Sirna for inhibiting expression of urate transporter 1 gene, and drug and use thereof

Abstract

Disclosed in the present invention is an siRNA for inhibiting the expression of a urate transporter 1 (URAT1) gene in human cells. In the present invention, a plurality of siRNAs capable of inhibiting URAT1 expression are obtained by screening, and on this basis, appropriate modifications are performed to obtain sequences with improved target silencing ability. Drugs with the siRNAs as active ingredients are expected to be clinically applicable in the prevention and treatment of diseases related to the URAT1 target, such as gout, hyperuricemia, gouty arthritis and renal calculi.

Description

siRNA, drugs for inhibiting expression of urate transporter 1 gene and application thereof

[0001] The present application claims priority to the Chinese patent application No. 2024111020341, filed on August 12, 2024, and No. 2025104193745, filed on April 03, 2025, both entitled "siRNA, drugs for inhibiting expression of urate transporter 1 gene and application thereof", the contents of which are incorporated herein by reference in their entirety. TECHNICAL FIELD

[0002] The present application belongs to the field of biological medicine, and specifically relates to siRNA, drugs for inhibiting expression of urate transporter 1 (URAT1) gene and application thereof. BACKGROUND

[0003] Hyperuricemia is a metabolic disorder caused by elevated levels of uric acid in the blood, usually defined as serum uric acid concentration greater than 7 mg / dL in men and 6 mg / dL in women. Long-term hyperuricemia is not only a major risk factor for gout, but also associated with various cardiovascular diseases, metabolic syndrome and renal function impairment. Urate transporter 1 (URAT1) plays a key role on the surface of proximal tubular cells in the kidney, responsible for the reabsorption of uric acid, and its overactivity is considered an important cause of hyperuricemia.

[0004] Currently, significant progress has been made in the study of URAT1, and several small molecule inhibitors have been developed. These drugs inhibit URAT1, reduce the reabsorption of uric acid, and thus lower the level of uric acid in the blood. Febuxostat and Benzbromarone are two widely used small molecule inhibitors of URAT1 in clinical practice, which have shown certain efficacy.

[0005] Despite the achievements of URAT1 small molecule inhibitors in clinical treatment, they still have some significant shortcomings:

[0006] 1) Side effects: Drugs such as Febuxostat and Benzbromarone may cause serious side effects such as liver damage and gastrointestinal discomfort in long-term use. 2) Drug resistance: Some patients may develop drug resistance after using these drugs for a period of time, reducing the therapeutic effect. 3) Lack of specificity: Existing small molecule inhibitors may not be highly selective, leading to non-target effects and affecting the function of other related transporters. 4) Frequency of administration: Most small molecule drugs need to be administered daily or weekly, increasing the problem of patient compliance.

[0007] To overcome the shortcomings of existing small molecule inhibitors, the present application proposes to use small interfering RNA (siRNA) technology to inhibit the expression of URAT1 gene, so as to achieve the purpose of treating hyperuricemia and related diseases. The siRNA technology has the following advantages:

[0008] 1) High specificity: siRNA can specifically target and degrade the mRNA of URAT1, thereby effectively preventing the expression of its protein and reducing non-target effects.

[0009] 2) Lower toxicity: Due to the high specificity of siRNA, the impact on other non-target proteins can be reduced, thereby reducing the occurrence of side effects.

[0010] 3) Lower frequency of administration: siRNA-based treatment regimens can be designed as long-acting formulations, with administration frequency extended to every three months or even every six months, significantly improving patient compliance. Therefore, to be suitable for clinical use, it is necessary to screen appropriate siRNA with targeting specificity. SUMMARY

[0011] The present application provides a siRNA specifically targeting URAT1 gene, which has high specificity and low administration frequency.

[0012] The first aspect of the present application provides a siRNA or a pharmaceutically acceptable salt thereof for inhibiting the expression of urate transporter 1 (URAT1) gene in human cells, wherein the siRNA comprises a sense strand and its corresponding complementary antisense strand, and the siRNA comprises a sense strand comprising a nucleotide sequence that differs from any of the sense nucleotide sequences in Table 1 or Table 2 by no more than 3, or 2, or 1 nucleotide, and an antisense strand comprising a nucleotide sequence that differs from any of the antisense nucleotide sequences in Table 1 by no more than 3 nucleotides.

[0013] Preferably, the siRNA is selected from any of the following pairs of sequences, or sequences that differ from the sense strand or the antisense strand thereof by no more than 1 nucleotide:

[0014] 24003, the 5'-3' sense strand sequence of which is CCUUUGGCUUCACCUUCUA (SEQ ID NO: 7), and the 5'-3' antisense strand sequence of which is UAGAAGGUGAAGCCAAAGGCG (SEQ ID NO: 8);

[0015] 24003a, having the 5’-3’ sense strand sequence of CGCCUUUGGCUUCACCUUCUA (SEQ ID NO: 9), and the 5’-3’ antisense strand sequence of UAGAAGGUGAAGCCAAAGGCG (SEQ ID NO: 10);

[0016] 24003f, having the 5’-3’ sense strand sequence of UCUUUGGCUUCACCUUCUA (SEQ ID NO: 19), and the 5’-3’ antisense strand sequence of UAGAAGGUGAAGCCAAAGGGG (SEQ ID NO: 20);

[0017] 24003g, having the 5’-3’ sense strand sequence of GCUUUGGCUUCACCUUCUA (SEQ ID NO: 21), and the 5’-3’ antisense strand sequence of UAGAAGGUGAAGCCAAAGCCG (SEQ ID NO: 22);

[0018] 24047, having the 5’-3’ sense strand sequence of GUGCGAGGGAUUGAAUAAAGA (SEQ ID NO: 225), and the 5’-3’ antisense strand sequence of UCUUUAUUCAAUCCCUCGCAC (SEQ ID NO: 226);

[0019] 24049, having the 5’-3’ sense strand sequence of UGGUGCGAGGGAUUGAAUAAA (SEQ ID NO: 259), and the 5’-3’ antisense strand sequence of UUUAUUCAAUCCCUCGCACCA (SEQ ID NO: 260);

[0020] 24055, having the 5’-3’ sense strand sequence of GGGAAAAGGACAGUUUGAUUA (SEQ ID NO: 271), and the 5’-3’ antisense strand sequence of UAAUCAAACUGUCCUUUUCCC (SEQ ID NO: 272);

[0021] 24070, having the 5’-3’ sense strand sequence of GAACUCUGUCCUAAAAUCCAA (SEQ ID NO: 303), and the 5’-3’ antisense strand sequence of UUGGAUUUUAGGACAGAGUUC (SEQ ID NO: 304);

[0022] 24075, the sequence of its 5 '-3'sense strand being UCGUGUGUGACUCUCAUGCUA (SEQ ID NO: 313), the sequence of its 5 '-3 'antisense strand being UAGCAUGAGAGUCACACACGA (SEQ ID NO: 314);

[0023] 24034, the sequence of its 5 '-3'sense strand being GGUGCGAGGGAUUGAAUAAAA (SEQ ID NO: 171), the sequence of its 5 '-3 'antisense strand being UUUUAUUCAAUCCCUCGCACC (SEQ ID NO: 172);

[0024] 24047a, the sequence of its 5 '-3'sense strand being GCGAGGGAUUGAAUAAAGA (SEQ ID NO: 227), the sequence of its 5 '-3 'antisense strand being UCUUUAUUCAAUCCCUCGCAC (SEQ ID NO: 228);

[0025] 24047g, the sequence of its 5 '-3'sense strand being CUGCGAGGGAUUGAAUAAAGA (SEQ ID NO: 239), the sequence of its 5 '-3 'antisense strand being UCUUUAUUCAAUCCCUCGCAG (SEQ ID NO: 240);

[0026] 24081, the sequence of its 5 '-3'sense strand being CGAGGGAUUGAAUAAAGAA (SEQ ID NO: 325), the sequence of its 5 '-3 'antisense strand being UUCUUUAUUCAAUCCCUCGCA (SEQ ID NO: 326);

[0027] 24017, the sequence of its 5 '-3'sense strand being AGCAACAUCUUCCUGCUCCAA (SEQ ID NO: 55), the sequence of its 5 '-3 'antisense strand being UUGGAGCAGGAAGAUGUUGCU (SEQ ID NO: 56);

[0028] 24026, the sequence of its 5 '-3'sense strand being GGCAACAUCUUCCUGCUCCAA (SEQ ID NO: 55), the sequence of its 5 '-3 'antisense strand being UUGGAGCAGGAAGAUGUUGCU (SEQ ID NO: 56);

[0029] 24027, the 5 '-3'sense strand sequence of which is AGUAAAGAAGGCAACACAUGA (SEQ ID NO: 127), the 5 '-3 'antisense strand sequence of which is UCAUGUGUUGCCUUCUUUACU (SEQ ID NO: 128);

[0030] 24068, the 5 '-3'sense strand sequence of which is AAUCCACACAGUUUUAGCCUA (SEQ ID NO: 299), the 5 '-3 'antisense strand sequence of which is UAGGCUAAAACUGUGUGGAUU (SEQ ID NO: 300).

[0031] The present application also provides modified siRNAs described above for improving the stability and activity of siRNAs in vitro and in vivo.

[0032] In some embodiments, the sense strand of the siRNA comprises no more than 3, 2, 1, or 0 unmodified nucleotides, the modified nucleotides in the sense strand comprise 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2'-fluoro modified nucleotides, inverted abasic residues, respectively, the sense strand contains 0, or 1, or 2, or 3 phosphorothioate linkages at the 5 '-end and 3 '-end.

[0033] In some embodiments, the antisense strand of the siRNA comprises no more than 3, 2, 1, or 0 unmodified nucleotides, the modified nucleotides in the antisense strand comprise 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2'-fluoro modified nucleotides, VPU (2'-O-methyluridine-5'-(E)-vinylphosphonate-3'-phosphate), VPU-S (2'-S-methyluridine-5'-(E)-vinylphosphonate-3'-phosphate) or other VPU derivatives, respectively, the antisense strand contains 1-3 phosphorothioate linkages at the 5 '-end and 3 '-end, respectively.

[0034] In some embodiments, the sense strand comprises at least 15, 16, or 17 contiguous nucleotides differing by no more than 3 nucleotides from any of the sense strand nucleotide sequences shown in Table 4; and wherein the antisense strand comprises at least 15, 16, or 17 contiguous nucleotides differing by no more than 3 nucleotides from any of the antisense strand nucleotide sequences shown in Table 4.

[0035] In some embodiments, the double-stranded siRNA is selected from any of the pairs of modified siRNAs of Table 4.

[0036] In some preferred embodiments, the modified siRNA is selected from any of the following pairs of sequences, or sequences differing by no more than 1 nucleotide from the sense or antisense strand thereof:

[0037] 24003.8-2, the sense strand sequence of which is set forth as

[0038] Invab *mC *mCmUmUmUmGfGfCfUfUmCfAmCmCmUmUmCmUmA Invab, the antisense strand sequence of which is set forth as

[0039] VPU-S *fA *mGmAmAmGmGmUmGmAmAdGmCfCmAfAmAmGmG *mC *mG; 24003.2-2, the sense strand sequence of which is set forth as

[0040] mC *mG *mCmCmUmUmUmGfGfCfUfUmCfAmCmCmUmUmCmUmA, the antisense strand sequence of which is set forth as

[0041] VPU-S *fA *mGmAmAmGmGmUmGmAmAdGmCfCmAfAmAmGmG *mG *mG; 24003.6-6, the sense strand sequence of which is set forth as mU *mC *mUmUmUmGfGfCfUfUmCfAmCmCmUmUmCmUmA, the 5'-3' antisense strand sequence of which is set forth as

[0042] VPU-S *fA *mGmAmAmGmGmUmGmAmAdGmCfCmAfAmAmGmG *mG *mG; 24003.7-7, the sense strand sequence of which is set forth as mG *mC *mUmUmUmGfGfCfUfUmCfAmCmCmUmUmCmUmA, the antisense strand sequence of which is set forth as

[0043] VPU-S *fA *mGmAmAmGmGmUmGmAmAdGmCfCmAfAmAmGmC *mC *mG; 24047a.1-1, the sense strand sequence of which is set forth as

[0044] Invab *mG *mUmGmCmGmAmGmGfGfAfUfUmGfAmAmUmAmAmAmGmA Invab, the antisense strand sequence of which is set forth as VPU-S *fC *mUmUmUmAmUmUmCmAmAdTmCfCmCfUmCmGmC *mA *mC; 24049a.1-1, the sense strand sequence of which is set forth as

[0045] Invab *mU *mGmGmUmGmCmGmAfGfGfGfAmUfUmGmAmAmUmAmAmA Invab, the antisense strand sequence of which is set forth as VPU-S *fU *mUmAmUmUmCmAmAmUmCdCmCfUmCfGmCmAmC *mC *mA; 24055a.1-1, the sense strand sequence of which is set forth as

[0046] Invab*mG*mGmGmAmAmAmAmGfGfAfCfAmGfUmUmUmGmAmUmUmAInvab, the antisense strand sequence is set forth as VPU-S*fA*mAmUmCmAmAmAmCmUmGdTmCfCmUfUmUmUmC*mC*mC; 24070a.1-1, the sense strand sequence of which is set forth as

[0047] Invab*mG*mAmAmCmUmCmUmGfUfCfCfUmAfAmAmAmUmCmCmAmAInvab, the antisense strand sequence is set forth as VPU-S*fU*mGmGmAmUmUmUmUmAmGdGmAfCmAfGmAmGmU*mU*mC; 24075a.1-1, the sense strand sequence of which is set forth as

[0048] Invab*mU*mCmGmUmGmUmGmUfGfAfCfUmCfUmCmAmUmGmCmUmAInvab, the antisense strand sequence is set forth as VPU-S*fA*mGmCmAmUmGmAmGmAmGdTmCfAmCfAmCmAmC*mG*mA; 24081a.1-1, the sense strand sequence of which is set forth as

[0049] 24034a.1-1, the sense strand sequence of which is set forth as

[0050] Invab*mG*mGmUmGmCmGmAmGfGfGfAfUmUfGmAmAmUmAmAmAmAInvab, the antisense strand sequence is set forth as VPU-S*fU*mUmUmAmUmUmCmAmAmUdCmCfCmUfCmGmCmA*mC*mC; 24047a.2-1, the sense strand sequence of which is set forth as

[0051] Invab*mG*mCmGmAmGmGfGfAfUfUmGfAmAmUmAmAmAmGmAInvab, the antisense strand sequence is set forth as VPU-S*fC*mUmUmUmAmUmUmCmAmAdTmCfCmCfUmCmGmC*mA*mC; 24047a.7-7, the sense strand sequence of which is set forth as

[0052] Invab*mC*mUmGmCmGmAmGmGfGfAfUfUmGfAmAmUmAmAmAmGmAInvab, the antisense strand sequence is set forth as VPU-S*fC*mUmUmUmAmUmUmCmAmAdTmCfCmCfUmCmGmC*mA*mG; 24047a.8-8, the sense strand sequence of which is set forth as

[0053] 24081a.1-1, the sense strand sequence of which is set forth as

[0054] Invab mA*mG*mCmAmAmCmAmUfCfUfUfCmCfUmGmCmUmCmCmAmA, the antisense strand sequence of which is shown as VPU-S*fU*mGmGmAmGmCmAmGmGmAdAmGfAmUfGmUmUmG*mC*mU; 24026.1-2, the sense strand sequence of which is shown as mG*mG*mCmAmGmUmAmAfAfGfAfAmGfGmCmAmAmCmAmCmA, the antisense strand sequence of which is shown as VPU-S*fG*mUmGmUmUmGmCmCmUmUdCmUfUmUfAmCmUmG*mC*mC;

[0055] mA*mG*mCmAmAmCmAmUfCfUfUfCmCfUmGmCmUmCmCmAmA, the antisense strand sequence of which is shown as VPU-S*fU*mGmGmAmGmCmAmGmGmAdAmGfAmUfGmUmUmG*mC*mU; 24026.1-2, the sense strand sequence of which is shown as mG*mG*mCmAmGmUmAmAfAfGfAfAmGfGmCmAmAmCmAmCmA, the antisense strand sequence of which is shown as VPU-S*fG*mUmGmUmUmGmCmCmUmUdCmUfUmUfAmCmUmG*mC*mC;

[0056] 24027.1-2, the sense strand sequence of which is shown as mG*mG*mCmAmGmUmAmAfAfGfAfAmGfGmCmAmAmCmAmCmA, the antisense strand sequence of which is shown as VPU-S*fG*mUmGmUmUmGmCmCmUmUdCmUfUmUfAmCmUmG*mC*mC;

[0057] mA*mG*mUmAmAmAmGmAfAfGfGfCmAfAmCmAmCmAmUmGmA, the antisense strand sequence of which is shown as VPU-S*fC*mAmUmGmUmGmUmUmGmCdCmUfUmCfUmUmUmA*mC*mU; 24068.1-1, the sense strand sequence of which is shown as mG*mG*mCmAmGmUmAmAfAfGfAfAmGfGmCmAmAmCmAmCmA, the antisense strand sequence of which is shown as VPU-S*fA*mGmGmCmUmAmAmAmAmCdTmGfUmGfUmGmGmA*mU*mU.

[0058] mA*mG*mUmAmAmAmGmAfAfGfGfCmAfAmCmAmCmAmUmGmA, the antisense strand sequence of which is shown as VPU-S*fC*mAmUmGmUmGmUmUmGmCdCmUfUmCfUmUmUmA*mC*mU; 24068.1-1, the sense strand sequence of which is shown as mG*mG*mCmAmGmUmAmAfAfGfAfAmGfGmCmAmAmCmAmCmA, the antisense strand sequence of which is shown as VPU-S*fA*mGmGmCmUmAmAmAmAmCdTmGfUmGfUmGmGmA*mU*mU.

[0059] wherein VPU-S is 2'-S-methyluridine-5'-(E)-vinylphosphonate-3'-phosphate, mA is 2'-O-methyladenosine-3'-phosphate, mU is 2'-O-methyluridine-3'-phosphate, mC is 2'-O-methylcytidine-3'-phosphate, mG is 2'-O-methylguanosine-3'-phosphate, fA is 2'-fluoroadenosine-3'-phosphate, fU is 2'-fluorouridine-3'-phosphate, fC is 2'-fluorocytidine-3'-phosphate, fG is 2'-fluoroguanosine-3'-phosphate, dA is 2'-deoxyadenosine-3'-phosphate, dT is 2'-deoxythymidine-3'-phosphate, dC is 2'-deoxycytidine-3'-phosphate, dG is 2'-deoxyguanosine-3'-phosphate, Invab is inverted abasic residue, and * is a phosphorothioate linkage.

[0060] In a second aspect of the present application, there is provided a medicament for inhibiting the expression of URAT1, wherein the active ingredient of the medicament comprises the siRNA or the pharmaceutically acceptable salt thereof as described above.

[0061] In a third aspect of the present application, there is provided the use of any of the siRNAs or the pharmaceutically acceptable salt thereof as described above, or the medicament in the preparation of a product for inhibiting or reducing the expression of URAT1 gene.

[0062] In some embodiments, the product is a biological or pharmaceutical preparation.

[0063] In a fourth aspect of the present application, there is provided a method for inhibiting the expression of URAT1, the method comprising the steps of:

[0064] (a) contacting a cell with any of the siRNA agents or the medicament as described above; and

[0065] (b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of URAT1 expression, thereby simultaneously inhibiting or reducing the expression of URAT1 in the cell.

[0066] In some embodiments, wherein the cell is within a subject.

[0067] In some embodiments, wherein the subject is a human.

[0068] In some embodiments, wherein the expression of URAT1 is inhibited or reduced by at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, or about 100%.

[0069] The siRNA is used for preparing a medicament for preventing or treating diseases mediated by URAT1 gene, wherein the diseases mediated by URAT1 gene include, but are not limited to, gout, hyperuricemia, gouty arthritis, and kidney stones.

[0070] A fourth aspect of the present application provides a method for preventing or treating gout, hyperuricemia, gouty arthritis, and / or kidney stones, which comprises administering to a subject a suitable dose of any of the above-mentioned siRNA or pharmaceutically acceptable salt thereof, or the above-mentioned medicament.

[0071] The present application screens a plurality of siRNAs or pharmaceutically acceptable salts thereof capable of inhibiting the expression of URAT1, and on this basis, makes suitable modifications to the bases in the siRNAs to improve the silencing ability of the siRNAs on the target gene URAT1, which is expected to be applied in the prevention and treatment of consumptive diseases caused by energy metabolism disorders and other factors related to the URAT1 target point in clinical practice.

[0072] The siRNA of the present application provides an innovative treatment for hyperuricemia and related diseases as a medicament. The siRNA not only overcomes the shortcomings of existing small molecule inhibitors, but also has advantages such as high specificity, low toxic side effects, and reduced dosing frequency, thereby improving the effectiveness of treatment and patient compliance. DETAILED DESCRIPTION

[0073] In order to facilitate the understanding of the present application, the present application will be described more fully below. The present application can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present application more thorough and comprehensive.

[0074] The experimental methods in the following examples, unless otherwise specified, are generally carried out according to conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Various common chemical reagents used in the examples are commercially available.

[0075] Unless otherwise defined, all technical and scientific terms used in the present application have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. The terms used in the specification of the present application are only for the purpose of describing specific embodiments and are not intended to limit the present application. The term "and / or" used in the present application includes any and all combinations of one or more related listed items.

[0076] The abbreviations and structures of the nucleotide monomers used in the nucleic acid sequence listing are as follows:

[0077] The specific structure is as follows:

[0078] URAT1 (encoded by SLC22A12 gene) is an important uric acid transporter, mainly expressed in the apical membrane of proximal tubular cells in the kidney, responsible for the reabsorption of uric acid. Abnormal function of URAT1 or mutation of related genes can cause disorders of uric acid metabolism, and then cause various diseases. URAT1 gene-mediated or related diseases include hereditary renal hypouricemia (RHUC, Type 1); hyperuricemia, gout, metabolic syndrome-related hyperuricemia, or drug-induced abnormal uric acid metabolism, and other potentially associated diseases, such as hypertension and cardiovascular disease: hyperuricemia (URAT1 related), chronic kidney disease (CKD).

[0079] As used herein, the term "preventing" means stopping or delaying the occurrence of a disease.

[0080] As used herein, the term "treating" means curing or at least partially stopping the progression of a disease, or relieving the symptoms of a disease.

[0081] In the present application, "therapeutically effective amount" includes, when administered to a patient for treating URAT1 gene-related diseases, the amount of nucleic acid, such as siRNA or its salt, sufficient to cause the treatment of the disease (e.g., by weakening, reducing or maintaining the existing disease, or one or more symptoms of the disease). The "therapeutically effective amount" can vary depending on the siRNA pharmaceutical preparation, how the preparation is administered, the disease and its severity, and the medical history, age, weight, family history, genetic composition of the patient to be treated, the stage of the pathological process mediated by URAT1 gene, the type of previous treatment or combination therapy (if any), and other independent characteristics.

[0082] In the present application, "prophylactically effective amount" includes, when administered to a subject who has not experienced or manifested symptoms of URAT1 gene-mediated related diseases but can be susceptible to the disease, the amount of pharmaceutical agent containing siRNA or its pharmaceutically acceptable salt as an active ingredient sufficient to prevent or reduce the disease or one or more symptoms of the disease. Reducing the disease includes delaying the progression of the disease or reducing the severity of the subsequently developed disease. The "prophylactically effective amount" can vary depending on how the siRNA or its salt pharmaceutical preparation is administered, the risk level of the disease, and the medical history, age, weight, family history, genetic composition of the patient to be treated, the stage of the pathological process mediated by URAT1 gene, the type of previous treatment or combination therapy (if any), and other independent characteristics.

[0083] A "therapeutically effective amount" or "prophylactically effective amount" also includes the amount of siRNA that is at a reasonable benefit / risk ratio applicable to any treatment.

[0084] The present application demonstrates the biological activity of the siRNA in vivo by delivering a ligand, such as an N-acetylgalactosamine derivative (GalNAc carrier).

[0085] Delivery of the siRNA agent of the present application to cells, such as cells in a subject (e.g., a human subject, such as a subject having a URAT1 gene-related disorder, such as hyperuricemia, gout, or uric acid nephropathy), can be accomplished by a variety of different routes. For example, delivery can be performed by contacting the cells with the siRNA of the present application, either in vitro or in vivo. In vivo delivery can also be accomplished by administering a composition comprising the siRNA or a salt thereof to the subject.

[0086] As used herein, "subject" or "patient" refers to a human or a non-human animal such as a mammal. A "subject" can include any other mammal, including horses, dogs, cats, pigs, goats, rabbits, hamsters, monkeys, guinea pigs, rats, mice, lizards, snakes, sheep, cattle, fish, and birds. A human subject can be referred to as a patient.

[0087] Generally, any method of delivering a nucleic acid molecule (either in vitro or in vivo) can refer to existing delivery techniques. For in vivo delivery, factors to consider for the delivery of siRNA molecules include, for example, the biological stability of the delivered molecule, prevention of non-specific effects, and accumulation of the delivered molecule in the target tissue. Formulations can be prepared by local administration (e.g., by direct injection or implantation into tissue or topical administration). Local administration to the treatment site maximizes the local concentration of the pharmaceutical formulation, limits the exposure of the agent to systemic tissues that can be harmed by the agent or can cause the agent to degrade, and allows for lower total doses of the siRNA molecule to be administered.

[0088] A pharmaceutically acceptable salt of the siRNA can be a sodium or potassium salt, for example, a sodium salt of the siRNA is produced during purification, according to techniques known in the art.

[0089] The present application is further described in conjunction with the following specific examples.

[0090] Example 1 Synthesis of siRNA

[0091] Oligonucleotide synthesis of 0.2-1 pmol was performed on Jiangsu Lingkun Biotechnology Co., Ltd. 48-channel nucleic acid synthesizer using solid-phase oligonucleotide synthesis protocol. For siRNA sense strands SS-GalNAc (R=O or S) with alkyne modification at 3'-end, they were synthesized by using the indicated structure-controlled porous glass bead (CPG) carrier, and the structure after GalNAc ligand and 3'-end of siRNA were connected as follows

[0092] Add an aminolysis reagent to the synthesized oligonucleotide and incubate at 45-80°C, separate the oligonucleotide from the solid-phase carrier to free the oligonucleotide. Then precipitate the crude oligonucleotide with ethanol, centrifuge at high speed to discard the supernatant, repeat twice to obtain the crude oligonucleotide, and resuspend the precipitate in DEPC water. Purify the crude oligonucleotide by ion pair HPLC method, dry the collected product to powder in a vacuum centrifugal dryer. Dissolve the product obtained after purification with DEPC water and analyze by TOF LC-MS. Determine the oligonucleotide concentration, calculate the volume of equimolar sense and antisense strands needed, mix equimolar sense and antisense strands uniformly, and prepare double-stranded by annealing method of heating at 95°C for 5 minutes, then naturally cooling to room temperature.

[0093] Table 1: Nucleotide sequences of sense and antisense strands of unmodified siRNA targeting human URAT1.

[0094] The siRNA sequence in Table 1 targets human URAT1 transcript NM_001276327.2. The siRNA sequence in Table 2 targets human URAT1 transcript NM_144585.4

[0095] Table 2: Nucleotide sequences of sense and antisense strands of unmodified siRNA targeting human URAT1.

[0096] Table 3: Nucleotide sequences of sense and antisense strands of unmodified siRNA targeting mouse URAT1.

[0097] The siRNA sequence in Table 3 targets mouse URAT1 transcript NM_009203.3

[0098] Table 4: Modified siRNA double-stranded sequences targeting URAT1

[0099] Example 2 siRNA in vitro screening in 293Ta-hURAT1 cells using lipofection method

[0100] Construction of 293Ta-hURAT1 cell line: According to the sequence information of URAT1 published by NCBI, the gene synthesis was sent to GenScript, and was connected to pLVX-mCMV vector. The pLVX-mCMV-hURAT1, psPAX2, pMD2.G three-plasmid system was used for lentivirus packaging. Before lentivirus infection, 293Ta cells were seeded to have a density of about 80%, 12h later, the culture medium in the six-well plate was discarded, 750μl virus and 750μl culture medium were added to each well, and Polybrene was added (final concentration was 10μg / ml), mixed well. Put into 37℃, 5% CO2 incubator for culture, 16h after infection, discard the culture medium, add new culture medium, and add puromycin for screening.

[0101] Cell culture and 96-well plate transfection: In vitro experiments were carried out in 293Ta-hURAT1 cells, using DMEM+10% FBS+1X penicillin streptomycin+1X non-essential amino acid medium, when the cell plating area reached 80%, trypsin digestion was used, and the cell density was determined by Scepter automatic cell counter (Millipore, #PHCC00000), at the same time, siRNA, Opti-MEM and INTERFERin (Polyplus transfection) were mixed and incubated at room temperature for 10 minutes, then complete culture medium containing 293Ta-hURAT1 cells was added to each well, and the 96-well plate was incubated in a 37℃, 5% CO2 incubator for 24 hours. Modified siRNA was screened at a final concentration of 10nM.

[0102] 96-well plate RNA extraction, reverse transcription: use Dynabeads mRNA DIRECT kit (Ambion) to extract 96-well plate cell mRNA, remove the culture medium in the 96-well plate, wash once with DPBS, add 50-300 μl cell lysate to each well, add 20-100 μl beads, shake on a shaker, place the 96-well plate in a magnetic separation rack, remove the lysate in the well, add 50-300 μl washing buffer A to each well, shake and then place in a magnetic separation rack, remove the washing buffer A, then use washing buffer B to blow up the beads and transfer to a new 96-well plate, place in a magnetic separation rack, remove the washing buffer B, use buffer B to blow up the beads and transfer to a 96-well PCR plate, at the same time prepare reverse transcription reagents, place the 96-well PCR plate in a magnetic separation rack, remove the washing buffer B, add 20 μl reverse transcription reagents to each well, seal the plate with a sealing film, then incubate in a PCR instrument at 25°C for 10 minutes, then incubate at 37°C for two hours, then at 85°C for 5 minutes, and then cool to 4°C, and the reverse transcription is completed.

[0103] Real-time fluorescent quantitative PCR: after the reverse transcription is completed, place the 96-well plate in a magnetic separation rack until the beads are adsorbed to the bottom, remove the reverse transcription reagents, add the prepared QPCR system to the 96-well PCR plate, seal with a sealing film, and then perform PCR in a real-time PCR system (applied biosystems) of a StepOnePlus. Use the ΔΔCt method to analyze the data, and use cells transfected with negative control sequence at the same concentration to test standardization.

[0104] The negative control AD-1955 sequence is as follows:

[0105] Sense strand: CUUACGCUGAGUACUUCGAdTdT (347)

[0106] Antisense strand: UCGAAGUACUCAGCGUAAGdTdT (348).

[0107] The primers for detecting human URAT1 are as follows:

[0108] Forward primer: TCTCCACGTTGTGCTGGTTC (349)

[0109] Reverse primer: GGATGTCCACGACACCAATGA (350)

[0110] The primers for detecting mouse URAT1 are as follows:

[0111] Forward primer: TCACCACCCAGAACATGCTG (351)

[0112] Reverse primer: GGAGACGGCCAGAAGAACAT (352).

[0113] Table 5: The results of the experiment of 10 nM modified siRNA duplexes transfected by liposome in 293Ta-hURATl cells

[0114] Example 3: In vitro screening of siRNA in mouse primary renal tubular epithelial cells by liposome transfection

[0115] Isolation of mouse primary renal tubular epithelial cells: 4-6 weeks old Kunming male mice were sacrificed by cervical dislocation and sterilized by 75% alcohol immersion. The double kidneys were obtained by cutting along the back of the double kidney area, and were repeatedly washed in a culture dish containing pre-cooled PBS (4°C). The kidney capsule was removed and washed with pre-cooled PBS for 2-3 times. The kidney cortex and medulla were separated, and the kidney cortex was cut into small pieces with tissue scissors and mixed with pre-cooled PBS before being transferred to a centrifuge tube and centrifuged at 1500 r / min for 5 min. The supernatant in the centrifuge tube was removed, and 2 mL of type II collagenase solution (0.1%) was added to the centrifuge tube and repeatedly blown several times. The centrifuge tube was placed on a 37°C shaker for 30 min. The medium containing 10% FBS was added to terminate the digestion, and the filtrate was filtered through a 70 μm filter screen. The filtrate was repeatedly blown and transferred to a centrifuge tube, which was centrifuged at 1500 r / min for 5 min. The supernatant was removed, and the primary culture medium preheated at 37°C was added to the cell pellet in the centrifuge tube and repeatedly blown several times to resuspend the cells. The cells were inoculated into a 75 cm culture flask and placed in a 37°C, 5% CO2 incubator. The culture flask should not be shaken within 12 h. The medium was changed for the first time after 48 h, and then every other day thereafter.

[0116] Table 6: The results of the experiment of modified siRNA duplexes screened at a transfection concentration of 10 nM in primary renal tubular epithelial cells of Kunming mice

[0117] Example 4: Integration of hURATl (human URATl) gene into liver-targeted AVV8 expression vector to prepare virus [OBiO Technology, AAV8LP] and infect mice to obtain transgenic mice stably expressing hURATl.

[0118] Extraction of mouse primary hepatocytes: Mouse hepatocytes were extracted by collagenase digestion through inferior vena cava perfusion. The active mouse primary hepatocytes were obtained by filtering through a tissue cell filter (BIOLOGIX, 15-1070) and resuspended in DMEM medium + 10% FBS + 1X penicillin streptomycin. The cell density was determined using a Scepter automatic cell counter (Millipore).

[0119] 96-well plate transfection: In vitro experiments were performed in mouse primary hepatocytes, siRNA, Opti-MEM and INTERFERin (Polyplus transfection) were mixed in 96-well plates and incubated at room temperature for 10 minutes (free uptake siRNA does not require the addition of INTERFERin) before adding complete medium containing mouse primary hepatocytes per well. The 96-well plates were incubated at 37°C in a 5% CO2 incubator for 24 hours.

[0120] Table 7 is the result of experiments screening modified siRNA duplexes delivered by GalNAc at a concentration of 10 nM in hURATl -expressing mouse primary hepatocytes.

[0121] Table 8 is the result of experiments screening modified siRNA duplexes delivered by GalNAc at a concentration of 1 nM in hURATl -expressing mouse primary hepatocytes.

[0122] Table 9 is the result of experiments screening modified siRNA duplexes delivered by lipofection at a concentration of 1 nM in hURATl -expressing mouse primary hepatocytes.

[0123] Table 10 is the result of experiments screening modified siRNA duplexes delivered by GalNAc at a concentration of 0.3 nM in hURATl -expressing mouse primary hepatocytes.

[0124] Example 5 In vitro siRNA screening in 786O-URATl cells using lipofection

[0125] Cell culture and 96-well plate transfection: In vitro experiments were performed in 786O-URATl cells using RPMI-1640 + 10% FBS + 1X penicillin streptomycin + 1X non-essential amino acids medium, cells were trypsinized when they reached 80% confluence and the cell density was determined using a Scepter automated cell counter (Millipore, #PHCC00000), while siRNA, Opti-MEM and INTERFERin (Polyplus transfection) were mixed in 96-well plates and incubated at room temperature for 10 minutes before adding complete medium containing 786O-URATl cells per well. The 96-well plates were incubated at 37°C in a 5% CO2 incubator for 24 hours.

[0126] Table 11: Experimental results of 10 nM modified siRNA duplexes by lipofection in 786O-URATl cells

[0127] Table 12: Experimental results of 0.3 nM modified siRNA duplexes by lipofection in 786O-URATl cells

[0128] Table 13: Experimental results of 0.03 nM modified siRNA duplexes by lipofection in 786O-URATl cells

[0129] Example 6 Evaluation of the effect of different sequences on URATl expression in the liver of mice expressing hURATl

[0130] The effect of different sequences on URATl expression in the liver of mice expressing hURATl was evaluated according to the experimental method in Example 4.

[0131] Table 14: Results of activity detection of different (siRNA duplexes) in the liver tissue of mice expressing hURATl on day 14

[0132] Table 15: Results of activity detection of different (siRNA duplexes) in the liver tissue of transgenic mice of hURATl on day 14

[0133] Table 16: Results of activity detection of different (siRNA duplexes) in the liver tissue of transgenic mice of hURATl on day 42

[0134] The knockdown efficiency of the target after 42 days of single administration is still 80% or more, indicating that the siRNA has a long duration of efficacy and can reduce the frequency of administration.

[0135] The above examples only express several embodiments of the present application, and the description is more specific and detailed, but it should not be understood as limiting the scope of the patent. It should be noted that for ordinary skilled in the art, without departing from the concept of the present application, several modifications and improvements can be made, which are within the scope of the present application. Therefore, the scope of protection of the present application should be subject to the appended claims.

Claims

1. An siRNA or a pharmaceutically acceptable salt thereof for use in inhibiting or reducing the expression of urate transporter 1 (URAT1) gene in human cells, wherein, The siRNA comprises a sense strand and its corresponding complementary antisense strand, and the siRNA is selected from any one of the sense strands and its corresponding complementary antisense strands in Table 1 or Table 2, or a sequence differing by no more than 1 nucleotide from the sense strand or the antisense strand thereof.

2. The siRNA or pharmaceutically acceptable salt thereof according to claim 1, wherein, The siRNA is selected from any one of the following pairs of sequences: 24003, the sense strand of which is shown as SEQ ID NO: 7, and the antisense strand sequence is shown as SEQ ID NO: 8; 24003a, the sense strand of which is shown as SEQ ID NO: 9, and the antisense strand sequence is shown as SEQ ID NO: 10; 24003f, the sense strand of which is shown as SEQ ID NO: 19, and the antisense strand sequence is shown as SEQ ID NO: 20 24003g, the sense strand of which is shown as SEQ ID NO: 21, and the antisense strand sequence is shown as SEQ ID NO: 22; 24047, the sense strand of which is shown as SEQ ID NO: 225, and the antisense strand sequence is shown as SEQ ID NO: 226; 24049, the sense strand of which is shown as SEQ ID NO: 259, and the antisense strand sequence is shown as SEQ ID NO: 260; 24055, the sense strand of which is shown as SEQ ID NO: 271, and the antisense strand sequence is shown as SEQ ID NO: 272; 24070, the sense strand of which is shown as SEQ ID NO: 303, and the antisense strand sequence is shown as SEQ ID NO: 304; 24075, the sense strand of which is shown as SEQ ID NO: 313, and the antisense strand sequence is shown as SEQ ID NO: 314; 24034, the sense strand of which is shown as SEQ ID NO: 171, and the antisense strand sequence is shown as SEQ ID NO: 172; 24047a, the sense strand of which is shown as SEQ ID NO: 227, and the antisense strand sequence is shown as SEQ ID NO: 228; 24047g, the sense strand of which is shown as SEQ ID NO: 239, and the antisense strand sequence is shown as SEQ ID NO: 240; 24081, the sense strand of which is shown as SEQ ID NO: 325, and the antisense strand sequence is shown as SEQ ID NO: 326; 24017, the sense strand of which is shown as SEQ ID NO: 55, and the antisense strand sequence is shown as SEQ ID NO: 56; 24026, the sense strand of which is shown as SEQ ID NO: 111, and the antisense strand sequence is shown as SEQ ID NO: 112; 24027, the sense strand of which is shown as SEQ ID NO: 127, and the antisense strand sequence is shown as SEQ ID NO: 128; 24068, the sense strand of which is shown as SEQ ID NO: 299, and the antisense strand sequence is shown as SEQ ID NO:

300.

3. The siRNA or pharmaceutically acceptable salt thereof of claim 1, wherein, The siRNA is modified, the sense strand includes no more than 3, 2, 1 or 0 unmodified nucleotides, the modified nucleotides in the sense strand comprise 2'-0-methyl modified nucleotides, 2'-deoxynucleotides, 2'-fluoro modified nucleotides, inverted abasic residues, respectively, the sense strand contains 0, or 1, or 2, or 3 phosphorothioate linkages at the 5'-end and 3'-end; and wherein the antisense strand includes no more than 3, 2, 1 or 0 unmodified nucleotides, the modified nucleotides in the antisense strand comprise 2'-0-methyl modified nucleotides, 2'-deoxynucleotides, 2'-fluoro modified nucleotides, VPU (2'-0-methyluridine-5'-(E)-vinylphosphonate-3'-phosphate), VPU-S (2'-S-methyluridine-5'-(E)-vinylphosphonate-3'-phosphate) or other VPU derivatives, respectively, the antisense strand contains 1-3 phosphorothioate linkages at the 5'-end and 3'-end, respectively.

4. The siRNA or pharmaceutically acceptable salt thereof for use according to claim 3, wherein, The siRNA is selected from any one pair of modified siRNAs in Table 4.

5. The siRNA or pharmaceutically acceptable salt thereof for use according to claim 4, wherein, The modified siRNA is selected from any one pair of sequences: 24003.8-2, whose sense strand sequence is shown as Invab*mC*mCmUmUmUmGfGfCfUfUmCfAmCmCmUmUmCmUmAInvab, and whose antisense strand sequence is shown as VPU-S*fA*mGmAmAmGmGmUmGmAmAdGmCfCmAfAmAmGmG*mC*mG; 24003.2-2, whose sense strand sequence is shown as mC*mG*mCmCmUmUmUmGfGfCfUfUmCfAmCmCmUmUmCmUmA, and whose antisense strand sequence is shown as VPU-S*fA*mGmAmAmGmGmUmGmAmAdGmCfCmAfAmAmGmG*mC*mG; 24003.6-6, whose sense strand sequence is shown as mU*mC*mUmUmUmGfGfCfUfUmCfAmCmCmUmUmCmUmA, and whose antisense strand sequence is shown as VPU-S*fA*mGmAmAmGmGmUmGmAmAdGmCfCmAfAmAmGmG*mG*mG; 24003.7-7, whose sense strand sequence is shown as mG*mC*mUmUmUmGfGfCfUfUmCfAmCmCmUmUmCmUmA, and whose antisense strand sequence is shown as VPU-S*fA*mGmAmAmGmGmUmGmAmAdGmCfCmAfAmAmGmC*mC*mG; 24047a.1-1, whose sense strand sequence is shown as Invab*mG*mUmGmCmGmAmGmGfGfAfUfUmGfAmAmUmAmAmAmGmAInvab, and whose antisense strand sequence is shown as VPU-S*fC*mUmUmUmAmUmUmCmAmAdTmCfCmCfUmCmGmC*mA*mC; 24049a.1-1, having a sense strand sequence as shown in Invab*mU*mGmGmUmGmCmGmAfGfGfGfAmUfUmGmAmAmUmAmAmAInvab and an antisense strand sequence as shown in VPU-S*fU*mUmAmUmUmCmAmAmUmCdCmCfUmCfGmCmAmC*mC*mA; 24055a.1-1, having a sense strand sequence as shown in Invab*mG*mGmGmAmAmAmAmGfGfAfCfAmGfUmUmUmGmAmUmUmAInvab and an antisense strand sequence as shown in VPU-S*fA*mAmUmCmAmAmAmCmUmGdTmCfCmUfUmUmUmC*mC*mC; 24070a.1-1, having a sense strand sequence as shown in Invab*mG*mAmAmCmUmCmUmGfUfCfCfUmAfAmAmAmUmCmCmAmAInvab and an antisense strand sequence as shown in VPU-S*fU*mGmGmAmUmUmUmUmAmGdGmAfCmAfGmAmGmU*mU*mC; 24075a.1-1, having a sense strand sequence as shown in Invab*mU*mCmGmUmGmUmGmUfGfAfCfUmCfUmCmAmUmGmCmUmAInvab and an antisense strand sequence as shown in VPU-S*fA*mGmCmAmUmGmAmGmAmGdTmCfAmCfAmCmAmC*mG*mA; 24034a.1-1, having a sense strand sequence as shown in Invab*mG*mGmUmGmCmGmAmGfGfGfAfUmUfGmAmAmUmAmAmAmAInvab and an antisense strand sequence as shown in VPU-S*fU*mUmUmAmUmUmCmAmAmUdCmCfCmUfCmGmCmA*mC*mC; 24047a.2-1, having a sense strand sequence as shown in Invab*mG*mCmGmAmGmGfGfAfUfUmGfAmAmUmAmAmAmGmAInvab and an antisense strand sequence as shown in VPU-S*fC*mUmUmUmAmUmUmCmAmAdTmCfCmCfUmCmGmC*mA*mC; 24047a.7-7, having a sense strand sequence as shown in Invab*mC*mUmGmCmGmAmGmGfGfAfUfUmGfAmAmUmAmAmAmGmAInvab and an antisense strand sequence as shown in VPU-S*fC*mUmUmUmAmUmUmCmAmAdTmCfCmCfUmCmGmC*mA*mG; 24081 a.1-1, whose sense strand sequence is shown as Invab*mC*mGmAmGmGmGfAfUfUfGmAfAmUmAmAmAmGmAmA Invab, and whose antisense strand sequence is shown as VPU-S*fU*mCmUmUmUmAmUmUmCmAdAmUfCmCfCmUmCmG*mC*mA; 24017.1-2, whose sense strand sequence is shown as mA*mG*mCmAmAmCmAmUfCfUfUfCmCfUmGmCmUmCmCmAmA, and whose antisense strand sequence is shown as VPU-S*fU*mGmGmAmGmCmAmGmGmAdAmGfAmUfGmUmUmG*mC*mU; 24026.1-2, whose sense strand sequence is shown as mG*mG*mCmAmGmUmAmAfAfGfAfAmGfGmCmAmAmCmAmCmA, and whose antisense strand sequence is shown as VPU-S*fG*mUmGmUmUmGmCmCmUmUdCmUfUmUfAmCmUmG*mC*mC; 24027.1-2, whose sense strand sequence is shown as mA*mG*mUmAmAmAmGmAfAfGfGfCmAfAmCmAmCmAmUmGmA, and whose antisense strand sequence is shown as VPU-S*fC*mAmUmGmUmGmUmUmGmCdCmUfUmCfUmUmUmA*mC*mU; 24068.1-1, whose sense strand sequence is shown as mA*mA*mUmCmCmAmCmAfCfAfGfUmUfUmUmAmGmCmCmUmA, and whose antisense strand sequence is shown as VPU-S*fA*mGmGmCmUmAmAmAmAmCdTmGfUmGfUmGmGmA*mU*mU; wherein VPU-S is 2'-S-methyluridine-5'-(E)-vinylphosphonate-3'-phosphate, mA is 2'-O-methyladenosine-3'-phosphate, mU is 2'-O-methyluridine-3'-phosphate, mC is 2'-O-methylcytidine-3'-phosphate, mG is 2'-O-methylguanosine-3'-phosphate, fA is 2'-fluoroadenosine-3'-phosphate, fU is 2'-fluorouridine-3'-phosphate, fC is 2'-fluorocytidine-3'-phosphate, fG is 2'-fluoroguanosine-3'-phosphate, dA is 2'-deoxyadenosine-3'-phosphate, dT is 2'-deoxythymidine-3'-phosphate, dC is 2'-deoxycytidine-3'-phosphate, dG is 2'-deoxyguanosine-3'-phosphate, Invab is inverted abasic residue, and * is phosphorothioate bond.

6. A medicament for inhibiting or reducing the expression of a URAT1 target gene, wherein, The active ingredient of the drug comprises the siRNA or pharmaceutically acceptable salt thereof according to any one of claims 1-5. The active ingredient of the drug comprises the siRNA or pharmaceutically acceptable salt thereof according to any one of claims 1-5.

7. Use of the siRNA or its pharmaceutically acceptable salt according to any one of claims 1-5, or the medicament according to claim 6, in the manufacture of a product for inhibiting or reducing the expression of URAT1 gene.

8. Use of the siRNA or its pharmaceutically acceptable salt according to any one of claims 1-5, or the medicament according to claims 6- in the manufacture of a product for preventing or treating a disease mediated or associated with URAT1 gene.

9. Use according to any one of claims 7-8, wherein, The disease mediated by URAT1 gene is at least one of gout, hyperuricemia, gouty arthritis, and kidney stone.

10. A method of inhibiting or reducing expression of URAT1 in a cell, wherein, The method comprises the following steps: (a) contacting the cell with the siRNA or its pharmaceutically acceptable salt according to any one of claims 1-5, or the medicament according to claim 6; (b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of URAT1 expression, thereby simultaneously inhibiting or reducing the expression of URAT1 in the cell.

11. A method for preventing or treating gout, hyperuricemia, gouty arthritis, and / or kidney stone, the method comprising administering to a subject a suitable dose of the siRNA or its pharmaceutically acceptable salt according to any one of claims 1-5, or the medicament according to claim 6.

Images