Inflammation-inducible vectors encoding HMGB1 antagonists for treatment of inflammatory diseases

Abstract

The present invention provides a method of treating a disease or condition in a subject characterized by an inflammatory response, comprising administering to the subject an effective amount of a nucleic acid encoding HMGB1 Box A wherein the HMGB1 Box A antagonizes an intact HMGB1 in the subject, wherein the nucleic acid comprises a promoter that regulates expression of the nucleic acid encoding HMGB 1 Box A, wherein the promoter is an inflammation-inducible promoter that is activated by an inflammatory signal. Viral vectors encoding HMGB 1 Box A for use in the methods are also provided.

Description

[0001] INFLAMMATION-INDUCIBLE VECTORS ENCODING HMGB1

[0002] ANTAGONISTS FOR TREATMENT OF INFLAMMATORY DISEASES CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Provisional Appl. No. 63 / 680,304, filed on August 7, 2024, and U.S. Provisional Appl. No. 63 / 721,755 filed on November 18, 2024, the contents of which are hereby incorporated by reference in their entirety.

[0004] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT

[0005] This invention was made with government support under Grant Number HL 167254 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0006] INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY

[0007] Incorporated by reference in its entirety herein is a computer-readable sequence listing submitted concurrently herewith and identified as follows: One 104,773 Byte XML file named “Sequencejisting.xml,” created on August 7, 2025.

[0008] FIELD OF THE INVENTION

[0009] The field of the invention relates to medicine and more specifically to treatments for inflammation, in particular, caused by viral infections, such as influenza.

[0010] BACKGROUND OF THE INVENTION

[0011] Influenza virus infection causes serious disease in millions and can lead to a massive death toll during pandemics (Morens et al., I Infect Dis, (2008), 198:962- 970; Chertow et al., JAMA, (2013), 309:275-282; Rynda-Apple et al., Infect Immun, (2015), 83:3764-3770). The need to predict which influenza strains to include into each upcoming year’s vaccine, as well as the appearance of strains to which we have no prior exposure, has led to efforts to develop a “universal influenza vaccine”, with limited success (Erbelding et al., J Infect Dis, (2018), 218:347-354; Rajao etal., Front Microbiol, (2018) 9: 123. doi: 10.3389 / fmicb.2018.00123; Nachbagauer et al., Nat Med, (2021), 27:106-114; Coughlin et al., Cell Host Microbe, (2018), 24:18-24). Efficacy of antiviral drugs is limited by their need to be administered early after infection and the appearance of drug-resistant strains (Fiore et al., MMWR Recomm Rep 60: 1-24 (2011); Gubareva et al., Antiviral Res 146:12-20 (2017)). Although influenza-induced disease is initiated by viral replication resulting in airway epithelial damage, the severe inflammatory response that follows metabolic stress in innate immune cells (e.g., macrophages (M )) elicits a “cytokine storm” that leads to acute lung injury (ALI) or the more severe acute respiratory distress syndrome (ARDS) (Nye et al., Front Pediatr, (2016), 4:128. doi: 10.3389 / fped.2016.00128; Kalil et al, Crit Care, (2019), 23:258. doi: 10.1186 / sl3054-019-2539-x; Li et al., Lancet, (2020), 395: 1517-1520).

[0012] The work of the present inventors has focused on developing strategies that modulate the host’s innate immune response to influenza infection, providing targeted therapeutic intervention. Their initial finding that TLR4 / _mice are highly refractory to lethal influenza infection led them to hypothesize that therapeutic treatment of influenza-infected mice with TLR4 antagonists would mitigate disease by blunting the “cytokine storm” (Nhu et al., Mucosal Immunol, (2010), 3:29-39; Shirey et al., Nature, (2013), 497:498-502). They first tested Eritoran (Eisai, Inc.), a potent lipid A analog antagonist that acts by competitive inhibition of the TLR4 co-receptor, MD-2 (Shirey et al., Nature, (2013), 497:498-502). Although Eritoran failed in Phase 3 clinical trials for all-cause sepsis, they reasoned that influenza, which targets the lung and leads to a “cytokine storm,” might be more amenable to therapeutic TLR4 antagonism (Opal et al., JAMA, (2013), 309:1154-1162). Eritoran treatment of mice infected with an LD90 of mouse-adapted influenza strain A / PR / 8 / 34 (PR8) starting 2 days post-infection (p.i.) for 5 days, blunted inflammatory cytokine levels and lung histopathology, with significant survival even when treatment was delayed up to 6 days p.i. (Shirey et al., Nature, (2013), 497:498-502; Piao et al., Cell Rep, (2015), 11:1941-1952; Shirey et al., Mucosal Immunol, (2016), 9:1173-1182; Perrin-Cocon et al., Sci Rep, (2017), 7:40791. doi: 10.1038 / srep40791 ; Shirey et al., Innate Immun, (2020), 26:26-34) These findings were confirmed in cotton rats (CR), Sigmodon hispidus, that, in contrast to mice, is susceptible to non-adapted human respiratory viruses, including influenza (Blanco et al., (2013), J Virol 87:2036-2045; Ottolini et al., (2005), J Gen Virol 86:2823-2830; Blanco et al., (2014), J Antivir Antiretrovir 6:40-42). Eritoran treatment of mice or CR also blunted the enhanced inflammation and lethality normally observed when influenza is followed by secondary Grampositive bacterial infection (Shirey et al., mBio, (2019), 10:e00810-19). They have since shown that many TLR4 antagonists that are structurally unrelated to Eritoran and act by distinct mechanisms are highly effective when administered therapeutically to influenza-infected mice and CR (Shirey et al., Front Immunol, (2021), 12:705080. doi: 10.3389 / fimmu.2021.705080). However, the synthesis of Eritoran is very complex, and continuous or repeated i.v. dosing is required in murine or human endotoxicity, sepsis, and influenza infection (Shirey et al., Nature, (2013), 497:498- 502; Orr JD, Patent no: US 8,377,893 B2. Date of patent: Feb. 19, 2013; Christ et al., J Am Chem Soc, (1994), 116:3637-3638; Rossignol et al., Innate Immun, (2008), 14:383-394).

[0013] Importantly, influenza does not express “pathogen- associated molecular patterns” (PAMPs) that activate TLR4 signaling. The inventors have reported that influenza-induced lung inflammation and lethality are mediated by host-derived HMGB1 (Shirey et al., Mucosal Immunol, (2016), 9: 1173-1182). HMGB1, a nuclear protein released from dying or stressed cells, was first identified as a key mediator of endotoxicity and sepsis (Andersson et al., Semin Immunol, (2018), 38:40-48; Wang et al., Science, (1999), 285:248-251; Yang et al., Proc Natl Acad Sci USA, (2004), 101:296-301; Lamkanfi etal., J Immunol, (2010), 185:4385-4392). Like the prototype TLR4 PAMP, LPS, the disulfide- HMGB1 isoform is a “danger-associated molecular pattern (DAMP)” that activates TLR4 signaling by binding the TLR4 co-receptor, MD-2 (Yang et al., J Exp Med, (2015), 212:5-14; van Zoelen et al., Shock, (2009), 31 :280-284; He et al., Mol Med, (2018), 24:21. doi:10.1186 / sl0020-018-0030-9; Sun et al., PLoS One, (2018), 13:e0193028; Sun et al., J Biomol Struct Dyn, (2019), 37:3721-3730).

[0014] However, other mechanisms of TLR4-dependent HMGB1 signaling have been proposed: (i) HMGB 1 binds LPS, transfers it to CD 14, that transfers LPS to MD- 2; and (ii) HMGB1 / LPS complexes enter the cell via the HMGB 1 receptor, Receptor for Advanced Glycation End products (RAGE), enabling LPS to interact with intracellular Caspase-11 to elicit inflammation (Youn et al., J Immunol, (2008), 180:5067-5074; Deng et al., Immunity, (2018), 49:740-753). In contrast to highly resistant TLR4 / _mice, RAGE7-mice succumb to PR8-induced lethality, although RAGE7mice exhibit a slightly extended mean time to death (Nhu et al., Mucosal Immunol, (2010), 3:29-39; Shirey et al., Nature, (2013), 497:498-502; Richard et al., J Exp Med, (2021), 218:e20200675; van Zoelen et al., Virology, (2009), 391:265- 273). Therefore, the direct HMGB1-MD-2 binding mechanism seemed most likely. To test this hypothesis, the inventors treated mice therapeutically with P5779, a small molecule inhibitor that competitively inhibits HMGB 1 binding to MD-2 and blocks TLR4 signaling (Yang et al., J Exp Med, (2015), 212:5-14; He et al., Mol Med, (2018), 24:21. doi:10.1186 / s 10020-018-0030-9). Administration of P5779 therapeutically protected PR8-infected mice comparably to Eritoran (Shirey et al., Mucosal Immunol, (2016), 9:1173-1182). However, the complex synthesis, high concentrations, and requirement for repeated dosing of TLR4 or HMGB1 inhibitors required for protection of mice are not likely to be clinically achievable. In CR infected with human influenza strains, disease severity based on lung pathology and cytokine production correlated with serum HMGB1 levels, and was reduced by Eritoran treatment (Shirey et al., mBio, (2019), 10:e00810-19; Patel et al., mBio, (2018), 9:e00246-18). These data, and those reporting that HMGB1 contributes to many other inflammatory diseases, support the hypothesis that HMGB1 signaling through TLR4 is a common denominator (Andersson et al., Annu Rev Immunol, (2011), 29: 139-162; Kang et al., Mol Med, (2014), 20:466-477; Paudel et al., Inti J Mol Sci, (2020), 21 :4609. doi: 10.3390 / ijms21134609; Andersson et al., Mol Med, (2020), 26:42. doi:10.1186 / sl0020-020-00172-4; Yang et al., Biomolecules, (2022), 12:101. doi.org / 10.3390 / bioml2010101 ; Zhang et al., Evid Based Complement Altemat Med, (2020), 8653783. doi: 101155 / 2020 / 8653783; Brammer et al., Infect Immun, (2021), 89:e00091-21; Yang et al., Cells, (2021), 10:2791. doi: 10.3390 / cellsl0102791).

[0015] There is a need to develop new methods for treating diseases or conditions that are characterized by an inflammatory response. The present invention satisfies this need and provides additional advantages as well.

[0016] This background information is provided for informational purposes only. No admission is necessarily intended, nor should it be construed, that any of the preceding information constitutes prior art against the present invention. SUMMARY OF THE INVENTION

[0017] It is to be understood that both the foregoing general description of the embodiments and the following detailed description are exemplary, and thus do not restrict the scope of the embodiments.

[0018] Herein, the present disclosure describes development of a novel, inflammation-inducible HMGB1 antagonist (Box A) expression cassette encoded by a non-replicative AdV vector, AdV.C3-Tat / HIV-Box A, that mitigates lung and systemic inflammation when administered therapeutically to influenza-infected animals. An endogenous (host) Complement C3 promoter (C3) sequence within the construct responds to inflammatory stimuli to initiate transcription of Box A. The non-replicative AdV vector that produces HMGB1 Box A is inducible by LPS and influenza in vitro and ex vivo in macrophages (M >) and protects mice and cotton rats therapeutically against infection with mouse-adapted and human non-adapted influenza strains, respectively, in vivo. This approach can be applied using diverse viral vectors and will apply not only to influenza, but also to the treatment of multiple diseases in which HMGB1 -mediated TLR4 / MD-2 signaling is a central driver of inflammation.

[0019] In one aspect, the invention provides a method of treating a disease or condition in a subject characterized by an inflammatory response, comprising administering to the subject an effective amount of a nucleic acid encoding HMGB1 Box A wherein the HMGB1 Box A antagonizes an intact HMGB1 in the subject.

[0020] In another aspect, the invention provides a nucleic acid or viral vector comprising a nucleic acid encoding HMGB1 Box A.

[0021] In another aspect, the invention provides an inflammation-inducible HMGB 1 Box A construct in a non-replicative adenovirus (AdV) vector for utility in mitigating lung and systemic inflammation therapeutically in response to influenza infection. In some embodiments, the vector can be used to treat multiple diseases in which HMGB- 1 mediated signaling is a central driver of inflammation.

[0022] Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

[0023] BRIEF DESCRIPTION OF THE DRAWINGS

[0024] The skilled artisan will understand that the drawings, described below, are for illustration purposes only. The drawings are not intended to limit the scope of the present teachings in any way.

[0025] FIG. 1. A. Structure of AdV.C3-Tat / HIV-Box A Cloned under control of a 2- component, inflammation-driven, AdV expression system (C3-Tat / HIV, top), our chimeric DNA construct encodes the HMGB1 Box A protein (green arrow) flanked by a secretory peptide (N-terminus, red arrow) and a C-terminal, 6x-His tag (purple arrow) (total 111 aa). B. Detection of HMGB 1 Box A produced in cell lysates of CR peritonea] M infected in vitro with AdV.C3-Tat / HTV-Box AGlyor -Box ASer(MOT = 1) and then treated with LPS (10 ng / ml, 18 h). C. Detection of secreted HMGB1 Box AGlyor HMGB1 Box ASerby CR BAL M obtained 24 h after i.n. infection with 107PFU of the indicated AdV.C3-Tat / HIV-Box A vector. BAL M were harvested 24 h after infection with AdV vectors, then cultured and treated with LPS for 24 h, followed by analysis of culture supernatants by WB.

[0026] FIG. 2. A. CR peritoneal M were treated with AdV.C3-Tat / HlV-Luc for 24 h and half the samples were exposed to LPS (10 ng / ml) for additional 24 h. Luciferase activity was measured in cell lysates (n=4, Student’s t test, ****, p<0.0001). B. Mice were treated with AdV.C3-Tat / HIV-Luc i.n. and challenged with saline or LPS i.t. (10 pg / mouse); mice were sacrificed at 18 h p.i. and lung luciferase levels measured; p<0.05, Student’s t test. C. CR were treated i.n. with AdV.C3-Tat / HIV-Luc (105PFU / CR) and challenged i.n. with PBS or influenza H3N2 (H / Wuhan) virus (106TCIDso / animal). CR were sacrificed at the indicated times p.i. with H3N2 (105TCID50 / CR) and luciferase expression measured in lung homogenates. (n=3-5 / group; ANOVA, ***, p<0.0001; **, p<0.01). D. CR peritoneal M(|) were exposed to LPS (10 ng / ml) for the indicated times. Expression of the endogenous cotton rat C3 gene was determined by qRT-PCR. E. CR peritoneal M(|) were transduced with AdV.C3- Tat / HIV-Box AGlyor AdV.C3-Tat / HTV-Box ASerusing an MOI = 1. Twenty-four hours post-transduction, cells were exposed to medium only (black symbols) LPS (Gly - red symbols; Ser - blue symbols) for the indicated time periods. Expression of the vector-based Box A mRNA was measured by qRT-PCR to show the kinetics of Adv.C3-Tat / HIV / Box A expression of the C3 mRNA post-LPS treatment.

[0027] FIG. 3. CR treated i.n. with PBS (A, 100 pl), or infected with H3N2 (B, 106TCIDso / animal), or AdV.C3-Tat / HIV-Luc (C and D, 107PFU / animal in 100 pl) and sacrificed on days 1 (A-C) or day 3 p.i. (D), showing undetectable lung inflammation in CR treated with AdV.C3-Tat / HIV-Luc early (C) or later (D) p.i. Magnification, 100X. Insets show details of bronchi, 200X.

[0028] FIG. 4. (A) C57BL / 6I mice were infected on day 0 with PR8 (LD90). Twenty- four hours later, mice were treated with saline (i.m.), AdV.C3-Tat / HIV-Luc (i.v.), or an equal mixture of AdV.C3-Tat / HIV-Box A variants (2 x 107PFU / mouse) administered either i.m or i.v. Data are from two separate experiments with 5 mice / treatment / experiment. Results from AdV-Luc-treated mice were obtained from 5 mice in a single experiment. (B) Mice were infected as in panel A. Twenty-four hours later, mice were treated i.v. with AdV.C3-Tat / HIV-Luc (2 X 107PFU / mouse), an equal mixture of AdV.C3-Tat / HIV-Box A variants, or the individual AdV.C3- Tat / HIV-Box A variants (Gly or Ser) (2 x 107 PFU / mouse). Data are from two separate experiments with 5 mice / treatment / experiment. (C). Mice were infected as in panel A. Mice were treated i.v. with AdV.C3-Tat / HIV-Luc (2 x 108PFU / mouse), an equal mixture of AdV.C3-Tat / HIV-Box A variants, or the individual AdV.C3- Tat / HIV-Box A variants (Gly or Ser) (2 x 108PFU / mouse). Data are from two separate experiments with 5 mice / treatment / experiment. (D) Mice were infected as in panel A. Mice were treated i.v. with AdV.C3-Tat / HIV-Luc (2 x 107PFU / mouse) or an equal mixture of AdV.C3-Tat / HIV-Box A variants (2 x 107PFU / mouse) on day 1, day 3, or day 5 post-infection. N = 5 mice / treatment group. (E) Mice were infected as in panel A. Mice were treated i.v. with AdV.C3-Tat / HIV-Luc (2 X 108PFU / mouse) or an equal mixture of AdV.C3-Tat / HIV-Box A variants (2 x 108PFU / mouse) at day 1, day 3, or day 5 p.i. N = 5 mice / treatment group.

[0029] FIG. 5. Survival of PR8-infected mice (LD90) treated i.v. with AdV.C3- Tat / HIV-Luc (black line) or AdV.C3-Tat / HIV-Box ASer / b (2x107PFU / mouse) on days 1 and 3 p.i., (blue line) or on days 2 and 4 p.i. (2xl08PFU / mouse; green line). B. Survival of PR8-infected mice (LD90) treated i.v. with AdV.C3-Tat / HIV-Luc (black line) or AdV.C3-Tat / HIV-Box ASer(2xl08PFU / mouse; purple line) on days 2 and 4 p.i. N=10 mice / treatment group.

[0030] FIG. 6. C57BL / 6J mice were infected on Day 0 with PR8 (LDQO). Twenty-four hours later, mice were treated i.v. with saline (mock), AdV.C3-TAT / HIV-Luc, or an equal mixture of AdV.C3-Tat / HIV-Box A variants (2X107PFU). A. Representative pathology of lung sections derived from mice treated therapeutically with AdV.C3- Tat / HIV-Luc or AdV.C3-Tat / HIV-Box A 24 h after infection with PR8 (LD90) at 5 days p.i. B. Quantification of lung histopathology scores for the individual mice including a combined histology score. C. Quantification of lung cytokine mRNA levels by qRT-PCR for the individual mice. B., C. Each symbol represents one mouse.

[0031] FIG. 7. CR were infected i.n. on day 0 with human influenza H3N2 (A / Wuhan / 359 / 95) 107TCID5o / CR. On day 1 p.i., CR were treated by i.v. injection with 107PFU / CR of AdV.C3-Tat / HIV-Luc, AdV.C3-Tat / HIV-Box AGlyor AdV.C3- Tat / HIV-Box ASer. CR were then sacrificed on 3 and 6 days p.i. to analyze lung cytokine mRNA expression and lung histopathology. A. mRNA expression of TNFa and IL- 10 in lung samples of CR sacrificed on day 3 p.i. (n=4 / treatment). B. Score of alveolitis at 3 days p.i. for the different groups of CR (n=4 / treatment). (C) Representative microscopic images of lungs of CR treated with AdV.C3-Tat / HIV- Luc (a), AdV.C3-Tat / HIV-Box AGly(b), or AdV.C3-Tat / HIV-Box ASer(c) showing reduced numbers of cells in the alveolar spaces of CR treated with AdV.C3-Tat / HIV-Box A vectors. Magnification, 200x. (D) mRNA expression of TNFa, IL- I p, and IL-10 in lungs of CR harvested at day 6 p.i. (n=5 / treatment) (E) Pathology scores for lungs of individual CR for peribronchioliis, perivasculitis, interstitial pneumonia, and alveolitis (n=5 / treament). (F) Representative microscopic images of lungs of CR treated with AdV.C3-Tat / HIV-Luc (a), AdV.C3-Tat / HIV-Box AGly(b), or AdV.C3- Tat / HIV-Box ASer(c) showing reduced peribronchiolitis in animals treated with AdV.C3-Tat / HIV-Box A vectors. Magnification, 40x. n=4-5 / group; Student t test, **, p<0.01; **. p<0.05.

[0032] FIG. 8. Model. Intact HMGB1 contains two domains, HMGB1 Box A and HMGB1 Box B. The HMGB1 Box A domain binds to TLR4, while the HMGB1 Box B domain binds MD-2 to elicit TLR4 signaling. In response to an inflammatory stimulus, the Adv.C3-Tat / HIV-Box A vector produces HMGB 1 Box A (in the absence of Box B) that competitively inhibits binding of the HMGB 1 Box A domain to TLR4 and precludes HMGB 1 Box B from binding to MD-2. This results in disruption of TLR4-mediated signaling.

[0033] FIG. 9. Extended mean time to death of RAGE7’ mice to influenza A / Puerto Rico / 8 / 34 virus (PR8) infection. C57BL / 6J WT and RAGE’7mice were infected with influenza PR8 (-7500 TCID50; i.n.) and monitored daily for survival for 14 days post- PR8 infection. Data represent the combined results of 2 separate experiments (WT, n=12; RAGE’7’, n=13). Data analyzed by log rank Mantel-Cox test.

[0034] FIG. 10. C57BL / 6J mice were infected on Day 0 with PR8 (LD90). Twenty- four hours later, mice were treated i.m. with an equal mixture of AdV.C3-Tat / HIV- Box A variants at either 2X107PFU / mouse or 2X108PFU / mouse. Mice were monitored for survival for 14 days. Data are from 2 separate experiments with 4-6 mice / treatment / experiment. Data analyzed by log-rank Mantel-Cox test.

[0035] FIG. 11. The lung samples analyzed in Figure 5C for cytokine mRNA expression were also analyzed for the detection of AdV DNA.

[0036] FIG. 12. A. Model for involvement of TLR4 / MD-2 and HMGB1 in influenza infection. Influenza-infected airway epithelial cells die, releasing the DAMP, HMGB1. Blocking TLR4 signaling with Eritoran17or the HMGB1 antagonist, P577919, mitigates ALI and lethality. It is expected that that the HMGB1 antagonist, Box A, expressed by an inflammation-inducible adenoviral vector, will reduce ALI, ARDS, and multi-organ failure in response to influenza and other infectious or non- infectious inflammatory agents. B. HMGB1 levels (mean + SEM) in sera of healthy controls (HCS) (n=20) and influenza-infected (n=18), hospitalized patients. Data analyzed by ANOVA with Tukey’s post-hoc test.

[0037] FIG. 13. Direct ELISA using purified, rHMGBl Box A-HisGly.

[0038] FIG. 14. Structure of AdV.Ptgs2-driven-Tat / HIV-Box A vector. The C3 promoter will be replaced with the most efficient sequence of the Ptgs2 promoter. (*) represents an uncertain base pair length due to the insertion of a new promoter sequence, but does not differ greatly from those in the original C3 -containing cassette (see Fig. 2A). DETAILED DESCRIPTION OF THE INVENTION

[0039] Influenza, as well as other respiratory viruses, can trigger local and systemic inflammation resulting in an overall "cytokine storm," that produces serious outcomes such as Acute Lung Injury (ALI) or even Acute Respiratory Distress Syndrome (ARDS). Provided herein is a gene therapy platform and methods useful in cases where production of an anti-inflammatory protein reflects the intensity and duration of the inflammatory condition. The anti-inflammatory protein can be produced and released only in the presence of the inciting stimulus, avoiding immunosuppression or other unwanted side effects that may occur when treating infectious diseases with anti-inflammatory drugs. The present disclosure describes Adv.C3-Tat / HIV-HMGBl Box A, an inflammation-inducible cassette that remains innocuous in the absence of inflammation but releases HMGB 1 Box A, an antagonist of High Mobility Group Box 1 (HMGB1), in response to an inflammatory stimulus such as influenza virus infection. The present application describes that this novel, inflammation-inducible HMGB 1 Box A construct in a non-replicative adenovirus (AdV) vector mitigates lung and systemic inflammation therapeutically in response to influenza infection. The vectors can be used in the treatment of multiple diseases in which HMGB 1 -mediated signaling is a central driver of inflammation.

[0040] Reference will now be made in detail to the presently preferred embodiments of the invention which, together with the drawings and the following examples, serve to explain the principles of the invention. These embodiments are described in sufficient detail to enable those skilled in the art to practice the invention, and it is understood that other embodiments may be utilized, and that structural, biological, and chemical changes may be made without departing from the spirit and scope of the present invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0041] The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook et al. Molecular Cloning: A Laboratory Manual, 2ndedition (1989); Current Protocols in Molecular Biology (F. M. Ausubel et al. eds. (1987)); the series Methods in Enzymology (Academic Press, Inc.); PCR: A Practical Approach (M. MacPherson et al. IRL Press at Oxford University Press (1991)); PCR 2: A Practical Approach (M. J. MacPherson, B. D. Hames and G. R. Taylor eds. (1995)); Antibodies, A Laboratory Manual (Harlow and Lane eds. (1988)); Using Antibodies, A Laboratory Manual (Harlow and Lane eds. (1999)); and Animal Cell Culture (R. I. Freshney ed. (1987)).

[0042] Definitions of common terms in molecular biology may be found, for example, in Benjamin Lewin, Genes VII, published by Oxford University Press, 2000 (ISBN 019879276Xf, Kendrew et al. (eds.); The Encyclopedia of Molecular Biology, published by Blackwell Publishers, 1994 (ISBN 0632021829); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by Wiley, John & Sons, Inc., 1995 (ISBN 0471186341).

[0043] For the purpose of interpreting this specification, the following definitions will apply and whenever appropriate, terms used in the singular will also include the plural and vice versa. In the event that any definition set forth below conflicts with the usage of that word in any other document, including any document incorporated herein by reference, the definition set forth below shall always control for purposes of interpreting this specification and its associated claims unless a contrary meaning is clearly intended (for example in the document where the term is originally used). The use of "or" means "and / or" unless stated otherwise. As used in the specification and claims, the singular form "a," "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a cell" includes a plurality of cells, including mixtures thereof. The use of “comprise,” “comprises,” “comprising,” “include,” “includes,” and “including” are interchangeable and not intended to be limiting. Furthermore, where the description of one or more embodiments uses the term “comprising,” those skilled in the art would understand that, in some specific instances, the embodiment or embodiments can be alternatively described using the language “consisting essentially of” and / or “consisting of.”

[0044] As used herein, the term "about" means plus or minus 10% of the numerical value of the number with which it is being used.

[0045] The term "subject" as used herein is not limiting and is used interchangeably with patient. In some embodiments, the subject refers to animals, such as mammals. For example, mammals contemplated include humans, primates, dogs, cats, sheep, cattle, goats, pigs, horses, chickens, mice, rats, rabbits, guinea pigs, and the like. The terms "subject" and "patient."

[0046] As used herein, "treat" and all its forms and tenses (including, for example, treating, treated, and treatment) can refer to therapeutic or prophylactic treatment. In certain aspects of the invention, those in need thereof of treatment include those already with a pathological condition of the invention (including, for example, a disease or condition characterized by inflammation), in which case treating refers to administering to a subject (including, for example, a human or other mammal in need of treatment) a therapeutically effective amount of a composition so that the subject has an improvement in a sign or symptom of a pathological condition of the invention. The improvement may be any observable or measurable improvement. Thus, one of skill in the art realizes that a treatment may improve the patient's condition but may not be a complete cure of the pathological condition. In other certain aspects of the invention, those in need thereof of treatment include, those in which a pathological condition is to be prevented, in which case treating refers to administering a therapeutically effective amount of a composition to a subject (including, for example, a human or other mammal in need of treatment) at risk of developing a disease or condition.

[0047] In some embodiments, a "therapeutically effective amount" or "effective amount" of a nucleic acid is administered to the subject. As used herein a "therapeutically effective amount" or "effective amount" is an amount sufficient to decrease, suppress, or ameliorate one or more symptoms associated with the disease or condition.

[0048] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues is a non-naturally occurring amino acid, for example, an amino acid analog. As used herein, the terms encompass amino acid chains of any length, including full length proteins, wherein the amino acid residues are linked by covalent peptide bonds. In one embodiment, the invention provides a method of treating a disease or condition in a subject characterized by an inflammatory response, comprising administering to the subject an effective amount of a nucleic acid encoding HMGB1 Box A wherein the HMGB1 Box A antagonizes an intact HMGB1 in the subject.

[0049] The disease or condition is not limiting. In some embodiments, the inflammatory response is caused by a pathogenic infection. In some embodiments, the pathogenic infection is a viral infection. In some embodiments, the viral infection is an influenza infection. In some embodiments, the inflammatory response is caused by trauma. In some embodiments, the inflammatory response is caused by acute lung injury. In some embodiments, the inflammatory response is caused by ischemia. In some embodiments, the inflammatory response is caused by radiation-induced damage. In some embodiments, the inflammatory response is caused by burn. In some embodiments, the inflammatory response is caused by cancer.

[0050] In some embodiments, the invention provides a nucleic acid or vector encoding HMGB 1 Box A, wherein the HMGB 1 Box A antagonizes an intact HMGB 1 when the nucleic acid or vector is administered to the subject.

[0051] HMGB1 contains two ~80 amino acid domains, Box A and Box B. In some embodiments, wild-type HMGB1 comprises the sequence found in Genbank accession number: NM_001363661. In some embodiments, HMGB1 has the amino acid sequence of SEQ ID NO: 1 and nucleotide sequence of SEQ ID NO:2. “HMGB 1 Box A” as used herein encompasses proteins or nucleic acids encoding not only the wild-type Box A domain of HMGB 1 , but also modifications of the HMGB 1 Box A domain, including fragments, insertions, deletions, substitutions, and N-terminal and C-terminal fusions, e.g., fusions with signal leader and / or purification / detection sequences. The wild-type and modified HMGB1 Box A as provided herein antagonizes an intact HMGB1 in a subject or in vitro and reduces an inflammatory response.

[0052] In some embodiments, the HMGB1 Box A is a wild-type amino acid sequence corresponding to the HMGB 1 Box A sequence found in SEQ ID NO: 1 or encoded by the corresponding nucleic acid found in SEQ ID NO:2. Table 1. HMGB1, HMBG1 Box A, , signal sequence, expression tag, and fusion sequences.

[0053] In some embodiments, the nucleic acid encodes a HMGB1 Box A amino acid sequence that is modified from a wild-type sequence. In some embodiments, HMGB1 Box A nucleotide sequence is codon optimized for expression, based on degeneracy of the genetic code.

[0054] In some embodiments, the HMGB 1 Box A amino acid sequence is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the corresponding to the HMGB1 Box A sequence found in SEQ ID NO: 1.

[0055] In some embodiments, the nucleic acid encoding HMGB1 Box A sequence is at least 70%, at least 75%, at least 80%, at least 85% at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the corresponding to the HMGB1 Box A nucleic acid found in SEQ ID NO:2. In some embodiments, the HMGB 1 Box A comprises a fusion protein. In some embodiments, the modified HMGB1 Box A amino acid sequence comprises a signal peptide sequence to enhance secretion. In some embodiments, the signal peptide sequence comprises an IgK signal peptide. In some embodiments, the IgK signal peptide comprises an amino acid sequence of SEQ ID NO:7 and a nucleotide sequence of SEQ ID NO:8. In some embodiments, the signal peptide sequence is fused to the N-terminus of a HMGB I Box A amino acid sequence.

[0056] In some embodiments, the HMGB1 Box A amino acid sequence comprises SEQ ID NO:5. In some embodiments, the HMGB1 Box A nucleotide sequence comprises SEQ ID NO:6.

[0057] In some embodiments, the modified HMGB1 Box A amino acid sequence comprises an amino acid substitution at a putative glycosylation site. In some embodiments, a serine residue in the glycosylation site is mutated to a glycine residue to preclude glycosylation. In some embodiments, the HMGB1 Box A having a mutation at a glycosylation site has an amino acid sequence comprising SEQ ID NO: 11. In some embodiments, the HMGB1 Box A having a mutation at a glycosylation site has a nucleotide sequence comprising SEQ ID NO: 12. In some embodiments, the subject is administered a combination of vectors encoding different HMGB 1 Box A nucleic acids, wherein the nucleic acids encode i) a HMGB1 Box A that comprises a substitution at one glycosylation site (e.g., an HMGB 1 Box A comprising SEQ ID NO: 11) and ii) a HMGB1 Box A that does not comprise a substitution at one putative glycosylation site (e.g., an HMGB1 Box A comprising SEQ ID NO:5).

[0058] In some embodiments, the modified HMGB1 Box A amino acid sequence comprises a purification or detection tag. In some embodiments, the purification or detection tag is fused to the C-terminus of HMGB1 Box A. In some embodiments, the tag is a 6X-His tag comprising an amino acid sequence of SEQ ID NO:9 and a nucleotide sequence comprising SEQ ID NO: 10.

[0059] In some embodiments, the subject is administered a vector or nucleic acid comprising a nucleic acid sequence encoding HMGB1 Box A having an amino acid sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NOS:5 or 11. In some embodiments, the subject is administered a nucleic acid encoding HMGB1 Box A having an amino acid sequence comprising SEQ ID NO: 5 or 11.

[0060] In some embodiments, the subject is administered a vector or nucleic acid comprising a nucleic acid sequence encoding HMGB 1 Box A (including a leader and expression tag sequence) having an amino acid sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NOS:3 or 13. In some embodiments, the subject is administered a nucleic acid encoding HMGB1 Box A (including a leader and expression tag sequence) having an amino acid sequence comprising SEQ ID NO:3 or 13. In some embodiments, the vector or nucleic acid comprises a nucleic acid that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NOS:4 or 14. In some embodiments, the vector or nucleic acid comprises a nucleic acid that is identical to SEQ ID NOS:4 or 14.

[0061] In some embodiments, the nucleic acid is DNA or RNA. The delivery of the nucleic acids comprising HMGB1 Box A is not necessarily limiting. In some embodiments, the nucleic acids are delivered by nanoparticles, e.g., lipid nanoparticles. In some embodiments, HMGB1 Box A is encoded by a vector, such as a viral vector.

[0062] In some embodiments, nucleic acids or vectors used in the compositions and methods described herein include polynucleotide sequences that encode HMGB1 Box A, such as polynucleotide sequences that encodes a protein having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to the amino acid sequence of HMGB1 Box A corresponding to SEQ ID NOS:5 or 11.

[0063] According to the methods described herein, a subject can be administered a composition containing a nucleic acid or vector encoding the amino acid sequence of SEQ ID NO: 1 or a polynucleotide sequence encoding an amino acid sequence having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to the amino acid sequence of SEQ ID NOS:5 or 11, or a polynucleotide sequence encoding an amino acid sequence that contains one or more conservative amino acid substitutions relative to SEQ ID NOS: 5 or 11 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more conservative amino acid substitutions), provided that the variant encoded retains the therapeutic function of HMGB 1 Box A, viz., the ability to antagonize an intact HMGB 1 in a subject or in vitro and reduces an inflammatory response. In some embodiments, the variant comprises an amino acid sequence that is at least 90% identical to SEQ ID NOS: 5 or 11.

[0064] In some embodiments, no more than 10% of the amino acids in wild-type HMGB1 Box A may be replaced with conservative amino acid substitutions. In some embodiments, the HMGB1 Box A may be encoded by a polynucleotide having the sequence of SEQ ID NOS:6 or 12. Variants of the polynucleotide sequence can also be used, for example, due to degeneracy of codon usage.

[0065] The organismal source of the nucleic acid sequence encoding HMGB1 Box A is not limiting. In some embodiments, HMGB1 Box A can be a homolog of human HMGB1 Box A from another mammalian species (e.g., mouse, rat, cow, horse, goat, sheep, donkey, cat, dog, rabbit, guinea pig, or other mammal). In some embodiments, the nucleic acid sequence is derived from a mammal. In some embodiments, the nucleic acid sequence is of human origin.

[0066] The nucleic acid molecules that can comprise the vector can be produced using recombinant DNA technology (e.g., polymerase chain reaction (PCR) amplification, cloning) or chemical synthesis. Nucleic acids that encode HMGB 1 Box A include natural nucleic acid molecules and homologues thereof, including, but not limited to, natural allelic variants and modified nucleic acid molecules in which nucleotides have been inserted, deleted, substituted, and / or inverted in such a manner that such modifications provide the desired effect (e.g., production of HMGB1 Box A protein in cells or other expression systems).

[0067] In some embodiments, the coding sequence of HMGB1 Box A is encoded by SEQ ID NO:2. The nucleic acid encoding HMGB1 Box A in accordance with the invention may contain a variety of different bases compared to the wild-type sequence and yet still encode a corresponding polypeptide that exhibits the biological activity of the wild-type HMGB 1 Box A polypeptide.

[0068] In some embodiments, a particular nucleotide sequence encoding HMGB1 Box A polypeptide may be identical over its entire length to the coding sequence in SEQ ID N0:2. In some embodiments, a particular nucleotide sequence encoding HMGB 1 Box A polypeptide may be an alternate form of SEQ ID NOS:6 or 12 due to degeneracy in the genetic code or variation in codon usage encoding the polypeptide of SEQ ID NOS:5 or 11.

[0069] In some embodiments, the nucleic acid sequence of HMGB1 Box A can contain a nucleotide sequence that is highly identical, at least 60% identical, with a nucleotide sequence encoding HMGB I Box A polypeptide. In some embodiments, the nucleic acid sequence of HMGB 1 Box A comprises a nucleotide sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% 99% or 100% identical with the encoding nucleotide sequence set forth in SEQ ID NOS:6 or 12.

[0070] When a polynucleotide of the invention is used for the production of HMGB 1 Box A polypeptide, the polynucleotide may include the coding sequence for the full- length polypeptide of HMGB 1 Box A or a fragment thereof, by itself; the coding sequence for the full-length polypeptide or fragment in reading frame with other coding sequences, such as those encoding a leader or secretory sequence, a pre-, or pro or prepro-protein sequence, or other fusion peptide portions. The polynucleotide may also contain non-coding 5’ and 3' sequences, such as transcribed, non-translated sequences, splicing and poly adenylation signals, ribosome binding sites and sequences that stabilize mRNA.

[0071] In some embodiments, the vector encoding the HMGB 1 Box A peptide includes nucleic acid molecules comprising a polynucleotide having a nucleotide sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% 99% or 100% identical to (a) a nucleotide sequence encoding HMGB 1 Box A having the amino acid sequence in SEQ ID NOS:5 or 11; or (b) a nucleotide sequence complementary to the nucleotide sequences in (a).

[0072] Conventional means utilizing known computer programs such as the BestFit program (Wisconsin Sequence Analysis Package, Version 10 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis. 53711) may be utilized to determine if a particular nucleic acid or amino acid molecule is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NOS:! or 2, for example. In some embodiments, the nucleotide sequences used in the vector encoding HMGB 1 Box A encodes an amino acid sequence of HMGB 1 Box A of SEQ ID NOS:5 or 11, in which 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid residues are substituted, deleted or added, in any combination.

[0073] In some embodiments, the nucleotide sequences are at least 90% identical over their entire length to a polynucleotide encoding the corresponding portion of HMGB 1 Box A, for which the amino acid sequence is set out in SEQ ID NOS:5 or 11, and polynucleotides which are complementary to such polynucleotides. In some embodiments, the polynucleotides are at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identical.

[0074] In some embodiments, the nucleic acid molecule encodes a modification of wild-type HMGB 1 Box A protein which is a biologically active fragment. In some embodiments, the biologically active fragment can be at least about 60, 61 , 62, 63, 64, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, or 79 amino acids in length.

[0075] In some embodiments, HMGB 1 Box A is expressed transiently in cells. In some embodiments, HMGB1 Box A is stably expressed in cells.

[0076] In some embodiments, stable expression of HMGB1 Box A in a mammalian cell can be achieved by integration of the polynucleotides containing the HMGB 1 Box A or variant thereof into the nuclear genome of the mammalian cell. A variety of vectors for the delivery and integration of polynucleotides encoding exogenous proteins into the nuclear DNA of a mammalian cell have been developed. In some embodiments, expression vectors for use in the compositions and methods described herein contain a polynucleotide sequence that encodes HMGB1 Box A, as well as, e.g., additional sequence elements used for the expression of these agents and / or the integration of these polynucleotide sequences into the genome of a mammalian cell. Certain vectors that can be used for the expression of HMGB1 Box A include plasmids that contain regulatory sequences, such as promoter and enhancer regions, which direct gene transcription. Other useful vectors for expression of HMGB 1 Box A contain polynucleotide sequences that enhance the rate of translation of these genes or improve the stability or nuclear export of the mRNA that results from gene transcription. These sequence elements include, e.g., 5’ and 3’ untranslated regions and a polyadenylation signal site in order to direct efficient transcription of the gene carried on the expression vector. The expression vectors suitable for use with the compositions and methods described herein may also contain a polynucleotide encoding a marker for selection of cells that contain such a vector. Examples of a suitable marker include genes that encode resistance to antibiotics, such as ampicillin, chloramphenicol, kanamycin, or nourseothricin.

[0077] Vectors or nucleic acids for stable or transient expression of HMGB1 Box A can be introduced into a cell by a variety of methods, including transformation, transfection, transduction, direct uptake, projectile bombardment, and by encapsulation of the vector or nucleic acid in a liposome or lipid nanoparticle. Examples of suitable methods of transfecting or transforming cells include calcium phosphate precipitation, electroporation, microinjection, infection, lipofection and direct uptake. Such methods are described in more detail, for example, in Green, et al. , Molecular Cloning: A Laboratory Manual, Fourth Edition (Cold Spring Harbor University Press, New York 2014); and Ausubel, et al., Current Protocols in Molecular Biology (John Wiley & Sons, New York 2015), the disclosures of each of which are incorporated herein by reference.

[0078] In some embodiments, HMGB1 Box A can also be introduced into a mammalian cell by a targeting vector to the cell membrane phospholipids. For example, vectors can be targeted to the phospholipids on the extracellular surface of the cell membrane by linking the vector molecule to a VSV-G protein, a viral protein with affinity for all cell membrane phospholipids. Such a construct can be produced using methods well known to those of skill in the field.

[0079] Recognition and binding of the polynucleotide encoding a HMGB 1 Box A by mammalian RNA polymerase is important for gene expression. As such, one may include sequence elements within the polynucleotide that exhibit a high affinity for transcription factors that recruit RNA polymerase and promote the assembly of the transcription complex at the transcription initiation site.

[0080] Such sequence elements include, e.g., a mammalian promoter, the sequence of which can be recognized and bound by specific transcription initiation factors and ultimately RNA polymerase. Polynucleotides suitable for use in the compositions and methods described herein also include those that encode an HMGB1 Box A protein downstream of a mammalian promoter.

[0081] Promoters that are useful for the expression of an HMGB1 Box A protein in mammalian cells include ubiquitous promoters and inflammation-inducible promoters. Ubiquitous promoters include the CAG promoter, or the cytomegalovirus (CMV) promoter. Cell type and tissue specific promoters can also be utilized.

[0082] In some embodiments, the promoter is an inflammation-inducible promoter that is activated by an inflammatory signal. In some embodiments, the inflammatory signal comprises one or more cytokines, such as pro-inflammatory cytokines such as IL- 1 p, IL-6, and TNF-ot, as well as chemokines like CXCL8 and CXCL6

[0083] In some embodiments, inflammation-inducible promoters include the complement C3 or the Ptgs2 gene promoter sequence. In some embodiments, the complement C3 promoter sequence comprises SEQ ID NO: 15 and Ptgs2 gene promoter sequence comprises SEQ ID NO: 16

[0084] In some embodiments, IL- 1 p and / or IFN-y activate the promoter. In some embodiments, the promoter comprises Ptgs2 gene promoter sequence.

[0085] In some embodiments, expression of HMGB1 Box A is regulated by an inflammation-inducible promoter and a secondary promoter.

[0086] In some embodiments, in the presence of the inflammatory signal, the inflammation-inducible promoter increases expression of a protein that activates the secondary promoter, wherein activation of the secondary promoter increases expression of HMGB1 Box A.

[0087] In some embodiments, the inflammation-inducible promoter comprises a complement C3 or Ptgs2 gene promoter sequence. Tn some embodiments, the complement C3 or Ptgs2 gene promoter sequence induces expression of an HIV transactivator of transcription protein (Tat), wherein the Tat protein increases expression of HMGB 1 Box A by activating the secondary promoter (HIV LTR promoter).

[0088] In some embodiments, Tat is encoded by SEQ ID NO: 17. In some embodiments, the Tat responsive element (HIV LTR) is encoded by SEQ ID NO: 18. Alternatively, promoters derived from viral genomes or from other mammalian inflammatory genes can also be used for the stable expression of these agents in mammalian cells. Examples of functional viral promoters that can be used to promote mammalian expression of these agents include adenovirus late promoter, vaccinia virus 7.5K promoter, S V40 promoter, tk promoter of HS V, mouse mammary tumor virus (MMTV) promoter, LTR promoter of HIV, promoter of Moloney virus, Epstein barr virus (EBV) promoter, and the Rous sarcoma virus (RSV) promoter.

[0089] Tn some embodiments, the vector encoding HMGB1 Box A is a viral vector. A “viral vector” is a virus that can be used to deliver genetic material into target cells. This can be done either in vivo or in vitro. In general, viral vectors are either inherently safe or are modified to present a low handling risk and have low toxicity with respect to the targeted cells. A “retrovirus” is a virus of the family Retroviridae that inserts a copy of its RNA genome into the DNA of a host cell, then uses a reverse transcriptase enzyme to produce DNA from its RNA genome. Retroviruses are known in the art to be useful in gene delivery systems. A “lentivirus” is a type of retrovirus; they are known as slow retroviruses. They are associated with severe immunodeficiency and death in humans but can be useful as viral vectors in gene therapy. An “adenovirus” is a virus of the family Adenoviridae that lacks an outer lipid bilayer and includes a double-stranded DNA genome. Adenoviruses are well established in the art as viral vectors for gene therapy and delivering genes coding proteins of interest to particular locations, as to selected cell types, is possible. An “adeno-associated virus” is of the genus Dependoparvovirus, which is of the family Parvoviridae. These are nonenveloped viruses having a single-stranded DNA genome. Adeno-associated viruses are well known in the art as attractive candidates for use as viral vectors for gene therapy. Unlike adenoviruses, they have the advantage that they do not cause disease.

[0090] In some embodiments, nucleic acids of the compositions and methods described herein are incorporated into recombinant AAV (rAAV) vectors and / or virions in order to facilitate their introduction into a cell. rAAV vectors useful in the compositions and methods described herein are recombinant nucleic acid constructs that include (1) a heterologous sequence to be expressed (e.g., a polynucleotide encoding HMGB1 Box A protein) and (2) viral sequences that facilitate stability and expression of the heterologous genes. The viral sequences may include those sequences of AAV that are required in cis for replication and packaging (e.g., functional ITRs) of the DNA into a virion. Such rAAV vectors may also contain marker or reporter genes. In some embodiments, useful rAAV vectors have one or more of the AAV wild-type genes deleted in whole or in part but retain functional flanking ITR sequences. The AAV ITRs may be of any serotype suitable for a particular application. In some embodiments, the ITRs can be AAV2 ITRs. Methods for using rAAV vectors are described, for example, in Tai et al., J. Biomed. Sci. 7:279 (2000), and Monahan and Samulski, Gene Delivery 7 2A (2000), the disclosures of each of which are incorporated herein by reference as they pertain to AAV vectors for gene delivery.

[0091] The nucleic acids and vectors described herein can be incorporated into a rAAV virion to facilitate the introduction of the nucleic acid or vector into a cell. The capsid proteins of AAV compose the exterior, non-nucleic acid portion of the virion and are encoded by the AAV cap gene. The cap gene encodes three viral coat proteins, VP1, VP2 and VP3, which are required for virion assembly. The construction of rAAV virions has been described, for instance, in U.S. Pat. Nos. 5,173,414; 5,139,941 ; 5,863,541; 5,869,305; 6,057,152; and 6,376,237; as well as in Rabinowitz et al., J. Virol. 76:791 (2002) and Bowles et al., J. Virol. 77 :423 (2003), the disclosures of each of which are incorporated herein by reference as they pertain to AAV vectors for gene delivery. rAAV virions useful in conjunction with the compositions and methods described herein include those derived from a variety of AAV serotypes including, without limitation, AAV1 , AAV2, AAV2quad(Y-F), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rhlO, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eb, and PHP.S.

[0092] Also useful in conjunction with the compositions and methods described herein are pseudotyped rAAV vectors. Pseudotyped vectors include AAV vectors of a given serotype (e.g., AAV9) pseudotyped with a capsid gene derived from a serotype other than the given serotype (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, etc.). Techniques involving the construction and use of pseudotyped rAAV virions are known in the art and are described, for instance, in Duan et al., J. Virol. 75:7662 (2001); Halbert et al., J. Virol. 74:1524 (2000); Zolotukhin et al., Methods, 28: 158 (2002); and Auricchio et al., Hum. Molec. Genet. 10:3075 (2001).

[0093] AAV virions that have mutations within the virion capsid may be used to infect particular cell types more effectively than non-mutated capsid virions. For example, suitable AAV mutants may have ligand insertion mutations for the facilitation of targeting AAV to specific cell types. The construction and characterization of AAV capsid mutants including insertion mutants, alanine screening mutants, and epitope tag mutants is described in Wu et ah, J. Virol. 74:8635 (2000). Other rAAV virions that can be used in methods described herein include those capsid hybrids that are generated by molecular breeding of viruses as well as by exon shuffling. See, e.g., Soong et al., Nat. Genet., 25:436 (2000) and Kolman and Stemmer, Nat. Biotechnol. 19:423 (2001).

[0094] In some embodiments, the viral vector is an adenoviral vector. In some embodiments, the viral vector is a human adenoviral 5 vector. In some embodiments, the viral vector is a non-replicative adenovirus vector. In some embodiments, the viral vector is selected from the group consisting of a rare serotype adenovirus vector, an adeno- associated vector, and a lentiviral vector.

[0095] In some embodiments, the invention provides an inflammation-inducible HMGB 1 Box A construct in a non-replicative adenovirus (AdV) vector for utility in mitigating lung and systemic inflammation therapeutically in response to influenza infection. In some embodiments, the vector can be used to treat multiple diseases in which HMGB-1 mediated signaling is a central driver of inflammation.

[0096] In some embodiments, the vector comprises an inflammation-inducible promoter comprising a polynucleotide sequence comprising at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater identity to SEQ ID NOS: 15 or 16.

[0097] In some embodiments, the vector comprises a poly(A) sequence. The poly(A) sequence is not particularly limiting. In some embodiments, the poly(A) sequence is at least 80% identical (at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to SEQ ID NO:19. In some embodiments, the invention provides a vector comprising a nucleic acid construct comprising an inflammation responsive promoter upstream of a HMGB1 Box A sequence, wherein the nucleic acid construct comprises a polynucleotide sequence of SEQ ID NOS:20 or 21 or a variant thereof comprising at least 60% identity (at least 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) thereto.

[0098] The compositions, vectors or nucleic acids described herein may be administered to a subject by a variety of routes, such as local administration, intravenous, parenteral, intradermal, transdermal, intramuscular, intranasal, subcutaneous, percutaneous, intratracheal, intraperitoneal, intraarterial, intravascular, inhalation, perfusion, lavage, and oral administration. The most suitable route for administration in any given case will depend on the particular composition administered, the patient, pharmaceutical formulation methods, administration methods (e.g., administration time and administration route), the patient’s age, body weight, sex, severity of the disease being treated, the patient’s diet, and the patient’s excretion rate.

[0099] Compositions may be administered once, or more than once (e.g., once on day 1 or day 2 after infection, and a second time on day 2, day 3 or day 4 after infection).

[0100] In some embodiments, the composition comprising the nucleic acid or vector is administered one or more times within 1-4 days of a viral infection, such as an influenza infection. In some embodiments, the composition is administered two times following infection. In some embodiments, the composition is administered on day 1

[0101] In some embodiments, the composition is administered to mice once on day 2, and again on day 4 post-infection. In some embodiments, the composition is administered once on day 2, and again on day 3 post-infection. In some embodiments, the composition is administered once on day 1 , and again on day 3 post-infection. In some embodiments, the composition is administered once on day 1, and again on day 4 post-infection. Of course, the number and timing of administrations can vary among species, individuals, and among inflammatory insults.

[0102] In some embodiments, expression of HMGB1 is assayed and the number and timing of administrations can be performed according to HMGB 1 expression analysis. In some embodiments, the administration results in a decrease in inflammatory cytokines in the subject.

[0103] Subjects that may be treated as described herein are subjects having or at risk of developing a disease or condition characterized by an inflammatory response. The methods described herein may include a step of screening a subject for infection or for an inflammatory response prior to treatment with or administration of the composition described herein.

[0104] Treatment may include administration of a composition containing the nucleic acid or vector (e.g., AAV vector) described herein in various unit doses. Each unit dose will ordinarily contain a predetermined quantity of the therapeutic composition. The quantity to be administered, and the particular route of administration and formulation, are within the skill of those in the clinical arts. A unit dose need not be administered as a single injection but may include continuous infusion over a set period. Dosing may be performed using a syringe pump to control the infusion rate to minimize damage to the tissue administered.

[0105] In cases in which the nucleic acids are administered by viral vectors, in some embodiments, the viral vectors may have a titer of, for example, from about 1 x 109vector genomes (VG) / mL to about 1 x 1016VG / mL (e.g., 1 x 109VG / mL, 2 x 109VG / mL, 3 x 109VG / mL, 4 x 109VG / mL, 5 x 109VG / mL, 6 x 109VG / mL, 7 x 109VG / mL, 8 x 109VG / mL, 9 x 109VG / mL, 1 x IO10VG / mL, 2 x IO10VG / mL, 3 x IO10VG / mL, 4 x IO10VG / mL, 5 x IO10VG / mL, 6 x IO10VG / mL, 7 x IO10VG / mL, 8 x IO10VG / mL, 9 x IO10VG / mL, 1 x 1011VG / mL, 2 x 1011VG / mL, 3 x 1011VG / mL, 4 x 1011VG / mL, 5 x 1011VG / mL, 6 x 1011VG / mL, 7 x 1011VG / mL, 8 x 1011VG / mL, 9 x 1011VG / mL, 1 x 1012VG / mL, 2 x 1012VG / mL, 3 x 1012VG / mL, 4 x 1012VG / mL,

[0106] 5 x 1012VG / mL, 6 x 1012VG / mL, 7 x 1012VG / mL, 8 x 1012VG / mL, 9 x 1012VG / mL,

[0107] 1 x 1013VG / mL, 2 x 1013VG / mL, 3 x 1013VG / mL, 4 x 1013VG / mL, 5 x 1013VG / mL,

[0108] 6 x 1013VG / mL, 7 x 1013VG / mL, 8 x 1013VG / mL, 9 x 1013VG / mL, 1 x 1014VG / mL,

[0109] 2 x 1014VG / mL, 3 x 1014VG / mL, 4 x 1014VG / mL, 5 x 1014VG / mL, 6 x 1014VG / mL,

[0110] 7 x 1014VG / mL, 8 x 1014VG / mL, 9 x 1014VG / mL, 1 x 1O1SVG / mL, 2 x 1O1SVG / mL,

[0111] 3 x 1015VG / mL, 4 x 1015VG / mL, 5 x 1015VG / mL, 6 x 1015VG / mL, 7 x 1015VG / mL,

[0112] 8 x 1015VG / mL, 9 x 1015VG / mL, or 1 x 1016VG / mL). In some embodiments, the viral vector may be administered to the subject at a dose of about 1 x 107VG to about 2 x 1O1SVG (e.g., 1 x 107VG, 2 x 107VG, 3 x 107VG, 4 x 107VG, 5 x 107VG, 6 x 107VG, 7 x 107VG, 8 x 107VG, 9 x 107VG, 1 x 108VG, 2 x 108VG, 3 x 108VG, 4 x 108VG, 5 x 108VG, 6 x 108VG, 7 x 108VG, 8 x 108VG, 9 x 108VG, 1 x 109VG, 2 x 109VG, 3 x 109VG, 4 x 109VG, 5 x 109VG, 6 x 109VG, 7 x 109VG, 8 x 109VG, 9 x 109VG, 1 x IO10VG, 2 x IO10VG, 3 x IO10VG, 4 x IO10VG, 5 x IO10VG, 6 x IO10VG, 7 x IO10VG, 8 x IO10VG, 9 x IO10VG,

[0113] 1 x 1011VG, 2 x 10" VG, 3 x 10" VG, 4 x 10" VG, 5 x 1011VG, 6 x 10" VG, 7 x 1011VG, 8 x 1011VG, 9 x 1011VG, 1 x 1012VG, 2 x 1012VG, 3 x 1012VG, 4 x 1012VG, 5 x 1012VG, 6 x 1012VG, 7 x 1012VG, 8 x 1012VG, 9 x 1012VG, 1 x 1013VG,

[0114] 2 x 1013VG, 3 x 1013VG, 4 x 1013VG, 5 x 1013VG, 6 x 1013VG, 7 x 1013VG, 8 x 1013VG, 9 x 1013VG, 1 x 1014VG, 2 x 1014VG, 3 x 1014VG, 4 x 1014VG, 5 x 1014VG, 6 x 1014VG, 7 x 1014VG, 8 x 1014VG, 9 x 1014VG, 1 x 1015VG, or 2 x 1015VG).

[0115] In some embodiments, the dose administered is from about 2xl07to about 2xl08viral particles or vector genomes one or more times.

[0116] The compositions described herein are administered in an amount sufficient to increase expression of HMGB1 Box A wherein the HMGB1 Box A antagonizes an intact HMGB1 in the subject, thereby reducing an inflammatory response in a subject.

[0117] In some embodiments, HMGB1 Box A expression may be evaluated using immunohistochemistry, Western blot analysis, quantitative real-time PCR, or other methods known in the art for detecting protein or mRNA. These effects may occur, for example, within 1 day, 2 days, three days, four days, five days, six days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 15 weeks, 20 weeks, 25 weeks, or more, following administration of the compositions described herein. The patient may be evaluated 1 month, 2 months, 3 months, 4 months, 5 months, 6 months or more following administration of the composition depending on the dose and route of administration used for treatment. Depending on the outcome of the evaluation, the patient may receive additional treatments.

[0118] In some embodiments, the method protects the subject against influenza- induced or inflammation-induced lethality. In some embodiments, the method protects the subject against tissue injury. In some embodiments, the method protects the subject against acute lung injury.

[0119] In another embodiment, the invention provides a pharmaceutical composition comprising an effective amount of a nucleic acid or vector as provided herein in combination with a pharmaceutically acceptable excipient.

[0120] A “pharmaceutically acceptable excipient” is a material that acts in concert with an active ingredient of a medication to impart desirable qualities to a drug intended to be introduced into the body of a subject. The desirable qualities could include enhancing long term stability, acting as a diluent for an active ingredient that must be administered in small amounts, enhancement of therapeutic qualities of an active ingredient, facilitating absorption of an active ingredient into the body, adjusting viscosity, enhancing solubility of an active ingredient, or modifying macroscopic properties of a drug such as flowability or adhesion. Pharmaceutically acceptable excipients can comprise but are not limited to diluents, binders, pH stabilizing agents, disin tegrants, surfactants, glidants, dyes, flavoring agents, preservatives, sorbents, sweeteners and lubricants. These materials can take many different forms. See, e.g., Nema, et al., Excipients and their use in injectable products, PDA I. Pharm. Sci. & Tech. 1997, 51(4): 166-171.

[0121] The nucleic acids or vectors (e.g., adenoviral or AAV vectors) described herein may be incorporated into a vehicle for administration into a patient, such as a human patient suffering from any of the conditions described herein. Pharmaceutical compositions containing vectors, such as viral vectors, that contain a polynucleotide encoding an HMGB 1 Box A can be prepared using methods known in the art. For example, such compositions can be prepared using, e.g., physiologically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980); incorporated herein by reference), and in a desired form, e.g., in the form of lyophilized formulations or aqueous solutions.

[0122] Nucleic acids or vectors (e.g., AAV vectors) described herein may be prepared in water suitably mixed with one or more excipients, carriers, or diluents. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (described in US 5,466,468, the disclosure of which is incorporated herein by reference). In any case the formulation may be sterile and may be fluid to the extent that easy syringability exists. Formulations may be stable under the conditions of manufacture and storage and may be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and / or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0123] For example, a solution containing a pharmaceutical composition described herein may be suitably buffered, if necessary, and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. In this connection, sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion. Some variation in dosage will necessarily occur depending on the condition of the subject being treated. For local administration to the inner ear, the composition may be formulated to contain a synthetic perilymph solution. An exemplary synthetic perilymph solution includes 20-200 mM NaCl, 1-5 mM KCI, 0.1-10 mM CaCh, 1-10 mM glucose, and 2-50 mM FIEPEs, with a pH between about 6 and 9 and an osmolality of about 300 mOsm / kg. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations may meet sterility, pyrogenicity, general safety, and purity standards as required by FDA Office of Biologies standards.

[0124] Application of the teachings of the present invention to a specific problem is within the capabilities of one having ordinary skill in the art in light of the teaching contained herein. Examples of the compositions and methods of the invention appear in the following non-limiting Examples.

[0125] EXAMPLES

[0126] Example 1. An Adenoviral Vector Encoding an Inflammation-inducible Antagonist, HMGB 1 Box A, As A Novel Therapeutic Approach to Inflammatory Diseases

[0127] This example describes development of an inflammation-inducible HMGB 1 Box A vector to treat inflammatory diseases.

[0128] Engineering the AdV.C3-Tat.HIV-Box A vectors

[0129] Fig. 1A illustrates that the AdV vector expresses the protein of interest (Box A) under control of an effective two-component expression system first developed by Varley and colleagues (Varley et al., Proc Natl Acad Sci USA, (1995), 92:5346-5350; Varley et al., Nat Biotechnol, (1997), 15:1002-1006; Munford RS, (1998), U.S. Patent 5,744,304). The construct contains an inflammation-activated promoter region (mouse C3 gene promoter) that, in response to inflammatory insult, drives production of HIV transactivator of transcription (Tat), which induces transcription of the gene of interest through its HIV LTR promoter, inserted into a non-replicating AdV vector. This inflammation-inducible cassette was first used successfully to express luciferase (Luc) in vivo in response to i.p. LPS or turpentine, as proof-of-principle for systemic inflammation-induced expression, and later, to mitigate joint inflammation in rodent models of arthritis by intraarticular expression of IL-1R antagonist or IL- 10 (Varley et al., Proc Natl Acad Sci USA, (1995), 92:5346-5350; Varley et al., Nat Biotechnol, (1997), 15:1002-1006; Munford RS, (1998), U.S. Patent 5,744,304; Bakker et al., Arthritis Rheum, (2002), 46:1661-1670; Miagkov el al., I Clin Invest, (2002) 109: 1223-1229). We hypothesized that in mice and CR challenged with LPS or infected with influenza, treatment with our engineered vector, AdV.C3-Tat / HIV-Box A, would result in secretion of Box A that would mitigate ALI by antagonizing TLR4- mediated inflammation induced by HMGB 1. Several modifications to the Box A sequence were made prior to insertion into the original AdV construct based on predictions that would facilitate its secretion, purification, and detection: (i) The N-terminus of the Box A sequence was placed in tandem with the IgK signal peptide sequence to enhance secretion because, due to the lack of a leader sequence, Box A cannot be actively secreted through the conventional Endoplasmic Reticulum (ER)-Golgi secretory pathway; (ii) We mutated a predicted glycosylation site that might cause retention of Box A in the ER (Kwak et al., Front Immunol, (2020), 11 :1189. doi: 10.3389 / fimmu.2020.001 189; Palade G, Science, (1975), 189:867). Non-glycosylated, bacterially-derived rBox ASeris an active antagonist that has been used extensively in experimental studies (wild-type (WT) glycosylation sequence “NFS”), while in Box AGly, the WT sequence was changed to “NFG” to preclude glycosylation that could impede secretion; (iii) A 6X-His tag sequence was added to the Box A C-terminus to facilitate detection by western blot (WB).

[0130] Expression of rBox ASerand rBox AGlyconstructs were first compared in transient transfection experiments using Expi293F cells. Upon finding comparable protein expression (data not shown), transfer of optimized Box A expression constructs from a pENTR™ 1A dual selection vector to the final AdV vector was performed by in vitro homologous recombination with a plasmid containing an E1 / E3 deleted (non-replicating) AdV backbone using gateway cloning. Genomes’ were sequences were confirmed, and viruses were rescued following Pad genome linearization and transfection into TRex293 cells. AdV recombinants for Box ASer, Box AGly, and the luciferase (Euc) gene were amplified, purified by 2 rounds of CsCl ultracentrifugation, titrated for infectious titers (all virus stocks had a viral titer of >10nPFU / ml) and physical titers (>1012vp / ml)) (Zhang et al., Mol Ther, (2001), 3:697-707; Coughlan E, Bradshaw AC, Parker AL, Robinson H, White K, Custer J, Goudsmit J, Van Rooijen et al., Mol Ther, (2012), 20:2268-2281).

[0131] Testing inducibility of the non-replicating AdV.C3-Tat / HIV-Box A promoter system by inflammatory stimuli

[0132] CR peritoneal M(|) were infected with AdV.C3-Tat / HIV-Box AGlyor AdV.C3- Tat / HIV-Box ASerat a multiplicity of infection (MOI) of 1. After 24 h, M were treated with medium or LPS (10 ng / ml) for 18 h. Proteins were separated on a 4-12% SDS-PAGE, transferred to a membrane that was stained with Ponceau red for total protein (Fig. IB, top) and WB with anti-His antibody (Fig. IB, bottom). AdV-infected CR M<|) expressed both WT (Ser) and mutated (Gly) Box A proteins only when stimulated with LPS (with the Box AGlyshowing slightly higher expression) at the predicted 13 kDa MW by WB with anti-His antibody. In addition, CR bronchoalveolar lavage (BAL) M obtained 24 h after i.n. inoculation with AdV.C3- Tat / HIV-Box AGlyor AdV.C3-Tat / HIV-Box ASer(107PFU), were stimulated in vitro with LPS (Fig. 1C). While low levels of Box A proteins were detected in culture supernatants of the BAL M(|) stimulated with medium only, levels of both Box A variants increased comparably upon LPS stimulation (Fig. 1C), indicating that glycosylation does not impede Box A secretion. The low levels of Box A in supernatants of the medium-treated M(|) are likely attributable to low level inflammation in vivo that stimulates the vectors’ C3 promoter to induce the His-tagged protein.

[0133] Confirmation of inflammation-inducible luciferase in vitro and in vivo

[0134] To confirm inflammation-inducible activity of the promoter in vitro, CR M<|) were infected with AdV.C3-Tat / HIV-Luc (MOI = 1) 24 h before LPS stimulation for an additional 24 h, resulting in strong luciferase induction (Fig. 2A). In vivo, mice were administered the AdV.C3-Tat / HIV-Luc i.n. (105PFU / mouse) 3 days prior to LPS challenge (10 mg / mouse i.t.). After 18 h, a time we showed LPS induces significant lung pathology and cellular infiltration, luciferase levels in lung homogenates were significantly increased only in response to LPS (Fig. 2B), indicating inflammation-induced activation of the construct in vivo (Richard et al., I Exp Med, (2021), 218:e20200675). We next sought to determine if influenza infection would similarly activate luciferase expression. CR were treated i.n. with AdV.C3- Tat / HIV-Luc (105PFU / CR) and infected 3 days later with human influenza H3N2 (A / Wuhan / 359 / 95) (107TCID50 / CR). Lung luciferase activity was significantly increased 1 and 2 days p.i. (Fig. 2C). These data correlated with endogenous C3 gene expression in CR M<|) (Fig. 2D) and the early kinetics of the expression of Box AGlyand Box ASermRNA in these cells (Fig. 2E). Importantly, (i) mice / CR treated with AdV.C3-Tat / HIV-Luc alone (without inflammatory induction) showed low luciferase expression (Figs. 2B,C) and (ii) treatment of CR i.n. with either PBS (Fig. 3 A) or with 107PFU of AdV.C3-Tat / HIV-Luc for 1 day (Fig. 3B) or 3 days (Fig. 3C) failed to induce lung inflammation, in contrast to the strong alveolitis and interstitial pneumonia seen only 1 day p.i. with H3N2 (Fig. 3D). Thus, our AdV.C3-Tat / HIV vectors are inducible by ALI-inducing challenges and safe and silenced in the absence of lung inflammation.

[0135] AdV.CS-Tat / HIV-Box A therapy protects mice against lethal influenza infection

[0136] Mice were infected with PR8 (LD90), then 24 hours later, administered saline, or 2x107PFU of AdV-C3-Tat / HTV-Luc (i.v.), or 2x107PFU of AdV.C3-Tat / HIV-Box A (an equal mix of Ser and Gly variants) by either i.v. or i.m. routes. This dose is very low compared to doses used for vaccines or gene therapy (e.g., 109to IO10PFU (64)). Fig. 4A shows that neither saline- nor AdV-C3-Tat / HIV-Luc protected mice against lethal PR8 challenge. In contrast, a single i.v. dose of the mixture of AdV.C3- Tat / HIV-Box A vectors significantly improved survival (to -60%), while i.m. treatment AdV.C3-Tat / HIV-Box A only delayed death. Increasing the i.m. dose of AdV.C3-Tat / HIV-Box A vectors 10-fold to 2xl08PFU / mouse increased survival to that approaching that induced by i.v. administration of 2xl07PFU / mouse (compare Fig. 10 to Fig. 4A).

[0137] These experiments were extended by comparing responses of mice to influenza PR8 infection, followed on Day 1 by i.v. treatment with 2xl07PFU / mouse of the AdV.C3-Tat / HIV-Luc, AdV.C3-Tat / HIV-Box A (an equal mix of Ser and Gly variants), the Ser variant only, or the Gly variant only. No mice survived treatment with the control AdV.C3-Tat / HIV-Luc vector. Surprisingly, the mixture of the two variant vectors was more protective than the same dose of either variant vector alone (Fig. 4B). When the dose of the mixed and individual vectors was increased 10-fold to 2x10sPFU / mouse and administered on Day 1, the individual Box A Ser or Gly vectors protected mice comparably to the mixture (Fig. 4C). To assess if treatment could be delayed and still protect, mice were infected then administered 2xl07PFU / mouse of AdV.C3-Tat / HIV-Luc (day 1 only) or AdV.C3-Tat / HIV-Box A (an equal mix of Ser and Gly variants) i.v. on days 1, 3, or 5 p.i. Fig. 4D shows that AdV.C3-Tat / HIV-Box A treatment at day 1 p.i. yielded the same degree of protection seen in Figs. 4A and 4B. Delaying treatment until day 3 p.i. resulted in a significant increase in the mean time to death (p - 0.0179). No protection was observed if treatment was delayed until day 5 p.i. When the treatment dose was increased 10- fold, increased protection was observed when the vector mixture was administered on Day 3, but no protection was observed when administered on Day 5 (Fig. 4E). Thus, protection induced by AdV.C3-Tat / HIV-Box ASe7AdV.C3-Tat / HIV-Box AGlyare dose- and time-dependent.

[0138] CR were similarly treated i.v. with AdV.C3-Tat / HIV-Box ASerand whole blood and organs were collected 1 day later for analysis of AdV DNA by qPCR. AdV DNA was detected primarily in blood, liver, spleen, and heart, with small intestine and lung as secondary sites (Table 2). Thus, the AdV vector disseminates throughout the body upon i.v. delivery. Together, the data strongly support the hypothesis that our non-replicating AdV.C3-Tat / HIV-Box A vectors are inflammation-regulated and sufficiently active in vitro and in vivo to induce Box A in response to potent non- infectious or infectious inflammatory stimuli (e.g., LPS or influenza) and AdV.C3- Tat / HIV-Box A protects against influenza-induced disease.

[0139] Table 2. Distribution of AdV.C3-Tat / HIV-Box A in CR. CR were treated i.v. with 107PFU / CR of AdV.C3-Tat / HlV-Box ASer. One day after treatment, CR were bled (blood), sacrificed, and dissected to obtain samples of the indicated tissues. Total genomic DNA was purified from each of the indicated organs, subjected to qPCR for the detection of AdV genome using two different sets of primers (Heim et al., J Med Virol, (2003), 71:320. 2003; Echavarria et al., J Clin Microbiol, (1998), 36:3323- 3326). Organs in red indicate those with consistent detection of AdV DNA. Number of samples tested from each indicated organ. Some samples are not equivalent due to different location within the organ.

[0140]

[0141] Effect of AdV.C 3 -Tat / HIV -Box A therapy on the inflammatory response to influenza infection in mice and CR

[0142] Mice were infected with PR8 (LD90), followed one day later by i.v. treatment with either AdV.C3-Tat / HIV-Luc or AdV.C3-Tat / HIV-Box A, as described for Fig. 4A. Five days p.i., a time just before control mice begin to die, lungs were harvested and pathology was blindly scored in fixed- and H&E-stained sections for peribronchiolitis, perivasculitis, interstitial pneumonia, and alveolitis as detailed in the Methods (Prince et al., Lab Invest, (1999), 79:1385-1392). Fig. 6A shows representative photomicrographs of lung sections 5 days p.i. of PR8-infected mice treated i.v. with either AdV.C3-Tat / HIV-Luc or AdV.C3-Tat / HIV-Box A (as in Fig. 4A). Mice treated therapeutically with AdV.C3-Tat / HIV-Luc (left) exhibited much greater lung inflammation than mice treated with AdV.C3-Tat / HIV-Box A (right). Blinded scoring revealed that mice treated with 2xl07PFU / mouse of an equal mix of AdV.C3-Tat / HIV-Box A variants exhibited significantly reduced pathology for each individual parameter scored as well as for the combined pathology score (Fig. 6B).

[0143] The effect of AdV.C3-Tat / HIV-Box A therapy on the magnitude of the cytokine response induced by influenza infection was also measured. Mice that received saline only (no infection; mock) had low levels of lung cytokine mRNA, in contrast to PR8-infected mice (Fig. 6C). When PR8-infected mice were treated with AdV.C3-Tat / HIV-Box A, significantly decreased lung inflammatory cytokine mRNA was observed on day 5 p.i. compared to AdV.C3-Tat / HIV-Luc treatment. At this same time, levels of AdV vectors were comparable in mice administered AdV.C3-Tat / HIV- Luc or AdV.C3-Tat / HIV-Box A (Fig. 11).

[0144] CR were infected with influenza H3N2 (A / Wuhan / 359 / 95, i.n., 107TCIDso / animal) on day 0. On day 1 p.i., groups of CR were treated with AdV.C3- Tat / HIV-Luc, AdV.C3-Tat / HIV-Box AGly, or AdV.C3-Tat / HIV-Box ASer(107PFU / animal, i.v.) and sacrificed on either day 3 or day 6 p.i. (Fig. 7). Fig. 7A shows that just 2 days after treatment, levels of TNFa mRNA were significantly reduced in CR that received AdV.C3-Tat / HIV-Box AGlyvector, with a similar but non-significant trend for those treated with AdV.C3-Tat / HIV-Box ASer. Conversely, levels of antiinflammatory IL-10 mRNA were upregulated by treatment with both AdV.C3- Tat / HIV-Box AGlyand AdV.C3-Tat / HIV-Box ASer. No significant change in production of influenza M protein mRNA was detected with treatments (data not shown), indicating that influenza replication was not affected at this time point. Lung histopathology (Fig. 7B) revealed that at day 3 p.i., significantly reduced alveolitis was observed in CR treated with either AdV.C3-Tat / HIV-Box AGlyand AdV.C3- Tat / HIV-Box ASer(Figs. 7B, C).

[0145] In CR harvested at day 6 p.i., levels of TNFa, IL- lb, and IL- 10 mRNA were significantly reduced only in the group that received AdV.C3-Tat / HIV-Box ASer(Fig. 7D). Peribronchiolitis and alveolitis scores were significantly decreased in CR treated with either Box A variant, whereas interstitial pneumonia was significantly reduced only in CR that had been treated with AdV.C3-Tat / HIV-Box AGly. By day 6, perivasculitis was not detected in any of the groups (Fig. 7E). Fig. 7F illustrates representative microscopic images from CR treated with either AdV.C3-Tat / HIV-Luc control (a), AdV.C3-Tat / HIV-Box AGly(b), or AdV.C3-Tat / HIV-Box ASer(c) showing reduced peribronchiolitis in CR treated with both Box A variants. These data indicate that both AdV.C3-Tat / HIV-Box AGlyand AdV.C3-Tat / HIV-Box ASerexert anti-inflammatory effects in response to human influenza H3N2 infection of CR. Discussion

[0146] Increased circulating HMGB1 correlates with many inflammatory diseases including sepsis, viral respiratory infections, traumatic brain injury, systemic lupus erythematosus, epileptic seizures, Alzheimer’s Disease, Parkinson’s Disease, Multiple Sclerosis, cancer, and others (Andersson et al., Annu Rev Immunol, (2011), 29:139-162; Kang et al., Mol Med, (2014), 20:466-477; Paudel et al., Inti J Mol Sci, (2020), 21:4609. doi:10.3390 / ijms21134609; Andersson et al., Mol Med, (2020), 26:42. doi:10.1186 / sl0020-020-00172-4; Yang et al., Biomolecules, (2022), 12:101. doi.org / 10.3390 / bioml2010101). HMGB1 has three cysteine residues and is redoxsensitive. Only the disulfide (cys23 and cys45) isoform is a TLR4 DAMP, binding MD-2 at a site distinct from LPS. Blocking the HMGB1 binding site on MD-2 with P5779 blocked HMGB1 -mediated TLR4 signaling, but not LPS-induced signaling (Yang et al., J Exp Med, (2015), 212:5-14). In addition to P5779, monoclonal antibody 2G7, recombinant HMGB1 Box A, and glycyrrhizin (a licorice-derived molecule that binds HMGB1) antagonize HMGB 1 -mediated signaling in many models of sterile or infectious inflammation (Yang et al., Front Immunol, (2020), 11 :484. doi:10.3389 / fimmu.2020.00484; Xue et al., J Cell Physiol, (2021), 236:3406- 3419; Singh et al., Molecules, (2022), 27:7311. doi: 10.3390 / molecules27217311 ; Taverna et al., Cells, (2022), 849:doi: 10.3390 / cellsl 1050849). However, targeting HMGB1 with these and other antagonists has not advanced beyond pre-clinical studies. We hypothesized that an inflammation- inducible viral vector-based delivery system might facilitate more sustained expression of therapeutic transgenes that dissipates as the inflammatory stimulus wanes (Coughlan L., Front Immunol, (2020), 11 :9009. doi: 10.3389 / fimmu.2020.00909).

[0147] Using surface plasmon resonance, He et al. showed that rBox A competitively antagonizes binding of intact HMGB1 to TLR4, causing it to be released from both TLR4 and MD-2 and thereby significantly reducing TLR4- mediated signaling via interaction of Box B with MD-2 (He et al., Mol Med, (2018), 24:21. doi: 10.1186 / s 10020-018-0030-9). Our data support this model (Fig. 8) and indicate that sufficient HMGB1 Box A is synthesized from our AdV vectors in an inflammation- inducible fashion to blunt the effect of HMGB 1 on TLR4 / MD-2 in the mouse and CR models of LPS and influenza challenge.

[0148] In experimental endotoxicity and sepsis, where bacterial-derived rBox A was used to antagonize HMGB 1 -mediated signaling, very high concentrations and multiple doses were required (Yang et al., Proc Natl Acad Sci USA, (2004), 101:296- 301). Similarly, P5779 was highly effective at mitigating influenza-induced disease only when administered at a high dose given over multiple days (Shirey et al., Mucosal Immunol, (2016), 9: 1173-1182). We sought proof-of-principle that therapeutic administration of an adenoviral vector that elicits inflammation-inducible rBox A would mitigate ALI in our well-established rodent models of mouse-adapted and non-adapted human influenza. We took advantage of a non-replicating AdV vector originally engineered by Munford and Varley to respond to inflammation to drive production of specific proteins (Varley et al., Proc Natl Acad Sci USA, (1995), 92:5346-5350; Varley et al., Nat Biotechnol, (1997), 15:1002-1006; Munford RS, (1998), U.S. Patent 5,744,304; Bakker et al., Arthritis Rheum, (2002), 46:1661-1670; Miagkov et al., J Clin Invest, (2002) 109: 1223-1229). Using this novel approach, luciferase was expressed in AdV-infected mice challenged with UPS or turpentine, and administration of this vector, modified to express IL-10 or IL-IRA, into the joints of arthritic rodents, lessened inflammation (Varley et al., Proc Natl Acad Sci USA, (1995), 92:5346-5350; Varley et al., Nat Biotechnol, (1997), 15: 1002-1006; Bakker et al., Arthritis Rheum, (2002), 46:1661-1670; Miagkov et al., J Clin Invest, (2002) 109:1223-1229). We substituted into the vector the sequence for the antagonist, HMGB1 Box A, in lieu of sequences encoding luciferase, IL- 10, or IL- IRA. In response to inflammatory stimuli in vitro or ex vivo, Box A-His protein was secreted. The AdV.C3-Tat / HIV-Box A vector failed to induce significant inflammation when administered to CR at high doses; however, when administered therapeutically after influenza infection, lethality and ALI were mitigated in mice, as was ALI in CR, accompanied by a significant reduction in proinflammatory cytokine responses that were dose- and time-dependent. Intravenous treatment was more effective than i.m. administration but increasing the dose i.m. compensated to improve survival. Unexpectedly, an equal mixture of the glycosylated (Ser) and non-glycosylated (Gly) variants provided greater protection at a lower dose (2xl07PFU / mouse) than an equivalent dose of either variant alone. Nonetheless, increasing the dose of either variant alone 10-fold improved survival equivalent to that of the mix of vectors. Since rBox A blocks RAGE-dependent endocytosis, our approach may also apply to RAGE- mediated diseases, in contrast to P5779, which is specific for TLR4 / MD-2 signaling (Yang et al., Mol Med, (2019), 15:1-13; Yang et al., J Exp Med, (2015), 212:5-14). Together, therapeutic treatment of influenza-infected mice and CR with the inflammation-inducible AdV.C3-Tat / HIV-Box A decreased lethality, pathology, and proinflammatory cytokine expression.

[0149] The efficacy of TLR4 antagonists in the influenza model is now well documented, as is the efficacy of the HMGB1 antagonist, P5779, but the observed degree of protection from lethal challenge with PR8 exceeded that reported herein with the AdV.C3-Tat / HIV-Box A vector (Shirey e al., Front Immunol, (2021), 12:705080. doi: 10.3389 / fimmu.2021 .705080). Although increasing the dose of either AdV.C3-Tat / HIV-Box A variant improved their ability to protect from influenza- induced lethality, the maximum level of protection elicited by the AdV.C3-Tat / HIV- Box A vectors (-60%) compared to TLR4 antagonists and P5779 (95-100%) may be attributable to the fact that the latter were administered at high doses daily for each of 5 days, in contrast to a single injection of AdV.C3-TAT / HIV-Box A in these studies. This was done intentionally to minimize the host response to the vector itself. Studies are ongoing to further optimize vector delivery, timing, and route of administration.

[0150] Clearly, this approach is early in development, but has significant potential for treating many different HMGB 1 -mediated diseases. First, to demonstrate proof-of- concept, we used a human adenovirus type-5 vector (HAdV-C5) due to its ease of genetic engineering, the ability to grow it to high titers in laboratory settings, and well- established dosing regimens for rodents. However, humans may have high levels of pre-existing immunity to this particular AdV serotype, which could negate the therapeutic effect (Mennechet el al., Expert Rev Vaccines, (2019), 18:597-613). In addition, i.v administration of AdV5 in humans warrants caution due to off-target interactions with coagulation factors and other blood components which can result in dose-limiting toxicity (L. Coughlan et al., Viruses, (2010), 2, 2290-2355). Despite this, it is important to note that this inducible therapeutic transgene cassette is compatible with many other viral vector systems such as rare serotype AdVs (>200 vectors exist which have low seroprevalence in humans), adeno-associated vectors, or lentiviruses (Mennechet et al., Expert Rev Vaccines, (2019), 18:597-613; Coughlan et al., Mol Ther, (2022), 30:182201849; Bulcha et al., Signal Transduct Target Ther, (2021), 6:53. doi.org / 10.1038 / s41392-021-00487-6). Such platforms could be engineered and tailored to specific inflammatory disease conditions in the future, including those focused on localized delivery rather than systemic delivery.

[0151] Materials and Methods

[0152] Construction ofAdV.C3-Tat / HIV-Box A and AdV. C3-Tat / HIV-Luc:

[0153] Adenovirus C5.C3-Tat / HIV(LTR)-Luc (provided by Dr. Robert Munford) was transduced into HEK-293A cells that were grown in DMEM with 10% fetal bovine serum, 1% fungizone, 1% penicillin / streptomycin, and 1% glutamax (Gibco, ThermoFisher, 35050061) (Munford RS, (1998), U.S. Patent 5,744,304). Transductions were done using 50 mL of virus stock in opti-MEM (Gibco, 31985- 070) for 1 h in a 75% confluent T225 culture flask at 37° C. After 2 days, viruses were harvested by collection of the medium and lysing cells using three freeze-thaw cycles in PBS. Lysates were centrifuged (10,000 rpm for 15’ at 4°C) and the cleared lysates’ supernatant and medium were combined, aliquoted, and stored at -70° C as AdV.C3- Tat / HIV-Luc viral stocks.

[0154] Amplification of the AdV transgene. DNA was extracted from virus stocks using a QIAamp DNA Mini Kit (Qiagen, 51304). DNA was used as a template for PCR amplification of the two-component transgene (C3-Tat / HIV(LTR)-Luc) , with the following primers that incorporate Kpnl and Xhol sites:

[0155] FWD: 5’-

[0156] CAGCTTTAAAGGTACCCGGGGATCCAGACATGATAAGATAC-3’ (SEQ ID NO:22)

[0157] REV: 5’-

[0158] TAGCTGATATCCTCGAGATCGATGATACCCAATTCAACAGGC-3’ (SEQ ID NO:23)

[0159] Reactions were carried out using GoTaq long PCR (Promega, M4021). Amplified fragments (cassette) were agarose gel purified and extracted (New England Biolabs, Monarch T 1020S).

[0160] Cloning of C3-Tat / HIV(LTR)-Luc cassette was into the Gateway™ pENTR™ 1A dual selection vector (Invitrogen, A10462). Box A expression cassettes were cloned into pENTR™ 1A dual selection vector (ThermoFisher Scientific #A10462). Plasmids were extracted and purified from the T1 bacteria (Invitrogen, A10460) using a plasmid maxi-prep kit (Qiagen, 12362). Amplified PCR products were cloned into pENTR 1A using Kpnl and Xhol restriction sites.

[0161] Primers included for sequencing (all listed 5’->3’): CACCACTGCTCCCATTCATCAGTTCC (SEQ ID NO:24), GATCGCCGTGTAATTCTAGAGGATC (SEQ ID NO:25) CCTTACTTCTGTGGTGTGACATAATTGG (SEQ ID NO:26), CCTTTCTTTATGTTTTTGGCGTCTTCC (SEQ ID NO:27), and GTAACATCAGAGATTTTGAGACA (SEQ ID NO:28)

[0162] Transfer of the HMGBl-Box A (Ser or Gly) trans gene into the cassette. pcDNA3.1 plasmids containing the engineered ‘IgK leader - Box A - 6xHis’ constructs (Gene Whiz) were amplified using primers that included either a Ncol or Notl site matching cloning sites in the pENTR 1A.C3-Tat / HIV(LTR)-Luc. Sequencing confirmed the cloning of Box A inserts and resulting in three pENTR 1A with the two-component inducible-expression system: C3-Tat / HIV-Luc, C3- Tat / HIV-Box ASer, C3-Tat / HIV-Box AGly.

[0163] Propagation of AdV.C3-Tat / HIV-Box A and AdV.C3-Tat / H / V-Luc constructs. Recombinant AdV5 genomes (E1 / E3 deleted) were produced by in vitro homologous recombination using LR clonase and gateway technology (Life Technologies, Carlsbad, CA). Plasmids containing genetically modified adenoviral genomes were fully sequence confirmed using PlasmidSaurus Inc., followed by Pad digestion to release the viral genome, and transfection into T-Rex-293 cells (Life Technologies, Carlsbad, CA). Viruses were scaled up, released from cells by freeze-thaw cycles, purified using two rounds of CsCl ultracentrifugation, and titrated (Reed et al., Am J Hyg, (1938), 27:493-497). Physical viral particle titers were determined using a microBCA assay Coughlan et al., Mol Ther, (2012), 20:2268-2281 ; Bradshaw et al., PLoS Pathog, (2010), 6:el001142. doi: 10.1371 / joumal.ppat.l001142). Expression of rBox ASerand rBox AGlywere confirmed in transient transfection experiments using Expi293F cells (ThermoFisher).

[0164] Mice and CR. All animal work was conducted under strict adherence to approved institutional IACUC protocols from the University of Maryland, Baltimore (UMB) and Sigmovir Biosystems Inc. (SBI), both AAALAC-accredited institutions. Six-week-old, WT C57BL / 6I mice were purchased from Jackson Laboratory (Bar Harbor, ME). Six- to 8-week-old RAGE' / _mice (provided by Dr. Ann Marie Schmidt, NYU) were bred in-house at UMB.

[0165] Four- to 6-week-old female and male CR (-100 g) were obtained from SBI’s inbred colony. CR were seronegative for adventitious respiratory viruses.

[0166] For in vitro studies, peritoneal M(|) were elicited from CR with thioglycollate and cultured as previously reported (Richardson et al., J Immunol, (2005), 174:4356- 4364a). Bronchoalveolar lavage (BAL) M<|) were collected by washing the entire lung block with 3 ml of cold saline, 3 times (Richardson et al., J Immunol, (2005), 174:4356-4364a).

[0167] Influenza viruses. Mouse-adapted H1N1 influenza A / PR / 8 / 34 virus (“PR8”) (ATCC, Manassas, VA) was grown in embryonated chicken eggs and kindly provided by Dr. Donna Farber (Columbia University). The human H3N2 A / Wuhan / 359 / 95 virus was provided by the Centers for Disease Control and Prevention, Atlanta, GA, and propagated in Madin-Darby canine kidney (MDCK) cells.

[0168] Mouse and CR virus challenge and treatment. For survival experiments, mice were infected with PR8 (-7500 TCIDso i.n., 25 ml / nares), an LD90 (14, 17). One day after PR8 infection, mice received either saline, AdV.C3-Tat / HIV-Luc (2xl07PFU), an equal mixture of AdV.C3-Tat / HIV-Box A variants, i.m or i.v., or the individual AdV.C3-Tat / HIV-Box A variants (Gly or Ser) (2xl07PFU or 2xl08PFU) by i.v. injection. For time course studies, mice were infected on Day 0 with PR8 (LD90), then treated with AdV.C3-Tat / HIV-Luc or an equal mixture of AdV.C3-Tat / HIV-Box A variants (2xX107PFU or 2xl08PFU) i.v. on days 1, 3 or 5 p.i. For tissue analysis, mice were infected on Day 0 with PR8 (LD90). Twenty-four hours later, mice were treated with saline (mock), AdV.C3-Tat / HIV-Luc, or an equal mixture of AdV.C3- Tat / HIV-Box A variants (2X107PFU) i.v. On day 5 p.i., lungs were harvested for histology and gene expression. Additionally, WT and RAGE / _mice were infected with PR8 (-7500 TCID50, i.n., 25 pl / nares). For survival experiments, mice were monitored daily for 14 days.

[0169] CR were infected i.n. under isoflurane anesthesia with 100 pl (107TCID50) of H3N2 virus preparation. Treatments were performed retro-orbitally under isoflurane anesthesia. Animals were euthanized by CO2 asphyxiation. Western blot (WB). For secreted protein, culture medium was collected with protease inhibitor (CST, 587 IS), and incubated with Ni-Sepharose FF-6 beads (Cytiva, 17531806, 50% slurry) for 2 h at RT. After washes, beads were incubated with sample buffer and lOx reducing agent (Invitrogen, NP0007, NP0009, respectively), boiled, and loaded onto a 4-12% Bis-Tris gel (NuPAGE, Invitrogen). Cell lysates were collected in RIPA buffer with protease inhibitor and centrifuged at 14,000 rpm for 10 min. Supernatants were mixed with lOx reducing agent and loaded onto gels. WB was carried out in NuPAGE (Invitrogen). Ponceau stain (Sigma- Aldrich, P7170) reflected protein loading. MW markers (Cytiva, RPN800E) and rBox A produced in Expi293F cells (Gibco, A14635) transfected with a pcDNA3.1 containing the Box A sequence, were used to confirm the MW and antibody specificity. Primary anti-6x His (Thermo-Fisher, MAI-21315) or anti-HMGBl (Abnova, H00003146-M08) antibodies (1: 1,000 dilution), and a sheep-anti-mouse IgG HRP conjugate (Cytiva NA931 V), were used for detection. Blots were developed using ECL substrate and film (Cytiva, RPN3004, and 28906838).

[0170] Luciferase assays. M(|) were lysed in a minimal volume of Glo-lysis buffer (Promega, E266A), mixed with equal volumes of Bright-Glo reagent (Promega, E2610), and assayed on a luminometer (Promega, GM2000 Glomax Navigator).

[0171] For tissue luciferase assays, -200 mg tissue was collected and placed into 1.5 mL of Glo-lysis buffer with two steel beads, homogenized at 50 Hz on a Qiagen tissuelyser LT, centrifuged, and 100 mL of supernatant mixed with 100 ml of Bright- Glo reagent to assay.

[0172] Tissue distribution of AdV.C3-Tat / HIV-Box A following i.v. injection of CR. CR were treated retro-orbitally with 1 x 107PFU of AdV.C3-Tat / HIV-Box A. One day post-treatment, CR were bled, euthanized, and organs dissected for the detection of AdV genome using qPCR with two different specific primer sets, the -1-AdV set and the 4-Hex set (Heim et al., J Med Virol, (2003), 71:320. 2003; Echavarria et al., J Clin Microbiol, (1998), 36:3323-3326). Tissues of uninfected animals showed Ct values of 40.

[0173] Histology and staining. Lungs were inflated and fixed with 4% PFA. Lung

[0174] Sections (5 mm) were stained with hematoxylin and eosin (H&E). Four parameters related to the position of inflammatory cells infiltration were scored independently from 0 to 4 for each section: peribronchiolitis (primarily lymphocytes, surrounding a bronchiole), perivasculitis (primarily lymphocytes, surrounding a blood vessel), alveolitis (within alveolar spaces), and interstitial pneumonia (increased thickness of alveolar walls). Slides were randomized and blindly scored for each parameter. Data is shown as individual scores for each parameter or a cumulation of the four parameters measured (Prince et al., Lab Invest, (1999), 79:1385-1392).

[0175] Quantitative real-time PCR (qRT-PCR). Total murine RNA isolation and qRT-PCR were performed as previously described using a 7500Fast instrument (Applied Biosystems) (Shirey et al., Nature, (2013), 497:498-502; Shirey et al., J Immunol, (2008), 181 :4159-4167; Shirey et al., Mucosal Immunol, (2010), 3:291- 300). Levels of mRNA for specific mouse genes were normalized to the level of the housekeeping gene, Hprt, in the same samples (Livak et al., Methods, (2001), 25:402- 408). For CR qRT-PCR , amplifications were performed on a Bio-Rad iCycler (MyiQ Single Color) (Patel et al., mBio, (2018), 9:e00246-18; Blanco et al., Hum Vaccin Immunother, (2022) 18:2148499. doi: 10.1080 / 21645515.2022.2148499). Relative gene expression was expressed after normalization of each gene to [Lactin mRNA as a housekeeping gene (Livak et al., Methods, (2001), 25:402-408). Data are expressed as “fold induction” (2DDCt) over mock-treated control animals.

[0176] Statistics. Statistical differences between two groups were determined by unpaired, one-tailed Student’s t test with significance set at p < 0.05. For >3 groups, analysis was done by one-way ANOVA followed by a Tukey’s post hoc test with significance determined at p < 0.05. For survival studies, a Log-Rank (Mantel-Cox) test was used.

[0177] Example 2. HMGB 1 antagonist for treatment of inflammation.

[0178] The present example describes development of a novel anti-inflammatory therapy that responds to levels of local inflammation that occur at any point during influenza infection. The present example discloses data that demonstrate the promise of the proposed therapeutic vector that “senses” inflammation and, in response, produces a potent inflammatory antagonist, HMGB1 Box A, which mitigates influenza-induced disease, with the potential for treating lung inflammatory diseases induced by other infectious or non-infectious agents. Below, we describe the development of a novel, inflammation-inducible rBox A expression “cassette” encoded by a non-replicative adenovirus vector (AdV), “AdV.C3-Tat / HIV-Box A,” that we have already reported increases survival and diminishes lung and systemic inflammation when administered therapeutically to influenza-infected animals (Shirey, K. et al., MBio (2024). In response to the inflammatory response caused by influenza infection, an inflammation-inducible host gene promoter sequence (derived from the gene encoding mammalian C3) within the cassette becomes activated and initiates transcription of rBox A. rBox A, in turn, competitively inhibits the interaction of HMGB1 with TLR4 / MD-2 to ameliorate influenza-induced disease.

[0179] Influenza infection is common, affecting millions and producing significant mortality mediated largely by the inflammatory response, leading to ALI and ARDS. Our existing AdV vector was chosen and designed for ease of engineering and to obtain “proof-of-concept” results. The AdV vector contains a cassette that “responds” to inflammation in vivo, thereby driving the transcription and translation of rHMGB 1 - Box A that, in turn, competitively inhibits binding of HMGB1 to the TLR4 / MD-2 complex. The innovation of this approach is that it obviates critical problems of dosing and timing associated with anti-HMGBl antibodies, rBox A, or small molecule inhibitors that must be administered at high concentrations and / or repeatedly and induce only partial resolution of the inflammatory insult in experimental models of inflammation. To date, none of these therapies has advanced to the clinic. Our vectored therapy is a highly significant breakthrough, as we have been able to achieve -90% survival from an otherwise lethal infection with only 2 doses.

[0180] Modifications of our existing vector can be made to (1) optimize the cassette to enhance levels of rBox A production, and (2) incorporate the optimized cassette into an Adenovirus-Associated Vims (AAV) vector that will be acceptable for human clinical testing. We also propose to develop a highly sensitive assay for detecting rBox A that will be used to determine pharmacokinetics (PK) and pharmacodynamics (PD) in plasma or target organs. While our studies focus on influenza-induced inflammatory lung disease, this approach could become very impactful as we expect it to be used ultimately for the many inflammatory diseases in which HMGB1 is considered a key driver of inflammation. Thus, our proposed work is based on the development of a target therapy that avoids off-target effects and is self-dosed for the time the inflammation persists, which is conceptually innovative.

[0181] We previously showed that antagonizing TLR4 / MD-2 directly or HMGB1- mediated TLR4 signaling in influenza-infected mice and CR inhibits ALI and the cytokine storm (Shirey, K. A. et al. Nature, (2013), 497:498-502; Shirey, K. A. et al. Mucosal immunology (2016); Perrin-Cocon, L. et al. Sci Rep, (2017), 7:40791 ; Shirey et al., mBio, (2019), 10; Shirey et al., Front Immunol, (2021), 12, 705080; Patel et ai., MBio, (2018), 9; Boukhvalova et al., Hum Vaccin Immunother, (2021), 17, 133-145). Circulating HMGB1 levels in influenza-infected mice / CR increased significantly at days 2-4 p.i. , peaked at days 6-8, and declined in Eritoran-treated mice and correlated with disease severity(Shirey, K. A. et al. Mucosal immunology (2016); Patel et al., MBio, (2018), 9). Thus, a sufficient time lapse between HMGB1 detection and clinical symptoms exists to permit HMGB1 to be targeted therapeutically. The following data describes the construction of our Box A-producing vectors and the data supporting their efficacy in vitro, ex vivo, and in vivo.

[0182] Engineering AdV.C3-Tat.HIV-Box A vectors (Shirey, K. et al., MBio (2024)). Fig. 1 A illustrates that the AdV vector expresses the protein of interest (HMGB 1-Box A) under control of a two-component expression system developed by Varley et al. (Varley et al., Nat Biotechnol, (1997), 15:1002-1006). The construct contains an inflammation-activated promoter region (mouse C3 gene promoter sequence) that, in response to inflammatory insults, drives production of HIV transactivator of transcription (Tat), which induces transcription of the gene of interest through its HIV LTR promoter, inserted into a non-replicating AdV vector. This inflammationinducible cassette was first used successfully in vivo to express luciferase (Luc) in response to i.p. LPS or turpentine, and later, to mitigate joint inflammation in rodent models of arthritis by intraarticular expression of vector-induced IL-1R antagonist or IL-10 (Varley et al., Nat Biotechnol, (1997), 15:1002-1006; Varley et al., Proc Natl Acad Sci U S A, (1995), 92:5346-5350; Bakker el al., Arthritis Rheum, (2002), 46: 1661-1670; Miagkov et al., J Clin Invest, (2002), 109: 1223-1229). We hypothesized that in mice and CR infected with influenza, or challenged with other strong inflammatory stimuli, treatment with our engineered vectors, “AdV.C3- Tat / HIV-Box ASer” or “AdV.C3-Tat / HIV-Box AGly,” would produce sufficient rBox A to mitigate ALI by antagonizing TLR4-mediated inflammation induced by HMGB 1. In contrast, “AdV.C3-Tat / HIV-Luc” would secrete luciferase (to permit detection of luciferase in various organs) as well as serve as a negative control for rBox A-producing vectors. The following modifications to the Box A sequence were made before its insertion into the original AdV construct based on predictions that would facilitate secretion, purification, and detection: (i) The N-terminus of the Box A sequence was placed in tandem with the IgK signal peptide sequence to enhance secretion because, due to the lack of a leader sequence, Box A cannot be actively secreted through the Endoplasmic Reticulum (ER)-Golgi secretory pathway; (ii) (Kwak et al., Front Immunol, (2020), 11:1189; Palade et al., Science, (1975), 189:867). The predicted glycosylation site within the wild-type (WT) sequence, “NFS” (resulting in rBox ASer), was mutated to “NFG” (resulting in non- glycosylatable rBox AGly), to prevent retention of rBox A protein in the ER; and, (iii) A 6X-His tag sequence was added to the Box A C-terminus to facilitate detection by western blot (WB) and permit rBox A purification by Ni++columns. rBox ASerand rBox AGlyproteins were expressed comparably in transient transfection experiments using Expi293F cells (data not shown). Optimized Box A expression constructs were transferred from a pENTR™ 1A dual selection vector to the final AdV vector by in vitro homologous recombination with a plasmid containing an El / E3-deleted (nonreplicating) AdV backbone using Gateway cloning. Genome sequences were confirmed, and viruses rescued following the Pad genome linearization and transfection into TRex293 cells. AdV recombinants encoding Box ASer, Box AGly, and luciferase (Luc) were amplified, purified by 2 rounds of CsCl ultracentrifugation, titrated for infectious titers (all virus stocks had viral titers of >10nPFU / ml) and physical titers (>1012vp / ml)) (Shirey, K. et al., MBio (2024); Zhang et al., Mol Ther, (2001), 3:697-707; Coughlan et al., Mol Ther, (2012), 20:2268-2281).

[0183] Inflammation-inducible expression of AdV.C3-Tat.HIV-Box A vectors (Shirey, K. et al., MBio (2024)). CR peritoneal M<|> were infected with AdV.C3-Tat / HIV-Box AGlyor AdV.C3-Tat / HIV-Box ASerat a multiplicity of infection (MOI) of 1. After 24 were treated with medium (control) or with LPS (10 ng / ml) for 18 h to activate the C3 promoter sequence within the vector. Cell proteins were separated on a 4-12% SDS-PAGE, transferred to a membrane that was stained with Ponceau red for total protein (Fig. IB, top), and Western blotted (WB) with anti-His antibody to detect rBox A-His (Fig. IB, bottom). AdV-infected CR M expressed both WT (Ser) and mutated (Gly) Box A proteins at the predicted 13 kDa MW by WB with anti-His antibody only when stimulated with LPS. The identity of the 13 kDa band was confirmed by WB with anti-HMGB 1 (amino acids 1 -90) antibody that is directed against much of the Box A amino acid sequence (data not shown). CR bronchoalveolar lavage (BAL) M<|) obtained 24 h after i.n. treatment with AdV.C3-Tat / HIV-Box AGlyor AdV.C3- Tat / HIV-Box ASer(107PFU / CR), were stimulated ex vivo with LPS (Fig. 1C). The levels of both rBox A variants increased comparably upon LPS stimulation (Fig. 1C), indicating that glycosylation of rBox A does not impede secretion. Low levels of rBox A in supernatants of the medium-treated M are likely due to low-level inflammation in vivo that stimulates the vectors’ C3 promoter to induce the His-tagged proteins. Thus, the inflammatory insult, LPS, is capable of stimulating production of Box A in vitro when the AdV.C3-Tat / HIV-Box A vector is first delivered in vitro or in vivo.

[0184] To confirm inflammation-inducible activity of the promoter in vitro, CR M were infected with AdV.C3-Tat / HIV-Luc (MOI = 1) 24 h before LPS stimulation for 24 h, resulting in strong luciferase induction (Fig. 2A). In vivo, mice were administered AdV.C3-Tat / HIV-Luc i.n. (105PFU / mouse) 3 days before LPS (10 mg / mouse i.t.). After 18 h, a time when LPS induces significant lung pathology and cellular infiltration, luciferase levels in lung homogenates were significantly increased only in response to LPS (Fig. 2B), indicating inflammation-induced activation of the construct in vivo (van Zoelen et al., Shock, (2009), 31 :280-284). Next, when CR were treated i.n. with AdV.C3-Tat / HIV-Luc (105PFU / CR) and infected 3 days later with human influenza H3N2 (A / Wuhan / 359 / 95) (IxlO7TCID50 / CR), lung luciferase activity was significantly increased at 1 and 2 days p.i. (Fig. 2C).

[0185] Importantly, (i) mice / CR treated with AdV.C3-Tat / HIV-Luc alone (without inflammatory induction) showed low luciferase expression (Fig. 5A) and (ii) treatment of CR i.n. with either PBS (Fig. 3A) or with IxlO7PFU of AdV.C3- Tat / HIV-Luc for 1 day (Fig. 3B) or 3 days (Fig. 3C) failed to induce lung inflammation, in contrast to the strong alveolitis and interstitial pneumonia seen 3 days p.i. with human influenza strain A(H3N2) (Ottolini, M. G. et al., J Gen Virol, (2005), 86:2823-2830) (Fig. 3D). Blinded histologic scoring for perivasculitis, peribronchiolitis, interstitial pneumonia, and alveolitis confirmed these visual images (Fig. 3, legend). Thus, our AdV.C3-Tat / HIV-Box A or -Luc vectors are inducible by ALI-inducing challenges and are safe and silenced in vivo in the absence of an inflammatory stimulus.

[0186] Assessment of AdV.C3-Tat / HIV-Box A vectors as therapeutic agents. To evaluate therapeutic efficacy, mice were infected i.n. with PR8 (LD90) on day 0, then administered a single i.v. injection of 2x10sPFU of AdV.C3- Tat / HIV-Luc (negative control), an equal mix of Box ASerand Box AGlyvectors (AdV.C3-Tat / HIV-Box ^Ser / Giy^ AdV.C3-Tat / HIV-Box ASer, or AdV.C3-Tat / HIV-Box AGlytherapeutically at 24 h p.i. This is a low dose of AdV compared to that required for vaccines or gene therapy (IO10to 1011) (Curiel, D. Adenoviral Vector for Gene therapy. @nd edn, (2016). Fig. 4C shows that while the negative control, AdV.C3-Tat / HIV-Luc, failed to protect mice, this dose of Box A-expressing vectors resulted in comparable protection (-60%). To determine if greater protection could be achieved with a second dose of the vector, PR8-infected mice were treated i.v. with the AdV.C3-Tat / HIV- Box ASer / Glymix at a 10-fold lower dose (2xl07PFU / mouse) on days 1 and 3 p.i., which increased survival to -90% (p<0.0001) (Fig. 5A)..

[0187] When CR were similarly treated i.v. with AdV.C3-Tat / HIV-Box ASer, blood and organs were collected 1 day later for analysis of AdV DNA by qPCR. AdV DNA was detected primarily in blood, liver, spleen, and heart, with small intestine and lung as secondary sites (Shirey, K. et al., MBio (2024)). Thus, the AdV vector disseminates throughout the body upon i.v. delivery. Importantly, AdV.C3-Tat / HIV-Box A protects mice from influenza-induced ALL When PR8-infected mice were treated on day 1 p.i. with AdV.C3-Tat / HIV-Box ASer / Gly(2xl07PFU), significantly reduced lung pathology (Fig. 6A; quantified in 15B, top graph) and II lb gene expression (Fig. 6B, bottom graph) were observed compared to mice treated with control AdV.C3- Tat / HIV-Luc vector at day 5 p.i. Tnf, Ptgs2, Ccl5, and Ifnb mRNA levels were similarly inhibited in PR8-infected mice treated with the Box A-expressing vector (Shirey, K. et al., MBio (2024)). Reduced lung pathology was confirmed as early as day 3 p.i. in A(H3N2)-infected CR treated on day 1 with either Gly or Ser variants (IxlO7PFU, 7C (*, p<0.05) and data not shown). Together, Figs. 2, 3, 4 and 5 and support the conclusion that the non-replicating AdV.C3-Tat / HIV-Box A vector is safe, inflammation-regulated, and sufficiently active in vivo in response to influenza infection to induce Box A-His secretion and, importantly, to reduce influenza-induced inflammation, lung pathology, and the cytokine storm.

[0188] Survival date is provided in the table below:

[0189] Table 3. Survival Data.

[0190] Studies

[0191] Part 1. Optimize the HMGB1 Box A cassette to increase Box A expression and optimize the vector for human use.

[0192] Replace the C3 promoter with the Ptgs2 promoter. We previously published a detailed analysis of the regulatory elements in the Ptgs2 promoter, and have shown functionally that Ptgs2 (Cox-2) / _mice are significantly more resistant than WT mice to influenza-induced lethality (Gopalakrishnan et al., Front Immunol, (2022), 13, 968336; Zhang et al., J Endotoxin Res, (2002), 8(5):379-88; Blanco et al., J Exp Med, (2000), 191:2131-2144). In vivo, Ptgs2 mRNA is more strongly induced than C3 mRNA by influenza (unpublished) and remains elevated late the lung, 9 days after sublethal infection with PR8 (Shirey et al., mBio, (2019), 10). Therefore, we shall replace the mouse C3 promoter sequence in the current cassette with the human Ptgs2 promoter region and compare these two “drivers” in vitro using influenza-permissive human lung epithelial cells and hepatocytes since (1) the liver is a strong site of induction for the C3 promoter and (2) we showed that both tissues are targets for our therapy (Shirey, K. et al., MBio (2024)). We expect this change to improve inducibility of the Box A-His product. The promoter with the greatest capacity for transcriptional activation driven by influenza will be used in our new vector.

[0193] We hypothesize that in response to influenza infection, followed by AdV- C3.Tat / HIV.Box A treatment, the duration of HMGB1 rBox A-His production is dependent upon both (i) the length of time that the inflammation-inducible promoter is transcriptionally active (i.e., as inflammation wanes, so will expression of Box A) and (ii) the time required for clearance of the non-replicating vectors. Studies by Coughlan and Munford suggest it would take -18-24 h to achieve peak rBox A expression in vivo since the C3 promoter is an acute phase reactant and highly responsive to inflammatory insults (Coughlan et al., Mol Ther, (2012), 20:2268-2281 ; Varley et al., Nat Biotechnol, (1997), 15:1002-1006; Bakker et al., Arthritis Rheum, (2002), 46:1661-1670; Miagkov et al., J Clin Invest, (2002), 109:1223-1229). However, since the C3 promoter is an acute-phase promoter, transcriptional activation may be silenced later in the inflammatory cascade, findings we confirmed by measuring endogenous C3 mRNA in vitro in response to LPS (Shirey, K. et al., MBio (2024)). This finding is supported by our data in Figs. 4 and 5, showing that survival was increased from 0 to 60% when infected mice were treated once 24 h p.i., but increased to 90% survival by a second administration of AdV.C3-Tat / HIV-Box A vector two days after the first treatment. For these reasons, we propose to modify our existing construct as previously described, by replacing the C3 promoter sequence with Ptgs2 promoter sequences (“AdV.Ptgs2-Tat / HIV-Box A”) (Shirey, K. et al., MBio (2024)). We previously analyzed the activity of the Ptgs2 promoter in vitro and in vivo in response to LPS and IFN-y, and will now directly compare the strength of the Ptgs2 vs. C3 promoters as we previously described (Zhang et al., J Endotoxin Res, (2002), 8(5):379-88; Blanco et al., JExp Med, (2000), 191:2131-2144). We will carry out side-by-side comparisons of the expression of a luciferase reporter gene (pGL2 vector) driven by the C3 vs. Ptgs2 promoters using transient transfection in the murine RAW 264.7 macrophage cell line, with LPS as an inflammatory stimulus, as shown in in Fig. IB. These studies will be complemented and extended by experiments in which human lung epithelial (e.g., A549) and hepatocyte (e.g., Hep2g) cell lines will be transfected with each of the two vectors and subsequently stimulated by influenza infection (PR8). Both cell types are highly susceptible to influenza infection and possess high transfection efficiencies. Several different regulatory regions of the Ptgs2 promoter will be tested to determine which promoter region is the most efficient regulator of luciferase expression, to identify the one that exhibits the lowest background in the absence of inflammation and is most efficiently activated during inflammation. Our published studies demonstrated that the Ptgs2 promoter encompasses many regulatory regions that can elicit either inducibility or silencing, depending on the regulatory conditions (Blanco et al., J Exp Med, (2000), 191 :2131- 2144). If a Ptgs2 promoter region sequence is determined to be more active than the existing C3 promoter sequence, we will replace the C3 sequence in the AdV vector with the Ptgs2 sequence to drive the Tat trans-activator expression, leading to enhanced production of Box A-His (Fig. 14).

[0194] Produce AAV using the cassette determined to be optimal. We initially utilized AdV5 as a vector for proof-of-concept studies in rodents due to its ease of engineering, but there are many contraindications for the use of AdV5 in humans, even in the non-replicative form (as in our extant vector) for gene therapy. Humans may have pre-existing antibodies to HAdV-C5 serotype, which could negate the therapeutic effect (Mennechet et al., Expert Rev Vaccines, (2019), 18:597-613; Sumida et al. , J Immunol, (2005), 174, 7179-7185). In addition, i.v. administration of AdV5 in humans warrants caution due to off-target interactions with coagulation factors and other blood components, possibly resulting in dose-limiting toxicity (Coughlan, L. et al. Viruses, (2010), 2:2290-2355). Therefore, we shall replace the AdV vector with an Adeno-Associated Virus (AAV), a common group of transducing vectors used in gene therapy that have gained many FDA approvals and whose tropism can be directed to our target organs, the liver and the lung. AAV and lentiviral vectors are the most promising vectors currently in use for gene therapy. As AAV and lentiviral vectors can transduce non-dividing cells, including hepatocytes, which normally express C3, lentiviral vectors integrate stably into the target cell genome, whereas only a small fraction of the AAV genomes are capable of stable genomic integration, with the transgene expression driven mainly by the non-integrated episomes (Nakai et al., I Virol, (2001), 75:6969-76). In addition, when tested side by side, some AAVs have shown higher gene expression levels and reduced proinflammatory risk when compared to lenti viral vectors (Vandendriessche et al., J Thromb Haemost, (2007) 5: 16-24). Currently, there are several FDA-approved AAV- based therapeutics on the market, and dozens of others are currently in clinical trial (Mendell et al., Mol Ther, (2021), 3:29:464-488).

[0195] Thus, we will modify our delivery vector system by changing the AdV5 to vectors that are more consistently used in clinical trials for various diseases and have been approved for use by the FDA. Our proof-of-principle using AdV5 as the delivery vector of our therapeutic cassette revealed that i.v. delivery targets the vector mainly to the liver, and to a lesser extent, the lungs (Shirey, K. et al., MBio (2024)). We will first identify which of the most common AAV serotypes (2, 5, 6, 8, 9) has the best tropism for liver / lung with minimal off-target effects when given i.v. to mice and CR. We will obtain reporter AAVs (GFP and Luciferase, both driven by CMV promoter) with these serotypes. These viruses will be prepared in stocks of 1013viral genomes (vG) / ml. Mice (10 per AAV serotype) will be treated with 109- 1012vG / kg on day 0, and 5 mice sacrificed on days 1 and 5 to validate their tropism in the liver and lung. Three representative liver and lung samples from each animal will be weighed and homogenized for DNA extraction (qPCR) and gene expression (luciferase) analysis. Once the presence of the vector (qPCR) and luciferase expression is carried out, GFP detection will be performed by fluorescence microscopy of lung and liver sections to confirm these findings. Validation of these results will be carried out in CR.

[0196] The most potent cassette driven by either the C3- or Ptgs2-containing regulatory sequence from part 1 will be cloned into the Notl site of the AAV backbone using the pAAV vector genome plasmid and co-transfected in HEK-293 cells with the other necessary packaging component plasmids, the AAV helper genes (rep, cap), pHelper plasmid with adenovirus helper genes (E2A, E4orf6, and VA RNA). All the plasmids will be purified using an endotoxin-free Qiagen kit. The transfection density required is 2.5 x 106cells per mg of DNA. rAAV particles will be purified and concentrated by using lodixanol (IDX) Gradient Ultracentrifugation. Purified virus preparations will be subjected to quality control measures, including genome titration (qPCR), capsid titration (ELISA), purity analysis (SDS-PAGE), full / empty ratio (mass spectrometry), and endotoxin content (LAL assay). AAV preparation will be carried out in the Viral Vector Core (UMB). We hypothesize that our newly constructed AAV will produce maximum Box A-His after treatment of influenza- infected mice (Nakai et al., J Virol, (2001), 75:6969-76).

[0197] Part 2. Develop a sensitive method for detecting Box A in vitro and ex vivo

[0198] Develop a sensitive assay for the detection of Box A-His using purified protein. The ability to measure pharmacokinetics / pharmacodynamics (PK / PD) of the Box A-His protein is pivotal for adjusting our treatment conditions and for commercialization advancement. In addition, it will enable us to adjust toxicity levels if high concentrations of expressed Box A negatively impact treatment, although the latter has not been observed to date. Thus, using a highly sensitive assay for detection of Box A, we will determine the minimum effective dose (MED) of rBox A produced by the AdV.C3-Tat / HIV-Box A construct in response to influenza infection, as well as the maximum tolerated dose (MTD). By concurrently measuring levels of circulating and local cytokines and other inflammatory mediators in sera or lung homogenates, as well as reduced histopathology, we expect to establish correlates of protection based on circulating HMGB1 rBox A-His levels. We anticipate this approach will form the basis for future expansion to counteract inflammatory diseases induced by diverse chemical, radiological, viral, traumatic, or microbial insults in which HMGB 1 has been implicated as a central mediator. All of this depends on the ability to measure Box A-His in vivo. Once we have established these parameters, we will ultimately subcontract IND-enabling studies using GMP / GLP-manufactured vector, including a standard 1-week GLP toxicology study with toxicokinetics, and respiratory function studies with single- and repeat-dosing regimens to optimize stability and safety in response to influenza infection.

[0199] In preliminary studies, we prepared highly purified rBox A-His protein by transfecting HEK293 cells with a CMV promoter construct containing the sequences encoding the Box A-His protein corresponding to those in our AdV cassette (Shirey, K. et al., MBio (2024)). We purified Box A-His by passing the supernatants of the transfectants over a Ni++column and dialyzed the protein extensively after elution. The purified protein was first analyzed by WB using anti-Box A (1-90) (Abnova H00003146-M08), which detects the HMGB1 Box A domain, and anti-His antibodies (Invitrogen MAI -21315) to estimate the concentration of purified protein (as seen in Fig. IB, C). While WB is not particularly useful for analyzing many samples, as would be required for PK / PD studies, it permitted an estimated protein concentration based on the lowest detectable signal obtained by WB.

[0200] To enable detection and quantitation of rBox A-His, we sought to develop a colorimetric Enzyme-linked Immunosorbent Assay (ELISA). A simple direct detection method was initially developed by first coating high-binding 96-well plates with increasing concentrations of Ni++-purified Box A-His. After washing the plate, the addition of anti-His-HRP antibody, followed by substrate, resulted in dosedependent detection of Box A-His (Fig. 13). As an alternative approach, a capture ELISA was also devised in which anti-HMGBl (epitope in amino acids 1-90) was used as the “capture antibody” to coat Immulon 4HBX plates (ThermoFisher). Purified rBox A-His was then applied to the plates and incubated. After extensive washing, anti-His-HRP antibody (Invitrogen MAI-21315) was added, followed by substrate, to detect Box A-His protein bound by the capture antibody. To increase sensitivity, we are considering using Ni++-coated plates instead of the anti-HMGBl antibody and then detecting the Box A using the anti-HMGBl (1-90), followed by an HRP-coupled secondary antibody.

[0201] Validation of Box A-His quantitative assay using plasma and organs from influenza-infected, AAV-treated mice.

[0202] (a) Once the AAV vector (i.e., the specific AAV serotype and either C3 or Ptgs2 promoter) has been engineered as described in Aim 1, Milestone 2, we must next establish efficacy before measuring Box A-His in the plasma and organs of influenza-infected, AAV-treated mice. Briefly, experiments similar to those described in Fig. 4 and 5 will be carried out using the new AAV vector, looking initially for protection from lethality as the primary outcome ((Shirey, K. et al., MBio (2024)). We shall infect mice (6 / group) with PR8 (LD90) followed by i.v. treatment with the AAV-C3 or Ptgs2.Tat / HIV.Box A-His (109- 1012vG / kg) or a control AAV-luciferase vector. To minimize the number of mice, we will start with a dose of 1012vG / kg on day 1 only or on days 1 and 3, then repeat the experiment with each lower AAV dose until survival is no longer optimal. Significant results will be confirmed in CR.

[0203] (b) Once the optimal time and dosage are established for survival in mice, plasma, lung, and liver samples will be collected from mice similarly treated at days 2, 4, 6, 8, 10, and 14 p.i. (6 mice / treatment group / time point; two separate experiments). This time course was established in our earlier studies of the efficacy of Eritoran and in our AdV.C3-Tat / HIV-Box A work to allow for induction of histopathology and proinflammatory gene expression before the PR8-infected, AAV control-treated mice begin to die (usually starting at day 6 p.i.) and to permit the reduction in inflammatory markers in protected mice (Ottolini, M. G. et al. , J Gen Virol, (2005), 86:2823-2830; Shirey, K. et al., MBio (2024)). The inferior right lobe of the lung or an equivalent size of the right lobe of the liver of each mouse will be dissected. One tissue portion will be fixed and H&E-stained for histopathology scoring, while the other portion will be homogenized in 1 ml of buffer containing protease inhibitors with an Omni homogenizer probe. After the homogenized tissue is centrifuged at 4,500 rpm for 10 min at 4° C, the supernatant is transferred to newly labeled tubes and stored at -80° C until use. Serial dilutions of each plasma sample and tissue homogenate will be tested in either the ELISA- or MS-based assay, and serial dilutions of the purified rBox A-His will be included to permit quantitation of the test samples.

[0204] Part 3. Perform PK / PD, efficacy, and safety studies

[0205] Measurement of AAV vector distribution, rate of decay, and safety. We will assess the initial pharmacokinetics of both the AAV vector, such as distribution, determination of cassette gene copy number, and rate of systemic and local clearance of the vector and inducible product using our rodent models. A major step that must be demonstrated is that the AAV chosen for our cassette delivery in part 1 reaches the target organs (liver / lungs) when delivered systemically (i.v.). In addition, the rate of cellular incorporation into liver and lung, off-target incorporation, and the rate of decay of the transduced AAV vG will be measured. Since our Box A-His is inflammation-inducible, studies must be done in both infected and uninfected animals to track both the vector and the anti-inflammatory product that will render preliminary efficacy data.

[0206] Analysis of vector in vivo: Different doses of the chosen AAV vector (between 109to 1012vG / kg) will be inoculated i.v. in mice and in CR. At each time point and following the schedule proposed (1 , 24, 48 and 72 h, and 7 days post- treatment), groups of mice and CR (n=4 / group) will be sacrificed to collect blood as well as target (lung and liver) and off-target (spleen, heart, gonads, brain, kidney, pancreas, intestine) organs to determine the rate of vector clearance and if the AAV elicits an antibody responses against their capsid (Wang et al., Mol Ther Methods Clin Dev, (2024), 19:32:101326). Detection and quantification of AAV in target organs, as well as in off-target organs, will be done by qPCR. We will determine the vG / gr of tissue and vG / mg of total DNA. The most common side effects of AAV therapy at high doses are hepatic and renal toxicity ((ZOLGNENSMA (2025) Highlights on prescribing information (Zolgensma); Mendell et al., N Engl J Med, (2017), 377: 1713-1722; Feldman et al., J Pediatr, (2020), 225:252-258). High systemic AAVs doses are known to increase levels of the liver enzyme, alanine aminotransferase (ALT). Therefore, to monitor toxicity, a comprehensive liver and kidney function panel will be used that includes serum albumin, alkaline phosphatase (ALP), ALT, aspartate aminotransferase (AST), bicarbonate (CO2), blood urea nitrogen (BUN), calcium, cholesterol, creatine phosphokinase (CPK), creatinine, direct bilirubin, gamma glutamyl transferase (GGT), glucose, phosphorus, sodium / potassium / chloride, total bilirubin, Total protein (TP), Triglycerides, Albumin / Globulin ratio (A / G ratio), Globulin, Bilirubin Indirect, BUN / Creatinine ratio (B / C ratio), and Na / K ratio to be carried out by VRL Diagnostics, Rockville, MD. An additional blood cell panel to determine CBC (blood cell counts and differentials) will also be included (UMB Hematology Core Facility). Vector detection in plasma and organs will be performed by qPCR. Excess gross pathology at the time of dissection and mortality events will be recorded.

[0207] Measure HMGB1 Box A distribution concomitant with preliminary PK / PD. Due to the nature and inducibility of our therapy under inflammatory conditions, initial pharmacokinetic analysis of Box A-His will need to be performed during influenza infection, post-AAV treatment. Relying on our new Box A-His detection systems and using our well-characterized animal models, we will define (1) distribution, (2) levels of inducibility, and (3) decay by testing transcription of the “driver sequence” (C3 or Ptgs2) in the cassette (qRT-PCR) and rBox A-His protein (ELISA / MS / Biacore) in plasma and target organs. Total Box A-His protein production will be expressed per gram of tissue to determine the Box A-His protein inducibility index (Bp-Ind). Initially, C57BL / 6J mice (6 / treatment) will be infected on day 0 with PR8 (LD90). Groups of infected mice will be administered an i.v. injection of saline (negative control) or AAV-Box A (at the dose and time determined in Aim 2, Milestone 2 to be most efficacious), to determine rBox A-His PK by following Box A-His protein in target organs and systemically, and by determining PD by correlating the dose of treatment with the amount of Box A released and reduction in well-established parameters, including mortality (mice), and cytokine profile in the lung, kinetics of influenza replication in the lung, circulating blood HMGBl-Box A protein, and lung histopathology scores will be used for determination of dose-response, maximum effect (Emax), potency (EC50), and therapeutic window (Shirey, K. et al., MBio (2024). Due to the complexity of the various kinetics involved, our studies in parts 1 and 2 will inform us on the best time points to measure these parameters efficiently (initially 1, 24, 48, and 72 h, and 7 days post- treatment). Confirmatory studies will be performed in CR using a non-adapted human strain of influenza with histopathology and cytokine gene expression as primary endpoints. In addition to quantifying vG copies as previously described, another portion of the tissue samples will be used for RNA purification, homogenized using Qiagen TissueLyser 11, and RNA was isolated using a Qiagen RNeasy 96 Universal tissue kit and RT-qPCR to quantify Box A-His expression using specific primers (Vandendriessche et al., J Thromb Haemost, (2007) 5:16-24; Mendell et al., Mol Ther, (2021), 3:29:464-488). A Box A-His protein inducibility index (mRNA expression / vG, Bp-Ind) will be calculated. We hypothesize that expression of AAV- induced HMGB1 Box A-His in response to influenza-induced inflammation will increase survival, blunt cytokine production and ALI over those previously seen, and that levels of circulating Box A-His will correlate with the degree of protection (Shirey, K. et al., MBio (2024).

Claims

WHAT IS CLAIMED IS:

1. A method of treating a disease or condition in a subject characterized by an inflammatory response, comprising administering to the subject an effective amount of a nucleic acid encoding HMGB1 Box A, wherein the HMGB1 Box A antagonizes an intact HMGB1 in the subject, wherein the nucleic acid comprises a promoter that regulates expression of the nucleic acid encoding HMGB 1 Box A, wherein the promoter is an inflammation-inducible promoter that is activated by an inflammatory signal.

2. The method of claim 1 , wherein the nucleic acid is encoded by a vector.

3. The method of claim 2, wherein the vector is a viral vector.

4. The method of claim 3, wherein the viral vector is an adenoviral vector.

5. The method of claim 3, wherein the viral vector is a human adenoviral 5 vector.

6. The method of claim 3, wherein the viral vector is a non-replicative adenovirus vector.

7. The method of claim 3, wherein the viral vector is selected from the group consisting of a rare serotype adenovirus vector, adeno- associated vector, and a lentiviral vector.

8. The method of any of claims 1-7, wherein expression of HMGB1 Box A is regulated by an inflammation-inducible promoter and a secondary promoter.

9. The method of claim 8, wherein in the presence of the inflammatory signal, the inflammation-inducible promoter increases expression of a protein that activates the secondary promoter, wherein activation of the secondary promoter increases expression of HMGB1 Box A.

10. The method of any of claims 7-9, wherein the inflammatory signal comprises one or more cytokines.

11. The method of any of claims 8-10, wherein the inflammation-inducible promoter comprises a complement C3 or Ptgs2 gene promoter sequence.

12. The method of claim 11, wherein the complement C3 or Ptgs2 gene promoter sequence induces expression of an HIV transactivator of transcription protein (Tat), wherein the Tat protein increases expression of HMGB 1 Box A by activating the secondary promoter (HIV LTR promoter).

13. The method of any of claims 1-12, wherein the inflammatory response is caused by a pathogenic infection.

14. The method of claim 13, wherein the pathogenic infection is a viral infection.

15. The method of claim 14, wherein the viral infection is an influenza infection.

16. The method of any of claims 1-12, wherein the inflammatory response is caused by trauma.

17. The method of any of claims 1-12, wherein the inflammatory response is caused by acute lung injury.

18. The method of any of claims 1-12, wherein the inflammatory response is caused by ischemia.

19. The method of any of claims 1-12, wherein the inflammatory response is caused by radiation-induced damage.

20. The method of any of claims 1-12, wherein the inflammatory response is caused by burn.

21. The method of any of claims 1-20, wherein the nucleic acid is administered by an intravenous route.L. The method of any of claims 1-20, wherein the nucleic acid is administered by an intramuscular route.

23. The method of any of claims 1-22, wherein the nucleic acid is administered one or more times within 1-4 days of viral infection.

24. The method of any of claims 1-23, wherein the administration results in a decrease in inflammatory cytokines in the subject.

25. The method of any of claims 1-15 and 21-23, wherein the method protects the subject against influenza-induced lethality.

26. The method of any of claims 1-25, wherein the method protects the subject against tissue injury.

27. The method of claim 26, wherein the method protects the subject against acute lung injury.

28. The method of any of claims 1-27, wherein the nucleic acid encodes a modified HMGB 1 Box A amino acid sequence.

29. The method of claim 28, wherein the modified HMGB 1 Box A amino acid sequence comprises a signal peptide sequence to enhance secretion.

30. The method of claim 29, wherein the signal peptide sequence comprises an IgK signal peptide.

31. The method of claim 29 or 30, wherein the signal peptide sequence is fused to the N-terminus of HMGB1 Box A amino acid sequence.

32. The method of any of claims 28-31, wherein the modified HMGB1 Box A amino acid sequence comprises an amino acid substitution at one or more putative glycosylation sites.

33. The method of any of claims 1-32, wherein the subject is administered a combination of HMGB1 Box A nucleic acids, wherein the nucleic acids encode i) a HMGB1 Box A that comprises a substitution at oneor more putative glycosylation sites and ii) a HMGB 1 Box A that does not comprise a substitution at one or more putative glycosylation sites.

34. The method of any of claims 28-33, wherein the modified HMGB1 Box A amino acid sequence comprises a purification or detection tag.

35. The method of claim 34, wherein the purification or detection tag is fused to the C-terminus of HMGB 1 Box A.

36. The method of any of claims 1-35, wherein the subject is administered a nucleic acid encoding HMGB1 Box A having an amino acid sequence that is at least 95% identical to SEQ ID NOS:5 or 11.

37. The method of claim 36, wherein the subject is administered a nucleic acid encoding HMGB1 Box A having an amino acid sequence comprising SEQ ID NOS: 5 or 11.

38. A viral vector comprising a nucleic acid encoding HMGB1 Box A, wherein the vector comprises a promoter that regulates expression of the nucleic acid encoding HMGB1 Box A, wherein the promoter is an inflammation-inducible promoter that is activated by an inflammatory signal.

39. The viral vector of claim 38, wherein the viral vector is an adenoviral vector.

40. The viral vector of claim 38, wherein the viral vector is a non- replicative adenovirus vector.

41. The viral vector of claim 38, wherein the viral vector is a human adenoviral 5 vector.

42. The viral vector of claim 38, wherein the viral vector is selected from the group consisting of a rare serotype adenovirus vector, adeno- associated vector, and an lentiviral vector.

43. The viral vector of any of claims 38-42, wherein the viral vector encodes a modified HMGB 1 Box A amino acid sequence.

44. The viral vector of claim 43, wherein the modified HMGB1 Box A amino acid sequence comprises a signal peptide sequence to enhance secretion.

45. The viral vector of claim 44, wherein the signal peptide sequence comprises an IgK signal peptide.

46. The viral vector of claim 44 or 45 , wherein the signal peptide sequence is fused to the N-terminus of HMGB 1 Box A amino acid sequence.

47. The viral vector of any of claims 43-46, wherein the modified HMGB 1 Box A amino acid sequence comprises an amino acid substitution at one or more putative glycosylation sites.

48. The viral vector of any of claims 43-47, wherein the modified HMGB 1 Box A amino acid sequence comprises a purification or detection tag.

49. The viral vector of any of claims 43-48, wherein the purification or detection tag is fused to the C-terminus of HMGB 1 Box A.

50. The viral vector of any of claims 38-49, wherein the nucleic acid encodes HMGB 1 Box A having an amino acid sequence that is at least 95% identical to SEQ ID NOS:5 or 1 1 .

51. The viral vector of any of claims 38-50, wherein the subject is administered a nucleic acid encoding HMGB 1 Box A having an amino acid sequence comprising SEQ ID NOS: 5 or 11.

52. The viral vector of claim 51 , wherein expression of HMGB 1 Box A is regulated by an inflammation-inducible promoter and a secondary promoter on the viral vector.

53. The viral vector of claim 52, wherein in the presence of the inflammatory signal, the inflammation-inducible promoter increasesexpression of a protein that activates the secondary promoter, wherein activation of the secondary promoter increases expression of HMGB 1 Box A.

54. The viral vector of any of claims 51-53, wherein the inflammatory signal comprises one or more cytokines.

55. The viral vector of any of claims 51-54, wherein the inflammationinducible promoter comprises a complement C3 or Ptgs2 gene promoter sequence.

56. The viral vector of claim 55 , wherein the complement C3 or Ptgs2 gene promoter sequence induces expression of an HIV transactivator of transcription protein (Tat), wherein the Tat protein increases expression of HMGB 1 Box A by activating the secondary promoter (HIV LTR promoter).

Images