Methods of treating neurological disorders

By inhibiting BAMBI activity to modulate TGF-B signaling, the methods address the lack of treatments for neurological disorders, enhancing TGF-B signaling to treat conditions like Alzheimer's and Parkinson's disease.

WO2026039578A1PCT designated stage Publication Date: 2026-02-19PRESIDENT & FELLOWS OF HARVARD COLLEGE
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/041895
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-13
Filing Date
2025-08-13
Publication Date
2026-02-19

AI Technical Summary

Technical Problem

Neurological disorders such as neurodegenerative and neurovascular diseases lack effective treatments, posing significant social and economic burdens due to their increasing prevalence and the lack of treatments or cures.

Method used

Administering agents that inhibit or reduce the activity of Bone Morphogenic Protein and Activin Membrane Bound Inhibitor (BAMBI) to modulate TGF-B signaling, thereby treating or preventing neurological disorders by enhancing TGF-B signaling, which can be achieved through systemic or targeted delivery using viral vectors, nanoparticles, and small molecules.

Benefits of technology

Enhances TGF-B signaling, promoting neurogenesis, vascularization, and remyelination, effectively treating or preventing conditions like Alzheimer's, Parkinson's disease, and multiple sclerosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025041895_19022026_PF_FP_ABST
    Figure US2025041895_19022026_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed herein are methods for treating a disease or disorder of the central or peripheral nervous system by administering to a subject in thereof an agent capable of modulating the activity or expression of bone morphogenetic protein and activin membrane-bound inhibitor (BAMBI). Additionally, methods for screening agents capable of modulating the activity or expression of BAMBI are disclosed.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] PATENT APPLICATION

[0002] Docket No. HRVY-253-WO1

[0003] -1-

[0004] METHODS OF TREATING NEUROLOGICAL DISORDERS

[0005] RELATED APPLICATION^ )

[0006] This application claims the benefit of U.S. Provisional Application No. 63 / 682,733, filed on August 13, 2024. The entire teaching of the above application is incorporated herein by reference.

[0007] BACKGROUND OF THE INVENTION

[0008] Neurological conditions are estimated to afflict 1 in 3 individuals throughout the world, with the number of cases steadily climbing. Among neurological conditions to see a significant increase over the last several decades are neurodegenerative disorders, such as Alzheimer’s disease and other dementias, Parkinson’s disease, and multiple sclerosis, and neuropathies, such as diabetic peripheral neuropathy. Diseases of the central and / or peripheral nervous system frequently have no treatments, let alone cures. Thus, there exists a need to provide treatments which can reduce or prevent the symptoms of such diseases and disorders and / or eliminate the disease or disorder entirely.

[0009] SUMMARY OF THE INVENTION

[0010] In some aspects, disclosed herein are methods for treating or preventing a disease or disorder of the central or peripheral nervous system in a subject in need thereof, comprising (a) administering to the subject a composition comprising an agent capable of inhibiting or reducing the activity of Bone Morphogenic Protein and Activin Membrane Bound Inhibitor (BAMBI) or inhibiting the expression thereof; thereby treating the disease or disorder in the subject.

[0011] In some embodiments, the agent capable of inhibiting, blocking or reducing the activity of BAMBI or inhibiting the expression thereof is selected from the group consisting of a small molecule, an anti-sense oligonucleotide, an siRNA, an miRNA, a Docket No. HRVY-253-WO1

[0012] -2- peptide, and an antibody or functional fragment thereof. In some embodiments, the composition comprises a virus comprising nucleic acids encoding the agent.

[0013] In some embodiments, the agent is a secreted peptide capable of blocking or inhibiting the interaction between BAMBI and Transforming Growth Factor-B Receptor 1 (TGFBR1) or the interaction between BAMBI and a Transforming Growth Factor-B superfamily polypeptide.

[0014] In some embodiments, the agent is a CNS -penetrating antibody or functional fragment thereof. In some embodiments, the antibody is a monoclonal antibody, and in some embodiments it selectively binds to an amino acid sequence that forms part of a polypeptide having at least 85% identify to SEQ ID NO: 1, 2, 3, or 4. In some embodiments, the monoclonal antibody is a humanized monoclonal antibody.

[0015] In some embodiments, step (a) of the method comprises intrathecal, intravenous, intramuscular, inhalation, oral, intranasal, or sublingual administration.

[0016] In some embodiments, the disease or disorder of the central or peripheral nervous system is a neurovascular disorder, a neurodegenerative disorder, is associated with old age, or is a disease or disorder characterized by demyelination. In some embodiments, the disease or disorder of the central or peripheral nervous system is selected from the group consisting of Huntington’s disease, Alzheimer’s disease, amyotrophic lateral sclerosis, Parkinson’s disease, multiple sclerosis, clinically isolated demyelinating syndrome (CIS), neuromyelitis optica, acute-disseminated encephalomyelitis, leukoencephalopathies, acute transverse myelitis, Balo’s concentric sclerosis, cerebrotendinous xanthomatosis, Fabry’s disease, HIV encephalitis, herpes simplex encephalitis, mitochondrial encephalopathy, Behcet’s disease with CNS involvement, neuropsychiatric systemic lupus erythematosus, progressive multifocal leukoencephalopathy, subacute sclerosing panencephalitis, Pelizaeus-Merzbacher disease, peripheral neuropathy, diabetic neuropathy, and chemotherapy -induced neuropathy. In some embodiments, the agent is administered in an amount effective to enhance an effect of an endogenously produced Transforming Growth Factor-B superfamily polypeptide on pSMAD signaling in the subject. In some embodiments, the endogenously produced TGF-B superfamily polypeptide is Growth Differentiation Factor 11 (GDF11).

[0017] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0018] -3-

[0019] In some embodiments, the agent is administered in an amount effective to induce neurogenesis, vascularization of neural tissues, increased expression of neuronal activity markers, or remyelination. In some embodiments, step (a) of the method comprises systemic administration of the agent to the subject, and some embodiments the agent is incapable of traversing the blood brain barrier of the subject.

[0020] In certain aspects, disclosed herein are methods for screening agents for the ability to selectively modulate the activity of Bone Morphogenic Protein and Activin Membrane Bound Inhibitor (BAMBI), comprising: (a) providing a cell or an organism comprising the cell which expresses BAMBI; (b) exposing the cell to an agent; (c) assessing whether the activity or expression of BAMBI has been modulated, and (d) identifying the agent as a candidate when modulation of BAMBI activity or expression has been confirmed. In some embodiments, the cell overexpresses BAMBI.

[0021] In some embodiments, the cell or organism is selected as a model for a neurodegenerative or neurovascular disease or disorder, or a disease or disorder characterized by demyelination. In some embodiments, the cell or organism is a model for old age, Huntington’s disease, Alzheimer disease, amyotrophic lateral sclerosis, Parkinson’s disease, multiple sclerosis, clinically isolated demyelinating syndrome (CIS), neuromyelitis optica, acute-disseminated encephalomyelitis, leukoencephalopathies, acute transverse myelitis, Balo’s concentric sclerosis, cerebrotendinous xanthomatosis, Fabry’s disease, HIV encephalitis, herpes simplex encephalitis, mitochondrial encephalopathy, Behcet’s disease with CNS involvement, neuropsychiatric systemic lupus erythematosus, progressive multifocal leukoencephalopathy, subacute sclerosing panencephalitis, Pelizaeus-Merzbacher disease, peripheral neuropathy, diabetic neuropathy, and chemotherapy-induced neuropathy.

[0022] In some embodiments, the method further comprises identifying the agent as a candidate for treating a disease or disorder of the central or peripheral nervous system when the activity or expression of BAMBI has been confirmed or identified as blocked, reduced or inhibited. In some embodiments, the modulation of BAMBI activity is assessed by measuring a change in TGF-P signaling.

[0023] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0024] -4-

[0025] In certain aspects, disclosed herein are viruses comprising nucleic acids which encode an agent capable of blocking, reducing, or inhibiting the activity or expression of BAMBI, wherein the agent is selected from the group consisting of an anti-sense oligonucleotide, an siRNA, an miRNA, or a peptide.

[0026] In some embodiments, the virus is an adenovirus, an adeno-associated virus (AAV), or a retrovirus. In some embodiments, the retrovirus is a replication-deficient lentivirus. In some embodiments, the AAV is an AAV having tropism for the nervous system. In some embodiments, the nucleic acids are operably linked to an inducible or constitutive promoter.

[0027] BRIEF DESCRIPTION OF THE DRAWINGS

[0028] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.

[0029] Figure 1 depicts BAMBI abundance and localization in adult and aged mouse brain.

[0030] Figure 2 depicts lentiviral vector designed to provide overexpression of BAMBI in cells transduced therewith.

[0031] Figure 3 depicts the effects of BAMBI overexpression on TGF-B / GDF11 signaling as assessed by phosphorylated SMAD.

[0032] Figure 4 depicts the change in neurogenesis and levels of GDF11, BAMBI, and myelin in the brain during aging. Additionally depicted are the downstream effects of BAMBI on GDF11 signaling.

[0033] Figure 5 depicts effects of overexpression of BAMBI on GDF11 and TGF-B signaling in HEK293 cells.

[0034] Figure 6 depicts immunohistochemistry staining demonstrating expression of BAMBI in olig2+ oligodendrocyte lineage cells and MBP+ mature oligodendrocytes. Additionally, bar charts depict strong BAMBI expression in mature oligodendrocytes (MBP+) compared with Olig2+ cells.

[0035] Figure 7 depicts immunohistochemistry staining demonstrating expression of BAMBI in olig2+ oligodendrocyte lineage cells and MBP+ mature oligodendrocytes.

[0036] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0037] -5-

[0038] Figure 8 depicts immunohistochemistry staining of olig2+ and MBP+ cell along with localization of BAMBI mRNA via Fluorescence In Situ Hybridization (FISH).

[0039] Figure 9 depicts BAMBI expression increases during different stages of oligodendrocyte differentiation.

[0040] Figure 10 depicts detection of endogenous TGFBR signaling in oligodendrocytes via immunohistochemistry staining of TGFBR1, phospho-SMAD2 and GDF11.

[0041] Figure 11 depicts an alignment of N-terminal regions of BAMBI and TGF- BR1, as well as an alignment of N-terminal regions of BAMBI and ALK3.

[0042] Figure 12 depicts the effects of neutralizing BAMBI with an anti-BAMBI antibody in oligodendrocyte lineage cell culture. In particular, neutralizing BAMBI provided a marked increase in pSMAD2 levels as determined by immunohistochemistry staining and western blot.

[0043] Figure 13 depicts a control lentiviral vector containing the reporter gene mCherry and a lentiviral vector containing the BAMBI gene linked to the mCherry reporter, driven by the EFla promoter. Also depicted is transduction of oligodendrocyte lineage cells that have been transduced by each vector, wherein overexpression of BAMBI / mChcrry is evident via immunohistochemistry.

[0044] Figure 14 depicts immunohistochemistry staining of oligodendrocyte lineage cells which validates the use of a lentiviral vector for overexpression of BAMBI in the transduced cells. Also depicted is a bar chart depicting increased BAMBI expression in olig2+ cells transduced with the lentiviral vector comprising BAMBI and mCherry driven by EFla.

[0045] Figure 15 depicts immunohistochemistry staining of oligodendrocyte lineage cells which have been transduced with a control lentiviral vector (pLenti-mCherry) or a lentiviral vector designed to overexpress BAMBI in a transduced cell (pLenti- mCherry-Bambi). It appears that Bambi overexpression abrogates pSMAD2 intensity in oligodendrocyte lineage cells.

[0046] Figure 16 depicts the impact of BAMBI overexpression on oligodendrocyte biology via immunohistochemistry staining of oligodendrocyte lineage cells and mature oligodendrocytes present in culture at 7 days in vitro.

[0047] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0048] -6-

[0049] DETAILED DESCRIPTION OF THE INVENTION

[0050] Neurological disorders, including neurodegenerative disorders, neurovascular disorders, demyelinating disorders, and neuropathies, are a leading cause of physical and cognitive disability worldwide. Such disorders pose an enormous social and economic burden on society, with treatment and care needs surpassing medical treatment and care facility capabilities in many instances. The number of diagnosed cases has surged in recent years, due in large part to an aging worldwide population, with a longer average lifespan, along with an increased incidence of type 2 diabetes associated with an ever-expanding percentage of developed nations’ populations comprising obese individuals. These social and economic costs are estimated to double by year 2045. This invention addresses this unmet need by providing methods for treating and preventing such neurological conditions by modulating activity or expression of BMP and activin membrane-bound inhibitor (BAMBI), particularly in the central and peripheral nervous system, thereby modulating transforming growth factor B (TGF-B) signaling therein.

[0051] BAMBI is a transmembrane pseudo-receptor for TGF-B family ligands, having an extracellular domain similar to ligand-binding domains of TGF-B receptor l(TGFBRl) / bone morphogenetic protein receptor type 1 (BMPR1). BAMBI has a putative amino acid sequence which is highly conserved across species. The human BAMBI gene comprises a nucleic acid sequence of SEQ ID NO: 5, which encodes the 260 amino acid polypeptide having the sequence of SEQ ID NO: 1, while mouse BAMBI has the amino acid sequence of SEQ ID NO: 3. The human extracellular domain comprises amino acids 21-152 of the full sequence, as shown in SEQ ID NO: 2, while the mouse extracellular domain comprises amino acids 27-152 of the full sequence, as shown in SEQ ID NO: 4. While the ligand-binding domain of BAMBI mimics that of TGFBR1 / BMPR1, the intracellular domain of BAMBI lacks a serine / threonine kinase structural domain found in TGFBR1 / BMPR1, resulting in BAMBI acting as a negative upstream regulator of TGF-B / BMP signaling. Work described herein demonstrates that overexpression of BAMBI severely inhibits TGF- B / GDF-11 signaling (Figs. 2, 5). BAMBI is expressed in peripheral nerves as well as in the central nervous system (Fig. 1). TGF-B ligands that are thought to bind BAMBI

[0052] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0053] -7- include TGF-B1, TGF-B2, TGF-B3, Activin A, Activin B, BMP2, BMP4, BMP5, BMP6, BMP7, BMP8, BMP9, BMP10, BMP15, GDF1, GDF3, GDF4, GDF5, GDF6, GDF7, GDF8, GDF9, GDF11, inhibin, anti-Mullerian hormone (AMH), and Nodal.

[0054] Multiple mechanisms have been proposed for BAMBI’s negative regulation of TGF-B signaling. In one aspect, BAMBI competitively binds type II TGF-B receptors, thereby blocking TGF-B signaling pathway transduction by prevention of phosphorylation of SMAD family proteins by the type II TGF-B receptor / BAMBI heterodimer because BAMBI lacks the necessary serine / threonine kinase structural domain. BAMBI may also complex with SMAD7 and TGFBR1 to prevent phosphorylation of SMAD3 by TGFBR1. Additionally, BAMBI and SMAD7 may also block SMAD2 phosphorylation, which likewise inhibits pSMAD-mediated TGF- B signaling.

[0055] Therefore, in one aspect, disclosed herein are methods for treating or preventing a disease or disorder of the central or peripheral nervous system in a subject in need thereof, comprising (a) administering to the subject an agent capable of modulating the activity or expression of Bone Morphogenic Protein and Activin Membrane Bound Inhibitor (BAMBI), thereby modulating TGF-B signaling. In some embodiments, the activity or expression of BAMBI is blocked, inhibited or reduced, thereby enhancing or increasing TGF-B signaling. In some embodiments, BAMBI activity or expression is reduced by 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 25- fold, 100-fold or more compared to BAMBI activity or expression before administration of the agent to the subject or compared to a reference value. In some embodiments, TGF-B signaling is increased by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 225%, 250%, 275%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more in comparison to TGF-B signaling levels before administration of the agent. In certain embodiments, BAMBI activity or expression is substantially blocked, inhibited or silenced. The fold reduction in BAMBI activity or expression and associated percent increase in TGF-B signaling can be measured or estimated by known methods in the field. In some embodiments, the expression of BAMBI can be assessed through direct measurement of BAMBI transcripts, such as by RNASeq, or HiBit assays. In

[0056] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0057] -8- other embodiments, an increase in downstream indicators of TGF-B signaling may be measured to estimate reduction in BAMBI activity or expression or increase in TGF-B signaling. In some embodiments, changes in levels of phosphorylated SMAD is utilized to assess BAMBI activity or expression or modulation of TGF-B signaling.

[0058] In some embodiments, BAMBI activity or expression is blocked, inhibited or reduced systemically or in a targeted locus within the body by an agent as described herein. The targeted locus may be an organ, tissue, cell or region of the body in which an enhancement or upregulation of TGF-B signaling will result in the prevention or treatment of a disease or disorder. In some embodiments, the targeted organ, tissue, cell or region of the body include those in which BAMBI is expressed and in which blocking, inhibiting or reducing BAMBI activity or expression aids in the prevention or treatment of a disease or disorder. In some embodiments, the disease or disorder is a disease or disorder of the central or peripheral nervous system. Diseases or disorders of the central or peripheral nervous system include a neurodegenerative disorder, a neurovascular disorder, a neurological condition associated with old age, a disease or disorder which can be prevented or ameliorated by an increase in angiogenesis, or a disease or disorder associated with loss of myelin. By way of non-limiting example, the disease or disorder may be Huntington’s disease, Alzheimer disease, amyotrophic lateral sclerosis, Parkinson’s disease, multiple sclerosis, clinically isolated demyelinating syndrome (CIS), neuromyelitis optica, acute-disseminated encephalomyelitis, leukoencephalopathies, acute transverse myelitis, Balo’s concentric sclerosis, cerebrotendinous xanthomatosis, Fabry’s disease, HIV encephalitis, herpes simplex encephalitis, mitochondrial encephalopathy, Behcet’s disease with CNS involvement, neuropsychiatric systemic lupus erythematosus, progressive multifocal leukoencephalopathy, subacute sclerosing panencephalitis, Pelizaeus-Merzbacher disease, peripheral neuropathy, diabetic neuropathy, and chemotherapy-induced neuropathy.

[0059] Methods for targeted delivery of a therapeutic agent to a locus within the body are not particularly limited, so long as the methods are capable of selectively delivering the agent to a target locus, compared to other loci in the body. Such methods will be known to those in this field, and include the methods described in Myerson, Jacob W., et al. ("Systems approaches to design of targeted therapeutic

[0060] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0061] -9- delivery." Wiley Interdisciplinary Reviews: Systems Biology and Medicine 7.5 (2015): 253-265), Zhao, Zongmin, et al. ("Targeting strategies for tissue-specific drug delivery." Cell 181.1 (2020): 151-167), and Dong, Xiaowei. ("Current strategies for brain drug delivery." Theranostics 8.6 (2018): 1481), all of which are incorporated herein by reference. In some embodiments, targeted delivery may be accomplished through choice of route of administration, such as local administration. In some embodiments, the targeted region is the central or peripheral nervous system and the administration includes intrathecal administration, intranasal administration, or direct injection into or proximate the central or peripheral nervous system or cells or tissues thereof.

[0062] Targeted delivery of the agent may also be accomplished through conjugating or associating the agent or its delivery vehicle to ligands or moieties which bind to a target organ, tissue, cell or region of the body. In some embodiments, the targeting moieties may bind to cell surface markers of the blood brain barrier, receptors expressed on cells of the central or peripheral nervous system, or transporters / receptors on the blood brain barrier. Transporters and receptors of the blood brain barrier and their ligands shown to facilitate transport of a cargo across the blood brain barrier are known in the art, and include those described in Georgieva, Julia V., Dick Hoekstra, and Inge S. Zuhom. ("Smuggling drugs into the brain: an overview of ligands targeting transcytosis for drug delivery across the blood-brain barrier." Pharmaceutics 6.4 (2014): 557-583), the entire disclosure of which is incorporated herein by reference. In some embodiments, the targeting moiety or ligand comprises transferrin, melanotransferrin (p97), insulin, low-density lipoproteins, lactoferrin, receptor-associated protein (RAP), tissue plasminogen activator (tPA), secreted amyloid precursor protein, leptin, thiamine, glutathione, enkephalin or enkephalin analogue, RVG peptide, cell penetrating peptides, such as transduction domain of human immunodeficiency virus type- 1 (TAT), and aptamers, antibodies, or functional antibody fragments which bind transporters, receptors, or cell-surface markers of the blood brain barrier or cells of the central or peripheral nervous system.

[0063] The agent delivery vehicle is not particularly limited, and includes delivery vehicles known in the art, and / or which are described herein. In some embodiments,

[0064] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0065] -10- the agent delivery vehicle comprises nanoparticles, microparticles, liposomes, micelles, exomes, cells or viral vectors. In some embodiments, the nanoparticles or microparticles are formed from inorganic compounds, polymers, lipids, and / or dendrimers. In certain embodiments, the delivery vehicle extends the time of the agent in systemic circulation. In some embodiments, the delivery vehicle protects the agent from degradation.

[0066] In one aspect of the invention, one or more viral vectors are utilized for delivery of the agent into a desired organ, tissue, cell or region of the body. In some embodiments, the one or more vectors can each be an adeno-associated virus (“AAV”) vector. The AAV vector may contain a full-length AAV 5' inverted terminal repeat (ITR) and a full-length 3 ' ITR. A shortened version of the 5' ITR, termed AITR, has been described in which the D- sequence and terminal resolution site (trs) are deleted. The abbreviation "sc" refers to self-complementary. "Self- complementary AAV" refers a construct in which a coding region carried by a recombinant AAV nucleic acid sequence has been designed to form an intramolecular double-stranded DNA template. Upon infection, rather than waiting for cell mediated synthesis of the second strand, the two complementary halves of scAAV will associate to form one double stranded DNA (dsDNA) unit that is ready for immediate replication and transcription. See, e.g., D M McCarty et al, "Self- complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis", Gene Therapy, (August 2001), Vol 8, Number 16, Pages 1248- 1254. Self-complementary AAVs are described in, e.g., U.S. Patent Nos. 6,596,535; 7, 125,717; and 7,456,683, each of which is incorporated herein by reference in its entirety.

[0067] In some embodiments, a single-stranded AAV viral vector may be used. Methods for generating and isolating AAV viral vectors suitable for delivery to a subject are known in the art. See, e.g., US Patent 7790449; US Patent 7282199; WO 2003 / 042397; WO 2005 / 033321, WO 2006 / 110689; and US 7588772 B2. In one system, a producer cell line is transiently transfected with a construct that encodes the transgene flanked by ITRs and a construct(s) that encodes rep and cap. In a second system, a packaging cell line that stably supplies rep and cap is transfected (transiently or stably) with a construct encoding the transgene flanked by ITRs. In

[0068] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0069] -11- each of these systems, AAV virions are produced in response to infection with helper adenovirus or herpesvirus, requiring the separation of the rAAVs from contaminating virus. More recently, systems have been developed that do not require infection with helper virus to recover the AAV - the required helper functions (i.e., adenovirus El, E2a, VA, and E4 or herpesvirus UL5, UL8, UL52, and UL29, and herpesvirus polymerase) are also supplied, in trans, by the system. In these newer systems, the helper functions can be supplied by transient transfection of the cells with constructs that encode the required helper functions, or the cells can be engineered to stably contain genes encoding the helper functions, the expression of which can be controlled at the transcriptional or posttranscriptional level. In yet another system, the transgene flanked by ITRs and rep / cap genes are introduced into insect cells by infection with baculovirus-based vectors. For reviews on these production systems, see generally, e.g., Zhang et al, 2009, "Adenovirus- adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production," Human Gene Therapy 20:922-929, the contents of each of which is incorporated herein by reference in its entirety. Methods of making and using these and other AAV production systems are also described in the following U.S. patents, the contents of which is incorporated herein by reference in its entirety: 5,139,941; 5,741,683; 6,057,152; 6,204,059; 6,268,213; 6,491,907; 6,660,514; 6,951,753; 7,094,604; 7,172,893; 7,201,898; 7,229,823; and 7,439,065.

[0070] In some embodiments, cells of the central or peripheral nervous system are targeted by a viral vector. Viral vectors capable of delivering an encoded agent to cells of the central or peripheral nervous system are known in the art, and include those disclosed in Davidson, Beverly L., and Xandra O. Breakefield ("Viral vectors for gene delivery to the nervous system." Nature Reviews Neuroscience 4.5 (2003): 353-364), the entirety of which is incorporated by reference. Such viral vectors may include lentivirus, adenovirus, adeno-associated virus, herpes simplex virus, poliovirus, sindbis, simian vacuolating virus 40, and pseudorabies virus. In some embodiments, the virus is a replication deficient virus. In some embodiments, the viral vector is neurotropic. In some embodiments, the viral vector is capable of selectively targeting cells of the central or peripheral nervous system over cells which are not cells of the central or peripheral nervous system. In some embodiments, the

[0071] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0072] -12- viral vectors are capable of retrograde and / or anterograde transport in neuronal cells (HSV, pseudorabies, poliovirus, poliovirus replicons, pseudotyped AAV / lentivirus, Adenovirus of serotype 5, etc.).

[0073] In some embodiments, the viral vector is a lentivirus that has been pseudotyped with glycoproteins which target the central and / or peripheral nervous system. Non-limiting examples of glycoproteins which may be selected to target cells of the central or peripheral nervous system include envelope proteins of pseudorabies, HSV, poliovirus, VSV, Ebola, Mokola, LCMV, MuLV, and Ross River Virus.

[0074] In other embodiments, the viral vector is an adenovirus or adeno-associated virus having a neurotropic capsid. Non-limiting examples include adeno-associated viruses of serotype AAV2, AAV6, AAV8, AAV9, AAV10, AAV-PHP.B and Anc80L65. Where a pseudotyped AAV is to be produced, the ITRs are selected from a source which differs from the AAV source of the capsid. For example, AAV2 ITRs may be selected for use with an AAV capsid having a particular efficiency for a selected cellular receptor, target tissue or viral target. In one embodiment, the ITR sequences from AAV2, or the deleted version thereof (AITR), are used for convenience and to accelerate regulatory approval. However, ITRs from other AAV sources may be selected. Where the source of the ITRs is from AAV2 and the AAV capsid is from another AAV source, the resulting vector may be termed pseudotyped. However, other sources of AAV ITRs may be utilized. In some embodiments, the AAV capsid can be targeted to the central nervous system by covalent attachment or association with an antibody which binds a cell-surface marker expressed in a cell of the peripheral or central nervous system. In some embodiments, a bispecific antibody or functional fragment thereof may be used that binds an epitope of the AAV capsid and also binds a receptor, transporter or cell surface marker of the blood brain barrier or cell of the peripheral or central nervous system.

[0075] It will be understood by one of skill in the art that the different strategies for delivering a composition comprising the agent to a target organ, tissue, cell or region of the body are not mutually exclusive. In some embodiments, a viral vector, nanoparticle or microparticle encoding or comprising the agent may be delivered by intrathecal, intranasal or direct injection administration. In other embodiments, the agent may be delivered in different delivery vehicles (e.g. intranasal gel and

[0076] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0077] -13- intrathecal injection) simultaneously or consecutively to achieve the treatment or prevention aims more quickly, or to prolong treatment or prevention of the disease or disorder. In some embodiments, a plurality of different agents may be administered simultaneously or consecutively. For example, a plurality of viral vectors, each encoding a different agent which blocks, inhibits or reduces the activity or expression of BAMBI, may be delivered simultaneously or consecutively to a subject.

[0078] Agents capable of inhibiting or reducing the activity of BAMBI include agents described herein, and those known in the art for this purpose. In some embodiments, the agent is selected from the group consisting of a synthetic small molecule, an aptamer, an anti- sense oligonucleotide, an siRNA, an miRNA, an shRNA, a peptide, and an antibody or functional fragment thereof. In some embodiments, the agent is capable of interfering with the formation of a heterodimer complex comprising a type I TGF-B / BMP receptor and BAMBI. In some embodiments, the agent is capable of inhibiting or reducing the activity of BAMBI by reducing or blocking the interaction between SMAD7 and BAMBI. In some embodiments, the agent is capable of inhibiting or reducing the activity of BAMBI by reducing or blocking interaction of a TGF-B superfamily ligand with the extracellular ligand-binding domain of BAMBI.

[0079] In some aspects, disclosed herein are methods for treating or preventing a disease or disorder of the central or peripheral nervous system in a subject in need thereof, comprising (a) administering to the subject an agent capable of inhibiting or reducing the expression of Bone Morphogenic Protein and Activin Membrane Bound Inhibitor (BAMBI), thereby treating or preventing the disease or disorder of the central or peripheral nervous system in the subject. In some embodiments, the agent is capable of reducing or inhibiting the expression of BAMBI by interfering with transcription initiation, elongation, or termination. In some embodiments, the expression of BAMBI is inhibited or reduced by an agent blocking access to the transcription start site, promoter and / or enhancer necessary for transcription initiation. In some embodiments, the agent is capable of reducing or inhibiting the expression of BAMBI by inducing cleavage or degradation of a BAMBI transcript before it can be spliced and / or translated. In some embodiments, the agent is capable of reducing or inhibiting the expression of BAMBI by binding to BAMBI mRNA and preventing

[0080] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0081] -14- translation, such as by blocking association of a ribosome or tRNA with the start codon of a BAMBI transcript.

[0082] RNA interference is a powerful tool that may be harnessed to inhibit or reduce expression of a target gene product. Agents according to the invention may harness the cellular RNAi machinery to inhibit, silence or reduce BAMBI expression. Such agents include the non-coding RNAs miRNA, siRNA, and shRNA. In some embodiments, the agent is an miRNA. Micro RNAs are typically approximately 21 ribonucleotides in length and bind to the 3’ untranslated region of a target mRNA, triggering mRNA degradation or inhibition of its translation. The selection of miRNA is not particularly limited, so long as it is capable of knout or knockdown of Bambi expression once delivered to or transcribed in a target cell. MiRNA which target BAMBI are known in the art. By way of non-limiting example, the miRNA according to the invention may be miR-519d-3p, miR-17-5p, miR-708, miR-20b-5p, miR-942, or miR-338-3p. In some embodiments, the miRNA is one which has been identified by a screening assay described herein.

[0083] In other embodiments, the agent may be an siRNA or shRNA. SiRNA and shRNA are double stranded RNA which are processed by cellular enzymes (e.g. drosha, dicer), to provide a short single stranded antisense RNA which forms part of the RNA-induced silencing complex (RISC). The siRNA and shRNA according to the invention will be capable of forming part of RISC after processing, thereafter capable of binding to BAMBI mRNA, resulting in cleavage of the mRNA or repression of its translation. In some embodiments, the siRNA comprises a length of 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29 nucleotides. In some embodiments, the siRNA will have one or more of: 1) a GC content of approximately 23% to 57%, 2) low internal stability at the 5’ end of the antisense strand, 3) having more than half of the 7 nucleotides of the 5 ’-end of the antisense strand being A or U, 4) does not contain one or more sequences of CCCC, GGGG, AAA or UUU, 5) a U at position 10 of the sense strand, 6) binds to a sequence close to the start codon, 7) binds to a motif of 5’-AA(N19)TT, 5’-AA(N21) or 5’NA(N21), or 8) secondary structures of the siRNA have a melting temperature below 20°C. In some embodiments, the siRNA comprises a sequence encoded by a sequence listed in Table 1. In some embodiments, the siRNA comprises a sequence encoded by a sequence having one or

[0084] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0085] -15- two substitutions compared to a sequence of Table 1. In some embodiments, the substitution(s) preferably occur within the inner approximately two-thirds of the sequence.

[0086] TABLE 1

[0087] Start

[0088] Sequence (SEQ ID NO) (CDS) GC%

[0089] GTGAAATTCGATGCTACTGT (SEQ ID NO: 6) 454 40.00

[0090] GACCTCAGCAACGATAAGAT (SEQ ID NO: 7) 1083 45.00

[0091] GATCCTCTCGCTTGTTCACT (SEQ ID NO: 8) 1100 50.00

[0092] GGAAGCTGGAATTCGTATGA (SEQ ID NO: 9) 1141 45.00

[0093] GGTGAAATTCGATGCTACTGT (SEQ ID NO: 10) 453 42.86

[0094] GGGAAGCTGGAATTCGTATGA (SEQ ID NO: 11) 1140 47.62

[0095] GCAGACCTCAGCAACGATAAGA (SEQ ID NO: 12) 1080 50.00

[0096] GGACAGGAGCACTTTATCTGAA (SEQ ID NO: 13) 1218 45.45

[0097] GCAGACCTCAGCAACGATAAGAT (SEQ ID NO: 14) 1080 47.83

[0098] GCACGGGAAGCTGGAATTCGTATGA (SEQ ID NO: 15) 1136 52.00

[0099] GAATTCGTATGACGGAGTCTTATCT (SEQ ID NO: 16) 1149 40.00

[0100] GCTGGACAGGAGCACTTTATCTGAA (SEQ ID NO: 17) 1215 48.00

[0101] GGCACGGGAAGCTGGAATTCGTATGA (SEQ ID NO: 18) 1135 53.85

[0102] GGAATTCGTATGACGGAGTCTTATCT (SEQ ID NO: 19) 1148 42.31

[0103] GACAAGCAGACCTCAGCAACGATAAGA (SEQ ID NO: 18) 1075 48.15

[0104] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0105] -16-

[0106] GACAAGCAGACCTCAGCAACGATAAGAT (SEQ ID NO:

[0107] 21) 1075 46.43

[0108] GAGACAAGCAGACCTCAGCAACGATAAGA (SEQ ID NO:

[0109] 22) 1073 48.28

[0110] GCTGGAATTCGTATGACGGAGTCTTATCT (SEQ ID NO:

[0111] 23) 1145 44.83

[0112] The miRNA, siRNA, and / or shRNA may comprise modified nucleic acids. In some embodiments, the miRNA, siRNA, and / or shRNA comprises at least one modified nucleic acid selected from pseudouridine, 5-methylcytodine, 2-thio-uridine, 5-methyluridine-5’ -triphosphate, 4-thiouridine-5’ -triphosphate, 5,6-dihydrouridine-5’- triphosphate, and 5-azauridine-5’-triphosphate. In some embodiments, the miRNA, siRNA, and / or shRNA comprises two or more modified nucleic acids selected from pseudouridine, 5-methylcytodine, 2-thio-uridine, 5-methyluridine-5’-triphosphate, 4- thiouridine-5’ -triphosphate, 5,6-dihydrouridine-5’-triphosphate, and 5-azauridine-5’- triphosphate.

[0113] In some embodiments, the miRNA, siRNA and / or shRNA are delivered by means known in the art, such as those described in Yang, Ningning ("An overview of viral and nonviral delivery systems for microRNA." International journal of pharmaceutical investigation 5.4 (2015): 179), hereby incorporated by reference. In some embodiments, the delivery system includes the viral vectors already disclosed which comprise nucleic acids encoding the miRNA, siRNA or shRNA. In some embodiments, the delivery system includes non-viral vectors, polymer nanocarriers, exosomes, and so forth, which are known in the art and / or are commercially available. Particular mention is made of 1) lipoplexes comprising LIPFECTAMINE RNAI- MAX, SILENTFECT, DHARMAFECT, SIPORT, and a combination of DOTMA, cholesterol and TPGS or DSPE-PEG-OMe, 2) polyplexes comprising polyethylenimine, poly(lactide-co-glycolide), poly(amidoamine) dendrimers, or cellpenetrating peptides including poly-lysine or arginine rich peptides, and 3) inorganic vectors including gold nanoparticles, gold nanoparticles conjugated with PEG, Fe3O4- based nanoparticles, and silica-based nanoparticles. In some embodiments, the non-

[0114] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0115] -17- viral vectors comprise ligands or targeting moieties known in the art or described herein which facilitate binding of the non- viral vectors to a target organ, tissue, cell or region of the body.

[0116] In one aspect of the invention, the method comprises administering to a subject a composition comprising a synthetic small molecule capable of inhibiting or reducing the activity or expression of BAMBI. A synthetic small molecule for purposes of this disclosure is defined as a chemically synthesized compound with a molecular weight of less than 1,000 g / mol. In certain embodiments, the small molecule has a molecular weight of less than 900 g / mol, 850 g / mol, 700 g / mol, 650 g / mol, 600 g / mol, 550 g / mol, 500 g / mol, 450 g / mol, 400 g / mol, or 350 g / mol. Synthetic small molecules useful in this invention include those capable of blocking interaction between BAMBI and at least one of a TGF-B superfamily ligand, SMAD7, or a type I or II TGF-B / BMP receptor. In some embodiments, the small molecule is a compound identified as a BAMBI inhibitor candidate via a screening assay described herein.

[0117] In one aspect of the invention, the method comprises administering to a subject a composition comprising an anti-sense oligonucleotide (ASO) capable of inhibiting or reducing the activity or expression of BAMBI. Methods of designing ASOs to reduce the activity or expression of a gene product will be familiar to one of ordinary skill in this field, such as those described in Kim, Yeonjoon ("Drug discovery perspectives of antisense oligonucleotides" Biomolecules & therapeutics 31.3 (2023): 241), incorporated herein by reference. In some embodiments, the ASO is selected from a phosphorothioate oligodeoxynucleotide (PS-ODN), 2’ methoxyethyl RNA (MOE) gapmer, a bridged nucleic acid (BNA), such as a locked nucleic acid (LNA) gapmer or constrained ethyl (CeT) gapmer, and occupancy-only oligonucleotide.

[0118] In some embodiments, the ASO targets a splicing enhancer sequence adjacent to an intron / exon junction of BAMBI pre-RNA, thereby causing exon skipping and translation of a truncated or non-functional protein. In some embodiments, the ASO targets exon 1, exon 2, or exon 3 of BAMBI mRNA, resulting in degradation of the transcript by RNaseH. In some embodiments, the ASO is chemically modified. In some embodiments, the chemically modified ASO comprises a modified linker

[0119] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0120] -18- selected from a phosphorothioate linker, a methyl phosphate linker, methoxypropyl phosphate linker and a mesyl phosphoramidate linker. In some embodiments, the chemically modified ASO comprises a modified nucleobase selected from 5- methylcytosine, 5-hydroxycytosine, 8-bromoguanine, and 8 -aminoguanine. In some embodiments, the ASO comprises a modified ribose with a 2’ substituent selected from methoxyethyl and methoxy, or comprises a bridged sugar compound or a phosphorodiamidate morpholino modification.

[0121] In certain aspects, the method comprises administering to a subject a composition comprising a peptide capable of inhibiting or reducing the activity or expression of BAMBI. In certain embodiments, the peptide is capable of blocking the interaction between BAMBI and Transforming Growth Factor-B Receptor 1 (TGFBR1). In some embodiments, the peptide is capable of blocking the interaction between BAMBI and a Transforming Growth Factor-B superfamily polypeptide selected from TGF-B1, TGF-B2, TGF-B3, Activin A, Activin B, BMP2, BMP4, BMP5, BMP6, BMP7, BMP8, BMP9, BMP10, BMP15, GDF1, GDF3, GDF4, GDF5, GDF6, GDF7, GDF8, GDF9, GDF11, inhibin, anti-Mullerian hormone (AMH), and Nodal. Processes for designing and screening peptides according to the invention are described in Mason, Jody M. ("Design and development of peptides and peptide mimetics as antagonists for therapeutic intervention." Future medicinal chemistry 2.12 (2010): 1813-1822), incorporated herein by reference. In some embodiments, the peptide is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 or more amino acid residues long. In certain embodiments, the peptide is identified as a candidate for inhibiting or reducing the activity or expression through use of protein-fragment complementation assays, Phage display, ribosome display, mRNA display, or CIS- display. In some embodiments, the peptide is a peptide which is secreted by a cell. In some embodiments, the peptide is a retro-inverso peptide formed from d-amino acids.

[0122] In one aspect, the method comprises administering to a subject a composition comprising an antibody or a functional fragment thereof capable of inhibiting or reducing the activity or expression of BAMBI. Antibodies according to the invention may be polyclonal antibodies or monoclonal antibodies, which selectively bind to

[0123] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0124] -19-

[0125] BAMBI. In some embodiments, the antibody selectively binds to an amino acid sequence that forms part of a polypeptide having at least 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity to SEQ ID NO: 1. In some embodiments, the antibody selectively binds to an amino acid sequence that forms part of a polypeptide having at least 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity to SEQ ID NO: 2. In some embodiments, the antibody selectively binds to an amino acid sequence that forms part of a polypeptide having at least 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity to SEQ ID NO: 3. In some embodiments, the antibody selectively binds to an amino acid sequence that forms part of a polypeptide having at least 60%, 65%, 70%, 75%, 80%, 85%, 87.5%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity to SEQ ID NO: 4. Methods of raising antibodies to the recited amino acid sequences are known in the art.

[0126] In some embodiments, the antibody is an antibody which is commercially available. For example, the antibody according to the invention may be selected from an antibody provided in Table 2. In some embodiments, the antibody according to the invention may comprise an antibody containing one or more complementary determining regions (CDRs) of an antibody provided in Table 2, or one or more CDRs substantially similar to a CDR of an antibody of Table 2. For purposes of this application, a CDR substantially similar to a comparison CDR is a CDR which shares at least 95% identity with the comparison CDR. In some embodiments, where the agent comprises a functional fragment of an antibody, the functional fragment comprises a functional fragment of an antibody of Table 2. In some embodiments, the antibody does not have a heavy chain variable region encoded by the nucleic acid sequence of SEQ ID NO: 24 or 25. In some embodiments, the antibody does not have a light chain variable region encoded by the nucleic acid sequence of SEQ ID NO: 26 or 27.

[0127] Table 2

[0128] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0129] -20-

[0130] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0131] -21-

[0132] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0133] -22-

[0134] When the antibody or antibody fragment is intended for delivery into the central nervous system, the antibody or functional fragment thereof may be modified to more easily penetrate the blood brain barrier (i.e. CNS -penetrating antibody or antibody fragment). Methods for modifying the antibody or antibody fragment are not particularly limited, insomuch as they substantially preserve the ability of the antibody or antibody fragment to bind to BAMBI. Methods for modifying the antibody or antibody fragment to be more CNS penetrant are described in Chacko, Ann-Marie, et al. ("Targeted delivery of antibody-based therapeutic and imaging agents to CNS tumors: crossing the blood-brain barrier divide." Expert opinion on drug delivery 10.7 (2013): 907-926), incorporated herein by reference. In some embodiments, the antibody or antibody fragment may be cationized to improve CNS penetration by conjugation of the antibody or antibody fragment with cationic polymers. Such cationic polymers may include hexamethylenediamine or tetramethylenediamine. In some embodiments the antibody or antibody fragment may be modified with a ligand recognized by a receptor expressed on the surface of the blood brain barrier capable of receptor-mediated transcytosis of the bound ligandantibody conjugate. Ligands of receptors expressed on the BBB which may be utilized for receptor-mediated transcytosis include receptors already disclosed above. Exemplary ligands include transferrin, melanotransferrin (p97), insulin, low-density

[0135] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0136] -23- lipoproteins, lactoferrin, receptor-associated protein (RAP), tissue plasminogen activator (tPA), secreted amyloid precursor protein, leptin, thiamine, glutathione, enkephalin or enkephalin analogue, RVG peptide, and cell penetrating peptides, such as transduction domain of human immunodeficiency virus type- 1 (TAT).

[0137] When forming the antibody / fragment-ligand conjugate, care will be taken not to reduce immunoreactivity of the antibody or fragment thus conjugated. In some embodiments, the ligand is conjugated to a position that is outside an antibody / fragment - BAMBI binding interface. In some embodiments, the ligand is attached to the antibody or antibody fragment with a cleavable linker, which is capable of cleavage subsequent receptor-mediated transcytosis of the antibody-ligand conjugate.

[0138] When the antibody or antibody fragment is intended for delivery to a human, the antibody may be humanized. Methods for humanizing antibodies are described in Safdari, Yaghoub, et al. ("Antibody humanization methods-a review and update." Biotechnology and. Genetic Engineering Reviews 29.2 (2013): 175-186), Almagro, Juan C., and Johan Fransson. ("Humanization of antibodies." Front Biosci 13.1 (2008): 1619-33), and Rossotti, Martin A., et al. "Immunogenicity and humanization of single-domain antibodies." The FEBS Journal 289.14 (2022): 4304- 4327), all of which are incorporated herein by reference. In some embodiments, CDR grafting may be employed to graft anti-BAMBI CDR(s) of a non-human antibody onto a human framework. In some embodiments, a non-human antibody is humanized by resurfacing antigenic surface residues to human residues common at these residues.

[0139] When formulating the composition according to the invention, a dose of the agent will be selected that is effective to treat or prevent a disease or disorder or ameliorate a symptom of the disease or disorder in a subject in need thereof. For purposes of this application, “treat”, “treating”, or “treated” are defined to encompass reduction or elimination of one symptom of the disease or disorder, amelioration or resolution of one underlying cause of the disease or disorder, and up to and including cure of the disease or disorder for a period of time. The terms “prevent”, “preventing”, “prevention”, and “prevented” are defined as encompassing the absence of one or more symptoms of a disease or disorder in a subject for a period of time.

[0140] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0141] -24-

[0142] The effects of treatment and / or prevention may last for a period of time to include one or more days, weeks, months, and years or may last the rest of the natural lifetime of the subject.

[0143] When the method or composition comprise a non-retroviral vector, the effective dose falls within the range of 1 x 107viral genomes (vg) / kg to 1.0 x 1015vg / kg. In some embodiments, the effective dose is approximately 1.0 x 107vg / kg, 5.0 x 107vg / kg, 1.0 x 108vg / kg, 5.0 x 108vg / kg, 1.0 x 109vg / kg, 5.0 x 109vg / kg, 1.0 x

[0144] 1010vg / kg, 5.0 x 1010vg / kg, 1.0 x 1011vg / kg, 2.5 x 1011vg / kg, 5.0 x 1011vg / kg, 7.5 x

[0145] 1011vg / kg, 1.0 x 1012vg / kg, 2.5 x 1012vg / kg, 5.0 x 1012vg / kg, 7.5 x 1012vg / kg, 1.0 x

[0146] 1013vg / kg, 2.5 x 1013vg / kg, 5.0 x 1013vg / kg, 7.5 x 1013vg / kg, 1.0 x 1014vg / kg, or 1.0 x 1015vg / kg. In some embodiments, the effective dose is approximately 1.0 x 107vg / kg to approximately 1.0 x 108vg / kg, approximately 5.0 x 107vg / kg to approximately 5.0 x 108vg / kg, approximately 1.0 x 109vg / kg to approximately 1.0 x

[0147] 1010vg / kg approximately 5.0 x 109vg / kg to approximately 5.0 x IO10vg / kg, approximately 1.0 x 1011vg / kg to approximately 1.0 x 1012vg / kg, approximately 2.5 x

[0148] 1011vg / kg to approximately 2.5 x 1012vg / kg, approximately 5.0 x 1011vg / kg to approximately 5.0 x 1012vg / kg, approximately 7.5 x 1011vg / kg to approximately 7.5 x

[0149] 1012vg / kg, approximately 1.0 x 107vg / kg to approximately 5.0 x 109vg / kg, approximately 1.0 x IO10vg / kg to approximately 5.0 x 1012vg / kg, approximately 5.0 x 107vg / kg to approximately 2.5 x 1013vg / kg, approximately 1.0 x 108vg / kg to approximately 1.0 x 1014vg / kg, approximately 5.0 x 108vg / kg to approximately 7.5 x 1012vg / kg, or approximately 1.0 x 109vg / kg to approximately 1.0 x 1015vg / kg. In some embodiments, the composition is in the form of a unit dose.

[0150] When the method or composition comprise retroviral vectors, the effective dose falls within the range of 1 x 103transduction units (TU) / kg to 1.0 x 1010TU / kg. In some embodiments, the effective dose is approximately 1.0 x 103TU / kg, 5.0 x 103TU / kg, 1.0 x 104TU / kg, 2.5 x 104TU / kg, 5.0 x 104TU / kg, 7.5 x 104TU / kg, 1.0 x 105

[0151] TU / kg, 2.5 x 105TU / kg, 5.0 x 105TU / kg, 7.5 x 105TU / kg, 1.0 x 106TU / kg, 2.5 x 106

[0152] TU / kg, 5.0 x 106TU / kg, 7.5 x 106TU / kg, 1.0 x 107TU / kg, 5.0 x 107TU / kg, 1.0 x 108

[0153] TU / kg, 5.0 x 108TU / kg, 1.0 x 109TU / kg, 5.0 x 109TU / kg, or 1.0 x IO10TU / kg. In some embodiments, the effective dose is approximately 1.0 x 103TU / kg to approximately 1.0 x 104TU / kg, approximately 2.5 x 103TU / kg to approximately 2.5 x

[0154] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0155] -25-

[0156] 104TU / kg, approximately 5.0 x 103TU / kg to approximately 5.0 x 104TU / kg, approximately 7.5 x 103TU / kg to approximately 7.5 x 104TU / kg, approximately 1.0 x

[0157] 107TU / kg to approximately 5.0 x 109TU / kg, approximately 1.0 x 104TU / kg to approximately 5.0 x 106TU / kg, approximately 5.0 x 107TU / kg to approximately 2.5 x 109TU / kg, approximately 1.0 x 104TU / kg to approximately 1.0 x 105TU / kg, approximately 5.0 x 108TU / kg to approximately 7.5 x 109TU / kg, or approximately 1.0 x 105TU / kg to approximately 1.0 x 108TU / kg, approximately 1.0 x 107TU / kg to approximately 1.0 x 108TU / kg, approximately 5.0 x 107TU / kg to approximately 5.0 x

[0158] 108TU / kg, approximately 1.0 x 109TU / kg to approximately 1.0 x 1010TU / kg . In some embodiments, the composition is in the form of a unit dose.

[0159] In some embodiments, the dose is one effective to induce remyelination in a subject suffering with a disease or disorder of the peripheral or central nervous system characterized by demyelination. In some embodiments, the dose of the agent is effective to halt demyelination or reduce the risk of developing a disease or disorder characterized by demyelination. In certain embodiments, the disease or disorder typically has an onset at a certain age or stage of life. In these circumstances, the administration of the agent may occur immediately before an anticipated onset of the disease and / or the initial demyelination. In some embodiments, the disease or disorder may have a late onset, and the initial administration may occur at age 45 or later, 50 or later, 55 or later, 60 or later, 65 or later, 70 or later, 75 or later, or 80 or later. In some embodiments, the administration commences when demyelination has been discovered, but before symptoms of the demyelinating disease or disorder have manifested. In some embodiments, demyelination is assessed by levels of a biomarker obtained from the CSF and / or serum, or through radiological approaches, such as MRI (e.g. T2 weighted imaging using FSE / fluid attenuation inversion recovery (FLAIR), contrast agents, etc.), DTI, or MTI. Such biomarkers may include assessment of levels of neurofilament light and heavy chain, AQP4 antibodies, glial fibrillary acid protein, calcium binding protein SIOOB, chitinase- 3 -like protein 1, CXCL13, N-acetyl aspartate, galectin-9, osteopontin, chemokines (e.g. CCL11, CCL10, CCL2, CCL3, CCL4, CCL5), cytokines (e.g. IL-6), HERV-W peptides, Tau, vitamin D, complement system (C4d, C5-C9, C3 / C4), Kappa and lambda free light chains, and oligoclonal bands.

[0160] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0161] -26-

[0162] In some embodiments, the dose of the agent is administered in an amount effective to induce neurogenesis. In some embodiments, the dose of the agent is administered in an amount to increase vascularization of neural tissues. In some embodiments, the dose of the agent is administered in an amount to increase expression of neuronal activity markers. In some embodiments, the dose of the agent is administered in an amount to increase TGF-B signaling. In particular, the dose of the agent is an amount effective to increase TGF-B signaling in relevant cells and / or tissues by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350%, 400% or more. In some embodiments, the dose of the agent is administered in an amount to increase levels of phosphorylated SMAD. In some embodiments, the dose of the agent is an amount effect to increase phosphorylated SMAD in a relevant cell or tissue by 5%, 10%, 15%, 20%, 25%, 30%, 35%. 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350%, 400% or more.

[0163] In the method, the treatment or prevention of a disease or disorder of the central or peripheral nervous system involves the treatment, prevention or amelioration of a symptom of a neurovascular disorder, a neurodegenerative disorder, a disease or disorder associated with old age, or a disease or disorder characterized by demyelination. In some embodiments, the disease or disorder of the central or peripheral nervous system is selected from the group consisting of Huntington’s disease, Alzheimer disease, amyotrophic lateral sclerosis, Parkinson’s disease, multiple sclerosis, clinically isolated demyelinating syndrome (CIS), neuromyelitis optica, acute-disseminated encephalomyelitis, leukoencephalopathies, acute transverse myelitis, Balo’s concentric sclerosis, cerebrotendinous xanthomatosis, Fabry’s disease, HIV encephalitis, herpes simplex encephalitis, mitochondrial encephalopathy, Behcet’s disease with CNS involvement, neuropsychiatric systemic lupus erythematosus, progressive multifocal leukoencephalopathy, subacute sclerosing panencephalitis, Pelizaeus-Merzbacher disease, peripheral neuropathy, diabetic neuropathy, and chemotherapy-induced neuropathy.

[0164] The route for administering the composition comprising an agent according to the invention is not particularly limited, and includes those methods known in the art,

[0165] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0166] -27- and / or described herein. In some embodiments, the compositions can be administered systemically or locally. In some embodiments, the composition is administered intraperitoneally, subcutaneously, intramuscularly, retro orbitally, intranasally, via inhalation, intravascularly, intrathecally, or intravenously. In some embodiments, the administering is by intrathecal administration. In some embodiments, the administering is by intravenous injection or retro orbital sinus injection. In some embodiments, the administering is via direct injection of tissue of the peripheral or central nervous system, or injection proximate said tissues.

[0167] Compositions and methods for delivery of an agent to a desired organ, tissue, cell or region of the body, such as the central or peripheral nervous system, are not limited, but include compositions, vehicles, and methods known in the art, and / or which are described herein. The compositions comprising the agent as disclosed herein may be formulated as a liquid, a suspension, a suspoemulsion, a gel, a solid, a powder, granules, oil-in-water emulsion, and a water-in-oil emulsion. In some embodiments the composition comprising the agent is formulated for injection by combining the nanoparticles, microparticles, viral vectors, non- viral vectors, exomes, complexes, antibodies, functional antibody fragments, small molecule, peptide, antisense oligonucleotides and / or or RNAi based agent with a liquid diluent recognized as safe for injection. Exemplary liquid diluents may include distilled or ultra-purified water, Ringer’s solution, lactated Ringer’s solution, a saline solution, such as phosphate-buffered saline (PBS), a dilute glucose solution, such as a 5% glucose aqueous solution, or a dilute alcohol or polyol aqueous solution, among others. In certain embodiments, the diluent is Water for Injection. In some embodiments, the diluent is PBS. In some embodiments, the diluent is an isotonic saline solution.

[0168] The composition may further comprise pharmaceutically acceptable excipients, such as those listed in the Handbook of Pharmaceutical Excipients (Handbook of Pharmaceutical Excipients, (2006) United Kingdom: Pharmaceutical Press). In some embodiments, selection of pharmaceutically acceptable excipients will be done with the goal to increase stability and effectiveness of the agent included in the composition. For example, buffers or pH adjusting agents may be selected to adjust the pH to less than 9, 8.5, 8, 7.8, 7.5. In some embodiments, the buffer is selected to increase the pH to greater than 3, 3.5, 4, 4.5, 4.8, 5, 5.5, 5.8, or 6.0. In

[0169] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0170] -28- some embodiments, the buffer and / or pH adjusting agent may be present at a concentration of 100 mM, 200 mM, 300 mM, 400 mM, 500 mM, 600 mM, 700 mM, 800 mM, 900 mM, or more. Buffers and pH adjusting agents include those which are commercially available and those disclosed herein. In some embodiments, the buffer and / or pH adjusting agent may comprise one or more of PBS, potassium phosphate, mono- or dibasic potassium phosphate, potassium chloride, potassium gluconate, potassium acetate, phosphoric acid or mixtures thereof, calcium chloride, calcium gluconate, calcium citrate, calcium carbonate, calcium lactate, calcium levulinate, calcium lactobionate, sodium acetate, sodium bicarbonate, sodium citrate, sodium lactate, sodium chloride, mono- or dibasic sodium phosphate, and mixtures thereof, HEPES, alkali earth hydroxides, alkali hydroxides, aluminum hydroxide, citric acid, and acetic acid. In some embodiments, the concentration of buffers and / or pH adjusting agents is selected to prevent aggregation of the viral vectors in solution. In some embodiments, a mixture of two, three, four, five or six of the above buffers are selected. In some embodiments, the composition comprises PBS in combination with magnesium chloride in a concentration of at least 300 mM, at least 400 mM, at least 500 mM, or at least 600 mM. In some embodiments, specific buffers and their concentrations will be selected to reduce pH shift during freezing, and / or will be combined with excipients which reduce the crystallization of the buffer on cooling / freezing. Such excipients include sucrose, fibrous disaccharides, seaweed sugar, cellobiose, mannitol or ionic cryoprotectants (e.g., TMAC1).

[0171] In some embodiments, the composition comprises one or more surface active agents and / or emulsifiers to enhance stability and efficacy of the composition comprising the agent, enhance penetration of cellular membranes and blood brain barrier, and to reduce adsorption of the viral vectors and agent onto surfaces used to prepare and administer the composition. In some embodiments, the surfactants are included in a concentration of 0.00001 w / v% to 3.0 w / v%., 0.0001 w / % to 1 w / v%, or 0.001 VI / N% to 0.5 The surface active agents are not particularly limited and include non-ionic, cationic, anionic and amphiphilic surfactants which are commercially available and those described herein. In some embodiments, the surface active agent may be sorbitan fatty acid esters, polyoxyethylene esters, sucrose fatty acid esters, polyethylene glycol fatty acid esters, polyoxyethylene ethers,

[0172] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0173] -29- nonionic triblock copolymers, such as poloxamers (e.g. P188) or pluronic copolymers, carbomers, high molecular weight alcohols, colloidal clays, natural emulsifiers (e.g. lecithin, cholesterol), diethylene glycol monolaurate, potassium oleate, sodium lauryl sulfate, benzalkonium chloride, cetylpyridinium chloride, among others. In some embodiments, the surface-active agent is combined with a buffer.

[0174] It will be appreciated by the ordinarily skilled artisan that the composition may comprise other pharmaceutically acceptable excipients to aid in formulating, preserving and administering the composition. For example, if the composition is to be frozen or lyophilized, cryoprotectants may be used to protect the stability and efficacy of the composition. The cryoprotectants utilized are not particularly limited and include those which are commercially available and those described herein. In some embodiments, the cryoprotectant is one or more of sucrose, lactose, glucose, mannitol, sorbitol, alginate, polyvinylpyrrolidone, ethylene glycol, propylene glycol, glycerol, hydroxy ethyl starch, and one or more salts. These cryoprotectants may include polyols, sugars, and salts, at a concentration between 0.5-55wt% of the composition. In addition, preservatives may be added to inhibit microbial growth and prevent oxidation of contents of the composition. Pharmaceutically acceptable excipients may also comprise osmolarity adjusting agents, solvents, vehicles, dispersion aids, suspension aids, as well as other excipients listed in Remington: the science and practice of pharmacy (Remington, Joseph Price, Vol. 1. Lippincott Williams & Wilkins, 2006).

[0175] In another aspect, methods for screening agents that selectively modulate the activity of Bone Morphogenic Protein and Activin Membrane Bound Inhibitor (BAMBI) are contemplated. In some embodiments, the method comprises exposing a cell expressing BAMBI or an organism comprising a cell which expresses BAMBI to a test agent selected from a small molecule, ASO, peptide, siRNA, shRNA, miRNA, and an antibody or antibody fragment, assessing whether the activity or expression of BAMBI has been modulated, and identifying the agent as a candidate agent when modulation of BAMBI activity or expression has been assessed. In some embodiments, the cell endogenously produces BAMBI. In some embodiments, the cell has been engineered to overexpress BAMBI. Overexpression of BAMBI in cells may be accomplished by means known in the art, or as described herein. Such means

[0176] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0177] -30- include use of integrating retroviral vectors which comprise a nucleic acid sequence encoding BAMBI, operably linked to a constitutive or inducible promoter. In some embodiments, the viral vector comprises elements of the lentiviral vector depicted in Figure 2. In other embodiments, overexpression of BAMBI in cells may be accomplished through gene editing techniques, including transducing the cells with one or more viral vectors comprising nucleic acids encoding a Cas protein, gRNAs, and a template nucleic acid sequence which encodes BAMBI, operably linked to a constitutive or inducible promoter.

[0178] Methods for exposing the cell to a test agent are not particularly limited, and include those known in the art, and those described herein. In some embodiments, the cell is exposed to a test agent in vitro or ex vivo, such as by adding the test agent or a delivery vehicle or vector containing or encoding the agent to culture media of the cell. In vitro or ex vivo contacting of the cell by the agent may be facilitated by electroporation or through microinjection into the cytoplasm or nucleus of the cell.

[0179] In some embodiments, the cell is a cell of an organism, and contacting the cell is achieved in vivo. In some embodiments, the in vivo contacting of the cell is accomplished by delivery of the agent or delivery vehicle or vector containing or encoding the agent intraperitoneally, subcutaneously, intramuscularly, retro orbitally, intranasally, via inhalation, intravascularly, intrathecally, intravenously or by direct injection of a tissue comprising the cell or injection of a tissue proximate the cell. In some embodiments, the administering is by intrathecal administration.

[0180] In some embodiments, the cell or organism is selected as a model for a disease or disorder of the central or peripheral nervous system. In some embodiments, the disease of the central or peripheral nervous system is a neurodegenerative or neurovascular disease or disorder, or a disease or disorder characterized by demyelination. In some embodiments, the cell or organism is a model for old age, Huntington’s disease, Alzheimer disease, amyotrophic lateral sclerosis, Parkinson’s disease, multiple sclerosis, clinically isolated demyelinating syndrome (CIS), neuromyelitis optica, acute-disseminated encephalomyelitis, leukoencephalopathies, acute transverse myelitis, Balo’s concentric sclerosis, cerebrotendinous xanthomatosis, Fabry’s disease, HIV encephalitis, herpes simplex encephalitis, mitochondrial encephalopathy, Behcet’s disease with CNS involvement,

[0181] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0182] -31- neuropsychiatric systemic lupus erythematosus, progressive multifocal leukoencephalopathy, subacute sclerosing panencephalitis, Pelizaeus-Merzbacher disease, peripheral neuropathy, diabetic neuropathy, and chemotherapy-induced neuropathy. In some embodiments, the cell is an oligodendrocyte (OLG) or oligodendrocyte precursor cell (OPC).

[0183] In some embodiments, an agent is identified as a candidate for treating a disease or disorder of the central or peripheral nervous system when the activity or expression of BAMBI has been assessed as blocked, reduced or inhibited. In some embodiments, an agent is identified as a candidate for treating a disease or disorder of the central or peripheral nervous system when TGF-B signaling is assessed as increased. In some embodiments, an increase in phosphorylated SMAD is indicative of the agent blocking, reducing, or inhibiting BAMBI activity or expression. In some embodiments, an increase in phosphorylated SMAD is indicative of an increase in TGF-B signaling. In some embodiments, an agent is identified as a candidate when proliferation and / or differentiation of oligodendrocyte lineage cells is assessed in response to contacting the cell with the agent. In some embodiments, assessment of proliferation involves In vitro EdU assays, immunocytochemistry and quantification for Olig2 and Pdgfra. In some embodiments, assessment of differentiation comprises culturing agent contacted OPCs in differentiation-promoting conditions and measuring one or more markers selected from MBP, CNPase, and MOG. In other embodiments, an agent may be assessed as a candidate for treating a disease of the central or peripheral nervous system when remyelination is observed after administration thereof to an animal that serves as a model for a demyelinating disease or disorder.

[0184] In some embodiments, high throughput screening assays may be employed to determine if BAMBI activity or expression is inhibited or blocked. Such high throughput screen assays will be known to those in the art, and include the assays described in Korn, Kerstin, and Eberhard Krausz ("Cell-based high-content screening of small-molecule libraries." Current opinion in chemical biology 11.5 (2007): 503- 510), Korn, Kerstin, and Eberhard Krausz ("Cell-based high-content screening of small-molecule libraries." Current opinion in chemical biology 11.5 (2007): 503-510), Varma, Hemant, Donald C. Lo, and Brent R. Stockwell ("High throughput screening

[0185] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0186] -32- for neurodegeneration and complex disease phenotypes." Combinatorial chemistry & high throughput screening 11.3 (2008): 238-248), and Simard, Jeffrey R., et al.

[0187] ("High-throughput quantitative assay technologies for accelerating the discovery and optimization of targeted protein degradation therapeutics." SLAS DISCOVERY: Advancing the Science of Drug Discovery 26.4 (2021): 503-517), incorporated herein by reference. In some embodiments, the high throughput screen is a HiBiT assay. Briefly, in some embodiments the BAMBI gene of the test cell will be modified to insert a nucleic acid sequence which encodes an 11 -amino acid HiBiT peptide tag.

[0188] The insertion can be made at a location of the BAMBI gene that encodes either the C- terminus or N-terminus. After the cell is contacted with the agent, the cell is lysed and a complementary LgBiT protein is added, whereupon luciferase is reconstituted when the HiBiT tag and complementary LgBiT protein are present. A luminescence signal is generated proportional to the amount of BAMBI present in cell lysate. Thus, in some embodiments, an agent is identified as a candidate for inhibiting or reducing BAMBI expression when reduced or no luminescence is assessed in the cell lysate, compared to the cell lysate of a cell which was not exposed to the agent.

[0189] 4937-2667-9899, v. 1 Sequences

[0190] SEQ ID NO: 1 - Human BAMBI

[0191] 1 mdrhssyifi wlqlelcama vlltkgeirc ycdaahcvat gymckselsa cfsrlldpqn

[0192] 61 snsplthgcl dslasttdic qakqarnhsg ttiptlecch edmcnyrglh dvlspprgea

[0193] 121 sgqgnryqhd gsrnlitkvq eltsskelwf raaviavpia gglilvllim lalrmlrsen

[0194] 181 krlqdqrqqm Isrlhysfhg hhskkgqvak Idlecmvpvs ghenccltcd kmrqadlsnd 241 kilslvhwgm ysghgklefv

[0195] SEQ ID NO: 2 - Human BAMBI (extracellular domain)

[0196] 1 vlltkgeirc ycdaahcvat gymckselsa cfsrlldpqn snsplthgcl dslasttdic

[0197] 61 qakqarnhsg ttiptlecch edmcnyrglh dvlspprgea sgqgnryqhd gsrnlitkvq 121 eltsskelwf ra

[0198] SEQ ID NO: 3 - Mouse BAMBI

[0199] 1 mdrhssyffi wlqlelcama vlltkgeirc ycdaahcvat gymckselsa cfsrlldpqn

[0200] 61 tnsplthgcl dslastadic rakqaqnhsg pamptlecch edmcnyrglh dvlspsksea

[0201] 121 sgqgnryqhd ssmlitkmq eltsskelwf raaviavpia gglilvllim lalrmlrsen

[0202] 181 krlqderqqm Isrlhysfhg hhskkgqvak Idlecmvpvs gqenccltcd kmrqaelsne 241 kilslvhwgm ysghgklefi

[0203] SEQ ID NO: 4 - Mouse BAMBI (extracellular domain)

[0204] 1 eircycdaah cvatgymcks elsacfsrll dpqntnsplt hgcldslast adicrakqaq

[0205] 61 nhsgpamptl ecchedmcny rglhdvlsps kseasgqgnr yqhdssrnli tkmqeltssk 121 elwfra

[0206] SEQ ID NO: 5 - Human BAMBI

[0207] 1 gggctggcgc gggcgggagc tgcggcggat acccttgcgt gctgtggaga ccctactctc

[0208] 61 ttcgctgaga acggccgcta gcggggactg aaggccggga gcccactccc gacccggggc

[0209] 121 tagcgtgcgt ccctagagtc gagcggggca agggagccag tggccgccga cgggggaccg 181 ggaaactttt ctgggctcct gggcgcgccc tgtagccgcg ctccatgctc cggcagcggc 241 ccgaaaccca gccccgccgc tgacggcgcc cgccgctccg ggcagggccc atgccctgcg 301 cgctccgggg gtcgtaggct gccgccgagc cggggctccg gaagccggcg ggggcgccgc 361 ggccgtgcgg ggcgtcaatg gatcgccact ccagctacat cttcatctgg ctgcagctgg 421 agctctgcgc catggccgtg ctgctcacca aaggtgggtg ccgggggcgc acggggcccg Docket No. HRVY-253-WO1

[0210] -34-

[0211] 481 gggtcccgtc ctcgccgcgg ggctttggag ccggctgcag aggctttgtt agcggcaggc 541 gaggctccct cctgcgccgg agccgcaggt cgcgacaagt tgctgtgttc ttagaagtcg 601 cggcggtggc ctggcgcgtg gatgcggact ccgatctaag ggcaggcgct gatcagaggg 661 tcctcctggc tctgcctgcg gggagcggcg cgtttgcagc ccagcgggga gcggggccgg 721 agtctcggcc tcgacgccgc cgcttccgca ccctgggggc tcgggcggcc gggaggaatc 781 gcagatcctg gcctgtagct gccgcgtgcc ctcagcgtgt ctgtgtgagt gcctcagggt 841 gtatttctgt gagtgtgtct ctgagtctca gtatccctaa atgcattttt gtgtctctga 901 gtgtcgttgt gtttctgaaa gtgtgtctga acctctgtat cactcagcgt atctctgtgt 961 ctctttgaat gtatctctga atgcatttct gtgtctcttt ctgagtcttt gtgtctctga 1021 atgtgtgagt ctctgtatct ctgatcttga gtgtgtcttt ctgaatgcat ttctgtgtct 1081 gtctctaagt gtctttgtat ctctgaatgt gcatctgagt ctctgtgtga gtgtgtctct 1141 gcgtacatct ctctgtgtgc gagcgagtgt gtgggtctcc ctgagagttt aggtgtccga 1201 ggtgtgcaga agtgtgtgtt gtgttgcttt tcagcagccg ggaggagtag gctctgtcag 1261 cgtctcactg ccactcacct catattttac aaacaggacc aaaaaaaaaa aaaaggcagc 1321 gggtcagttt cttctttcct ctgcaggctt tcacctttta gaaagaaata acccgaactg 1381 tctccgaatt tcaaggttct cctcacctcc ctgctgtgaa atctacctac tgttctgtga 1441 acagataatt tttttaagta ggaagcagtt tagtctttgc agccccctac ttctctttaa 1501 ttgctatgta gcaggcatga ggttaaagca taagctagcc cagcgaggat gatgtgctac 1561 agtatttatt tattttggaa ggaagggtgt aattaaccct aaataacagc ccttgtggct 1621 tgcagagggg agcctcctgg ccctatcaaa ggcgggcaga acagggaggg actgaggctg 1681 acatgaagtc acagataccg aaactatgtg cctgataatg atataattag gggatcagag 1741 atttctgacg gctgcggact tcaaaagctt taaaagaagc cagcagtctc tcctgtagcc 1801 atcttgacta aagcagacat ttttgtttaa tcactacata cagtaacgag aaggggacag 1861 aaacagaagg gcattgttcc acagtttcaa aataccagtc ccctttctgg ccttttgcat 1921 gccacaggaa gaaactttat gaacgacaga aatatagttt taatacagtg gtacaaaagt 1981 ccattctcct tgcttaaaat gtggctccaa ttaaaaaaaa aaggtagtta gaactttccc 2041 agttacctgt caaaatttta ttaggctgtt tttaggtcat tgaaaatagg ctctcataaa 2101 catttaagca gcattttact tgtattcagt cttccttttc tgtacaaggt ctgaagctaa 2161 tagggtcaaa atgggctttt aatctgtttt atttatactt taaatctata tatggaattt 2221 gtcaaactag ggatatgtag tcatcacccc agaagactgg tgagctttat gtggaaaata 2281 aagtgagctt ggagggagga ggagaaagag cagagaagtg gttctgcaaa gcaaggttct 2341 tacttgaagc agagaaggaa cttgggccca accagtgcag atttaggagc aagaccccta

[0212] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0213] -35-

[0214] 2401 gctttggact gttaagggtt gccaaagatc tgtgtttagc gggctggttt tccttagaac

[0215] 2461 cgaagcatta gcagcgtccg gtgaaaactg agcatacaat accgtggtct ggaatttgga

[0216] 2521 cagataatta aatgagacac cttactgggg cgttcagaga gagggggaag aataaaggta

[0217] 2581 agggtgggaa gaggtttgta aaacagcaga tcccggtgtt taatttcaga gtggaggttt

[0218] 2641 cggatcttca gacgggaaac tggaagaggc gtgtgcatta gtttagttta ctcgctgtgg

[0219] 2701 catgtgacag cgaccagggt ccactaggtg gatattgtat tagtgagaac ttgaagaccc

[0220] 2761 agattatttc aacgagaaac tgatattaaa gcctccaatc ttgccctgcg acaaaatgtg

[0221] 2821 aacggagcca tgcaactcac aaaataagtt tttataaagg aaacttttaa tcacttcctg

[0222] 2881 tagaaaattt gaggtttcct taaggatttt tcattcaacc agcagaggat tttcagtttc

[0223] 2941 agtgtttccc cttttagatc acatgtcgaa ttacatgtaa aacttgtgag gaggaggagg

[0224] 3001 agaagttagc cttgcagttt tatactcccc ccacctttta tgactttcca tttgggctga

[0225] 3061 aagaaattga ctttggcaag caaaccacta attgtaaact gcctagttcc tgttttacaa

[0226] 3121 tatactgact aaaagctcct ctgcatgaaa agatctttat aggcaaaaag tttgcctttt

[0227] 3181 ctagagaggt tgcaaatagc tgcctagttt catagtttta aaacctcctg acctgggcag

[0228] 3241 tttctagatt gttgtgtttc tagttaataa ctttataagg tgttagctaa agctcttaac

[0229] 3301 tcttggtgca gtcctgtggg atagtaaaca attcagtagt tccgatcaaa tatttatact

[0230] 3361 gacaaaatca aaaagcctaa catttttatg ttgtatggtc atgtaggatt aaaatgaata

[0231] 3421 aataatgtgt tataccttat ggtaggagaa attatactca ttactatttc cttcaaaaag

[0232] 3481 caaaagtttt tttaaaatga ctctaaactc ctcagaaacc tgctattggg attactacat

[0233] 3541 tgccaaaatg acgtttaact ggattgaaac ttacgcactg gctgcaggaa gggcttctcc

[0234] 3601 aggctctgta gactggagcc ctcagcttgg atgatctaaa agttcatgcc tttgaatttg

[0235] 3661 ggatttagca gttgcctaaa tagttgcttt atctggtctc tggagcagag tttgaggtgg

[0236] 3721 tttctcattg ttttcaggtg aaattcgatg ctactgtgat gctgcccact gtgtagccac

[0237] 3781 tggttatatg tgtaaatctg agctcagcgc ctgcttctct agacttcttg atcctcagaa

[0238] 3841 ctcaaattcc ccactcaccc atggctgcct ggactctctt gcaagcacga cagacatctg

[0239] 3901 ccaagccaaa caggcccgaa accactctgg caccaccata cccacattgg aatgctgtca

[0240] 3961 tgaagacatg tgcaattaca gagggctgca cgatgttctc tctcctccca ggggtgaggc

[0241] 4021 ctcaggtagg tggaagccgt ttctaaccag aatgcctgcc tgatctatag acttgtgaca

[0242] 4081 gccacgactt tgtatgtctg ctattgattt tgttgttaat gtaattagag acaccagagg

[0243] 4141 gagaagcctg gctggatgca aagatgcatc ttgattgagt ggcttttatg tctgagcatt

[0244] 4201 agatgtctgt ctacataata ggttttgcct gttttttcaa cattttgaag acattaaaag

[0245] 4261 gccattacat ctcagtaatg acagtctgta aacaaatgcg tttgtaagct tcttcagata

[0246] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0247] -36-

[0248] 4321 gttttgcaat gttttctaaa tatcgttgat ttaattgtaa gcttcttttt aatggaattc

[0249] 4381 ttggttaaaa tgaattgatg attatgaata tccctaggag gagttagcat ggagtttgat

[0250] 4441 cattttcttt gtactccttt aggacaagga aacaggtatc agcatgatgg tagcagaaac

[0251] 4501 cttatcacca aggtgcagga gctgacttct tccaaagagt tgtggttccg ggcagcggtc

[0252] 4561 attgccgtgc ccattgctgg agggctgatt ttagtgttgc ttattatgtt ggccctgagg

[0253] 4621 atgcttcgaa gtgaaaataa gaggctgcag gatcagcggc aacagatgct ctcccgtttg 4681 cactacagct ttcacggaca ccattccaaa aaggggcagg ttgcaaagtt agacttggaa 4741 tgcatggtgc cggtcagtgg gcacgagaac tgctgtctga cctgtgataa aatgagacaa 4801 gcagacctca gcaacgataa gatcctctcg cttgttcact ggggcatgta cagtgggcac 4861 gggaagctgg aattcgtatg acggagtctt atctgaacta cacttactga acagcttgaa 4921 ggccttttga gttctgctgg acaggagcac tttatctgaa gacaaactca tttaatcatc 4981 tttgagagac aaaatgacct ctgcaaacag aatcttggat atttcttctg aaggattatt 5041 tgcacagact taaatacagt taaatgtgtt atttgctttt aaaattataa aaagcaaaga 5101 gaagactttg tacacactgt caccagggtt atttgcatcc aagggagctg gaattgagta 5161 cctaaataaa caaaaatgtg ccctatgtaa gcttctacat cttgatttat tgtaaagatt 5221 taaaagaaat atatatattt tgtctgaaat ttaatagtgt ctttcataaa tttaactggg 5281 aaacgtgaga cagtacatgt taattataca aatggccatt tgctgttaat aatttgttct 5341 caactctagg atgtggcttg gttttttttt ttctcttttc ttttttaaac aagaccaaga

[0254] 5401 tcttgcttat tc

[0255] SEQ ID NO: 6 - siRNA 1

[0256] 1 gtgaaattcg atgctactgt

[0257] SEQ ID NO: 7 - siRNA 2

[0258] 1 gacctcagca acgataagat

[0259] SEQ ID NO: 8 - siRNA 3

[0260] 1 gatcctctcg cttgttcact

[0261] SEQ ID NO: 9 - siRNA 4

[0262] 1 ggaagctgga attcgtatga

[0263] SEQ ID NO: 10 - siRNA 5

[0264] 1 ggtgaaattc gatgctactg t

[0265] SEQ ID NO: 11 - siRNA 6

[0266] 1 gggaagctgg aattcgtatg a

[0267] SEQ ID NO: 12 - siRNA 7

[0268] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0269] -37-

[0270] 1 gcagacctca gcaacgataa ga

[0271] SEQ ID NO: 13 - siRNA 8

[0272] 1 ggacaggagc actttatctg aa

[0273] SEQ ID NO: 14 - siRNA 9

[0274] 1 gcagacctca gcaacgataa gat

[0275] SEQ ID NO: 15 - siRNA 10

[0276] 1 gcacgggaag ctggaattcg tatga

[0277] SEQ ID NO: 16 - siRNA 11

[0278] 1 gaattcgtat gacggagtct tatct

[0279] SEQ ID NO: 17 - siRNA 12

[0280] 1 gctggacagg agcactttat ctgaa

[0281] SEQ ID NO: 18 - siRNA 13

[0282] 1 ggcacgggaa gctggaattc gtatga

[0283] SEQ ID NO: 19 - siRNA 14

[0284] 1 ggaattcgta tgacggagtc ttatct

[0285] SEQ ID NO: 20 - siRNA 15

[0286] 1 gacaagcaga cctcagcaac gataaga

[0287] SEQ ID NO: 21 - siRNA 16

[0288] 1 gacaagcaga cctcagcaac gataagat

[0289] SEQ ID NO: 22 - siRNA 17

[0290] 1 gagacaagca gacctcagca acgataaga

[0291] SEQ ID NO: 23 - siRNA 18

[0292] 1 gctggaattc gtatgacgga gtcttatct

[0293] SEQ ID NO: 24 - mAb heavy chain 1

[0294] 1 cagctggagc agtcaggacc tgagctgaag aggcctggag agacagtcaa gttctcctgc 61 aaggcttctg ggtatccctt cacaaactat ggaatgcact gggtgaaaca ggctccagga 121 aagggtttaa agtggatggg ctggataaac acccacactg gagagccaac atatgctgat 181 gacttcaggg gacggtttgc cttctctttg gaaacctctg ccagcactgc ctatttgcag 241 atcaacaacc tcaaaaatga ggacacggct acatatttct gtgcaagaga gggttattat

[0295] 301 aactacgaag gctggtactt cgatgtctgg ggcgcaggga ccacggtcac cgtctcctca 361 gccaaaacga cacccccatc tgtctataga tcttcc

[0296] 4937-2667-9899, v. 1 Docket No. HRVY-253-WO1

[0297] -38-

[0298] SEQ ID NO: 25 - mAb heavy chain 2

[0299] 1 cttccggaat tccaagttca gctggaggag tcaggggctg agcttgtgaa gcctggggct 61 tcagtgaaga tgtcctgcaa ggcttctggc tacaccttca ccagctactg gataaactgg 121 gtgaagctga ggcctggaca aggccttgag tggattggag atatttatcc tggtagtggt 181 agtactaact acaatgagaa gttcaagagc aaggccacac tgactgtaga cacatcctcc 241 agcacagcct acatgcaact cagcagcctg acatctgagg actctgcggt ctattactgt 301 gcaactgggt ttgactactg gggccaaggc accactctca cagtctcctc agagagtcag 361 tccttcccaa atgtc agate ttcc

[0300] SEQ ID NO: 26 - mAb light chain 1

[0301] 1 gggagetega cattgtgctg acccagtctc catccagtct gtctgcatcc cttggagaca 61 caattaccat cacttgccat gccagtcaga acatttattt ttggttaagt tggtaccagc 121 agaaaccagg aaatattcct aaactattga tetataagge ttccaacttg cacacaggcg 181 tcccatcaag gtttagtggc agtggatctg gaacaggttt cacattaacc atcagcagcc 241 tgcagcctga agacattgcc acttactact gtcaacaggg tcaaagttat ccgctcacgt 301 teggtgetgg gaccaagctg gagctgaaac gggctgatgc tgcaccaact gtatccgcat 361 gcacc

[0302] SEQ ID NO: 27 - mAb light chain 2

[0303] 1 gggagetega cattgtgctc acccagtctc cagccaccct gtctgtgact ccaggagata 61 gegteagtet ttcctgcagg gccagccaaa gtattagcaa caacctacac tggtatcaac 121 aaaaatcaca tgagtctcca aggettetea teaagtatge ttcccagtcc atctctggga 181 tcccctccag gttcagtggc agtggatcag ggacagattt cactctcagt atcaacagtg 241 tggagactga agattttgga atgtatttct gtcaacagag taacagctgg tggacgttcg 301 gtggaggcac caagctggaa atcaaacggg etgatgetge accaactgta tccgcatgca 361 cc

[0304] 4937-2667-9899, v. 1

Claims

Docket No. HRVY-253-WO1-39-CLAIMSWhat is claimed is:

1. A method for treating or preventing a disease or disorder of the central or peripheral nervous system in a subject in need thereof, comprising:(a) administering to the subject a composition comprising an agent capable of inhibiting or reducing the activity of Bone Morphogenic Protein and Activin Membrane Bound Inhibitor (BAMBI) or inhibiting the expression thereof; thereby treating the disease or disorder in the subject.

2. The method of claim 1, wherein the agent capable of inhibiting or reducing the activity of BAMBI or inhibiting the expression thereof is selected from the group consisting of a small molecule, an anti-sense oligonucleotide (ASO), an siRNA, an miRNA, an shRNA, a peptide, and an antibody or functional fragment thereof.

3. The method of claim 1 or 2, wherein the composition comprises a virus comprising nucleic acids encoding the agent.

4. The method of claim 2 or 3, wherein the peptide is a secreted peptide capable of blocking the interaction between BAMBI and Transforming Growth Factor-B Receptor 1 (TGFBR1) or the interaction between BAMBI and a Transforming Growth Factor-B superfamily polypeptide.

5. The method of claim 2, wherein the antibody or functional fragment thereof is a CNS -penetrating antibody or functional fragment thereof.

6. The method of claim 2 or 5, wherein the antibody is a monoclonal antibody, and selectively binds to an amino acid sequence that forms part of a polypeptide having at least 85% identify to SEQ ID NO: 1, 2, 3, or 4.

7. The method of claim 2, 5 or 6, wherein the monoclonal antibody is a humanized monoclonal antibody.

8. The method of claim 1, wherein step (a) comprises intrathecal, intravenous, intramuscular, inhalation, oral, intranasal, or sublingual administration.

9. The method of claim 1, wherein the disease or disorder of the central or peripheral nervous system is a neurovascular disorder, a neurodegenerative disorder, is associated with old age, or is a disease or disorder characterized by demyelination.4937-2667-9899, v. 1Docket No. HRVY-253-WO1-40-10. The method of any one of claims 1-9, wherein the disease or disorder of the central or peripheral nervous system is selected from the group consisting of Huntington’s disease, Alzheimer disease, amyotrophic lateral sclerosis, Parkinson’s disease, multiple sclerosis, clinically isolated demyelinating syndrome (CIS), neuromyelitis optica, acute-disseminated encephalomyelitis, leukoencephalopathies, acute transverse myelitis, Balo’s concentric sclerosis, cerebrotendinous xanthomatosis, Fabry’s disease, HIV encephalitis, herpes simplex encephalitis, mitochondrial encephalopathy, Behcet’s disease with CNS involvement, neuropsychiatric systemic lupus erythematosus, progressive multifocal leukoencephalopathy, subacute sclerosing panencephalitis, Pelizaeus-Merzbacher disease, peripheral neuropathy, diabetic neuropathy, and chemotherapy-induced neuropathy.

11. The method of claim 1, wherein the agent is administered in an amount effective to enhance an effect of an endogenously produced Transforming Growth Factor-B superfamily polypeptide on pSMAD signaling in the subject.

12. The method of claim 1, wherein the endogenously produced TGF-B superfamily polypeptide is Growth Differentiation Factor 11 (GDF11).

13. The method of claim 1, wherein the agent is administered in an amount effective to induce neurogenesis, vascularization of neural tissues, or increased expression of neuronal activity markers.

14. The method of claim 1, wherein step (a) comprises systemic administration of the agent to the subject, and wherein the agent is incapable of traversing a blood brain barrier of the subject.

15. A method for screening agents for selectively modulating the activity of Bone Morphogenic Protein and Activin Membrane Bound Inhibitor (BAMBI), comprising:(a) providing a cell or an organism comprising the cell which expresses BAMBI;(b) exposing the cell to an agent;(c) assessing whether the activity or expression of BAMBI has been modulated, and(d) identifying the agent as a candidate when modulation of BAMBI activity or expression has been assessed.4937-2667-9899, v. 1Docket No. HRVY-253-WO1-41-16. The method of claim 15, wherein the cell overexpresses BAMBI.

17. The method of claim 15, wherein the cell or organism is selected as a model for a neurodegenerative or neurovascular disease or disorder, or a disease or disorder characterized by demyelination.

18. The method of claim 15, wherein the cell or organism is a model for old age, Huntington’s disease, Alzheimer disease, amyotrophic lateral sclerosis, Parkinson’s disease, multiple sclerosis, clinically isolated demyelinating syndrome (CIS), neuromyelitis optica, acute-disseminated encephalomyelitis, leukoencephalopathies, acute transverse myelitis, Balo’s concentric sclerosis, cerebrotendinous xanthomatosis, Fabry’s disease, HIV encephalitis, herpes simplex encephalitis, mitochondrial encephalopathy, Behcet’s disease with CNS involvement, neuropsychiatric systemic lupus erythematosus, progressive multifocal leukoencephalopathy, subacute sclerosing panencephalitis, Pelizaeus-Merzbacher disease, peripheral neuropathy, diabetic neuropathy, and chemotherapy-induced neuropathy.

19. The method of claim 15, further comprising identifying the agent as a candidate for treating a disease or disorder of the central or peripheral nervous system when the activity or expression of BAMBI has been assessed as blocked, reduced or inhibited.

20. The method of claim 13, wherein the modulation of BAMBI activity is assessed by measuring a change in TGF-P signaling.

21. A virus comprising nucleic acids which encode an agent capable of blocking, reducing, or inhibiting the activity or expression of BAMBI, wherein the agent is selected from the group consisting of an anti-sense oligonucleotide, an siRNA, an miRNA, or a peptide.

22. The virus of claim 21, wherein the virus is an adenovirus, an adeno-associated virus (AAV), or a retrovirus.

23. The virus of claim 22, wherein the retrovirus is a replication deficient lentivirus.

24. The virus of claim 22, wherein the AAV is an AAV having tropism for the nervous system.4937-2667-9899, v. 1Docket No. HRVY-253-WO1-42-25. The virus of claim 21, wherein the nucleic acids are operably linked to an inducible or constitutive promoter.4937-2667-9899, v. 1

Citation Information

Patent Citations

  • Use of blocking agents of bone morphogenic protein (BMP) signalling for the treatment of neuroinflammatory and neurodegenerative diseases

    US20150139983A1

  • Methods and compositions for increasing neurogenesis and angiogenesis

    US20160220640A1

  • Compositions and methods for treating or ameliorating neuroinflammation, neurodegeneration, neuropathic pain, and migraine

    US20200390906A1

  • ACVR1 (ALK2) receptor inhibition to treat neurological diseases

    US20230235036A1

  • Modulating bone morphogenic protein (BMP) signaling in the treatment of alzheimer's disease

    US20240102022A1