M+H]+ 593.2645 m / z, observed 593.2642.

[0663] Synthesis of I27:

[0664] I27 was synthesized from I26 following General Procedure V to give product as an oil in 95% yield. LC-MS [M+H]+ 493.2121 m / z, observed 493.2120.

[0665] Synthesis of I28:

[0666] I28 was synthesized from I27 and palmitoyl chloride following General Procedure III. The product was isolated using DCM: MeOH (96:4) to give an oil in 44% yield. LC-MS [M+H]+ 731.4417 m / z, observed 731.4419.

[0667] Synthesis of LP-482-p:

[0668] LP-482 was synthesized from I28 following General Procedure IV. Product was isolated using DCM: MeOH (96:4) to give an off-white solid in 76% yield. LC-MS [M+H]+ 763.4316 m / z, observed 763.4315.Scheme 55. Synthesis of LP-484-p

[0669] Reagents and Conditions: (a) TEA, DCM, rt, 12 h, 41%. (b) mCPBA, DCM, rt, 12 h, 71%.

[0670] Synthesis of I29:

[0671] I29 was synthesized from I11 and docosanoyl chloride following General Procedure III. Product was isolated using DCM: MeOH (96:4) to give an oil in 41% yield. LC-MS [M+H]+ 706.4829 m / z, observed 706.4828.

[0672] Synthesis of LP-484:

[0673] LP-484 was synthesized from I29 following General Procedure IV. Product was isolated using DCM: MeOH (96:4) to give an off-white solid in 71% yield. LC-MS [M+H]+ 738.4727 m / z, observed 738.4728. Scheme 56. Synthesis of LP-485-p

[0674] Reagents and Conditions: (a) COMU, DIPEA, DCM, rt, 2 h, 51% (b) TFA: DCM (3:1), rt, 1 h, 95%. (c) TEA, DCM, rt, 12 h, 40%. (d) mCPBA, DCM, rt, 12 h, 69%.

[0675] Synthesis of I30:

[0676] I30 was synthesized from I11 and 4-((tert- butoxycarbonyl)amino)bicyclo[2.2.2]octane-1-carboxylic acid following General Procedure I. Product was isolated using hexanes: ethyl acetate (70:30) to give an oil in 51% yield. LC- MS [M+H]+ 635.3115 m / z, observed 635.3114.

[0677] Synthesis of I31:

[0678] I31 was synthesized from I30 following General Procedure V to give product as an oil in 95% yield. LC-MS [M+H]+ 535.2590 m / z, observed 535.2589.

[0679] Synthesis of I32:

[0680] I32 was synthesized from I31 and palmitoyl chloride following General Procedure III. The product was isolated using DCM: MeOH (96:4) to give an oil in 40% yield. LC-MS [M+H]+ 773.4887 m / z, observed 773.4886.

[0681] Synthesis of LP-485-p:

[0682] LP-485 was synthesized from I32 following General Procedure IV. Product was isolated using DCM: MeOH (96:4) to give an off-white solid in 69% yield. LC-MS [M+H]+ 805.4785 m / z, observed 805.4788. Scheme 57. Synthesis of LP-516-p

[0683] Reagents and Conditions: (a) H2, Pd / c, EtOAc, rt, 12 h, 97% (b) TEA, DCM, rt, 12 h, 30%. (c) LiOH, MeOH: H2O (2:1), rt, 3 h, 94%. (d) COMU, DIPEA, DCM, rt, 12 h, 53%.

[0684] Synthesis of I33:

[0685] Methyl 1,4-dibenzyl-1,4-diazepane-6-carboxylate was dissolved in EtOAc (0.2 M) and purged for 15 min with nitrogen gas. Then, a catalytic amount of Pd / c was added. Thereaction was purged twice with a hydrogen balloon for 15 min each and then allowed to run overnight at room temperature under hydrogen gas. After, the reaction mixture was filtered over celite to obtain product as an oil in 97% yield. LC-MS [M+H]+ 159.1134 m / z, observed 159.1138.

[0686] Synthesis of I34:

[0687] I34 was synthesized from I33 and palmitoyl chloride following General Procedure III. The product was isolated using hexanes: ethyl acetate (60:40) to give an oil in 30% yield. LC-MS [M+H]+ 635.5727 m / z, observed 635.5721.

[0688] Synthesis of I35:

[0689] I35 was synthesized from I34 following General Procedure VI to give product as an off-white solid in 94% yield. LC-MS [M+H]+ 621.5570 m / z, observed 621.5575.

[0690] Synthesis of LP-516-p:

[0691] LP-516 was synthesized from I35 and 2-(2-(2-(2-(4-(5-(methylsulfonyl)-1,3,4- oxadiazol-2-yl)phenoxy)ethoxy)ethoxy)ethoxy)ethan-1-amine following General Procedure I. Product was isolated using DCM: MeOH (96:4) to give an off-white solid in 53% yield. LC- MS [M+H]+ 1018.6878, observed 1018.6877. Scheme 58. Synthesis of LP-517-pO O

[0692] Reagents and Conditions: (a) TEA, DCM, rt, 12 h, 28%. (b) TFA: DCM (3:1), rt, 1 h, 95%. (c) COMU, DIPEA, DCM, rt, 12 h, 48%.

[0693] Synthesis of I36:

[0694] I36 was synthesized from N-(t-butyl ester-PEG3)-N-bis(PEG3-amine) and palmitoyl chloride following General Procedure III. Product was isolated using DCM: MeOH (96:4) as an oil in 28% yield. LC-MS [M+H]+ 1132.8927 m / z, observed 1132.8925.

[0695] Synthesis of I37:

[0696] I37 was synthesized from I36 following General Procedure V to give product as an oil in 95% yield. LC-MS [M+H]+ 1076.8301 m / z, observed 1076.8300.

[0697] Synthesis of LP-517:

[0698] LP-517 was synthesized from I37 and 2-(2-(2-(2-(4-(5-(methylsulfonyl)-1,3,4- oxadiazol-2-yl)phenoxy)ethoxy)ethoxy)ethoxy)ethan-1-amine following General Procedure I. Product was isolated using DCM: MeOH (96:4) to give an off-white solid in 48% yield. LC- MS [M+H]+ 1473.9608 m / z, observed 1473.9610. Scheme 59. Synthesis of LP-518-p

[0699] Reagents and Conditions: (a) TEA, DCM, rt, 12 h, 25%. (b) 25% piperidine in DMF, rt, 1 h, 90%. (c) K2CO3, ACN, 85ºC, 12 h, 64%. (d) mCPBA, DCM, rt, 12 h, 60%. (e) TFA: DCM (3:1), rt, 1 h, 96%. (f) COMU, DIPEA, DCM, rt, 12 h, 53%.

[0700] Synthesis of I38:

[0701] I38 was synthesized from (9H-fluoren-9-yl)methyl bis(14-amino-3,6,9,12- tetraoxatetradecyl)carbamate and palmitoyl chloride following General Procedure III. Product was isolated using DCM: MeOH (96:4) to give an oil in 25% yield. LC-MS [M+H]+ 1154.8559 m / z, observed 1154.8564.

[0702] Synthesis of I39:

[0703] I39 was synthesized from I38 following General Procedure VII. Product was isolated using DCM: MeOH (95:5) to give an oil in 90% yield. LC-MS [M+H]+ 932.7878 m / z, observed 932.7871.

[0704] Synthesis of I40:

[0705] I40 was synthesized from I9 following General Procedure II. Product was isolated using hexanes: ethyl acetate (50:50) to give an oil in 64% yield. LC-MS [M+H]+ 455.1852 m / z, observed 455.1858.

[0706] Synthesis of I41:

[0707] I41 was synthesized from I40 following General Procedure IV. Product was isolated using hexanes: ethyl acetate (30:70) to give an off-white solid in 60% yield. LC-MS [M+H]+ 487.1750 m / z, observed 487.1755.

[0708] Synthesis of I42:

[0709] I42 was synthesized from I41 following General Procedure V to give product as an off-white solid in 96% yield. LC-MS [M+H]+ 431.1124 m / z, observed 431.1129.

[0710] Synthesis of LP-518-p:

[0711] LP-518 was synthesized from I42 and I39 following General Procedure I. Product was isolated using DCM: MeOH (96:4) to give an oil in 53% yield. LC-MS [M+H]+ 1344.8819 m / z, observed 1344.8811.Scheme 60. Synthesis of LP-355-p

[0712] Reagents and Conditions: (a) COMU, DIPEA, DCM, rt, 2 h, 48%. (b) TFA: DCM (3:1), rt, 1 h, 91%. (c) 25% piperidine in DMF. Rt.1 h (d) TEA, THF, rt, 2 h, 57%.

[0713] Synthesis of E7:

[0714] E7 was synthesized following General Procedure I. The product was purified using DCM: MeOH (96:4) to give an oil in 48% yield. LC-MS [M+H]+ 735.4948 m / z, observed 735.4949.

[0715] Synthesis of E8:

[0716] E8 was synthesized from E7 following General Procedure V to give product as an oil in 91% yield. LC-MS [M+H]+ 623.3696 m / z, observed 623.3698.

[0717] Synthesis of I17:

[0718] I17 was synthesized from E8 following General Procedure VII. The product was moved forward to the next step without any purification. LC-MS [M+H]+ 401.3015 m / z, observed 401.3017.

[0719] Synthesis of LP355-p:

[0720] LP355-p was synthesized from I17 & Sulfone TFP Ester following General Procedure III. The product was obtained using DCM: MeOH (96:4) to give an off-white solid in 57% yield. LC-MS [M+H]+ 651.3064 m / z, observed 651.3063. Scheme 61. Synthesis of LP-362-p

[0721] Reagents and Conditions: (a) TEA, DCM, rt, 3 h, 56% (b) TFA: DCM (3:1), rt, 1 h, 93%. (c) COMU, DIPEA, DCM, rt, 2 h, 62% (d) TFA: DCM (3:1), rt, 1 h, 96%. (e) TEA, THF, rt, 2 h, 49%.

[0722] Synthesis of E9:

[0723] E9 was synthesized from tert-butyl 3-aminobicyclo[1.1.1]pentane-1-carboxylate and palmitoyl chloride following General Procedure III. Product was obtained using hexanes: ethyl acetate (70:30) to give an oil in 56% yield. LC-MS [M+H]+ 422.3634 m / z, observed 422.3635.

[0724] Synthesis of I18:

[0725] I18 was synthesized from E9 following General Procedure V to give product as a white solid in 93% yield. LC-MS [M+H]+ 366.3008 m / z, observed 366.3010.

[0726] Synthesis of I19:

[0727] I19 was synthesized from I18 and N-Boc-Amino-PEG2-Amine following General Procedure I. Product was obtained using DCM: MeOH (98:2) to give an oil in 62% yield. LC-MS [M+H]+ 596.4639 m / z, observed 596.4638.

[0728] Synthesis of I20:

[0729] I20 was synthesized from I19 following General Procedure V to give product as an oil in 96% yield. LC-MS [M+H]+ 496.4114 m / z, observed 496.4113.

[0730] Synthesis of LP-362-p:

[0731] LP-362 was synthesized from I20 following General Procedure III. Product was obtained using DCM: MeOH (96:4) to give an off-white solid in 49% yield. LC-MS [M+H]+ 746.4163 m / z, observed 746.4161. Example 5. Conjugation of Linkers and Targeting Ligands to RNAi agents

[0732] A. Conjugation of Activated Ester Linkers

[0733] The following procedure was used to conjugate linking groups having the structure of L4 as shown in Table 4 above to an RNAi agent with an amine-functionalized sense strand, such as C6-NH2, NH2-C6, or (NH2-C6)s, as shown in Table 4, above. An annealed RNAi Agent dried by lyophilization was dissolved in DMSO and 10% water (v / v%) at 25 mg / mL. Then 50-100 equivalents of TEA and 3 equivalents of activated ester linker were added to the solution. The solution was allowed to react for 1-2 hours, while monitored by RP-HPLC-MS (mobile phase A 100 mM HFIP, 14 mM TEA; mobile phase B: acetonitrile on an Waters™ XBridge C18 column, Waters Corp.)

[0734] The product was then precipitated by adding 12 mL acetonitrile and 0.4 mL PBS and centrifuging the solid to a pellet. The pellet was then re-dissolved in 0.4 mL of 1XPBS and 12 mL of acetonitrile. The resulting pellet was dried on high vacuum for one hour.

[0735] B. Conjugation of Targeting Ligands to Propargyl Linkers

[0736] Either prior to or after annealing, the 5′ or 3′ tridentate alkyne functionalized sense strand is conjugated to the GLP1R Ligands. The following example describes the conjugation of GLP1R ligands to the annealed duplex: Stock solutions of 0.5M Tris(3- hydroxypropyltriazolylmethyl)amine (THPTA), 0.5M of Cu(II) sulfate pentahydrate (Cu(II)SO4 ^ 5 H2O) and 2M solution of sodium ascorbate were prepared in deionized water. A 75 mg / mL solution in DMSO of GLP1R ligand was made. In a 1.5 mL centrifuge tube containing tri-alkyne functionalized duplex (3mg, 75µL, 40mg / mL in deionized water, approximately 15,000 g / mol), 25 µL of 1M Hepes pH 8.5 buffer is added. After vortexing, 35 µL of DMSO was added and the solution is vortexed. GLP1R ligand was added to the reaction (6 eq / duplex, 2 eq / alkyne, approximately 15µL) and the solution is vortexed. Using pH paper, pH was checked and confirmed to be pH approximately 8. In a separate 1.5 mL centrifuge tube, 50 µL of 0.5M THPTA was mixed with 10µL of 0.5M Cu(II)SO4 ^ 5 H2O, vortexed, and incubated at room temp for 5 min. After 5 min, THPTA / Cu solution (7.2 µL, 6 eq 5:1 THPTA:Cu) was added to the reaction vial, and vortexed. Immediately afterwards, 2M ascorbate (5 µL, 50 eq per duplex, 16.7 per alkyne) was added to the reaction vial and vortexed. Once the reaction was complete (typically complete in 0.5-1h), the reaction mixture was immediately purified by non-denaturing anion exchange chromatography.

[0737] C. Conjugation of Targeting Ligands to Amine-Functionalized Sense Strand

[0738] The following procedure may be used to conjugate an activated ester-functionalized targeting ligand such as αvβ6 peptide 1, peptide 5 or peptide 6 to an amine functionalized RNAi agent comprising an amine, such as C6-NH2, NH2-C6, or (NH2-C6)s, as shown in Table 4.

[0739] An annealed, lyophilized RNAi agent was dissolved in DMSO and 10% water (v / v%) at 25 mg / mL. Then 50-100 equivalents TEA and three equivalents of activated ester targeting ligand were added to the mixture. The reaction mixture was allowed to stir for 1-2 hours while monitored by RP-HPLC-MS (mobile phase A: 100 mM HFIP, 14 mM TEA; mobile phase B: Acetonitrile; column: Waters™ XBridge C18). After the reaction mixture was complete, 12 mL of acetonitrile was added followed by 0.4 mL of PBS and then the mixture was centrifuged. The solid pellet was collected and dissolved in 0.4 mL of 1xPBS and then 12 mL of acetonitrile was added. The resulting pellet was collected and dried under vacuum for 1 hour.Example 6. Conjugation of PK / PD modulator precursors

[0740] Either prior to or after annealing and prior to or after conjugation of one or more targeting ligands, one or more PK / PD modulator precursors can be linked to the RNAi agents disclosed herein. The following describes the general conjugation process used to link PK / PD modulator precursors to the constructs set forth in the Examples depicted herein.

[0741] A. Conjugation of a maleimide-containing PK / PD modulator

[0742] The following describes the general process used to link a maleimide-containing PK / PD modulator precursor to the (C6-SS-C6) or (6-SS-6) functionalized sense strand of an RNAi agent by undertaking a dithiothreitol reduction of disulfide followed by a thiol-Michael Addition of the respective maleimide-containing PK / PD modulator precursor: In a vial, functionalized sense strand was dissolved at 50mg / mL in sterilized water. Then 20 equivalents of each of 0.1M Hepes pH 8.5 buffer and dithiothreitol were added. The mixture was allowed to react for one hour, then the conjugate was precipitated in acetonitrile and PBS, and the solids were centrifuged into a pellet.

[0743] The pellet was brought up in a 70 / 30 mixture of DMSO / water at a solids concentration of 30 mg / mL. Then, the maleimide-containing PK / PD modulator precursor was added at 1.5 equivalents. The mixture was allowed to react for 30 minutes. The product was purified on an AEX-HPLC (mobile phase A: 25 mM TRIS pH=7.2, 1 mM EDTA, 50% acetonitrile; mobile phase B: 25 mM TRIS pH=7.2, 1 mM EDTA, 500 mM NaBr, 50% acetonitrile; solid phase TSKgel®-30; 1.5 cmx10 cm). The solvent was removed by rotary evaporator, and desalted with a 3K spin column using 2 x 10 mL exchanges with sterilized water. The solid product was dried using lyophilization and stored for later use.

[0744] B. Conjugation of a sulfone-containing PK / PD modulator precursor

[0745] In a vial, functionalized sense strand was dissolved at 50mg / mL in sterilized water. Then 20 equivalents of each of 0.1M Hepes pH 8.5 buffer and dithiothreitol are added. The mixture was allowed to react for one hour, then the conjugate was precipitated in acetonitrile and PBS, and the solids were centrifuged into a pellet.

[0746] The pellet was brought up in a 70 / 30 mixture of DMSO / water at a solids concentration of 30 mg / mL. Then, the sulfone-containing PK / PD modulator precursor was added at 1.5 equivalents. The vial was purged with N2, and heated to 40°C while stirring. The mixture was allowed to react for one hour. The product was purified on an AEX-HPLC (mobile phase A: 25 mM TRIS pH=7.2, 1 mM EDTA, 50% acetonitrile; mobile phase B: 25 mM TRIS pH=7.2, 1 mM EDTA, 500 mM NaBr, 50% acetonitrile; solid phase TSKgel®-30;1.5 cmx10 cm.) The solvent was removed by rotary evaporator, and desalted with a 3K spin column using 2x10 mL exchanges with sterilized water. The solid product was dried using lyophilization and stored for later use.

[0747] C. Conjugation of an azide-containing PK / PD modulator precursor

[0748] One molar equivalent of TG-TBTA resin loaded with Cu(I) was weighed into a glass vial. The vial was purged with N2for 15 minutes. Then, functionalized sense strand was dissolved in a separate vial in sterilized water at a concentration of 100 mg / mL. Then two equivalents of the azide-containing PK / PD modulator precursor (50 mg / mL in DMF) is added to the vial. Then TEA, DMF and water are added until the final reaction conditions are 33 mM TEA, 60% DMF, and 20 mg / mL of the conjugated product. The solution was then transferred to the vial with resin via a syringe. The N2 purge was removed and the vial was sealed and moved to a stir plate at 40°C. The mixture was allowed to react for 16 hours. The resin was filtered off using a 0.45 μm filter.

[0749] The product was purified using AEX purification (mobile phase A: 25 mM TRIS pH=7.2, 1mM EDTA, 50% acetonitrile; mobile phase B: 25mM TRIS pH=7.2, 1mM EDTA, 500mM NaBr, 50% acetonitrile solid phase TSKgel®-30; 1.5 cmx10 cm.) The acetonitrile was removed using a rotary evaporator, and desalted with a 3K spin column using 2x10 mL exchanges with sterilized water. The solid product was dried using lyophilization and stored for later use.

[0750] D. Conjugation of an alkyne-containing PK / PD modulator precursor

[0751] The following describes the general process used to link an activated alkyne- containing lipid PK / PD modulator precursor to the (C6-SS-C6) or (6-SS-6) functionalized sense strand of an RNAi agent by undertaking a dithiothreitol reduction of disulfide followed by addition to an alkyne-containing PK / PD modulator precursor: In a vial, 10 mg of siRNA comprising the (C6-SS-C6) or (6-SS-6) functionalized sense strand was dissolved at 50 mg / mL in sterilized water. Then 20 equivalents of each of 0.1M Hepes pH 8.5 buffer and dithiothreitol (1M in sterilized water) were added. The mixture was allowed to react for one hour, then purified on Waters™ XBridge BEH C4 Column using a mobile phase A of 100mM HFIP, 14 mM, and TEA, and a mobile phase B of Acetonitrile using the following formula, wherein %B indicates the amount of mobile phase B while the remainder is mobile phase A.

[0752] The product was precipitated once by adding 12 mL of acetonitrile and 0.4mL 1XPBS, and the resulting solid was centrifuged into a pellet. The pellet was re-dissolved in 0.4 mL 1XPBS and 12 mL of acetonitrile. The pellet was dried on high vacuum for one hour.

[0753] The pellet was brought up in a vial a 70 / 30 mixture of DMSO / water at a solids concentration of 30 mg / mL. Then, the alkyne-containing lipid PK / PD modulator precursor was added at 2 equivalents relative to siRNA. Then 10 equivalents of TEA was added. The vial was purged using N2, and the reaction mixture was heated to 40°C while stirring. The mixture was allowed to react for one hour. The product was purified using anion-exchange HPLC using a TSKgel®-30 packed column (Tosoh Bioscience), 1.5cm x 10 cm, using a mobile phase A of 25mM TRIS pH=7.2, 1mM EDTA, 50% Acetonitrile, and a mobile phase B of 25mM TRIS pH=7.2, 1mM EDTA, 500mM NaBr, 50% Acetonitrile using the following formula, wherein %B indicates the amount of mobile phase B while the remainder is mobile phase A.

[0754] The fractions containing the product were collected, and acetonitrile was removed using a rotary evaporator. The product was desalted with a 3K spin column, using 2 x 10 mL exchanges with sterilized water. The product was then dried using lyophilization and stored for later use.O W-64703cacacacacaca acuaa a uaa uaa ua:uf fuf fuf fuf fuf fuf f aafufa Uf aafcs fcfcsel CfA CafCfA CafCfAafCfAafCfAafCfAauA fuuafCf aaauaAuA uafuuaf)bAasf)bAasf)bp fAfACfACfACfACfAuACfuauuAuAAvAAvAAm U ufU ufU ufU ufU ufU uf aufU g u uf aufn ufuf vaxaeauUaaauUaaauUaaauUaaauUaaauUcas)bUaaaf auGfcsUcas)bUai(s)Unai(sUnai(sgn ufi uuGufguuGufguuGufguuGufguGufguGg AfvGuguAf)b fAGg AfvGg6 f)CGg6 f)CGg6Cwo allca a a a a a aua aua ansgio)ucsgucsgucsgucsg csg (auaG sg csuv ani a -gnig (sgHag- Hag- H fbg ) g ) g ) g )ug )ug )ug ) a (ug )ug N( ug N( uN(eAagb a b a b a b a b a 6Ca b gas)a 6Ca-4 a-4ga-4hfA gfA gfA gfA gfA gf -gfAs 6gf -gfLgfLgfL tvnAvnAvnAvnAvnAvnAHAvn usC- AHA- A- A-nii(ss)u is(ss)u is(ss)u is(ssi)us (ssi)us (ss)uN(-su i(susHsuN(-su 1Msu 2Msu 3M de 6 fs CU6 f 6 f 6 f 6 f 6sfa sf)6uu- sC UsC UsCUsC UCU-6UCsN )( sfa sfSb-6U-6U-sfS sfSRU- RU- R s2 u-tnHpNr 2 u-PHpNr 2 u-PHp2 u- su- su 9su-9su 9su 1su 1su 1NrPHp2NrPHp2NrPHp 3NrP-Ppr 2P HAv 3Nn -Ppr3P-PprPpPpP P LrPLrPL eg ( c ( c ( c ( c ( c ( cLc (i(LcLcGcGcG AiS S S S S S S S A ND S-AS -S-AS -S-AS -SS -A-SS -A-SS -A-SS -A-SS S -A-SS S -A-SS S -A-SS S -A-SS S -A-S- RI: d636 05n83840 164641 264642 364643 464644 564 45 664 46 764 47 4 4 7 7 8 8 964 969 969 969 96la1 1 2 2 2 2 2 2 2 2 262 262 262 262 262 262 262 2er0b t00 000 000 000 000 000 000 000 000 0 0 0 0 0 0 0aSC0C C0C C0CC0C C0C C0CC0C C0CC0C0C0C0C0C0C0C0C T A A A A A A A A A A A A A A A A A A A A A A A A AO W-64703Aasf)bAas)bAas)bAas)bAas)bAas)bAas)Aas)Aas)Aas)AaaaAas)Aas)guf s)AaAu AfvAu AfvAu AfvAu AfvAu AfvAu Af bvAu Af bvAAf bvAAf bvAAf uvAuf buAAf bvAAGbvafAfvA f Uni(fUni(fUni(fUni(fUni(fUni(fUniu(fUniu(fUniu(fUniu(fuaufniu(fni(Aa niu(faf s)Gg6af s)CGg6af s)CGg6af s)CGg6af s)CGg6af s)CG6af s)CG6af s)CG6af s)CG6af s)U C G6afcsU )af s)U C GbG6af s)fUs)UafC G6Cuf 6C G ag- a - a - a - a -ga -ga -ga -ga -ga -gaA ga -ga - -gauH gaNg(-uH gaNg(-uH gaNg(-uH gaNg(-uH gaNgHgHgHgHgHgv(-ugaN(-ugaN(-ugaN(-ug N(-ug N(-ungi( gsuH gNgHAgHg(-ug N(- gfN(-uggf 4Lg4g4g4g4g4g4g4 ag4 ag4 ag )6 ag4 ag4Ag 4 agAs -fL 4 As -fL 6 As -fL 4 As -fL 4 A-fL 4 A-fL 4 A-fL 4 A-fLfLf4A-4A-4AC- fL A-fL 4 A-4auL-f4A usfM USusfMusfMusfMsussfMusfMsusfMsussfMusfMsusfMsusHsf NusfMsSusfMsSassfMusfs -uRUS- R US- RUS- R US- R US- R US- R US- RUS- R US- R U(-3U- R U-SRG- R U p1s s1s1s s1s s s s s8s s s sr Pu 1PcLprPuLprPuLprPu 1LprPuLprPup1rPup1rPup1rPup1rPupr1- up1rPup1rPup1 urPprGPcGPcGPcGPcGPcL GPcL GPcL GPcL GPcL GPcP LPcL GPcL GPcL GPcS AS S S S S S S S S S S S S S S S S S S S S -S9-90 A-S-0002 A-S-0205 A-S-45 4 A-S-04 5 A-S-05 6 A-S-06 7 AS -S-07 8 AS -S-08 0 AS -S-AS -S-AS -S-AS -S-AS -S-A-10 111 232 595 262 8886 7 7 7 7 949 202 202 202 202 202 212 212 23293638202002 2C00 02 2C0C00 02 3C0C00 03 3 3 3 3 3 3 3 3 3 3 3 3 323 323 333 333C0C00 0C0C00 0C0C00 0C0C00 0C0C00 0C0C00 0C0C00 0C0C00 0C0C00 0 0 0 0C0C0C0C0C0C A A A A A A A A A A A A A A A A A A A A A A A A A A A A AO W-64703s)bAas)bAas)bA)abAas)bAas)bA)abAas)bAas)Aas)A)abA)abA)abAavnAavnAfvA niu AfvAu AfAv Auv fn Au AfvAu AfAv Av fn AAf bvAAf b fAv AAvAv fAnAv fAnAv f in A(s f i) A(s)(fs)Unai(fs)Unai(f isU(as)fUnai(fsUnaiu(f ius U(as)fUnaiu(fsUnaiu(fns Uaiu(f isU(asu)f iU(asu)f iU(asu)fU6ua Cf 6-Ua C-6 f 6 f)6 f 6Cf)6 f)6 f 6Cf)6 f)6 f)6 f 6 f 6 f 6 fHfH C- GgHaC- GgaC- Gg- G a HgaC- GgaC- Gg- G a HgaC- GgaC- GgaC- Gg C- GC- GC- G a HgaHgHg N(G -g N(-NgHgHg(-uN( uN( uN(gHgHg-uN( uNuN(gHgHgHg-uN( uNuN( uNa a(g-uN(g-uN(g-u 4 aLg44ga-uL- L- g -f4gaL- g -f4gaL- g4gfLa-1 g -f4ga (L- g -f4gaL- g4gfLa-1 g -f4ga (L- g -f4gaLg -f4gaLg4gfLa-g4gfLa-g4gfLa-g1gf4a7g0f574As4A4A2A4A4A2A4A-4A-4A12A12A12A0- A0- MSu-sfMsSussfMusfMsusfMsusfMsusfMsusfMsussfMusfMsusfMsusfMsussfMussfMSusfMSRU- US- US- US- US- US- US- US- US- US- US-S- - -1s R1s R s R s R1s R1s R s R1s R s R s R s RUs RUs RUs RPuPu 1Pu 1PuPuPu 1PuPu 1Pu 1Pu 1Pu 1 u 1 u 1Pu 1P LprPLprPLprPLprPLprPLprPLprpPLrpPrprprPprPprprcL GPcL GPcL L L L L GcGcGcGcGcGcGcG GPcGPcGPcGPcG SSS S S S S S S S S S S S S S S S S S S S S S -A S-A S A S A S A S A S A S A S ASS ASS ASS ASS ASS ASS9-0- -1- -2- -6- -7- -8- -9- -0- -1- - - - - - - - - -893833903939139392393963939739348545692627027271 227272 327273 427 74 227 42 334 4303 303 303 303 303 3 3 3 3 4 4 4 4 4 4 4 4 424 424 535 50000000000 000 000 000 000 000 000 000 000 0 0 0C0CC0C C0CC0C C0C C0C C0C C0CC0C C0C C0C C0C C0C0C0C0C A A A A A A A A A A A A A A A A A A A A A A A A A A A A AO W-64703AavfnAiA (avnus f iAavniAavniAavniAavnAavnAavnAavnAas)gbuu vnAavnAavnAavnAaf)A(s f6uf)A(s f6uf)A(s f6uf)A(s f i6u )A(s f i6u )A(s f i6u )A(s f i6u )A(s fAA6u )6uvuf i(Us f) Ai(s fAi(s fAi(s fA 6u )6u )6u )6uUCUCUCUCfUCfUCfUCfUCfUCfni( cfCfCfCfCfaf -af -a-a-a-a-a-a-a- Uas)U- Ua- Ua- Ua- UaGHGHfGHfGHfGHfGHfGHfGHfGHf 6afHfHfHfHfgaN(- gaN(- gaN(- gaN(- gaN(- gaN(- gaN(- gaN(- gaN(G -gaC-C N(G -gaN(G -gaN(G -gaN(G -gg4g Lg4 4 4 4 4 4 4 4Hg 4 4 4 4 aua-uLg2ga-uLg3ga-uLg4ga-uLg g g g g a9ga-uL 0ga-uL 1ga-uL 2g -uL 3g -u4g N(-cufLg g g g-uL 4g -uL 5g -uL 6g -u7ggf3 g 3 g 3 g 0 g 1 g 1 g 1ag 1ag 2ag4G7ag 7ag 7ag 7agA9s0f 9-As 0f 9-As 0f 0-A1f 0-A1f 0-A1f 0-A1f 0-A1f 0 fL - A1- A-4uu 01f 0 f 0 f 0 f-A1- A1- A1- A usfM USusfMSusfMsSusfMsSusfMsusfMsusfMsusfMsusfMsusfMuassMussfMussfMussfMusfs -uRU- R U- RU- R US- R US- R US- R US- RUS- R US- fSRG- R US- R US-SRU- R U p1s1s1s1s1s s s s s s s s s sr PuPuPuPuPu 1Pu 1Pu 1Pu 1Pu 1 a 1Pu 1Pu 1Pu 1PuPcLprLprLprLprLprLprprprprPprprprprprGPcGPcGPcGPcGPcGPcL GPcL GPcL GPcL GPcL GPcL GPcL GPcL GPcS AS S S S S S S S S S S S S S S S S S S S S -S3-45 A-S-4546 A-S-4647 A-S-47 8 A-S-48 9 A-S-49 0 A-S-50 1 AS -S-51 2 AS -S-52 4 AS -S-AS -S-AS -S-AS -S-AS -S-A-64 727 161 262 363 4643 3 3 3 3 343 343 343 353 353 353 464 929 06060606505005 5C00 05 5C0C00 05 5C0C00 05 5 5 5 5 5 5 5 5 5 5 5 5 606 606 606 606C0C00 0C0C00 0C0C00 0C0C00 0C0C00 0C0C00 0C0C00 0C0C00 0C0C00 0 0 0 0C0C0C0C0C0C A A A A A A A A A A A A A A A A A A A A A A A A A A A A AO W-64703vniA (avnsf iAavniAavniAavniAavniAavnAavnAavnAavnAavnAavnAavnAavnAavn)A(s f) A(s f) A(s f) A(s f) A(s f i) A(s f i) A(s fAi(s fAi(s fAi(s fAi(s fAi(s fAi(s fAi(s6uCf-U6uCfU6uCfU6uCfU6uCfU6uCfU6u )CfU6u )CfU6u )Cf 6u )Cf 6u )Cf 6u )Cf 6u )Cf 6u )Cf 6C Haf -aN(GHf -a-a-a-a-a-a- Ua- Ua- Ua- Ua- Ua- Ua- GHfGHfGHfGHfGHfGHfGHfGHfGHfHfHfHfH -4gaN(- gaN(- gaN(- gaN(- gaN(- gaN(- gaN(- gaN(- gaN(- gaN(G -gaN(G -g N(G -g N(G -g N(- Lg-u 4Lg-u 4Lg-u 4Lg-u 4Lg-u 4Lg4g4g4g4g4g4 ag4 ag4 ag4-uL-uL-uL-uL-uL-uL-uL-uLuL 8g7a0g9g7ag0g8ag2g8ag3g8ag3g7ag8g5ag9g5ag8g2ag5g5ag6g5ag7g5ag8g -5ag9g -5ag061f 01f 01f 01f 01f 01f 01f 01f 0 f 1 f 1 f 1 f 1 f 1 f 1-As- A- A- A- A- A- A- A1- A1- A1- A1- A1- A1- A1- MSusfMsSusfMsSusfMsSusfMsusfMsusfMsusfMsusfMsusfMsussfMussfMussfMussfMusfM - RU- U- U- US- US- US- US- US- US- US- US-S-S-S-1s R1s R1s R1s R1s R s R s R s R s R s R s RUs RUs RUs RPuprPupPrPupPupPup1Pup1Pup1Pup1Pup1Pup1Pup1Pup1Pup1Pup1P L LPLrPLrPLrPLrPLrPLrPr r r r r rcL GPcL GPcL L L L L GcGcGcGcGcGcGcG GPcGPcGPcGPcG SSS SSS SSS SSS SSS SSS SSS SSS SSS SSS SSS SSS S S S S S -A-A A A A A A A A A A A S A S A S5-6- -7- -9- -0- -1- -1- -2- -3- -4- - - - - - - - - -650660660606706069060700707107061464624646346464 546465 646466 746 67 846 68 946 6406 606 606 606 606 6 6 6 6 6 6 6 6 6 6 6 6 646 646 646 60000000000 000 000 000 000 000 000 000 000 0 0 0C0CC0C C0CC0C C0C C0C C0C C0CC0C C0C C0C C0C C0C0C0C0C A A A A A A A A A A A A A A A A A A A A A A A A A A A A AO W-64703A_ g vAvAvAvAvAv gf suv guvAs gus s s)a a uun a n a n a n a n a nfnfn a )b f)bAa )bAa )AabAaA)ubuf i(s f ifAU)A(s f i6uf)A(s f i6uf)A(s fAi(s fAi(sG 6uf)6uf)6uf)6aif(sG )6aif(fs)AAGf f b fA6uf vafAvAu AfvAu AfvAuv fniAuUvcfCUCUC C C CAa CAa CUni(Aa ni( ni( ni(f(s fafniG(gsU )a-fHaf -Haf -U Haf -U Haf -U Haf - fHU- f -as f sUasUasUa )UaC NGg NGg NGg NGg NGg NuHUHffNufNG)g6U)C uf 6 f)CG6 f)CG6 f 6CGCf-G ag6 (-a (-a (-a (-a (-a (-(-(-a - -ga -ga -gaHgauC- gagaHc 4ufLg4g4g4g4g4A-uL 1ga-uL 2ga-uL 3ga-uL 4ga-uL 5g -g6g4Ag 4gf L-5gfL-uHA5gaNg(- gH fNg(-uH gNg(-uH gNg(-uNg(g-u4ggfN(- G6 g 6 g 6 g 6 g 6ag 8 Ag9 Ag9 g4A4 ag4 ag4 ag LagAs 91uu 11f 1 f 1 f 1 f 1 f 2-A1- A1- A1- A1- A1-au 21-au 21fL - As -g4auL-fL 7 A-fL 8 A-f -9A0f1A usfMuUSasfMsSusfMsusfMsusfMsusfMsusfMsasfMsasfMus sf MassfMussfMussfMussfMusfs -uRG- US- US- US- US- US- GS- GS- US- GS- US-S-S- p1s R1s R1s R s R s R s R s R s R suR s R s RUs RUs RUsr PaPuPu 1Pu 1Pu 1Pu 1PcLprLprLprLprLprprPup1rPup1rPp1rPup1rPup1 u 1 u 1 urPprPprPprGPcGPcGPcGPcGPcL GPcL GPcL GPcL GPcL GPcL GPcL GPcL GPcL GPcS AS S S S S S S S S S S S S S S S S S S S S -S9-65 A-S-8580 A-S-7071 A-S-71 2 A-S-72 3 A-S-73 4 A-S-74 1 AS -S-61 5 AS -S-25 6 AS -S-AS -S-AS -S-AS -S-AS -S-A-76 323 555 656 757 8584 6 6 4 4 474 474 474 474 868 020 676 727 15151515606006 6C00 06 6C0C00 06 6C0C00 06 6 6 6 6 7 7 8 8 8 8 8 8 313 313 313 313C0C00 0C0C00 0C0C00 0C0C00 0C0C00 0C0C00 0C0C00 0C0C00 0C0C00 0 0 0 0C0C0C0C0C0C A A A A A A A A A A A A A A A A A A A A A A A A A A A A AO W-64703vnv(nvnvnvnvnvnvis i(s i(s i(s i(s i(s i( nsi(a a a a a a asaaa a a a a aaauacuauauauauauauuccucucucucucucuaccacacacacacacaucfucfucfucfucucucu )713 / CfCf f f f bfCfCfCfCfCfCfA36C C C C C C v2fUf f fCfCnaUaUf f fiaU U U U U(saua aaaaaaaaaa aug uuuuuuuuuuua uuuuauu saf u gusaf u gusaf u gusaf u gusaf u gusaf u gusaf u gusfgaacUcUcUcUcUcU UaUas) af sbA) af s) af s) af s) af safcsafcsafcgAvaf bAaniAAv f bAaA A)A)AAv f babababA)abAa af aAAv fAAv fAAv fAAv fAAv fACfsc(su)fniu6 U(as)fniuU(s fniuU(s fniu niu niu niu UfcaU(s fU(s fU(s fU(s fUG cfCf 6af)6af)6af)6af)6af)6af)6af u-GuA gC- Gg C- Gg C- Gg C- Gg C- GC- GC- Gug afH Na(gHagHagHagHagHgagHgagHgagugAc-uN(-uN(-uN(-uN(-uN(-uN(-uN(-u g f4gLa 4g-La 4gLa 4ga 4ga 4ga 4ga 4gausA)gu1 gf -2 gf -gfL-gfL-gfL-gfL-gfL-gf b c1As1As 31As 41As 51As 61As 71A81AAvgfMSu-sfMusfMusMusMusMusMsussMus ni(UuRUS- US- fUS- fUS- fUS- fUS- fUS- fUs uc1sPuR1suR1suR1suR1suR1s R1s R1s 73 usLprPprPprPprPprPuprPuLprPuprGfAA GPcL GPcL GPcL GPcL GPcL GPcGPcL GPcNsuSSS -9 AS -SS ASSS ASSS ASSS ASSS ASSS SSS S S 59-0-0-1-1-2- -3- -4- -5 A- -6 A- A- S-15 631 16 616 6216 6316 6416 6516 666 494903 3100 03 3103 3103 313 313 3131313 5353C00 0 0 0 0 0 0 0 0 0 01 1C0C0C0C0C0C0C0C0C0C0C0C0C0C0C DD A A A A A A A A A A A A A A A A A Aa = 2′-O-methyladenosine-3′-phosphate as = 2′-O-methyladenosine-3′-phosphorothioate c = 2′-O-methylcytidine-3′-phosphate cs = 2′-O-methylcytidine-3′-phosphorothioate g = 2′-O-methylguanosine-3′-phosphate gs = 2′-O-methylguanosine-3′-phosphorothioate is = 2′-O-methylinosine-3′-phosphorothioate t = 2′-O-methyl-5-methyluridine-3′-phosphate ts = 2′-O-methyl-5-methyluridine-3′-phosphorothioate u = 2′-O-methyluridine-3′-phosphate us = 2′-O-methyluridine-3′-phosphorothioate Af = 2′-fluoroadenosine-3′-phosphate Afs = 2′-fluoroadenosine-3′-phosporothioate Cf = 2′-fluorocytidine-3′-phosphate Cfs = 2′-fluorocytidine-3′-phosphorothioate Gf = 2′-fluoroguanosine-3′-phosphate Gfs = 2′-fluoroguanosine-3′-phosphorothioate Uf = 2′-fluorouridine-3′-phosphate Ufs = 2′-fluorouridine-3′-phosphorothioate a_2N = see Table 4 a_2Ns = see Table 4 (invAb) = inverted abasic deoxyribonucleotide-5′- phosphate, see Table 4 (invAb)s = inverted abasic deoxyribonucleotide-5′- phosphorothioate, see Table 4 s = phosphorothioate linkage ss = phosphorodithioate linkage Other structures, see Table 4. Example 7. In Vivo Knockdown of SOD1 in Rats

[0755] On study day 1, male Sprague Dawley rats were dosed subcutaneously with either saline solution or test article comprising LP161 and SM1295 conjugated to an siRNA targeting rat SOD1 formulated in saline, according to the dosing schedule below:

[0756] Table 6: Dosing regimen for the rats of Example 7.

[0757] On study day 2, three rats from group 4 were sacrificed. On study days 15, 29, 43, 57, 85 and 113, three rats from each group were sacrificed and samples of heart tissue were taken from each animal. Samples were analyzed by qPCR for SOD1 mRNA knockdown, using rat ARL1 (rARL1) as a control gene. Treatment groups were normalized to group 1 (saline control). Average knockdown of SOD1 for each group are shown in Table 7 below: Table 7: Relative expression of SOD1 mRNA in heart tissue analyzed by qPCR for each of the dosing groups of Example 7.

[0758] As can be seen in Table 7, a dose-response was observed for animals injected with AC008676 through day 113. Furthermore, animals dosed with AC008676 continued to show deep knockdown well after the animals were dosed, even at the 1 mpk dose level. Example 8. In Vivo Knockdown of SOD1 in Cynomolgus Monkeys

[0759] On Study day 1, cynomolgus monkeys were subcutaneously injected with either saline or test article of a conjugate using lipids described herein conjugated to an siRNA targeting cyno SOD1 formulated in saline, according to Table 8 below:

[0760] Table 8: Dosing regimen for the monkeys of Example 8.

[0761] On study day 36, animals were sacrificed and tissue was collected from heart apex, left ventricle, right ventricle, left atrium and right atrium. Samples were analyzed by qPCR for SOD1 mRNA knockdown, using cynomolgus ARL1 (cARL1) as a control gene. Treatment groups were normalized to group 1 (saline control). Average knockdown of SOD1 for each group in the collected tissues are shown in Table 9 below:

[0762] Table 9: Relative expression of SOD1 mRNA in heart tissues analyzed by qPCR for each of the dosing groups of Example 8.

[0763] As can be seen in Table 9, RNAi agents comprising GLP1R ligands SM-4, SM-1286, and SM-1295 and LP-161 are delivered to heart tissue in cynomolgus monkeys. Each of the tissues analyzed showed deep knockdown of SOD1 at the 36-day time point. Example 9. In vivo Knockdown of Myh6 in mice

[0764] On study day 1, female Balb / c mice were dosed intravenously with either saline solution or test article comprising LP161 and SM4 or LP161 and SM19 conjugated to an siRNA targeting the mouse gene Myh6, formulated in saline, according to the dosing schedule below:

[0765] Table 10: Dosing regimen for the mice of Example 9.

[0766] On study days 8, 15, 29, 43, and 57, four mice from each group (except for day 57: 5 mice from groups 1 and 2 and three mice from group 3) were sacrificed and samples of heart tissue were taken from each animal. Samples were analyzed by qPCR for Myh6 mRNAknockdown, using mouse ARL1 (mARL1) as a control gene. Treatment groups were normalized to group 1 (saline control). Average knockdown of Myh6 for each group are shown in Table 11 below: Table 11: Relative expression of Myh6 mRNA in heart tissue analyzed by qPCR for each of the dosing groups of Example 9.

[0767] As can be seen in Table 11, both AC005927 (comprising GLP1R-SM-4) and AC006685 (comprising GLP1R-SM-19) showed deep and durable knockdown of a gene expressed in heart tissue through day 57. Example 10. In Vivo Knockdown of SOD1 in cynomolgus monkeys

[0768] On study day 1, cynomolgus monkeys were either dosed subcutaneously (SQ) with 0.3 mL / kg AD13594 or intravenously (IV) with 1.0 mL / kg AC003362. SOD1 RNAi agent AD13594 comprises NAG37s (see Table 4) and AC003362 comprises SM4 and LP161. NAG37s is a ligand comprising GalNAc and is not expected to be delivered to heart tissue and serves as a negative control.

[0769] On study day 8 animals were sacrificed and tissue was collected from heart apex, left ventricle, right ventricle, left atrium and right atrium. Samples were analyzed by qPCR for SOD1 mRNA knockdown, using cynomolgus ARL1 (cARL1) as a control gene. Treatmentgroups were normalized to group 2 (NAG37s control). Average knockdown of SOD1 for each group in the collected tissues are shown in Table 12 below.

[0770] Table 12: Relative expression of SOD1 mRNA in heart tissues analyzed by qPCR for each of the dosing groups of Example 10.

[0771] As can be seen in Table 12, each of the tissues analyzed showed deep knockdown of a target gene at the 8-day time point compared to AD13594 which contains a NAG37 ligand rather than one of the GLP1R targeting ligands disclosed herein. Example 11. In Vivo Knockdown of SOD1 in Cynomolgus Monkeys

[0772] On study day 1, male Cynomolgus Monkeys were dosed intravenously with either 3.0 mg / kg AC003362 comprising SM4 and LP161 conjugated to an siRNA targeting SOD1 or saline control.

[0773] On study day 8 animals were sacrificed and tissue was collected from heart apex, left ventricle, right ventricle, left atrium and right atrium. Samples were analyzed by qPCR forSOD1 mRNA knockdown, using cARL1 as a control gene. Average knockdown of SOD1 for each group in the collected tissues are shown in Table 13 below:

[0774] Table 13: Relative expression of SOD1 mRNA in heart tissues analyzed by qPCR for each of the dosing groups of Example 11.

[0775] As can be seen in Table 13, RNAi agents comprising GLP1R-SM-4 are delivered to heart tissue in male cynomolgus monkeys. Each of the tissues analyzed showed deep knockdown of a target gene at the 8-day time point. Example 12. In Vivo Knockdown of SOD1 in Rats

[0776] On study day 1, male Sprague Dawley rats were dosed subcutaneously with either saline solution or test article comprising LP161 and SM-4 conjugated to an siRNA targeting rat SOD1 formulated in saline, according to the dosing schedule below:

[0777] Table 14: Dosing regimen for the rats of Example 12.

[0778] On study days 22, 29, 43, 57, and 85, three rats from each group were sacrificed and samples of different tissues were taken from each animal. Samples were analyzed by qPCR for SOD1 mRNA knockdown, using rat ARL1 (rARL1) as a control gene. Treatment groups were normalized to group 1 (saline control). Average knockdown of SOD1 for each group are shown in Tables 15-19 below:

[0779] Table 15: Relative expression of SOD1 mRNA in various tissues analyzed by qPCR for each of the dosing groups of Example 12 at Day 22.

[0780] Table 16: Relative expression of SOD1 mRNA in various tissues analyzed by qPCR for each of the dosing groups of Example 12 at Day 29.

[0781] Table 17: Relative expression of SOD1 mRNA in various tissues analyzed by qPCR for each of the dosing groups of Example 12 at Day 43.

[0782] Table 18: Relative expression of SOD1 mRNA in various tissues analyzed by qPCR for each of the dosing groups of Example 12 at Day 57.

[0783] Table 19: Relative expression of SOD1 mRNA in various tissues analyzed by qPCR for each of the dosing groups of Example 12 at Day 85.

[0784] As can be seen in Tables 15-19, a dose-response was observed for animals injected with AC002700 in tissues analyzed. Furthermore, animals dosed with AC002700 continued to show deep knockdown well after the animals were dosed, even at the 1 mpk dose level, particularly in heart and adipose tissue.Example 13. In vivo Knockdown of SOD1 in Mice

[0785] On study day 1, female Balb / c mice were dosed subcutaneously with either saline solution or test article, according to the dosing schedule below:

[0786] Table 20: Dosing regimen for the mice of Example 13.

[0787] On study day 8, mice were sacrificed and samples of heart tissue were taken from each animal. Samples were analyzed by qPCR for SOD1 mRNA knockdown, using mouse ARL1 (mARL1) as a control gene. Treatment groups were normalized to group 1 (saline control). Average knockdown of SOD1 for each group are shown in Table 21 below:

[0788] Table 21: Relative expression of SOD1 mRNA in heart tissue analyzed by qPCR for each of the dosing groups of Example 13.

[0789] As can be seen in Table 21, select RNAi agents comprising a lipid achieve deep and durable knockdown of a gene expressed in heart tissue. Group 8, dosed with AC002645 (comprising LP-396 and LP-161) demonstrated the greatest knockdown of SOD1 at 0.5 mpk. Example 14. In vivo Knockdown of SOD1 in Mice

[0790] On study day 1, female C57BL / 6 mice were dosed intravenously (IV) with either saline solution or test article comprising a GLP1R targeting ligand, according to the dosing schedule below:

[0791] Table 22: Dosing regimen for the mice of Example 14.

[0792] On study day 8, mice were sacrificed and samples of heart tissue were taken from each animal. Samples were analyzed by qPCR for SOD1 mRNA knockdown, using mouse ARL1 (mARL1) as a control gene. Treatment groups were normalized to group 1 (saline control). Average knockdown of SOD1 for each group are shown in Table 23 below:

[0793] Table 23: Relative expression of SOD1 mRNA in heart tissue analyzed by qPCR for each of the dosing groups of Example 14.

[0794] As can be seen in Table 23, RNAi agents comprising a GLP1R targeting ligand and a lipid achieve deep and durable knockdown of a gene expressed in heart tissue. Group 6,dosed with AC002700 (comprising GLP1R-SM-4) demonstrated the greatest knockdown of SOD1. Example 15. In vivo Knockdown of SOD1 in Mice

[0795] On study day 1, female Balb / c mice were dosed intravenously (IV) with either saline solution or test article comprising a GLP1R targeting ligand, according to the dosing schedule below:

[0796] Table 24: Dosing regimen for the mice of Example 15.

[0797] On study day 8, mice were sacrificed and samples of heart tissue were taken from each animal. Samples were analyzed by qPCR for SOD1 mRNA knockdown, using mouse ARL1 (mARL1) as a control gene. Treatment groups were normalized to group 1 (saline control). Average knockdown of SOD1 for each group are shown in Table 25 below:

[0798] Table 25: Relative expression of SOD1 mRNA in heart tissue analyzed by qPCR for each of the dosing groups of Example 15.

[0799] As can be seen in Table 25, RNAi agents comprising a GLP1R targeting ligand and a lipid achieve deep and durable knockdown of a gene expressed in heart tissue. Group 2, dosed with AC002700 (comprising GLP1R-SM-4) demonstrated the greatest knockdown of SOD1 at 0.5 mpk. Example 16. In vivo Knockdown of SOD1 in Mice

[0800] On study day 1, female Balb / c mice were dosed intravenously (IV) with either saline solution or test article comprising a GLP1R targeting ligand, according to the dosing schedule below:

[0801] Table 26: Dosing regimen for the mice of Example 16.

[0802] On study day 8, mice were sacrificed and samples of heart tissue were taken from each animal. Samples were analyzed by qPCR for SOD1 mRNA knockdown, using mouse ARL1 (mARL1) as a control gene. Treatment groups were normalized to group 1 (saline control). Average knockdown of SOD1 for each group are shown in Table 27 below:

[0803] Table 27: Relative expression of SOD1 mRNA in heart tissue analyzed by qPCR for each of the dosing groups of Example 16.

[0804] As can be seen in Table 27, RNAi agents comprising a GLP1R targeting ligand and a lipid achieve deep and durable knockdown of a gene expressed in heart tissue. Group 6, dosed with AC003390 (comprising GLP1R-SM-4) demonstrated the greatest knockdown of SOD1. Example 17. In vivo Knockdown of SOD1 in Mice

[0805] On study day 1, female Balb / c mice were dosed intravenously (IV) with either saline solution or test article comprising a GLP1R targeting ligand, according to the dosing schedule below:

[0806] Table 28: Dosing regimen for the mice of Example 17.

[0807] On study day 8, mice were sacrificed and samples of heart tissue were taken from each animal. Samples were analyzed by qPCR for SOD1 mRNA knockdown, using mouse ARL1 (mARL1) as a control gene. Treatment groups were normalized to group 1 (saline control). Average knockdown of SOD1 for each group are shown in Table 29 below:

[0808] Table 29: Relative expression of SOD1 mRNA in heart tissue analyzed by qPCR for each of the dosing groups of Example 17.

[0809] As can be seen in Table 29, RNAi agents comprising a GLP1R targeting ligand and a lipid achieve deep and durable knockdown of a gene expressed in heart tissue. Group 5, dosed with AC003392 (comprising GLP1R-SM-21) demonstrated the greatest knockdown of SOD1 at 0.3 mpk. Example 18. In vivo Knockdown of SOD1 in Mice

[0810] On study day 1, female Balb / c mice were dosed intravenously (IV) with either saline solution or test article comprising a GLP1R targeting ligand, according to the dosing schedule below:

[0811] Table 30: Dosing regimen for the mice of Example 18.

[0812] On study day 8, mice were sacrificed and samples of heart tissue were taken from each animal. Samples were analyzed by qPCR for SOD1 mRNA knockdown, using mouse ARL1 (mARL1) as a control gene. Treatment groups were normalized to group 1 (saline control). Average knockdown of SOD1 for each group are shown in Table 31 below:

[0813] Table 31: Relative expression of SOD1 mRNA in heart tissue analyzed by qPCR for each of the dosing groups of Example 18.

[0814] As can be seen in Table 31, RNAi agents comprising a GLP1R targeting ligand and a lipid achieve deep and durable knockdown of a gene expressed in heart tissue. Group 16, dosed with AC005351 (comprising GLP1R-SM-1012) demonstrated the greatest knockdown of SOD1. Example 19. In vivo Knockdown of SOD1 in Mice

[0815] On study day 1, female Balb / c mice were dosed intravenously (IV) with either saline solution or test article comprising a GLP1R targeting ligand, according to the dosing schedule below:

[0816] Table 32: Dosing regimen for the mice of Example 19.

[0817] On study day 8, mice were sacrificed and samples of heart tissue were taken from each animal. Samples were analyzed by qPCR for SOD1 mRNA knockdown, using mouse ARL1 (mARL1) as a control gene. Treatment groups were normalized to group 1 (saline control). Average knockdown of SOD1 for each group are shown in Table 33 below:

[0818] Table 33: Relative expression of SOD1 mRNA in heart tissue analyzed by qPCR for each of the dosing groups of Example 19.

[0819] As can be seen in Table 33, RNAi agents comprising a GLP1R targeting ligand and a lipid achieve deep and durable knockdown of a gene expressed in heart tissue. Group 15, dosed with AC006070 (comprising GLP1R-SM-1083) demonstrated the greatest knockdown of SOD1. Example 20. In vivo Knockdown of SOD1 in Mice

[0820] On study day 1, female Balb / c mice were dosed intravenously (IV) with either saline solution or test article comprising a GLP1R targeting ligand, according to the dosing schedule below:

[0821] Table 34: Dosing regimen for the mice of Example 20.

[0822] On study day 8, mice were sacrificed and samples of heart tissue were taken from each animal. Samples were analyzed by qPCR for SOD1 mRNA knockdown, using mouse ARL1 (mARL1) as a control gene. Treatment groups were normalized to group 1 (saline control). Average knockdown of SOD1 for each group are shown in Table 35 below:

[0823] Table 35: Relative expression of SOD1 mRNA in heart tissue analyzed by qPCR for each of the dosing groups of Example 20.

[0824] As can be seen in Table 35, RNAi agents comprising a GLP1R targeting ligand and a lipid achieve deep and durable knockdown of a gene expressed in heart tissue. Group 8, dosed with AC006462 (comprising GLP1R-SM-1059) demonstrated the greatest knockdown of SOD1. Example 21. In vivo Knockdown of SOD1 in Mice

[0825] On study day 1, female Balb / c mice were dosed intravenously (IV) with either saline solution or test article comprising a GLP1R targeting ligand, according to the dosing schedule below:

[0826] Table 36: Dosing regimen for the mice of Example 21.

[0827] On study day 8, mice were sacrificed and samples of heart tissue were taken from each animal. Samples were analyzed by qPCR for SOD1 mRNA knockdown, using mouse ARL1 (mARL1) as a control gene. Treatment groups were normalized to group 1 (saline control). Average knockdown of SOD1 for each group are shown in Table 37 below:

[0828] Table 37: Relative expression of SOD1 mRNA in heart tissue analyzed by qPCR for each of the dosing groups of Example 21.

[0829] As can be seen in Table 37, RNAi agents comprising a GLP1R targeting ligand and a lipid achieve deep and durable knockdown of a gene expressed in heart tissue. Group 11, dosed with AC003162 (comprising GLP1R-SM-14) demonstrated the greatest knockdown of SOD1.EQUIVALENTS AND SCOPE

[0830] In the claims articles such as “a,” “an,” and “the” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.

[0831] Furthermore, the invention encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, and descriptive terms from one or more of the listed claims is introduced into another claim. For example, any claim that is dependent on another claim can be modified to include one or more limitations found in any other claim that is dependent on the same base claim. Where elements are presented as lists, e.g., in Markush group format, each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should it be understood that, in general, where the invention, or aspects of the invention, is / are referred to as comprising particular elements and / or features, certain embodiments of the invention or aspects of the invention consist, or consist essentially of, such elements and / or features. For purposes of simplicity, those embodiments have not been specifically set forth in haec verba herein. It is also noted that the terms “comprising” and “containing” are intended to be open and permits the inclusion of additional elements or steps. Where ranges are given, endpoints are included. Furthermore, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or sub–range within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.

[0832] This application refers to various issued patents, published patent applications, journal articles, and other publications, all of which are incorporated herein by reference. If there is a conflict between any of the incorporated references and the instant specification, the specification shall control. In addition, any particular embodiment of the present invention that falls within the prior art may be explicitly excluded from any one or more of the claims. Because such embodiments are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein. Any particularembodiment of the invention can be excluded from any claim, for any reason, whether or not related to the existence of prior art.

Claims

CLAIMS What is claimed is:

1. A compound, or a pharmaceutically acceptable salt thereof, of Formula (I′):wherein: the targeting ligand has affinity for a receptor present on the surface of a cardiomyocyte; the RNAi agent comprises: (iii) an antisense strand comprising 17-49 nucleotides wherein at least 15 nucleotides are complementary to the mRNA sequence of a gene that is expressed in cardiomyocytes; (iv) a sense strand that is 16-49 nucleotides in length that is at least partially complementary to the antisense strand; and m is 1, 2, 3, 4, or 5.

2. A compound for inhibiting expression of a gene expressed in cardiomyocytes comprising: (c) an RNAi agent comprising: (iii) an antisense strand comprising 17-49 nucleotides wherein at least 15 nucleotides are complementary to the mRNA sequence of a gene that is expressed in cardiomyocytes; (iv) a sense strand that is 16-49 nucleotides in length that is at least partially complementary to the antisense strand; and (d) a delivery vehicle comprising: (iii) a targeting ligand with affinity for a receptor present on the surface of a cardiomyocyte; and (iv) a PK / PD modulator; wherein the RNAi agent is covalently linked to the targeting ligand and to the PK / PD modulator.

3. The compound of claim 1 or 2, wherein the PK / PD modulator is of Formula (I):wherein: L1 is a linking moiety; L2 is selected from the group consisting of: optionally substituted alkylene, optionally substituted arylene, 2-20 polyethylene glycol (PEG) units optionally interrupted by C(O)NR3, wherein R3is selected from C1-C6alkyl and H, and a bond; Z is selected from the group consisting of: CH (wherein p is 1), CH2(wherein p is 0), N (wherein p is 1), optionally substituted arylene, C(O)NR3(wherein p is 0), heterocyclene, and NR3(wherein p is 0), wherein R3is selected from C1-C6alkyl and H; p is 0 or 1, as valency permits; Y1and Y2are each independently selected from the group consisting of: 2-20 polyethylene glycol (PEG) units, optionally substituted alkyl, optionally substituted cycloalkyl, and a bond; X1and X2are each independently selected from the group consisting of: C(O), C(O)NR2and a bond, wherein R2is C1-C6alkyl or H; n and m are each independently an integer from 8 to 20; W1and W2are each independently selected from the group consisting of: H, COOH andwherein indicates a point of connection to the remainder of the compound.

4. The compound of claim 3, wherein L1is selected from the group consisting of -S-, maleimide, C(O)NH, and triazole,5 The compound of claim 3 or 4, wherein. 6 The compound of claim 3 or claim 4, wherein L1is. 7 The compound of any one of claims 3-6, wherein L2 is selected from the group c8. The compound of any one of claims 3-7, wherein Z is selected from the group consisting of:bond.

9. The compound of any one of claims 3-8, wherein Y1is selected from the groupc10. The compound of any one of claims 3-9, wherein X1is C(O)NR2.

11. The compound of claim 10, wherein R2is H.

12. The compound of any one of claims 3-11, wherein n is 13, 14, 15, or 16.

13. The compound of any one of claims 3-12, wherein p is 0.

14. The compound of any one of claims 3-12, wherein p is 1.

15. The compound of claim 14, wherein Z is N.

16. The compound of any one of claims 3-15, wherein W1 is H.

17. The compound of any one of claims 3-16, wherein L2comprises between 2-5 PEG units.

18. The compound of any one of claims 1-17, wherein the PK / PD modulator is selected from the group consisting of:whereinindicates the point of connection of the PK / PD modulator to the remainder of the compound.

19. The compound of any one of claims 1-18, wherein the PK / PD modulator is of the formula:(LP161),whereinindicates the point of connection of the PK / PD modulator to the remainder of the compound.

20. The compound of any one of claims 1-19, wherein the targeting ligand is of Formula (II):or a pharmaceutically acceptable salt thereof, wherein: R comprises an oligonucleotide-based agent; A is a substituted or unsubstituted carbocyclic or bicyclic ring, or a substituted or unsubstituted arylene ring; B is a substituted or unsubstituted heteroarylene ring; C is a substituted or unsubstituted, monocyclic, bicyclic, spirocyclic, or heterocyclic ring; or a substituted or unsubstituted heteroarylene ring; Y is –O–, –S–, or –N(Rc)–; L1ais a linker comprising 2-20 PEG units; L2ais a linking moiety; Z1and Z2are each independently –O–, –S–, –N(Rb)–, –C(Ra)2–, –C(=O)–, or – C(=O)N(Rb)–, each instance of Raand Rbis independently hydrogen, substituted or unsubstituted alkyl, or -S(O)2-Rd; wherein Rdis a substituted or unsubstituted carbocyclic ring; Rcis substituted or unsubstituted alkyl, or a substituted or unsubstituted carbocyclic ring; and indicates a point of connection to the remainder of the compound.

21. The compound of claim 20, wherein A is a substituted or unsubstituted arylene ring.

22. The compound of claim 20 or 21, wherein A is a substituted or unsubstituted phenylene ring.

23. The compound of claim 20, wherein A is selected from the group consisting of:, ,24. The compound of any one of claims 20-23, wherein A is of the formula:

25. The compound of any one of claims 20-24, wherein Z1is O.

26. The compound of any one of claims 20-25, wherein B is selected from the group c.

27. The compound of any one of claims 20-25, wherein B is a substituted or unsubstituted thiazolene ring.

28. The compound of any one of claims 20-25, wherein B is of the formula:.

29. The compound of any one of claims 20-28, wherein C is a substituted or unsubstituted, monocyclic, bicyclic, or spirocyclic, heterocyclene ring.

30. The compound of any one of claims 20-29, wherein C is a substituted or unsubstituted, monocyclic heterocyclene ring.

31. The compound of any one of claims 20-28, wherein C is selected from the group c32. The compound of any one of claims 20-28, wherein C is of the formula:.

33. The compound of any one of claims 20-32, wherein Y is –N(Rc)–.

34. The compound of any one of claims 20-33, wherein Rcis substituted or unsubstituted alkyl.

35. The compound of any one of claims 20-33, wherein Rcis selected from the group c36. The compound of any one of claims 20-33, wherein Rcis substituted or unsubstituted ethylene.

37. The compound of any one of claims 20-33, wherein Rcis of the formula:.

38. The compound of any one of claims 20-37, wherein Z2is –C(Ra)2–.

39. The compound of any one of claims 20-37, wherein Z2is –C(=O)–.

40. The compound of any one of claims 20-39, wherein each instance of Rais H.

41. The compound of any one of claims 1-9, wherein the targeting ligand is of Formula (III):or a pharmaceutically acceptable salt thereof, wherein: R1is hydrogen, halogen, alkyl, or –ORd; Rdis substituted or unsubstituted alkyl; L1ais a linker comprising 2-20 PEG units; L2ais a linking moiety, and indicates a point of connection to the remainder of the compound.

42. The compound of claim 41, wherein the compound is of Formula (III-1):wherein: R1is hydrogen, halogen, substituted or unsubstituted alkyl, or –ORd; Rdis substituted or unsubstituted alkyl; L1ais a linker comprising 2-20 PEG units; L2ais a linking moiety; and indicates a point of connection to the remainder of the compound.

43. The compound of claim 41 or 42, wherein R1is a halogen.

44. The compound of any one of claims 41-43, wherein R1is Br, Cl, or F.

45. The compound of claim 41 or 42, wherein R1is Br.

46. The compound of claim 41 or 42, wherein R1is H.

47. The compound of claim 41 or 42, wherein R1is methyl.

48. The compound of claim 41 or 42, wherein R1is -OCH3.

49. The compound of any one of claims 20-48, wherein L1is a linker comprising 2-20 PEG units.

50. The compound of any one of claims 20-48, wherein L1is selected from the group c ,.

51. The compound of any one of claims 20-50, wherein L2is of the formula:.

52. The compound of any one of claims 20-50, wherein L2is of the formula.

53. The compound of claim 20, wherein the targeting ligand is selected from the group consisting of:w.

54. The compound of claim 20, wherein the targeting ligand is selected from the group consisting of:wherein indicates a point of connection to the remainder of the compound.

55. The compound of claim 41, wherein the targeting ligand is selected from the groupconsisting of:wherein indicates a point of connection to the remainder of the compound.

56. The compound of claim 41, wherein the targeting ligand is selected from the group c57. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein the targeting ligand is selected from the group consisting of:wherein indicates a point of connection to the remainder of the compound.

58. The compound of any one of claims 1-57, wherein the targeting ligand has affinity for a glucagon like peptide (GLP) receptor.

59. The compound of any one of claims 1-58, wherein the targeting ligand has affinity for the GLP receptor 1 (GLP1R).

60. The compound of any one of claims 1-59, wherein the RNAi agent inhibits expression of the mRNA of a human gene in a cardiomyocyte.

61. The compound of any one of claims 1-60, wherein the pharmaceutically acceptable salt is a sodium salt.

62. The compound of any one of claims 1-60, wherein the pharmaceutically acceptable salt is a potassium salt.

63. A composition comprising the compound of any one of claims 1-62.

64. A pharmaceutical composition comprising the composition of claim 63 and a pharmaceutical excipient.

65. The pharmaceutical composition of claim 64, wherein the pharmaceutical excipient is selected form water for injection and saline solution.

66. The pharmaceutical composition of claim 65, wherein the pharmaceutical excipient is saline solution.

67. A method of treating a disease or disorder of a cardiomyocyte comprising administering to a subject in need thereof the compound of any one of claims 1-62, or a composition or pharmaceutical composition of any one of claims 63-66.

68. The method of claim 67, wherein the disease or disorder is mediated by a gene expressed in a cardiomyocyte.

69. Use of the compound of any one of claims 1-62, or the composition or pharmaceutical composition of any one of claims 63-66, for the delivery of an RNAi agent to a cardiomyocyte.

70. The use according to claim 69, wherein the cardiomyocyte is within a subject.

71. The use according to claim 70, wherein the subject is a human subject.

72. The use according to any one of claims 69-71, wherein the RNAi agent inhibits expression of a target gene in the cardiomyocyte by at least about 50%.

73. Use of the compound of any one of claims 1-62 or the composition or pharmaceutical composition of any one of claims 63-66 for the preparation of a medicament for the treatment of a disease or disorder.

74. The use of claim 73, wherein the disease or disorder is mediated by a gene expressed in cardiomyocytes.

75. A method of making the compound of any one of claims 1-62, the method comprising: (i) synthesizing the sense strand;(ii) synthesizing the antisense strand; (iii) annealing the sense strand and the antisense strand; (iv) before or after annealing the sense strand and the antisense strand, conjugating the targeting ligand to the sense strand or the antisense strand; and (v) before or after annealing the sense strand and the antisense strand, and before or after conjugating the targeting ligand to the sense strand or the antisense strand, conjugating the PK / PD modulator to the sense strand or the antisense strand.

Citation Information

Patent Citations

  • GLP-1r modulating compounds

    US20220306614A1

  • Compositions and methods of treating muscle atrophy and myotonic dystrophy

    WO2019113393A1

  • Rnai agents for inhibiting expression of DM1 protein kinase (DMPK) compositions thereof, and methods of use

    WO2024086633A1