Use of GSK3 as protease, GSK3-based proteolysis targeting chimera, and preparation method therefor and use thereof

Abstract

The present invention specifically belongs to the technical field of protein degradation. Provided are the use of GSK3 as a protease, a GSK3-based proteolysis targeting chimera, and a preparation method therefor and the use thereof. GSK3 and an N-terminal domain, intermediate domain or C-terminal domain thereof have proteolytic activity, and can achieve efficient degradation of proteins. On the basis of GSK3 and similar proteases, a proteolysis targeting chimera can be developed to achieve efficient targeted degradation of a target protein.

Description

Use of GSK3 as a protease, GSK3-based proteolysis targeting chimera and preparation method and use thereof TECHNICAL FIELD

[0001] The present application belongs to the technical field of protein degradation, and particularly relates to use of GSK3 as a protease, GSK3-based proteolysis targeting chimera and preparation method and use thereof. BACKGROUND

[0002] Glycogen synthase kinase-3 (GSK3) is a serine / threonine kinase widely present in eukaryotes. Due to more than 100 substrates, GSK3 is also known as the busiest kinase in most cells. In 1980, GSK3 was first discovered in rabbit skeletal muscle. As the name implies, GSK3 inactivates glycogen synthase by phosphorylating it. In the following 40 years, the important role of GSK3 in many signaling pathways of animals and plants has been revealed. However, so far, the reports about the function of GSK3 are limited to its kinase properties, and there is no related report about its other enzyme properties.

[0003] SUMMARY

[0004] The purpose of the present application is to provide use of GSK3 as a protease, GSK3-based proteolysis targeting chimera and preparation method and use thereof. The present application can achieve the degradation of proteins by using GSK3 as a protease.

[0005] The present application provides use of GSK3 as a protease.

[0006] The present application also provides use of GSK3 as a protease having any one or two or more functions of aspartate protease, serine protease, threonine protease, cysteine protease and metalloprotease.

[0007] The present application also provides use of the N-terminal domain, the intermediate domain or the C-terminal domain of GSK3 as a protease.

[0008] The present application also provides use of the N-terminal domain of GSK3 as a protease having any one or two or more functions of aspartate protease, serine protease, threonine protease, cysteine protease and metalloprotease.

[0009] The present application also provides use of the intermediate domain of GSK3 as a protease having any one or two or more functions of aspartate protease, serine protease, threonine protease and cysteine protease.

[0010] The application also provides the application of the C-terminal domain of GSK3 as a protease having the function of any one or more than two of aspartate protease, serine protease and cysteine protease.

[0011] The application also provides a protease-based protein degradation targeting chimera, which is connected by a linker from two ligands, including a ligand binding to a target protein and a ligand binding to a protease.

[0012] The application also provides a GSK3-based protein degradation targeting chimera, which is connected by a linker from two ligands, including a ligand binding to a target protein and a ligand binding to GSK3.

[0013] Preferably, when the ligand binding to GSK3 is polypeptide type and GSK3 is human protein, the ligand binding to GSK3 includes the amino acid sequence as shown in SEQ ID NO. 1.

[0014] Preferably, when the ligand binding to GSK3 is polypeptide type and GSK3 is Arabidopsis thaliana protein, the ligand binding to GSK3 includes the amino acid sequence as shown in SEQ ID NO. 2.

[0015] Preferably, the linker includes the amino acid sequence as shown in SEQ ID NO. 3.

[0016] Preferably, when the ligand binding to a target protein is polypeptide type, the ligand binding to a target protein includes the amino acid sequence on the binding surface of the protein interacting with the target protein.

[0017] Preferably, the C-terminal of the amino acid of the target protein binding surface of the interacting protein is further fused with the amino acid sequence as shown in SEQ ID NO. 4.

[0018] The application also provides the application of the protease-based protein degradation targeting chimera or the GSK3-based protein degradation targeting chimera in the preparation of a targeting reagent for degrading proteins.

[0019] The application also provides a method for degrading a target protein by the protease-based protein degradation targeting chimera or the GSK3-based protein degradation targeting chimera, which comprises the following steps: mixing the protease-based protein degradation targeting chimera or the GSK3-based protein degradation targeting chimera with a sample containing a target protein to degrade the target protein.

[0020] Preferably, when the GSK3 is a human protein, the temperature for targeted degradation is 36-37℃.

[0021] Preferably, when the GSK3 is an Arabidopsis protein, the temperature for targeted degradation is 26-28℃.

[0022] Preferably, the mixed system preferably further comprises the addition of cisplatin.

[0023] The application also provides the use of cisplatin in the preparation of a reagent for enhancing the protease activity of GSK3.

[0024] The application also provides the use of cisplatin in the preparation of a reagent for enhancing the degradation of target proteins by GSK3 based on the GSK3-based protein degradation targeting chimera guided degradation of GSK3.

[0025] The application provides the use of GSK3 as a protease. The application utilizes GSK3 as a protease to achieve the degradation of proteins. Further, GSK3 and its N-terminal domain, intermediate domain or C-terminal domain can achieve efficient degradation of proteins. Based on GSK3, a protein degradation targeting chimera can be developed to achieve efficient targeted degradation of target proteins. BRIEF DESCRIPTION OF DRAWINGS

[0026] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can be obtained by those skilled in the art without creative labor.

[0027] Figure 1 is an immunoblotting result diagram of E. coli-expressed and purified human, Arabidopsis GSK3 and domain-deleted variants thereof provided by the application;

[0028] Figure 2 is an immunoblotting result diagram of E. coli-expressed and purified human PD-L1, human Aβ42 and novel coronavirus spike glycoprotein XS provided by the application;

[0029] Figure 3 is an immunoblotting result diagram of E. coli-expressed and purified GPTAC provided by the application;

[0030] Figure 4 is a protease activity analysis diagram of E. coli-expressed and purified human, Arabidopsis GSK3 and domain-deleted variants thereof provided by the application;

[0031] Figure 5 is a diagram of factors affecting the protease activity of human GSK3 provided by the present application, wherein A is a diagram of protease activity inhibitor analysis of human GSK3; B is a diagram of protease activity activator analysis of human GSK3; C is a diagram of protease property analysis of the N-terminal domain of human GSK3; D is a diagram of protease property analysis of the intermediate domain of human GSK3; and E is a diagram of protease property analysis of the C-terminal domain of human GSK3;

[0032] Figure 6 is a diagram of GPTAC-guided GSK3 degrading target proteins provided by the present application, wherein A is a diagram of GPTAC-guided Arabidopsis GSK3 degrading NS-mFc with specificity to coronavirus spike glycoprotein NS-mFc; B is a diagram of GPTAC-guided human GSK3 degrading PD-L1 with different affinity to PD-L1; C is a diagram of GPTAC-guided human GSK3 degrading Aβ42 with different affinity to Aβ42; and D is a diagram of GPTAC-guided human GSK3 degrading XS with different affinity to coronavirus spike glycoprotein XS.

[0033] Figure 7 is a diagram of cisplatin promoting GPTAC-guided human GSK3 degrading target proteins provided by the present application, wherein A is a diagram of cisplatin promoting GPTAC-guided human GSK3 degrading PD-L1 with specificity to PD-L1; B is a diagram of cisplatin promoting GPTAC-guided human GSK3 degrading Aβ42 with specificity to Aβ42; and C is a diagram of cisplatin promoting GPTAC-guided human GSK3 degrading XS with specificity to coronavirus spike glycoprotein XS. DETAILED DESCRIPTION

[0034] The present application provides the application of GSK3 as a protease. In the present application, the GSK3 preferably includes human GSK3 (human glycogen synthase kinase 3-beta subtype, hGSK3β) and Arabidopsis GSK3 (AtBIN2). The present application finds that GSK3 is a multifunctional enzyme, also has protease activity, and has three independent protease domains. GSK3 at least has the function of endopeptidase, and as a protease can achieve the degradation of proteins.

[0035] The present application also provides the application of GSK3 as a protease having the function of any one or two or more of aspartic protease, serine protease, threonine protease, cysteine protease and metalloprotease.

[0036] The present application also provides the application of the N-terminal domain, the intermediate domain or the C-terminal domain of GSK3 as a protease. The N-terminal and the intermediate domain of GSK3 are very active, and the C-terminal domain of GSK3 is relatively weak. Therefore, compared with all other proteases, the overall degradation efficiency of GSK3 will be much higher.

[0037] The application also provides the use of the N-terminal domain of GSK3 as a protease having the function of any one or more than two of aspartic protease, serine protease, threonine protease, cysteine protease and metalloprotease.

[0038] The application also provides the use of the intermediate domain of GSK3 as a protease having the function of any one or more than two of aspartic protease, serine protease, threonine protease and cysteine protease.

[0039] The application also provides the use of the C-terminal domain of GSK3 as a protease having the function of any one or more than two of aspartic protease, serine protease and cysteine protease.

[0040] The application also provides a protease-based protein degradation targeting chimera, which is connected by a linker from two ligands, including a ligand binding to a target protein and a ligand binding to a protease. In the application, the protease preferably includes GSK3. The protease in the application can also be other proteases having protease activity similar to GSK3. The protease-based protein degradation targeting chimera in the application is similar to PROTAC (proteolysis targeting chimera) in physical properties and can be a polypeptide or a PROTAC-like organic compound. The protease-based protein degradation targeting chimera in the application must be soluble in water and can be synthesized and purified in vitro.

[0041] The application also provides a GSK3-based protein degradation targeting chimera (GSK3 proteolysis targeting chimera, GPTAC), which is connected by a linker from two ligands, including a ligand binding to a target protein and a ligand binding to GSK3. That is, the GPTAC in the application is composed of three parts, including a ligand part of GSK3, a linker part and a ligand part of a target protein. The GPTAC in the application is similar to PROTAC in physical properties and can be a polypeptide or a PROTAC-like organic compound. The interacting proteins of proteases are mostly their substrates, and it is difficult to target the target protein. The GPTAC in the application, like PROTAC for E3 ubiquitin ligase and target protein, can bind GSK3 and target protein together, and directly utilize the protease activity of GSK3 to achieve efficient and specific degradation of the target protein.

[0042] In the present application, when the ligand binding to GSK3 is polypeptide type, and the GSK3 is human protein, the ligand binding to GSK3 preferably comprises the amino acid sequence as shown in SEQ ID NO. 1 (MVEPQKFAEELIHRLEAVQR). In the present application, when the ligand binding to GSK3 is polypeptide type, and the GSK3 is Arabidopsis thaliana protein, the ligand binding to GSK3 preferably comprises the amino acid sequence as shown in SEQ ID NO. 2 (MEELIDRSLLEAVRR). The present application finds that GSK3 has a region that can bind to Axin without degrading Axin. In the present application, the N-terminal domain of GPTAC is preferably derived from the Axin domain interacting with the interface of GSK3. The present application utilizes the binding ability of GSK3 to Axin to realize the binding of the protein degradation targeting chimera to GSK3, and then realize the degradation of the target protein.

[0043] In the present application, the linker preferably comprises the amino acid sequence as shown in SEQ ID NO. 3 (AAVLEYLTAEILELA). In the present application, the Linker domain is derived from the IBIVU database (https: / / www.ibi.vu.nl / programs / linkerdbwww / ).

[0044] In the present application, when the ligand binding to the target protein is polypeptide type, the ligand binding to the target protein preferably comprises the amino acid sequence of the protein interacting with the target protein at the binding surface. In the present application, the C-terminal of the amino acid sequence of the protein interacting with the target protein at the binding surface is further fused with the amino acid sequence as shown in SEQ ID NO. 4 (KLAAALEHHHHHHHHH). That is, the ligand part of the target protein of the present application is the amino acid sequence of the protein (including antibody) interacting with the target protein at the binding surface in the existing crystal structure, and the C-terminal of the ligand is fused with KLAAALEHHHHHHHH (SEQ ID NO. 4).

[0045] The GPTAC of the present application must be soluble in water and can be synthesized and purified in vitro. The present application does not have special limitations on the method of synthesizing and purifying in vitro. If the GPTAC is polypeptide type, various protein expression systems can be used for purification, such as E. coli, yeast, insects, HEK293 cell lines, etc. If the GPTAC is organic type, the synthesis method of PROTAC is preferably referred to.

[0046] The protease-based protein degradation targeting chimera of the present application is not limited to GPTAC, and the GPTAC of the present application is not limited to the specific polypeptide type GPTAC listed above. Other GPTACs derived based on the same construction principle are within the protection scope of the present application. For example, the N-terminus of the polypeptide type GPTAC of the present application can be replaced with a similar sequence of the existing Axin sequence; or the N-terminus of the polypeptide type GPTAC of the present application can be replaced with other sequences to enable the GPTAC to target other proteases. Or the Linker of the polypeptide type GPTAC of the present application can be replaced with other sequences. Or the protease-based protein degradation targeting chimera of the present application can be an organic type GPTAC, or other types such as nucleic acid peptides, etc.

[0047] The present application also provides the use of the GSK3-based protein degradation targeting chimera described in the above technical solutions in the preparation of a targeted agent for degrading proteins. Proteases generally have specificity, some have substrate specificity, but more have sequence site specificity. This means that the interacting proteins of proteases are mostly their substrates, and it is difficult to target the target proteins. The present application discloses that GSK3 has protease activity, and the GPTAC (GSK3 proteolysis targeting chimera) derived therefrom, like PROTAC (proteolysis targeting chimera) for E3 ubiquitin ligase and target protein, can effectively bind GSK3 and target protein together to achieve efficient and specific degradation of target protein. GPTAC, like PROTAC, can be directly, quickly and effectively applied in various eukaryotes such as animals and plants. Moreover, GSK3 has three independent protease domains, and the N-terminus and the middle domain have very strong protease activity. At the same time, GSK3 is almost ubiquitously distributed at the cellular level; and is almost constitutively expressed at the tissue level. Therefore, GPTAC has great potential to directly use all PROTACs due to its efficient and specific degradation ability of target proteins and wider expression range. The application fields of GPTAC preferably include: (a) all fields involving existing PROTACs; (b) degradation of all proteins in blood (harmful proteins in blood, such as free bacteria, cancer cells, secretions of the body itself, viruses, etc.); (c) suicide of harmful cells of the body (cancer cells, senescent cells, apoptotic cells, pyroptotic cells, necrotic cells, etc.); (d) repair and self-rescue of cells damaged by viruses or other damage, senescent cells; (e) and the like.

[0048] When the GPTAC is applied to animals, the polypeptide type GPTAC is preferably used by injection, and the organic type GPTAC can be used by injection or orally. When the GPTAC is applied to plants, the polypeptide type GPTAC is preferably used by transgene, and the organic type GPTAC can be used by vascular bundle injection, local application or root application.

[0049] PROTAC relies on the natural intracellular protein degradation system (ubiquitin-proteasome system) to achieve specific degradation of target proteins. A few target protein degradation systems use lysosomes, such as AUTAC. Since PROTAC is highly dependent on the ubiquitin-proteasome system, the redundancy of E3 ubiquitin ligase can cause off-target effects. The function of GPTAC is based on the protease activity of GSK3. First, GSK3 has extremely wide distribution in animals and plants, and almost universal distribution at the cellular level (cell membrane, cytoplasm, nucleus, mitochondria, chloroplast). In humans, hGSK3β is constitutively distributed (except in muscle and soft tissue); in Arabidopsis thaliana, AtBIN2 (a homologous protein of GSK3) is distributed throughout the life cycle and most tissues (except pollen). Second, GSK3 homologous proteins have extremely high amino acid homology in animals and plants. Because GPTAC directly uses the protease activity of GSK3, GSK3 homologous proteins are likely to further increase the efficiency of GPTAC. Because GPTAC differs from PROTAC in design only in that the ligand of E3 ubiquitin ligase in PROTAC is replaced by the ligand of GSK3. Therefore, by optimizing the ligand of GSK3 into the best small organic molecule, all PROTACs can be replaced by corresponding GPTACs at extremely low research and development costs, that is, the efficiency and range of target protein degradation can be improved while retaining all the advantages of PROTAC. After entering the cell, GPTAC will directly guide GSK3 to degrade the target protein; while PROTAC will first guide E3 ubiquitin ligase to ubiquitinate the target protein, and then the proteasome can recognize and degrade the target protein. Therefore, the reaction steps of GPTAC after entering the cell will be much less than those of PROTAC. In vitro experiments show that once GPTAC is added to the reaction system, the reaction ends immediately, that is, the target protein is immediately degraded. However, the organic GPTAC will not be degraded and can be recycled like PROTAC. Moreover, since GPTACs with different affinities for target proteins will have similar performance, it is impossible to distinguish them in terms of time scale (once GPTAC is added to the reaction system, the corresponding target protein is immediately degraded. Only a few seconds of time cannot determine which GPTAC can more effectively guide GSK3 to degrade the target protein. In other words, in the existing embodiments, the affinity difference between GPTAC and the target protein does not affect the degradation efficiency of GSK3 on the target protein). In summary, GPTAC has extremely high efficiency in vitro.

[0050] PROTAC can only degrade proteins inside cells (including membrane proteins), and cannot achieve the clearance of endogenous and exogenous proteins in the blood. GSK3β, which GPTAC relies on, exists in human platelets, peripheral blood mononuclear cells and serum. This means that GPTAC has great potential to degrade any protein in the blood. Harmful proteins in the blood may come from free bacteria, cancer cells, body secretions, viruses, etc. In vitro experiments in embodiments of the present application can achieve efficient degradation of PD-L1 protein on the surface of cancer cells, Alzheimer's disease pathogenic polypeptide Aβ42, and SARS-CoV-2 spike glycoprotein.

[0051] GPTAC has all the advantages of PROTAC compared to gene editing technology:

[0052] Gene editing changes genomic information. At this stage, the function of any gene or protein cannot be completely analyzed, and there is a high probability of knowledge gaps and risks after application. GPTAC is an instant application technology that can efficiently target and degrade proteins during use, and once use is terminated, the targeted degradation effect will gradually disappear. This technology not only does not change the genome, but also can be adjusted at any time and quickly re-applied.

[0053] Gene editing will have some off-target effects. GPTAC has high specificity and high affinity for target proteins, greatly reducing off-target effects.

[0054] Gene editing has limited ability to knock out multiple genes (1. multiple unrelated genes; 2. multiple homologous genes or gene family genes) at the same time. On the one hand, due to the limitations of vector load and the compatibility of co-transformation of multiple vectors; on the other hand, for a single sequence, if you want to knock out a gene family or multiple homologous genes at one time, you need to find and rely on the sequence consistency of the key site, which is very difficult. GPTAC has no limit on the number of target proteins it degrades at the same time. On the one hand, GPTAC is based on the recognition of protein spatial structure, so reasonable design (high specificity or high affinity) will simultaneously degrade the proteins corresponding to the gene family or multiple homologous proteins or isoenzyme proteins. On the other hand, as mentioned earlier, GPTAC has very high degradation efficiency in vitro, and is currently in the form of consumable polypeptide (i.e. the final GSK3 degradation will only leave the N-terminal GSK3 ligand part), so GPTAC has no limit on the number of uses, i.e. more GPTAC units targeting different proteins can be used at the same time. That is, in the future, GPTAC can be optimized and upgraded to non-degradable small molecules, and its efficient degradation of target proteins plus the optimization of the use ratio of different units will also give it a huge advantage in the number of uses.

[0055] In animals, there are many limitations in gene editing technology. For example, relevant norms and ethical principles need to be strictly followed. GPTAC does not change the genome and has no ethical risks. GPTAC is time-effective, i.e. it takes effect as soon as it is used and loses effect as soon as it is stopped. In addition, at this stage, the technology is consumable (polypeptide type), and almost all of its components (except linker) can be replaced with corresponding animal sources, with extremely low immunogenicity. After optimization and upgrading, GPTAC will draw on the advantages of all related PROTACs to minimize immunogenicity. The optimization and upgrading refer to the design of GPTAC as an organic small molecule. Further, for the existing PROTAC, the E3 ubiquitin ligase ligand part is replaced with the GSK3 organic ligand, and the corresponding GPTAC is obtained. Because the optimized and upgraded GPTAC is very similar in structure to the PROTAC from which it is borrowed, the optimized GPTAC can have similar immunogenicity to PROTAC.

[0056] In plants, gene editing technology also has limitations. First, it is difficult to establish callus or somatic embryo systems in different species, and the efficiency of gene editing on them is limited. Second, the effects and variability of different gene editing technologies are large. For GPTAC, first, the present stage of the invention is still in the form of a raw polypeptide, with a molecular weight of about 8-16 kDa. The GPTAC in this embodiment contains 80-160 amino acids, corresponding to 240-480 nt of DNA. Due to the limited examples, GPTAC can at least be applied in plants through transgenic overexpression; compared with gene editing, GPTAC transgenes have more independent sequence units under the same vector load limit; under the same number of sequence units, GPTAC can target more target proteins. Second, plants have a vascular system similar to animal blood vessels, but also have plasmodesmata that animal cells do not have, which can achieve efficient transport of substances between cells. Since the design of GPTAC and PROTAC is very similar, and the molecular weight of today's PROTAC is only 700-1200 Da, the molecular weight of the molecular glue is less than 500 Da (for example, ARV-110 of Arvinas Company for treating prostate cancer is the first PROTAC drug in the world to enter clinical trials, with a molecular weight of 812 Da. ARV-471 of Arvinas Company for treating breast cancer has a molecular weight of 724 Da. Currently, only three molecular glue drugs (thalidomide, lenalidomide, and pomalidomide) have been approved for marketing, used for treating solid tumors and hematologic malignancies, with molecular weights of 258 Da, 259 Da, and 273 Da, respectively), so the updated GPTAC has the potential to be less than 1 kDa. Although the size exclusion limit (SEL) of plasmodesmata is usually 800-1000 Da, the optimized GPTAC will have a higher probability of successfully passing through the plasmodesmata and the vascular system, and the cell permeability of small molecules is good in itself, so it can achieve more efficient targeted protein degradation than the current GPTAC.

[0057] The application also provides a method for degrading a target protein based on the GSK3-based protein degradation targeting chimera, comprising the following steps: mixing the GSK3-based protein degradation targeting chimera with a sample containing the target protein to degrade the target protein.

[0058] In the application, when the GSK3 is a human protein, the temperature for targeted degradation is preferably 36-37℃, more preferably 37℃.

[0059] In the application, when the GSK3 is an Arabidopsis thaliana protein, the temperature for targeted degradation is preferably 26-28℃, more preferably 28℃.

[0060] In the present application, the mixed system preferably further comprises the addition of Cisplatin.

[0061] The present application also provides the use of Cisplatin in the preparation of an agent for enhancing the protease activity of GSK3.

[0062] The present application also provides the use of Cisplatin in the preparation of an agent for enhancing the GSK3-targeted proteolysis directed by the GSK3-based proteolysis targeting chimera on the degradation of the target protein.

[0063] In order to further illustrate the present application, the application of GSK3 as a protease, the GSK3-based proteolysis targeting chimera and its preparation method and application provided by the present application are described in detail below in conjunction with the accompanying drawings and examples, but they should not be understood as limiting the scope of protection of the present application.

[0064] Example 1

[0065] Gene cloning, protein expression and purification of hGSK3β, domain knockout hGSK3β variant, single domain hGSK3β variant, AtBIN2, single domain AtBIN2 variant.

[0066] 1. Basic information of hGSK3β (P49841, in UniProt) gene, encoding 420 amino acids.

[0067] 2. BIN2 (AT4G18710, in TAIR) gene basic information, encoding 380 amino acids.

[0068] 3. Gene cloning of hGSK3β, domain knockout hGSK3β variant, single domain hGSK3β variant, AtBIN2, single domain AtBIN2 variant.

[0069] (1) Synthesis of CDS of hGSK3β

[0070] Synthesis of CDS of hGSK3β (optimized for codons, without TGA stop codon), with a restriction enzyme cutting site NdeI at the N-terminal and a restriction enzyme cutting site HindIII at the C-terminal, for connection to the pET41b vector to generate a C-terminal His tag. The fragment was synthesized by Beijing Genki Biological Technology Co., Ltd. The sequence is shown as SEQ ID NO. 5:

[0071] (2) Extraction of RNA from Arabidopsis thaliana inflorescence stem and reverse transcription into cDNA

[0072] When the plant height is close to 20 cm, the inflorescence stem without flower is cut. After the material is crushed with liquid nitrogen, total RNA is extracted by using an RNA extraction kit (EASYspin Plus RNA Fast Extraction Kit RN38-EASYspin Plus, Aidley Company). The extracted total RNA is reverse transcribed into cDNA by using a reverse transcription kit (PC18-TRUEscript 1st Strand cDNA Synthesis Kit, Aidley Company).

[0073] (3) Primer design

[0074] According to the sequence characteristics, primers with restriction enzyme cutting sites at both ends are designed for connection to the pET41b vector to generate a C-terminal His tag. The upstream primer contains an NdeI enzyme cutting site, and the downstream primer contains a HindIII enzyme cutting site. All primers are entrusted to Shengong Bioengineering (Shanghai) Co., Ltd. for synthesis.

[0075] (a). Primer design for expressing hGSK3β vector (pET41b-GSK3β-His):

[0076] Upstream primer: AGGAGATATACATATGTCAGGGCGGCCCAGAAC (SEQ ID NO. 6);

[0077] Downstream primer: GTGCGGCCGCAAGCTTGGTGGAGTTGGAAGCTGAT (SEQ ID NO. 7).

[0078] (b). Primer design for expressing hGSK3β knockout N-terminal domain vector (pET41b-GSK3β-Δ202-His):

[0079] Upstream primer: AGGAGATATACATATGAGTGCAAAGCAGCTGGTC (SEQ ID NO. 8);

[0080] Downstream primer: GTGCGGCCGCAAGCTTGGTGGAGTTGGAAGCTGAT (SEQ ID NO. 9).

[0081] (c). Primer design for expressing hGSK3β knockout intermediate domain vector (pET41b-GSK3β-Δ95-His):

[0082] Upstream fusion primer: CTCTGTGACTTTGGAGCACATCCTTGGACTAAGGTC (SEQ ID NO. 10);

[0083] Downstream fusion primer: GACCTTAGTCCAAGGATGTGCTCCAAAGTCACAGAG (SEQ ID NO. 11);

[0084] Upstream fusion primer on pET41b backbone: TTCCGACCCCGAACTCCA (SEQ ID NO. 12);

[0085] Downstream fusion primer on pET41b backbone: TTTTAATACAGCAGTATCAGGATC (SEQ ID NO. 13).

[0086] (d). Primer design for the expression of N-terminal domain of hGSK3β vector (pET41b-GSK3β-Δ218-His):

[0087] Upstream primer: AGGAGATATACATATGTCAGGGCGGCCCAGAAC (SEQ ID NO. 14);

[0088] Downstream primer: GTGCGGCCGCAAGCTTTCCAAAGTCACAGAGTTTTAAT (SEQ ID NO. 15).

[0089] (e). Primer design for the expression of intermediate domain of hGSK3β vector (pET41b-GSK3β-On95-His):

[0090] Upstream primer: AGGAGATATACATATGAGTGCAAAGCAGCTGGTC (SEQ ID NO. 16);

[0091] Downstream primer: GTGCGGCCGCAAGCTTCTTAATTTGAGGGAATTTAAATT (SEQ ID NO. 17).

[0092] (f). Primer design for the expression of C-terminal domain of hGSK3β vector (pET41b-GSK3β-On123-His):

[0093] Upstream primer: AGGAGATATACATATGTCAGGGCGGCCCAGAAC (SEQ ID NO. 18);

[0094] Downstream primer: AGGAGATATACATATGGCACATCCTTGGACTAAGG (SEQ ID NO. 19).

[0095] (g). Primer design for the expression of AtBIN2 vector (pET41b-BIN2-His):

[0096] Upstream primer: AGGAGATATACATATGGCTGATGATAAGGAGATGC (SEQ ID NO. 20);

[0097] Downstream primer: GTGCGGCCGCAAGCTTAGTTCCAGATTGATTCAAGAA (SEQ ID NO. 21).

[0098] (h) Primer design for the N-terminal domain of AtBIN2 expressing vector (pET41b-BIN2-Δ194-His):

[0099] Upstream primer: AGGAGATATACATATGGCTGATGATAAGGAGATGC (SEQ ID NO. 22);

[0100] Downstream primer: GTGCGGCCGCAAGCTTGCCAAAGTCACAGATTTTGA (SEQ ID NO. 23).

[0101] (i) Primer design for the middle domain of AtBIN2 expressing vector (pET41b-BIN2-On95-His):

[0102] Upstream primer: AGGAGATATACATATGAGTGCGAAACAGCTCGTTAA (SEQ ID NO. 24);

[0103] Downstream primer: GTGCGGCCGCAAGCTTCTTTATCTGTGGAAACCTGAA (SEQ ID NO. 25).

[0104] (j) Primer design for the C-terminal domain of AtBIN2 expressing vector (pET41b-BIN2-Δ281-His):

[0105] Upstream primer: AGGAGATATACATATGGCACATCCCTGGCACAAGA (SEQ ID NO. 26);

[0106] Downstream primer: GTGCGGCCGCAAGCTTAGTTCCAGATTGATTCAAGAA (SEQ ID NO. 27).

[0107] (4) PCR amplification of the target gene

[0108] In 50 μL PrimeSTAR Max (TAKARA, R045B, see reagent manual for preparation method) reaction system, hGSK3β and its variant genes were amplified by PCR using synthetic GSK3β CDS as template, and the vector (pET41b-GSK3β-Δ95-His) for hGSK3β knockout intermediate domain was amplified by PCR using pET41b-GSK3β-His (preparation method: using synthetic hGSK3β CDS as template, and using upstream and downstream primers of hGSK3β expression vector (pET41b-GSK3β-His) to connect hGSK3β CDS to linear vector pET41b digested by NdeI and HindIII) as template. AtBIN2 and its variant genes were amplified by PCR using Arabidopsis thaliana cDNA as template. The above primers were used as amplification primers, and the PCR reaction was performed by the method of PCR, and the PCR reaction conditions were as follows: pre-denaturation at 98°C for 5 min; thermal cycling at 98°C for 30 s, 55°C for 15 s, 72°C for 5 s / kb, for 30 cycles; and extension at 72°C for 10 min.

[0109] (5) After the target fragment was amplified by PCR, the DNA amplification product of the target gene was confirmed by 1% agarose gel electrophoresis, and then the PCR product purification recovery kit (Aidley Company DR02-PCR) was used for recovery and purification of the amplification product.

[0110] 4. Construction of recombinant plasmid

[0111] The vector pET41b (purchased from Thermo Fisher) was double-digested with NdeI and HindIII (purchased from NEB), and then the obtained backbone fragment and the purified DNA fragment in step 3 were subjected to homologous recombination using a seamless cloning kit (Biyun Tian Company D7010S).

[0112] The ligation product was transformed into E. coli DH5a (purchased from Shengong Bioengineering (Shanghai) Co., Ltd.), plated on solid LB medium containing 30 μg / ml kanamycin, and incubated at 37°C overnight in an inverted culture. A single colony was selected and incubated at 37°C in liquid LB medium containing 30 μg / ml kanamycin overnight with shaking at 220 rpm. The recombinant plasmid in the bacterial solution was extracted using a plasmid extraction kit (Aidley Co. PL02). Plasmid PCR verified that the recombinant plasmid contained the desired fragment. The constructed recombinant plasmids pET41b-GSK3β-His, pET41b-GSK3β-Δ202-His, pET41b-GSK3β-Δ95-His, pET41b-GSK3β-Δ218-His, pET41b-GSK3β-On95-His, pET41b-GSK3β-On123-His, pET41b-BIN2-His, pET41b-BIN2-Δ194-His, pET41b-BIN2-On95-His, and pET41b-BIN2-Δ281-His were sequenced and identified by Beijing Qikang Biotechnology Co., Ltd. The measured sequences were completely matched with the corresponding references, indicating that the recombinant plasmids were successfully constructed.

[0113] 5. Expression of recombinant plasmids in host bacteria

[0114] The recombinant plasmids were transformed into host bacteria E. coli BL21 (purchased from Shengong Bioengineering (Shanghai) Co., Ltd.), and a single colony was selected and incubated at 37°C in liquid LB medium containing 30 μg / ml kanamycin overnight with shaking at 220 rpm. The next day, the bacteria were inoculated into fresh liquid LB medium containing 30 μg / ml kanamycin at a ratio of 1:50, and incubated until the OD 600 was between 0.4 and 0.6. IPTG (isopropyl-β-D-thiogalactoside) was added to a final concentration of 1 mM. The bacteria were incubated at 28°C for 6 h with shaking at 220 rpm, and the bacterial cells were collected by centrifugation (8000 rpm, 10 min).

[0115] 6. Purification of recombinant proteins

[0116] The bacterial pellet was resuspended in Ni-NTA lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazol). After sonication (40 apt; 5 s on, 25 s off; 3 min) the supernatant was collected by centrifugation (12000 rpm, 30 min). First, the Ni-NTA affinity column (Qiagen P2233) was equilibrated with 8 column volumes of Ni-NTA lysis buffer; then the collected supernatant was passed through the column. The column was washed with 4 column volumes of Ni-NTA lysis buffer; then the column was washed with 4 column volumes of Ni-NTA wash buffer (50 mM NaH2PO4, 300 mM NaCl, 25 mM imidazol). The column was eluted with 1 column volume of Ni-NTA elution buffer (50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazol). The eluted product was separated by 10% SDS-PAGE and then subjected to immunoblotting. The proteins produced by recombinant plasmids pET41b-GSK3β-His, pET41b-GSK3β-Δ202-His, pET41b-GSK3β-Δ95-His, pET41b-GSK3β-Δ218-His, pET41b-GSK3β-On95-His, pET41b-GSK3β-On123-His, pET41b-BIN2-His, pET41b-BIN2-Δ194-His, pET41b-BIN2-On95-His, pET41b-BIN2-Δ281-His were named hGSK3β-His, hGSK3β Δ202 -His, hGSK3β Δ95 -His, hGSK3β Δ218 -His, hGSK3β On95 -His, hGSK3β On123 -His, AtBIN2-His, AtBIN2 Δ194 -His, AtBIN2 On95 -His and AtBIN2 Δ281 -His. As shown in Figure 1, all the recombinant proteins were purified correctly.

[0117] hGSK3β Δ202 -His: hGSK3β lacks the N-terminal domain. If this protein has protease activity, it indicates that the middle or C-terminal domain of hGSK3β has protease activity; otherwise, it indicates that the N-terminal domain of hGSK3β has protease activity.

[0118] hGSK3β Δ95-His: hGSK3β has only N-terminal domain. If this protein has protease activity, it means that the N-terminal domain of hGSK3β has protease activity; otherwise, it means that the middle or C-terminal domain of hGSK3β has protease activity.

[0119] hGSK3β Δ218 -His: hGSK3β has only N-terminal domain. If this protein has protease activity, it means that the N-terminal domain of hGSK3β has protease activity; otherwise, it means that the middle or C-terminal domain of hGSK3β has protease activity.

[0120] hGSK3β On95 -His: hGSK3β has only N-terminal domain. If this protein has protease activity, it means that the N-terminal domain of hGSK3β has protease activity; otherwise, it means that the middle or C-terminal domain of hGSK3β has protease activity.

[0121] hGSK3β On123 -His: hGSK3β has only N-terminal domain. If this protein has protease activity, it means that the N-terminal domain of hGSK3β has protease activity; otherwise, it means that the middle or C-terminal domain of hGSK3β has protease activity.

[0122] AtBIN2 Δ194 -His: hGSK3β has only N-terminal domain. If this protein has protease activity, it means that the N-terminal domain of hGSK3β has protease activity; otherwise, it means that the middle or C-terminal domain of hGSK3β has protease activity.

[0123] AtBIN2 On95 -His: hGSK3β has only N-terminal domain. If this protein has protease activity, it means that the N-terminal domain of hGSK3β has protease activity; otherwise, it means that the middle or C-terminal domain of hGSK3β has protease activity.

[0124] AtBIN2 Δ281 -His: hGSK3β has only N-terminal domain. If this protein has protease activity, it means that the N-terminal domain of hGSK3β has protease activity; otherwise, it means that the middle or C-terminal domain of hGSK3β has protease activity.

[0125] Example 2

[0126] Gene cloning, protein expression and purification of human PD-L1, human Aβ42 and S-protein of new coronavirus.

[0127] 1. Human PD-L1 (hPD-L1) (Q9NZQ7, in UniProt)

[0128] The htPD-L1 protein (truncated human cell programmed death-ligand 1) used in the embodiments of the present application is a truncated form of hPD-L1, and its codon-optimized CDS sequence (without stop codon) for facilitating expression and purification in E. coli system is shown in SEQ ID NO. 28:

[0129] 2. Basic information of human Aβ42. Human Aβ42 (human beta-amyloid polypeptide-42, hAβ42) is a part of the complete protein APP (P05067, in UniProt). hAβ42 encodes 42 amino acids, and its codon-optimized CDS sequence (without stop codon) for facilitating expression and purification in E. coli system is shown in SEQ ID NO. 29:

[0130] 3. Basic information of Spike XS of SARS-CoV-2

[0131] SARS-CoV-2 (XBB) Spike RBD (YP_009724390.1, with mutation G339H, R346T, L368I, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486S, F490S, Q498R, N501Y, Y505H). The XS protein (Spike RBD of SARS-CoV-2 (XBB) of the present application is a part of SARS-CoV-2 (XBB) Spike RBD (R319-F541), and its codon-optimized CDS sequence (without stop codon) for facilitating expression and purification in E. coli system is shown in SEQ ID NO. 30:

[0132] 4. Gene cloning of htPD-L1, hAβ42 and XS

[0133] (1) Synthesis of CDS of htPD-L1 (F19-R238)

[0134] The CDS of htPD-L1 (without TGA stop codon) was synthesized by Beijing Qikexing Biotechnology Co., Ltd.

[0135] (2) Synthesis of CDS of hAβ42

[0136] The CDS of hAβ42 (without TGA stop codon) was synthesized by Beijing Qikexing Biotechnology Co., Ltd.

[0137] (3) CDS of XS

[0138] The CDS of XS (without TGA stop codon) was synthesized by Beijing Genconn Biotech Co., Ltd.

[0139] (4) Primer design

[0140] According to the sequence characteristics, primers with restriction enzyme sites at both ends were designed for connection to the pET41b vector to generate an N-terminal GST tag. The upstream primer contains a Spel enzyme site, and the downstream primer contains a BlpI enzyme site. All primers were synthesized by Shengong Bioengineering (Shanghai) Co., Ltd.

[0141] (a). Primer design for expressing htPD-L1 vector (pET41b-GST-PD-L1):

[0142] Upstream primer: GGATGGTTCAACTAGTATGTTCACGGTTACGGTACCGA (SEQ ID NO. 31);

[0143] Downstream primer: CTAGTTATTGCTCAGCTTAACGTTCGTTCGGCGGGT (SEQ ID NO. 32).

[0144] (b). Primer design for expressing hAβ42 vector (pET41b-GST-Aβ42):

[0145] Upstream primer: GGATGGTTCAACTAGTATGGATGCAGAATTCCGTCATGA (SEQ ID NO. 33);

[0146] Downstream primer: CTAGTTATTGCTCAGCTTATGCGATAACCACACCACCA (SEQ ID NO. 34).

[0147] (c). Primer design for expressing XS vector (pET41b-GST-XS):

[0148] Upstream primer: GGATGGTTCAACTAGTATGCGTGTGCAGCCGACCG (SEQ ID NO. 35);

[0149] Downstream primer: CTAGTTATTGCTCAGCTTAAAAGTTCACGCACTTGTTTTTA (SEQ ID NO. 36).

[0150] (5) PCR amplification of the target gene

[0151] In a 50 μL PrimeSTAR Max (TAKARA, see the reagent instruction for the preparation method) reaction system, the synthesized CDS was used as a template, and the corresponding primers described above were used as amplification primers to amplify by PCR. The PCR reaction conditions were as follows: pre-denaturation at 98℃ for 5 min; thermal cycling at 98℃ for 30 s, 55℃ for 15 s, and 72℃ for 5 s / kb for 30 cycles; and extension at 72℃ for 10 min.

[0152] (6) After the target fragment was amplified by PCR and the DNA amplification product of the target gene was confirmed by 1% agarose gel electrophoresis, the PCR product was recovered and purified using a PCR product purification recovery kit (Aidley Company DR02-PCR).

[0153] 5. Construction of the target protein recombinant plasmid

[0154] Refer to Example 1.

[0155] The constructed recombinant plasmids pET41b-GST-PD-L1, pET41b-GST-Aβ42, and pET41b-GST-XS were sequenced and identified by Beijing Qikexing Biological Technology Co., Ltd. The measured sequence was completely matched with the corresponding reference, indicating that the recombinant plasmid was successfully constructed.

[0156] 6. Expression of the target protein recombinant plasmid in a host bacterium

[0157] Refer to Example 1.

[0158] 7. Purification of the target protein recombinant protein

[0159] Refer to Example 1. The proteins produced by the recombinant plasmids pET41b-GST-PD-L1, pET41b-GST-Aβ42, and pET41b-GST-XS were named as GST-htPD-L1, GST-hAβ42, and GST-XS, respectively. As shown in FIG. 2, all the recombinant proteins were correctly purified.

[0160] Example 3

[0161] Gene cloning, protein expression, and purification of the polypeptide type GPTAC.

[0162] 1. The composition structure of all GPTACs is: the ligand part of GSK3 (containing BIN2), the Linker part and the ligand part of the target protein. The naming method is G(GSK3)-L(Linker)-Initial Acronym of POI. For example, GLP = G(GSK3)-L(Linker)-P(PD-L1). The GPTAC related to BIN2 is named as B(BIN2)-L(Linker)-Initial Acronym of POI. For example, BLP = B(BIN2)-L(Linker)-P(PD-L1).

[0163] 2. Basic information of BIN2 related polypeptide type GPTAC

[0164] (1) In all BIN2 related polypeptide type GPTACs, the ligand part and the Linker part of BIN2 are fixed.

[0165] The amino acid sequence of the ligand part of BIN2 is: MEELIDRSLLEAVRR (SEQ ID NO. 2).

[0166] The amino acid sequence of the Linker part is: AAVLEYLTAEILELA (SEQ ID NO. 3).

[0167] (2) GPTAC targeting COVID-19 spike RBD: BLC(COVID-19 Spike RBD)

[0168] The amino acid sequence of the ligand part of COVID-19 spike RBD is:

[0169] 3. Basic information of hGSK3 related polypeptide type GPTAC

[0170] (1) In all hGSK3 related polypeptide type GPTACs, the ligand part and the Linker part of GSK3 are fixed.

[0171] The amino acid sequence of the ligand part of GSK3 is: MVEPQKFAEELIHRLEAVQR (SEQ ID NO. 1).

[0172] The amino acid sequence of the Linker part is: AAVLEYLTAEILELA (SEQ ID NO. 3).

[0173] (2) GPTAC targeting hPD-L1: GLP(hPD-L1)

[0174] The amino acid sequence of the ligand part of hPD-L1 is:

[0175] (3) GPTAC targeting hPD-L1: GLPH (anti-PD-L1 antibody with High affinity)

[0176] The amino acid sequence of the ligand portion of hPD-L1 is:

[0177] (4) GPTAC targeting hPD-L1: GLPL (anti-PD-L1 antibody with Low affinity)

[0178] The amino acid sequence of the ligand portion of hPD-L1 is:

[0179] (5) GPTAC targeting hAβ42: GLAm (anti-Aβ42 monoclonal antibody)

[0180] The amino acid sequence of the ligand portion of hAβ42 is:

[0181] (6) GPTAC targeting hAβ42: GLAmH (anti-Aβ42 monoclonal antibody with High affinity)

[0182] The amino acid sequence of the ligand portion of hAβ42 is:

[0183] (7) GPTAC targeting hAβ42: GLAmM (anti-Aβ42 monoclonal antibody with Medium affinity)

[0184] The amino acid sequence of the ligand portion of hAβ42 is:

[0185] (8) GPTAC targeting COVID-19 Spike RBD: GLC (anti-COVID-19 Spike RBD)

[0186] The ligand information of COVID-19 Spike RBD is the same as in BLC.

[0187] (9) GPTAC targeting COVID-19 Spike RBD: GLCH (anti-COVID-19 Spike RBD monoclonal antibody with High affinity)

[0188] The amino acid sequence of the XS ligand part of the same is:

[0189] (10) GPTAC of new coronavirus spike protein: GLCM (anti-COVID-19 Spike RBD monoclonal antibody with medium affinity)

[0190] The amino acid sequence of the XS ligand part of the same is:

[0191] 4. Synthesize all GPTAC genes, and optimize their CDS for codon usage for expression and purification in E. coli system, and do not contain DNA sequences corresponding to fusion His tag. Commission Beijing Qikexing Biological Technology Co., Ltd. to synthesize.

[0192] (1) DNA sequence of BLC:

[0193] (2) DNA sequence of GLP:

[0194] (3) DNA sequence of GLPH:

[0195] (4) DNA sequence of GLPL:

[0196] (5) DNA sequence of GLAm:

[0197] (6) DNA sequence of GLAmH:

[0198] (7) DNA sequence of GLAmM:

[0199] (8) DNA sequence of GLC:

[0200] (9) DNA sequence of GLCH:

[0201] (10) DNA sequence of GLCM:

[0202] 5. Cloning of all GPTAC genes

[0203] (1) Primer design

[0204] According to the sequence characteristics, the primers with restriction enzyme sites at both ends were designed for connecting to the pET41b vector to generate C-terminal His tag. The upstream primer contains a NdeI enzyme site, and the downstream primer contains a HindIII enzyme site. All primers were synthesized by Shengong Bioengineering (Shanghai) Co., Ltd.

[0205] (a). Primer design for expressing BLC vector (pET41b-BLC-His):

[0206] Upstream primer: AGGAGATATACATATGGAGGAATTAATAGATAGAAGTC (SEQ ID NO. 56);

[0207] Downstream primer: GTGCGGCCGCAAGCTTTTCCTGCAGTGGGTACATC (SEQ ID NO. 57).

[0208] (b). Primer design for expressing GLP vector (pET41b-GLP-His):

[0209] Upstream primer: AGGAGATATACATATGGTAGAACCGCAGAAATTCG (SEQ ID NO. 58);

[0210] Downstream primer: GTGCGGCCGCAAGCTTGCTTTCTTTGATCTGGATTTT (SEQ ID NO. 59).

[0211] (c). Primer design for expressing GLPH vector (pET41b-GLPH-His):

[0212] Upstream primer: ATCCTGGAACTGGCTGGTTTTACTTTCAGCAGCTA (SEQ ID NO. 60);

[0213] Downstream primer: TGCGGCCGCAAGCTTGGTAGTGACCGTACCCAG (SEQ ID NO. 61);

[0214] Upstream primer of pET41b-GL-His skeleton: AAGCTTGCGGCCGCAC (SEQ ID NO. 62);

[0215] Downstream primer of pET41b-GL-His skeleton: AGCCAGTTCCAGGATTTCT (SEQ ID NO. 63).

[0216] (d). Primer design for expressing GLPL vector (pET41b-GLPL-His):

[0217] Upstream primer: ATCCTGGAACTGGCTAGCGATTCTTGGATTCACTG (SEQ ID NO. 64);

[0218] Downstream primer: TGCGGCCGCAAGCTTCCAGTGGCGACGAGCG (SEQ ID NO. 65);

[0219] Upstream primer for pET41b-GL-His backbone: AAGCTTGCGGCCGCAC (SEQ ID NO. 62);

[0220] Downstream primer for pET41b-GL-His backbone: AGCCAGTTCCAGGATTTCT (SEQ ID NO. 63).

[0221] (e). Primer design for expression of GLAm vector (pET41b-GLAm-His):

[0222] Upstream primer:

[0223] Downstream primer:

[0224] Upstream primer for pET41b-GL-His backbone: AAGCTTGCGGCCGCAC (SEQ ID NO. 62);

[0225] Downstream primer for pET41b-GL-His backbone: AGCCAGTTCCAGGATTTCT (SEQ ID NO. 63).

[0226] (f). Primer design for expression of GLAmH vector (pET41b-GLAmH-His):

[0227] Upstream primer: ATCCTGGAACTGGCTGGTTTCACTTTCTCCCGCT (SEQ ID NO. 68);

[0228] Downstream primer: TGCGGCCGCAAGCTTGTAGTCACCGGATGCACAA (SEQ ID NO. 69);

[0229] Upstream primer for pET41b-GL-His backbone: AAGCTTGCGGCCGCAC (SEQ ID NO. 62);

[0230] Downstream primer for pET41b-GL-His backbone: AGCCAGTTCCAGGATTTCT (SEQ ID NO. 63).

[0231] (g). Primer design for expression of GLAmM vector (pET41b-GLAmM-His):

[0232] Upstream primer: ATCCTGGAACTGGCTTGGATCGAATGGATTAAACAG (SEQ ID NO. 70);

[0233] Downstream primer: TGCGGCCGCAAGCTTGTTGTTGTTAGAGCCTTCAC (SEQ ID NO. 71);

[0234] Upstream primer for pET41b-GL-His backbone: AAGCTTGCGGCCGCAC (SEQ ID NO. 62);

[0235] Downstream primer for pET41b-GL-His backbone: AGCCAGTTCCAGGATTTCT (SEQ ID NO. 63).

[0236] (h). Primer design for expression of GLC vector (pET41b-GLC-His):

[0237] Upstream primer: AGGAGATATACATATGGTTGAACCGCAGAAATTCG (SEQ ID NO. 72);

[0238] Downstream primer: GTGCGGCCGCAAGCTTTTCCTGCAGCGGGTACATT (SEQ ID NO. 73).

[0239] (i). Primer design for expression of GLCH vector (pET41b-GLCH-His):

[0240] Upstream primer: ATCCTGGAACTGGCTGGTCGTTCTCTGCGTCTG (SEQ ID NO. 74);

[0241] Downstream primer: TGCGGCCGCAAGCTTTTCCGGATCTGCACCCAG (SEQ ID NO. 75);

[0242] Upstream primer for pET41b-GL-His backbone: AAGCTTGCGGCCGCAC (SEQ ID NO. 62);

[0243] Downstream primer for pET41b-GL-His backbone: AGCCAGTTCCAGGATTTCT (SEQ ID NO. 63).

[0244] (j). Primer design for expression of GLCM vector (pET41b-GLCM-His):

[0245] Upstream primer: ATCCTGGAACTGGCTTCCTCTGCAGTAGCATGGT (SEQ ID NO. 76);

[0246] Downstream primer: TGCGGCCGCAAGCTTACGGTAGGATTGCTGGCA (SEQ ID NO. 77);

[0247] Upstream primer of pET41b-GL-His skeleton: AAGCTTGCGGCCGCAC (SEQ ID NO. 62);

[0248] Downstream primer of pET41b-GL-His skeleton: AGCCAGTTCCAGGATTTCT (SEQ ID NO. 63).

[0249] (2) PCR amplification of target gene

[0250] In a 50 μL PrimeSTAR Max (TAKARA Company, see reagent instruction for preparation method) reaction system, all GPTAC upstream and downstream primer pairs were used as templates with synthesized CDS. Some GPTAC contained pET41b-GL-His skeleton upstream and downstream primer pairs, and the corresponding skeleton sequence was amplified using vector pET41b-GLP-His as a template. Amplification was performed by PCR, and the PCR reaction conditions were as follows: pre-denaturation 98℃ min; thermal cycling 98℃ 30s, 55℃ annealing 15s, 72℃ extension 5s / kb, 30 cycles; 72℃ extension 10min.

[0251] (3) After the DNA amplification product of the target gene was confirmed by 1% agarose gel electrophoresis, the PCR product purification recovery kit (Aidley Company DR02-PCR) was used for recovery and purification of the amplified product.

[0252] 6. Construction of recombinant plasmid

[0253] Refer to Example 1.

[0254] The constructed recombinant plasmids pET41b-BLC-His, pET41b-GLP-His, pET41b-GLPH-His, pET41b-GLPL-His, pET41b-GLAm-His, pET41b-GLAmH-His, pET41b-GLAmM-His, pET41b-GLC-His, pET41b-GLCH-His, pET41b-GLCM-His were sequenced and identified by Beijing GenScript Biotech Co., Ltd. The measured sequence was completely matched with the corresponding reference, indicating that the recombinant plasmid was successfully constructed.

[0255] 7. Expression of all GPTAC recombinant plasmids in host bacteria

[0256] Refer to Example 1.

[0257] 8. Purification of all GPTAC recombinant proteins

[0258] Refer to Example 1. The proteins produced by the recombinant plasmids pET41b-BLC-His, pET41b-GLP-His, pET41b-GLPH-His, pET41b-GLPL-His, pET41b-GLAm-His, pET41b-GLAmH-His, pET41b-GLAmM-His, pET41b-GLC-His, pET41b-GLCH-His, pET41b-GLCM-His were named as BLC-His, GLP-His, GLPH-His, GLPL-His, GLAm-His, GLAmH-His, GLAmM-His, GLC-His, GLCH-His and GLCM-His, respectively. As shown in Figure 3, all the recombinant proteins were correctly purified.

[0259] Example 4

[0260] hGSK3β, domain knockout hGSK3β variant, individual domain hGSK3β variant, AtBIN2, individual domain AtBIN2 variant protein has protease activity.

[0261] 1. The concentration of the recombinant protein was measured by microspectrophotometer Nanodrop.

[0262] 2. Conversion of molar concentration of recombinant protein. Log in the website https: / / web.expasy.org / protparam / , input the amino acid sequence of recombinant protein, and check the light absorption value Abs. For each recombinant protein, define the molar concentration as M (mM / L), the substance concentration as C (mg / ml), the light absorption value as A (0.1% = 1 g / l), and the molecular weight as M (kD). Then the conversion formula of molar concentration of recombinant protein is: M = (C / A)*1000 / M or M = 1000C / (A*M).

[0263] 3. Proteinase activity detection scheme:

[0264] The recombinant protein obtained from Example 1 was subjected to proteinase activity detection. The specific method is as follows:

[0265] Reaction system (22 μL):

[0266] (1) Dialysis Buffer: 20 mM Tris HCl (pH 7.5), 20 mM NaCl, 10 mM MgCl2, and 0.5 mM KCl.

[0267] (2) ATP: final concentration 1 mM.

[0268] (3) hGSK3β, AtBIN and variant proteins: final concentration 20 μM, dialyzed by Dialysis buffer.

[0269] Sample addition sequence:

[0270] (1) Dialysis Buffer. (2) ATP. (3) hGSK3β or AtBIN or variant protein.

[0271] Notes:

[0272] (1) The reaction system needs to be ice-bathed. (2) After adding each reagent, mix immediately. (3) For each treatment, label the EP tubes of "0 h" and "24 h", and add 10 μL 2x SDS protein loading buffer in advance in the "0 h" EP tube. (4) After the reaction system is prepared, respectively, dispense 10 μL reaction sample to the "0 h" and "24 h" EP tubes, and mix quickly.

[0273] Reaction conditions:

[0274] (1) For human GSK3β (hGSK3β) and variants, incubate at 37°C for 24 h.

[0275] (2) For Arabidopsis BIN2 (AtBIN2) and variants, incubate at 28°C for 24 h.

[0276] (3) After the incubation, add 10 μL 2x SDS protein loading buffer to the "24h" EP tube and mix well.

[0277] Detection conditions:

[0278] (1) Load each pair of treated samples ("0h" and "24h") onto a 15% SDS-PAGE (Tris-Glycine system) in order, run 6 min at 220V for stacking gel, and run 15 min at 280V for separation gel.

[0279] (2) Perform the routine semi-dry blotting procedure, using 2x 0.22 μm nitrocellulose membrane, 0.8x membrane area (mm 2 ) mA current, and run for 30-40 min (determine by pre-experiment).

[0280] (3) Soak the membrane in PBST-M (5% milk, 0.1% Tween-20 in 1x PBS) for 1 h.

[0281] (4) Add HRP-conjugated anti-His tag mouse monoclonal antibody (Biotechne AF2873-200 μL, 1:5000 dilution) and incubate for 1 h.

[0282] (5) Discard the PBST-M and wash the membrane quickly 3 times with PBST (0.1% Tween-20 in 1x PBS), and then wash with PBST for 10 min, 5 min, and 5 min, respectively.

[0283] (6) Expose and develop.

[0284] 4. The results are shown in Figure 4. Most of the recombinant proteins have obvious protease activity. Only AtBIN2 Δ281 -His shows weak protease activity. It should be noted that AtBIN2 On95 -His is not shown in Figure 4, because its protease activity is too strong, and there is no AtBIN2 On95 -His signal in all "0h" samples even after ice bath operation.

[0285] Example 5

[0286] Factors affecting the protease activity of hGSK3β.

[0287] 1. Take hGSK3β as the research object and perform in vitro target protein degradation test:

[0288] Reaction system (22 μL):

[0289] (1) Dialysis Buffer: 20 mM Tris HC1 (pH 7.5), 20 mM NaCl, 10 mM MgCl2, and 0.5 mM KC1.

[0290] (2) ATP: final concentration 1 mM.

[0291] (3) Protease activity treatment: MG132 (Beyotime S1748-5mg, final concentration 100 mM) or Bikinin (MedChemExpress, HY-12524-5mg, final concentration 30 mM) or Cisplatin (Beyotime S1552, final concentration 150 mM) or AEBSF (Beyotime SG2000-5mg, final concentration 1 mM) or Pepstain A (Beyotime SG2016-5mg, final concentration 1 mM) or Leupeptin (Sigma L8110, final concentration 1 mM) or 1,10-Phenanthrolin (Sangon Biotech (Shanghai) Co., Ltd. A600693-0005, final concentration 1 mM).

[0292] (4) hGSK3P and variants: final concentration 20 mM, dialyzed with Dialysis buffer.

[0293] Loading order:

[0294] (1) Dialysis Buffer. (2) ATP. (3) Protease activity treatment. (4) hGSK3P or variants.

[0295] Notes:

[0296] (1) The reaction system needs to be ice-bathed. (2) Each reagent should be mixed immediately after being added. (3) The treatment group settings are shown in Figure 5.

[0297] (4) For multiple groups of treatments, a large sample containing Dialysis Buffer and ATP must be prepared, and the volume containing the least Dialysis Buffer in all treatment groups is used as the standard. For example, if there are 7 groups of treatments, the large sample should be prepared (7.2 to 7.6) x the Dialysis Buffer and ATP in the treatment group containing the least Dialysis Buffer, then mixed and aliquoted.

[0298] (5) For each treatment group, compensate for the missing Dialysis Buffer, then add the corresponding protease activity treatment, to ensure that the total volume of the reaction system is always 22 pL.

[0299] (6) For each treatment, label the "Oh" and "24h" EP tubes and add 10 μL of 2x SDS loading buffer to the "Oh" EP tube in advance.

[0300] (7) After the reaction system is prepared, 10 μL of the reaction sample is respectively dispensed into the "Oh" and "24h" EP tubes and mixed quickly.

[0301] Reaction conditions:

[0302] (1) For human GSK3β (hGSK3β) and variants, incubate at 37°C for 24h.

[0303] (2) After the incubation is completed, add 10 μL of 2x SDS loading buffer to the "24h" EP tube and mix quickly.

[0304] Detection conditions:

[0305] (1) The sample pair ("Oh" and "24h") of each treatment is loaded onto a 15% SDS-PAGE (Tris-Glycine system) in turn, 220V voltage is applied for 6min to stack the gel, and 280V voltage is applied for 15min to separate the gel.

[0306] (2) The conventional semi-dry transfer membrane procedure is used, 2x 0.22 μm nitrocellulose membrane, 0.8x membrane area (mm 2 ) mA current, and running for 30-40min (preliminary experiments are required to determine).

[0307] (3) The membrane is immersed in PBST-M (5% milk, 0.1% Tween-20 in 1x PBS) for blocking for 1h.

[0308] (4) HRP-conjugated anti-His tag mouse monoclonal antibody (Biotechnology Company AF2873-200 μL, 1:5000 dilution) is added and incubated for 1h.

[0309] (5) The PBST-M is discarded, and the membrane is quickly washed with PBST (0.1% Tween-20 in 1x PBS) for 3 times, and then washed with PBST for 10min, 5min, and 5min, respectively.

[0310] (6) Exposure and development.

[0311] 2. MG132, Bikinin and Cisplatin are added to the reaction system as control groups, respectively. MG132 is dissolved in DMSO, and the final concentration is 100 μM. Bikinin is dissolved in DMSO, and the final concentration is 30 μM. Cisplatin is dissolved in 1x PBS, and the final concentration is 150 μM.

[0312] 3. As shown in A of FIG. 5, MG132 and Bikinin can strongly inhibit the protease activity of hGSK3β-His, and both MG132 and Bikinin can inhibit the three independent domains of hGSK3β (hGSK3β Δ218 -His, hGSK3β On95 -His, hGSK3β On123 -His) (C of FIG. 5, D of FIG. 5, E of FIG. 5). As shown in B of FIG. 5, Cisplatin can significantly enhance the protease activity of hGSK3β-His. In analyzing the protease properties of each domain of hGSK3, the present application uses AEBSF (serine protease inhibitor), Pepstatin A (aspartic protease inhibitor), Leupeptin (serine protease, threonine protease and cysteine protease inhibitor), 1,10-Phenanthrolin (metal protease (carboxypeptidase) inhibitor), MG132 (proteasome inhibitor, capable of inhibiting the activity of serine protease, calpain (calcium-dependent cysteine endopeptidase), etc.). In addition, Bikinin (plant GSK3 kinase activity inhibitor) is also used. As shown in C of FIG. 5, the protease activity of the N-terminal domain of hGSK3 is very strong. Compared with the working inhibitors, only a few seconds of preparation time, the domain has self-degraded by more than half. The six inhibitors have a strong inhibitory effect on this domain. Therefore, this domain is certainly a serine, aspartic and metalloprotease, and may contain threonine, cysteine protease activity, and is inhibited by MG132 and Bikinin. As shown in D of FIG. 5, the protease activity of the intermediate domain of hGSK3 is very strong. Compared with the working inhibitors, only a few seconds of preparation time, the domain has self-degraded by more than half. Pepstatin A has some inhibitory effect, and Leupeptin has very strong inhibitory effect. Therefore, this domain is certainly an aspartic protease, and certainly contains one or more of serine, threonine, cysteine protease activity. As shown in E of FIG. 5, the protease activity of the C-terminal domain of hGSK3 is weak, but 24h treatment can also reflect the effect of the corresponding inhibitors. AEBSF, Pepstatin A and Bikinin all have some inhibitory effect. MG132 also has some inhibitory effect, but its instantaneous inhibitory effect is not as good as the first three. Therefore, this domain is certainly a serine, aspartic protease, and may contain cysteine protease activity, and is inhibited by MG132 and Bikinin.

[0313] Example 6

[0314] GPTAC directs GSK3 to efficiently degrade target proteins.

[0315] 1. The case of BLC-His guiding AtBIN2-His degrading COVID-19 Spike RBD.

[0316] 1) AtBIN2-His as protease. 2) BLC-His purified in Example 3 was used. 3) Commercialized COVID-19 Spike RBD (Sino Biological, 40592-V05H) was used, named as NS-mFc. 4) In vitro target protein degradation protocol, AtBIN2-His, BLC-His, NS-mFc as reaction reagents, to detect the degradation of NS-mFc.

[0317] GPTAC guiding GSK3 degrading target protein protocol (Example 6, all used this protocol):

[0318] Reaction system (22 μL):

[0319] (1) Dialysis Buffer: 20 mM Tris HCl (pH 7.5), 20 mM NaCl, 10 mM MgCl2, and 0.5 mM KCl.

[0320] (2) ATP: final concentration 1 mM.

[0321] (3) Target protein: final concentration 20 μM, dialyzed by Dialysis buffer.

[0322] (4) AtBIN2 or hGSK3β: final concentration 20 μM, dialyzed by Dialysis buffer.

[0323] (5) GPTAC: final concentration 200 μM, dialyzed by Dialysis buffer.

[0324] Loading sequence:

[0325] (1) Dialysis Buffer. (2) ATP. (3) Target protein. (4) AtBIN2 or hGSK3β.

[0326] (5) GPTAC.

[0327] Notes:

[0328] (1) The reaction system needs ice bath. (2) Mix well immediately after adding each reagent. (3) The treatment groups are set as shown in Figure 6. (4) For multiple treatment groups, prepare a large sample containing Dialysis Buffer, ATP and target protein, and use the volume containing the least Dialysis Buffer in all treatment groups as the standard. For example, if there are 7 treatment groups, prepare (7.2 to 7.6) x the volume of Dialysis Buffer, ATP and target protein in the treatment group containing the least Dialysis Buffer, then mix and aliquot. (5) For each treatment group, compensate for the missing Dialysis Buffer to ensure that the total volume of the reaction system is always 22 μL. (6) Then add the corresponding AtBIN2 or hGSK3β, mix quickly, and then add GPTAC and mix quickly. (7) For each treatment, label the "Oh" and "24h" EP tubes, and add 10 μL of 2x SDS protein loading buffer in advance to the "Oh" EP tube. (8) After the reaction system is prepared, aliquot 10 μL of the reaction sample to the "Oh" and "24h" EP tubes, and mix quickly.

[0329] Reaction conditions:

[0330] (1) For the reaction system containing human GSK3β (hGSK3β), incubate at 37°C for 24h.

[0331] (2) For the reaction system containing Arabidopsis BIN2 (AtBIN2), incubate at 28°C for 24h.

[0332] (3) After incubation, add 10 μL of 2x SDS protein loading buffer to the "24h" EP tube, and mix quickly.

[0333] Detection conditions:

[0334] (1) Load each pair of samples ("Oh" and "24h") of each treatment onto a 15% SDS-PAGE (Tris-Glycine system) in turn, run the stacking gel at 220V for 6 min, and run the separating gel at 280V for 15 min.

[0335] (2) Perform the conventional semi-dry transfer membrane procedure, using 2x 0.22 μm nitrocellulose membranes, 0.8x the membrane area (mm 2 ) mA current, and running for 30-40 min (determine by preliminary experiment).

[0336] (3) Immerse the membrane in PBST-M (5% milk, 0.1% Tween-20 in 1x PBS) and block for 1h.

[0337] (4) Add HRP-conjugated anti-GST tag mouse monoclonal antibody (Biological, AF2891-50 μL, 1:5000 dilution) and incubate for 1 h.

[0338] (5) Discard PBST-M, wash with PBST (0.1% Tween-20 in 1xPBS) for 3 times quickly, then wash with PBST for 10 min, 5 min, 5 min, respectively.

[0339] (6) Expose and develop.

[0340] (7) Wash the developed membrane with PBST (0.1% Tween-20 in 1xPBS) for 3 times quickly, then wash with PBST for 30 min to remove most of the HRP-conjugated anti-GST tag mouse monoclonal antibody (adjust according to the removal condition).

[0341] (8) Block with PBST-M (5% milk, 0.1% Tween-20 in 1xPBS) for 1 h.

[0342] (9) Add HRP-conjugated anti-His tag mouse monoclonal antibody (Biological, AF2873-200 μL, 1:5000 dilution) and incubate for 1 h.

[0343] (10) Discard PBST-M, wash with PBST (0.1% Tween-20 in 1xPBS) for 3 times quickly, then wash with PBST for 10 min, 5 min, 5 min, respectively.

[0344] (11) Expose and develop.

[0345] 5) As shown in A of FIG. 6, compared with the control, BLC-His can guide AtBIN2-His to cut more NS-mFc, thereby generating more protein fragments (about 35 kDa). In summary, BLC-His can guide AtBIN2-His to effectively degrade NS-mFc.

[0346] 2. GLP-His, GLPH-His, GLPL-His guided hGSK3β-His to degrade GST-htPD-L1.

[0347] (1) hGSK3β-His was used as the protease.

[0348] (2) GLP-His, GLPH-His, GLPL-His purified in Example 3 were used.

[0349] (3) GST-htPD-L1 purified in Example 2 was used.

[0350] (4) In vitro target protein degradation protocol Same as above (Example 6, Part 1, Step 4), using hGSK3β-His, GLP-His or GLPH-His or GLPL-His, GST-htPD-L1 as reaction reagents, to detect the degradation of GST-htPD-L1.

[0351] (5) As shown in B of FIG. 6, GLP-His, GLPH-His, GLPL-His completed the degradation of GST-htPD-L1 at the moment of adding the reaction system (0h and 24h treatment had little difference, indicating that the impurities contained in the E. coli-expressed and purified protein had no degradation effect on the target protein). In summary, GLP-His, GLPH-His, GLPL-His can guide hGSK3β-His to efficiently degrade GST-htPD-L1.

[0352] Conclusion: Based on the existing GPTAC for htPD-L1, the difference in affinity of the GPTAC for htPD-L1 does not affect the degradation of hGSK3β for htPD-L1.

[0353] For polypeptide-type GPTAC, the ligand part of GSK3 and the linker part are fixed, and only the ligand part of the target protein needs to be replaced to design a GPTAC for any target protein. Since the change in the affinity of the ligand part of the target protein (htPD-L1) for the target protein (htPD-L1) does not affect the degradation efficiency of GSK3 for the target protein (htPD-L1), the design threshold of the ligand part of the target protein will be relatively low. To some extent, it is just the interacting protein. If there is no crystal structure of the interaction between the two, the contact surface can be predicted by software such as Alphafold3, and then the domain is selected to design a GPTAC for a specific target protein. Therefore, this conclusion proves the simplicity of the system in the design and application aspects.

[0354] 3. GLAm-His, GLAmH-His, GLAmM-His guided hGSK3β-His to degrade GST-hAβ42.

[0355] (1) hGSK3β-His was used as a protease.

[0356] (2) GLAm-His, GLAmH-His, GLAmM-His purified in Example 3 were used.

[0357] (3) GST-hAβ42 purified in Example 2 was used.

[0358] (4) The in vitro target protein degradation protocol is the same as above (step 4 in part 1 of example 6), using hGSK3β-His, GLAm-His or GLAmH-His or GLAmM-His, and GST-hAβ42 as the reaction reagents, to detect the degradation of GST-hAβ42.

[0359] (5) As shown in Fig. 6C, GLAm-His, GLAmH-His, and GLAmM-His completed the degradation of GST-hAβ42 at the moment of adding the reaction system (there is almost no difference between 0h and 24h treatment) compared with the control. In summary, GLAm-His, GLAmH-His, and GLAmM-His can guide hGSK3β-His to efficiently degrade GST-hAβ42. The conclusion is the same as part 2.

[0360] 4. GLC-His, GLCH-His, and GLCM-His guide hGSK3β-His to degrade GST-XS.

[0361] (1) hGSK3β-His is used as the protease.

[0362] (2) GLC-His, GLCH-His, and GLCM-His purified in example 3 are used.

[0363] (3) GST-XS purified in example 2 is used.

[0364] (4) The in vitro target protein degradation protocol is the same as above (step 4 in part 1 of example 6), using hGSK3β-His, GLC-His or GLCH-His or GLCM-His, and GST-XS as the reaction reagents, to detect the degradation of GST-XS.

[0365] (5) As shown in Fig. 6D, GLC-His, GLCH-His, and GLCM-His completed the degradation of GST-XS at the moment of adding the reaction system (there is almost no difference between 0h and 24h treatment) compared with the control. In summary, GLC-His, GLCH-His, and GLCM-His can guide hGSK3β-His to efficiently degrade GST-XS. The conclusion is the same as part 2.

[0366] Example 7

[0367] Promotion of Cisplatin on GLP, GLAmM, GLCM respectively guiding hGSK3β to degrade htPD-L1, hAβ42, XS

[0368] 1. hGSK3β-His is used as the protease.

[0369] 2. GLP-His, GLAmM-His, GLCM-His purified in Example 3 were used.

[0370] 3. GST-htPD-L1, GST-hAβ42, GST-XS purified in Example 2 were used.

[0371] 4. Three reaction combinations of "hGSK3β-His, GLP-His, GST-htPD-L1", "hGSK3β-His, GLAmM-His, GST-hAβ42" and "hGSK3β-His, GLCM-His, GST-XS" were set up to detect the promoting effect of Cisplatin on GPTAC-guided hGSK3β degradation of the corresponding target protein. The specific steps are as follows:

[0372] Reaction system (22 μL):

[0373] (1) Dialysis Buffer: 20 mM Tris HCl (pH 7.5), 20 mM NaCl, 10 mM MgCl2, and 0.5 mM KCl.

[0374] (2) ATP: final concentration 1 mM.

[0375] (3) Target protein: final concentration 20 μM, dialyzed with Dialysis buffer.

[0376] (4) hGSK3β: final concentration 20 μM, dialyzed with Dialysis buffer.

[0377] (5) Cisplatin: final concentration 150 μM.

[0378] (6) GPTAC: final concentration 200 μM, dialyzed with Dialysis buffer.

[0379] Loading sequence:

[0380] (1) Dialysis Buffer. (2) ATP. (3) Target protein. (4) hGSK3β. (5) GPTAC and / or Cisplatin.

[0381] Notes:

[0382] (1) The reaction system requires ice bath. (2) Each reagent should be mixed immediately after addition. (3) The treatment groups are set as shown in Figure 7. (4) For multiple treatment groups, a large sample containing Dialysis Buffer, ATP, target protein and hGSK3β should be prepared, and the volume of the treatment group containing the least Dialysis Buffer should be used as the standard. For example, if there are 7 treatment groups, a large sample containing (7.2 to 7.6) x the Dialysis Buffer, ATP, target protein and hGSK3β of the treatment group containing the least Dialysis Buffer should be prepared, and then mixed and aliquoted. (5) For each treatment group, the missing Dialysis Buffer should be compensated to ensure that the total volume of the reaction system is always 22 μL. (6) Then, the corresponding Cisplatin and / or GPTAC should be added and mixed quickly. (7) For each treatment, the "Oh" and "24h" EP tubes should be labeled, and 10 μL of 2x SDS protein loading buffer should be added in advance to the "Oh" EP tube. (8) After the reaction system is prepared, 10 μL of the reaction sample should be aliquoted to the "Oh" and "24h" EP tubes, and mixed quickly.

[0383] Reaction conditions:

[0384] (1) For the reaction system containing human GSK3β (hGSK3β), incubate at 37°C for 24h.

[0385] (2) After incubation, add 10 μL of 2x SDS protein loading buffer to the "24h" EP tube, and mix quickly.

[0386] Detection conditions:

[0387] (1) The samples of each treatment pair ("Oh" and "24h") should be loaded onto a 15% SDS-PAGE (Tris-Glycine system) in turn, and run at 220V for 6 min to stack the gel and at 280V for 15 min to separate the gel.

[0388] (2) The conventional semi-dry transfer membrane procedure should be used, 2x 0.22 μm nitrocellulose membrane, 0.8x membrane area (mm 2 ) mA current, run for 30-40 min (preliminary experiments should be performed to determine).

[0389] (3) The membrane should be immersed in PBST-M (5% milk, 0.1% Tween-20 in 1x PBS) for blocking for 1h.

[0390] (4) HRP-conjugated anti-GST tag mouse monoclonal antibody (Biouniquer, AF2891-50 μL, 1:5000 dilution) should be added, and incubated for 1h.

[0391] (5) Discard PBST-M, wash with PBST (0.1% Tween-20 in 1xPBS) for 3 times quickly, then wash with PBST for 10 min, 5 min, 5 min respectively.

[0392] (6) Expose and develop.

[0393] (7) Wash the developed membrane with PBST (0.1% Tween-20 in 1xPBS) for 3 times quickly, then wash with PBST for 30 min to remove most of the HRP-conjugated anti-GST tag mouse monoclonal antibody (adjustable according to the removal condition).

[0394] (8) Block with PBST-M (5% milk, 0.1% Tween-20 in 1xPBS) for 1 h.

[0395] (9) Add HRP-conjugated anti-His tag mouse monoclonal antibody (Biouniquer AF2873-200 μL, 1:5000 dilution) and incubate for 1 h.

[0396] (10) Discard PBST-M, wash with PBST (0.1% Tween-20 in 1xPBS) for 3 times quickly, then wash with PBST for 10 min, 5 min, 5 min respectively.

[0397] (11) Expose and develop.

[0398] 5. As shown in A of FIG. 7, Cisplatin directly promotes the transient degradation of hGSK3p guided by GLP to htPD-L1. As shown in B of FIG. 7, Cisplatin also directly promotes the transient degradation of hGSK3p guided by GLAmM to hAb42. As shown in C of FIG. 7, although Cisplatin inhibits the transient degradation of hGSK3p guided by GLCM to XS, it can obviously play a role for a long time. That is, Cisplatin can promote the degradation of target proteins by GPTAC mediated GSK3.

[0399] Although the above embodiment has made a detailed description of the present application, it is only a part of the embodiments of the present application, but not all the embodiments, and people can also obtain other embodiments according to the present embodiment without creativity, which all belong to the protection scope of the present application.

Claims

Application of GSK3 as a protease. Application of GSK3 as a protease with one or more than one function of aspartate protease, serine protease, threonine protease, cysteine protease and metalloprotease. Application of N-terminal domain, middle domain or C-terminal domain of GSK3 as a protease. Application of N-terminal domain of GSK3 as a protease with one or more than one function of aspartate protease, serine protease, threonine protease, cysteine protease and metalloprotease. Application of middle domain of GSK3 as a protease with one or more than one function of aspartate protease, serine protease, threonine protease and cysteine protease. Application of C-terminal domain of GSK3 as a protease with one or more than one function of aspartate protease, serine protease and cysteine protease. A protease-based protein degradation targeting chimera, characterized in that, The protease-based protein degradation targeting chimera is connected by a linker from two ligands, including a ligand binding to a target protein and a ligand binding to a protease. A GSK3-based protein degradation targeting chimera, characterized in that, The GSK3-based protein degradation targeting chimera is connected by a linker from two ligands, including a ligand binding to a target protein and a ligand binding to GSK3. The GSK3-based protein degradation targeting chimera according to claim 8, characterized in that, When the ligand binding to GSK3 is in polypeptide type and GSK3 is a human protein, the ligand binding to GSK3 includes an amino acid sequence as shown in SEQ ID NO.

1. The GSK3-based protein degradation targeting chimera according to claim 8, characterized in that, When the ligand binding to GSK3 is in polypeptide type and GSK3 is an Arabidopsis thaliana protein, the ligand binding to GSK3 includes an amino acid sequence as shown in SEQ ID NO.

2. The GSK3-based protein degradation targeting chimera according to any one of claims 8-10, characterized in that, The linker includes an amino acid sequence as shown in SEQ ID NO.

3. The GSK3-based protein degradation targeting chimera according to claim 8, characterized in that, When the ligand binding to a target protein is in polypeptide type, the ligand binding to a target protein includes an amino acid sequence on the binding surface of a protein interacting with a target protein. The GSK3-based protein degradation targeting chimera according to claim 12, characterized in that, The C-terminal of the amino acid sequence on the binding surface of the protein interacting with a target protein is further fused with an amino acid sequence as shown in SEQ ID NO.

4. Application of the protease-based protein degradation targeting chimera of claim 7 or the GSK3-based protein degradation targeting chimera of any one of claims 8-12 in preparing a targeting agent for degrading a protein. The method of degrading a target protein using the protease-based protein degradation targeting chimera of claim 7 or the GSK3-based protein degradation targeting chimera of any one of claims 8-12, comprising the steps of: Mixing the protease-based protein degradation targeting chimera or the GSK3-based protein degradation targeting chimera with a sample containing a target protein to perform targeted degradation of the target protein. The method of claim 15, wherein When the GSK3 is a human protein, the temperature for the targeted degradation is 36-37℃. The method of claim 15, wherein When the GSK3 is an Arabidopsis thaliana protein, the temperature for the targeted degradation is 26-28℃. The method of claim 15, wherein The system for the mixing preferably further includes adding cisplatin. Application of cisplatin in preparing an agent for enhancing the protease activity of GSK3. Application of cisplatin in preparing an agent for enhancing the degradation of a target protein by GSK3 guided by the GSK3-based protein degradation targeting chimera of any one of claims 8-12. A composition comprising a GSK3-based protein degradation targeting chimera, characterized in that, The composition includes the GSK3-based protein degradation targeting chimera of any one of claims 8-12 and cisplatin.

Images