Degradable magnesium alloy having antibacterial and osteopromoting effects, and preparation method therefor and use thereof
By preparing magnesium alloys containing Gd, Ag, Ga, and Zr, and combining hot extrusion and solution treatment processes, the problems of low mechanical properties, fast corrosion rate, and insufficient antibacterial and bone-promoting properties of magnesium alloys have been solved, realizing the application of high-strength, antibacterial, and bone-promoting biomedical materials.
Patent Information
- Application Number
- PCT/CN2024/115256
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-08-28
- Publication Date
- 2026-03-05
AI Technical Summary
Existing magnesium alloys have low mechanical properties, excessively fast corrosion rates, and insufficient antibacterial and bone-promoting properties in the biomedical field, which cannot meet the needs of clinical applications.
Magnesium alloys containing 3-7% Gd, 0.1-1.0% Ag, 0.2-2.0% Ga, and 0.1-0.6% Zr are prepared through hot extrusion and solution treatment to form MgGdAg and MgGdGa strengthening phases. Combined with the grain refinement effect of Zr, the strength and toughness are improved. Furthermore, the Mg/Ag composite forms Mg-Ag micro-galvanic corrosion to inhibit bacteria, and the Mg/Ga composite promotes osteoblast formation.
It achieves high strength, antibacterial and bone-promoting effects in magnesium alloys, and has good biocompatibility and biodegradability, meeting the comprehensive performance requirements of biomedical materials.
Smart Images

Figure PCTCN2024115256-FTAPPB-I100001
Abstract
Description
A biodegradable magnesium alloy with antibacterial and bone-promoting effects, its preparation method and application Technical Field
[0001] This invention relates to a biodegradable magnesium alloy with antibacterial and bone-promoting effects, its preparation method, and its application. Background Technology
[0002] Materials research in the biomedical field has consistently sought novel materials with excellent biocompatibility, antibacterial properties, and the ability to promote bone tissue growth. Stainless steel, titanium alloys, and cobalt-based alloys, due to their high mechanical strength and toughness, are commonly used in orthopedic implants. However, their Young's modulus is far higher than that of human bone, leading to a "stress shielding effect" that hinders bone remodeling. Furthermore, because these alloys are non-degradable, long-term retention in the body can cause rejection reactions and infections, ultimately requiring secondary surgery for removal, significantly increasing patient suffering and financial burden. Therefore, the development of novel biodegradable biomaterials with antibacterial properties and the ability to promote bone tissue growth has become particularly urgent.
[0003] Magnesium alloys, with their biodegradability and Young's modulus similar to bone tissue, are a new generation of medical implantable metal materials. However, current magnesium alloys suffer from low mechanical properties, rapid corrosion rates, and insufficient antibacterial and bone-promoting properties, failing to meet clinical application needs. To address these issues, researchers both domestically and internationally have conducted extensive research and development. The Mg-Ca-Zn alloy screws developed by U&I in South Korea, used for fracture repair, exhibit good biocompatibility; however, their mechanical properties remain low when used for fixation or tensioning devices. Syntellix AG in Germany has developed the rare-earth magnesium alloy WE43, which can be used for various indications in orthopedic and trauma surgery. The bio-implantation application of WE43 fully demonstrates that rare-earth magnesium alloys with low rare-earth content have no toxic side effects. However, the corrosion rate of WE43 alloy is too rapid, and it lacks significant antibacterial and bone-promoting effects, requiring further breakthroughs. The Mg-Nd-Zn-Zr developed by Shanghai Jiao Tong University in collaboration with Huichuang Medical Technology Co., Ltd. in China is currently undergoing clinical trials, but its antibacterial and bone-promoting benefits have not yet been clearly defined. CN112472868B discloses a biodegradable MgNdZnSc biomedical magnesium alloy, but its mechanical yield strength is only 97 MPa, which is still relatively low. CN114075629B discloses a biodegradable ultrafine-grained magnesium alloy with a tensile strength ≤300 MPa and no clearly defined corrosion rate indicator. Currently, the comprehensive strength, toughness, corrosion resistance, antibacterial properties, and bone-promoting effects of biomedical magnesium alloys remain challenging problems that urgently need to be overcome.
[0004] Summary of the Invention
[0005] One object of the present invention is to provide a magnesium alloy comprising the following metallic elements in weight percentage:
[0006] Gd 3-7%, Ag 0.1-1.0%, Ga 0.2-2.0%, Zr 0.1-0.6%, and the balance Mg.
[0007] In some embodiments, the magnesium alloy has a tensile strength of 400-450 MPa, a yield strength of 300-320 MPa, an elongation after fracture of 16.0-18.0%, a neutral salt spray corrosion rate of 0.1-0.3 mm / y, and a Hank's solution weight loss rate of 0.2-0.4 mm / y.
[0008] In some embodiments, the magnesium alloy has antibacterial and bone-promoting effects.
[0009] Another object of the present invention is to provide a method for preparing magnesium alloys, comprising:
[0010] Mg-20Gd, 99.99Ag, 99.99Ga, Mg-30Zr, and 99.99Mg are melted separately, and the fused alloy or metal is cast into a metal mold to form a magnesium alloy ingot. The magnesium alloy contains the following metal elements in weight percentage: Gd 3-7%, Ag 0.1-1.0%, Ga 0.2-2.0%, Zr 0.1-0.6%, and the balance Mg.
[0011] The magnesium alloy ingot is obtained by hot extrusion and solution treatment.
[0012] In some embodiments, the melting temperature of 99.99Mg is 650°C, the melting temperature of Mg-20Gd is 740°C, the melting temperature of 99.99Ag is 750°C, and the melting temperature of Mg-30Zr is 780°C.
[0013] In some embodiments, the hot extrusion has an extrusion ratio of 16-25:1 and an extrusion speed of 0.1-0.5 mm / s.
[0014] In some embodiments, the solution treatment process has a solution temperature of 450-480℃ and a solution duration of 15-20h; the aging temperature is 180-250℃ and the aging duration is 10-60h.
[0015] The application of the magnesium alloy described in this invention in the field of bio-orthopedics.
[0016] Another object of the present invention is to provide a medical implant made of the aforementioned magnesium alloy. Detailed Implementation
[0017] To better illustrate the objectives, complete technical approach, and advantages of this invention, the following detailed description will be provided in conjunction with specific embodiments. However, the embodiments described below are only a part of the embodiments of this invention and do not include all embodiments. Other embodiments that can be obtained by those skilled in the art without creative effort based on the embodiments of this invention are all within the protection scope of this invention.
[0018] In the embodiments described below, unless otherwise specified, the conventional methods used are all technical means recognized or commonly used by those skilled in the art, and the instruments, reagents, consumables, etc. used in the embodiments of the present invention can be obtained through legitimate commercial channels.
[0019] The "Report on the Development of China's New Materials Industry," compiled by the Chemical Engineering, Metallurgy and Materials Engineering Division of the Chinese Academy of Engineering and the Chinese Materials Research Society, clearly outlines the performance requirements for biomedical magnesium alloys: room temperature tensile strength ≥300MPa, yield strength ≥220MPa, elongation ≥20%, harmful impurities ≤500ppm; uniform degradation rate in artificial plasma ≤0.3mm / y, 90-day strength decrease ≤20%, 180-day strength decrease ≤50%, and cytotoxicity level 1.
[0020] To meet the performance requirements of biomedical magnesium alloys, this invention provides a biodegradable magnesium alloy with antibacterial and bone-promoting properties, comprising 3-7 wt.% Gd, 0.1-1.0 wt.% Ag, 0.2-2.0 wt.% Ga, 0.1-0.6 wt.% Zr, and the balance Mg. This magnesium alloy exhibits a tensile strength of 400-450 MPa, a yield strength of 300-320 MPa, an elongation after fracture of 16.0-18.0%, a neutral salt spray corrosion rate of 0.1-0.3 mm / y, and a Hank's solution weight loss rate of 0.2-0.4 mm / y.
[0021] In magnesium alloys, Mg / Ag composites effectively promote antibacterial activity, Mg / Ga composites are beneficial for promoting osteoblast formation, Mg / Gd / Ag / Ga composites promote mechanical strength and toughness, Zr is a good grain refiner, and together they enhance strength and toughness. Mg is an element required by the body.
[0022] The magnesium alloy of the present invention has a significant antibacterial effect. After Mg / Ag is combined, Mg-Ag micro-galvanic corrosion is formed in body fluid, which promotes the release of Ag ions, hinders the work of bacterial oxygen metabolism enzymes, effectively inhibits bacterial reproduction, thereby achieving a bacteriostatic effect and reducing the risk of wound infection.
[0023] The magnesium alloy of the present invention has a significant bone-promoting effect. After Mg / Ga is combined, it can enhance the expression of alkaline phosphatase (Alp1), osteogenic factor (Osx) and Runt-related transcription factor 2 (Runx2), promote the formation of osteoblasts, effectively form new bone tissue, and inhibit osteoclast differentiation, thus playing a comprehensive role in promoting bone.
[0024] The magnesium alloy of the present invention has excellent strength and toughness. After Mg / Gd / Ag / Ga is combined, MgGdAg and MgGdGa strengthening phases are formed, which effectively suppress dislocation movement and greatly improve strength and toughness. In addition, Zr has a significant grain-refining effect, which simultaneously improves strength and plasticity, and comprehensively improves strength and toughness.
[0025] Example 1
[0026] Alloy composition: Gd 6wt.%, Ag 0.1wt.%, Ga 0.2wt.%, Zr 0.6wt.%, balance Mg.
[0027] Alloy ingot preparation: Mg-20Gd (Jiangxi Shida Magnesium Alloy Technology Co., Ltd.), 99.99Ag, 99.99Ga, Mg-30Zr (Jiangxi Shida Magnesium Alloy Technology Co., Ltd.), and 99.99Mg were added in the following ways: Mg-20Gd (melting temperature 650℃), Mg-20Gd (melting temperature 740℃), 99.99Ag (melting temperature 750℃), 99.99Ga (melting temperature 760℃), and Mg-30Zr (melting temperature 780℃) were added sequentially in an electric resistance furnace. After all the above alloys or metals were completely melted, they were poured into a metal mold and gravity-cast into ingots with a diameter of 200mm and a height of 500mm.
[0028] Hot processing technology: The hot extrusion process has an extrusion ratio of 25:1 and an extrusion speed of 0.1 mm / s.
[0029] Heat treatment regime: solution treatment at 450℃ for 15 hours; aging at 180℃ for 60 hours.
[0030] The prepared alloy was subjected to tensile mechanical and neutral salt spray corrosion resistance tests. The tensile mechanical tests were conducted according to the standard GB / T 228.1-2010 "Metallic Materials - Tensile Testing". The neutral salt spray corrosion resistance tests were conducted according to the standard GB / T 10125-2012 "Artificial Atmosphere Corrosion Tests - Salt Spray Tests".
[0031] The results showed that the ingot had a tensile strength of 410 MPa, a yield strength of 305 MPa, an elongation after fracture of 22.0%, a neutral salt spray corrosion rate of 0.2 mm / y, and a Hank's solution weight loss rate of 0.3 mm / y.
[0032] In vitro antibacterial activity was tested using the plate coating method.
[0033] The results showed that the in vitro bactericidal rate of the cast ingot was 97% for Escherichia coli and 97% for Staphylococcus aureus, with a minimum inhibitory concentration of 16 μg / mL.
[0034] PCR polymerase chain reaction was used to test bone-promoting properties.
[0035] In this embodiment, the magnesium alloy sample is a circular piece with a diameter of 10 mm and a thickness of 2 mm. It is polished with 1000# and 2000# SiC sandpaper in sequence, and then ultrasonically cleaned with acetone and anhydrous ethanol for 10 minutes each. After drying, it is sterilized by ultraviolet light for 60 minutes on each side and used immediately after sterilization.
[0036] Place the sample in a 24-well plate, according to the international standard (ISO 10993 Part 12) at a depth of 1.25 cm. 2 The extract was soaked in α-MEM medium containing 10% FBS at a concentration of / mL and placed in a cell culture incubator containing 5% CO2 at 37°C for 72 hours. After 72 hours, the extract was filtered through a 0.22μm filter. The extract was then diluted 6-fold for in vitro cell experiments.
[0037] Mouse embryonic osteoblast precursor cells (C3T3-E1 cells, provided by the Central Laboratory of the Affiliated Stomatological Hospital of China Medical University, passages 10-15) were added to α-MEM medium containing 10% FBS and placed in a cell culture incubator at 37°C with 5% CO2. The medium was changed every other day. When the confluence reached 80%-90%, the cells were passaged using 0.25% trypsin. In subsequent experiments, MC3T3-E1 cells will be used to test the osteopromoting properties of magnesium alloys.
[0038] 1 mL of a concentration of 5×10 4Cell suspension of 1 mL / well was seeded into 6-well plates and cultured at 37°C in a 5% CO2 incubator for 24 hours. After cell attachment, the original culture medium was discarded, and the cells were washed three times with PBS. 1 mL of magnesium alloy extraction solution was added to each well, and the culture was continued, with the medium changed every other day. After 3 and 7 days of culture, the culture plates were removed, washed once with PBS, and 1 mL of Trizol was added to each well. The plates were gently agitated to distribute the lysis buffer evenly on the cell surface. The plates were repeatedly pipetted until no significant precipitate was observed. The cell lysis buffer was transferred to 1.5 mL EP tubes, incubated at room temperature for 5 minutes, centrifuged at 12000g for 5 minutes at 4°C, and the supernatant was transferred to a new 1.5 mL EP tube. 200 μL of chloroform was added, and the plates were vortexed and incubated for 5 minutes. Then, the plates were centrifuged at 12000g for 15 minutes at 4°C, and the supernatant was transferred to a new 1.5 mL EP tube. 500 μL of isopropanol was added, and the plates were mixed and incubated at room temperature for 10 minutes. After centrifugation at 12000g for 10 minutes at 4℃, the supernatant was discarded. The precipitate was washed twice with 1 mL of 75% ethanol, centrifuged at 12000g for 5 minutes at 4℃, the supernatant was discarded, and the precipitate was dried at room temperature. The precipitate was then dissolved in 20 μL of DEPC water. The total RNA content and mass were determined spectrophotometrically at 260 nm and 260 / 280 nm, respectively. The extracted total RNA was reverse-transcribed into cDNA using the PremScript™ RT cDNA reverse transcription kit. The target genes ALP, OCN, and Runt-related transcription factor 2 (RUNX-2) were quantified using the TBGreen™ Premix Ex Taq™ II kit.
[0039] Reaction system:
[0040] Reaction conditions: 95℃ for 2 min pre-denaturation, 95℃ for 15 s, 60℃ for 60 s, 40 cycles.
[0041] Primer sequence
[0042] ALP
[0043] F:CATGTTCCTGGGAGATGGTAT;
[0044] R: GTGTTGTACGTCTTGGAGAGA.
[0045] OCN
[0046] F: ACCATCTTTCTGCTCACTCTGCT;
[0047] R:CCTTATTGCCCTCCTGCTTG.
[0048] RUNX-2
[0049] F: GCCACTTACCACAGAGCTATTA;
[0050] R: GGCGGTCAGAGAACAAACTA.
[0051] The results showed that the expression levels of osteogenic-related genes were as follows: alkaline phosphatase (ALP) 1.9, Runt-related transcription factor 2 (RUNX-2) 1.8, and osteocalcin (OCN) 1.5.
[0052] Example 2
[0053] Alloy composition: Gd 6wt.%, Ag 1.0wt.%, Ga 0.2wt.%, Zr 0.6wt.%, balance Mg.
[0054] Alloy ingot preparation: Mg-20Gd, 99.99Ag, 99.99Ga, Mg-30Zr, and 99.99Mg were added sequentially in an electric resistance furnace: 99.99Mg (melting temperature 650℃), Mg-20Gd (melting temperature 740℃), 99.99Ag (melting temperature 750℃), 99.99Ga (melting temperature 760℃), and Mg-30Zr (melting temperature 780℃). After all the above alloys or metals were completely melted, they were poured into a metal mold and gravity-cast into ingots with a diameter of 200mm and a height of 500mm.
[0055] Hot processing technology: The hot extrusion process has an extrusion ratio of 25:1 and an extrusion speed of 0.1 mm / s.
[0056] Heat treatment regime: solution treatment at 450℃ for 15 hours; aging at 180℃ for 60 hours.
[0057] The prepared alloy was subjected to tensile mechanical and neutral salt spray corrosion resistance tests. The tensile mechanical tests were conducted according to the standard GB / T 228.1-2010 "Metallic Materials - Tensile Testing". The neutral salt spray corrosion resistance tests were conducted according to the standard GB / T 10125-2012 "Artificial Atmosphere Corrosion Tests - Salt Spray Tests".
[0058] The results showed that the ingot had a tensile strength of 430 MPa, a yield strength of 330 MPa, an elongation after fracture of 21%, a neutral salt spray corrosion rate of 0.3 mm / y, and a Hank's solution weight loss rate of 0.4 mm / y.
[0059] In vitro antibacterial activity was tested using the plate coating method.
[0060] The results showed that the in vitro sterilization rate of the ingot was 98% for Escherichia coli and 98% for Staphylococcus aureus, with a minimum inhibitory concentration of 15 μg / mL.
[0061] The bone-promoting properties were tested using PCR polymerase chain reaction, see Example 1.
[0062] The results showed that the expression levels of osteogenic-related genes were 1.9 for ALP, 1.8 for RUNX-2, and 1.5 for OCN.
[0063] Example 3
[0064] Alloy composition: Gd 3wt.%, Ag 1.0wt.%, Ga 0.2wt.%, Zr 0.6wt.%, balance Mg.
[0065] Alloy ingot preparation: Mg-20Gd, 99.99Ag, 99.99Ga, Mg-30Zr, and 99.99Mg were added sequentially in an electric resistance furnace: 99.99Mg (melting temperature 650℃), Mg-20Gd (melting temperature 740℃), 99.99Ag (melting temperature 750℃), 99.99Ga (melting temperature 760℃), and Mg-30Zr (melting temperature 780℃). After all the above alloys or metals were completely melted, they were poured into a metal mold and gravity-cast into ingots with a diameter of 200mm and a height of 500mm.
[0066] Hot processing technology: The hot extrusion process has an extrusion ratio of 25:1 and an extrusion speed of 0.1 mm / s.
[0067] Heat treatment regime: solution treatment at 450℃ for 15 hours; aging at 180℃ for 60 hours.
[0068] The prepared alloy was subjected to tensile mechanical and neutral salt spray corrosion resistance tests. The tensile mechanical tests were conducted according to the standard GB / T 228.1-2010 "Metallic Materials - Tensile Testing". The neutral salt spray corrosion resistance tests were conducted according to the standard GB / T 10125-2012 "Artificial Atmosphere Corrosion Tests - Salt Spray Tests".
[0069] The results showed that the tensile strength was 400 MPa, the yield strength was 300 MPa, the elongation after fracture was 25%, the neutral salt spray corrosion rate was 0.1 mm / y, and the Hank's solution weight loss rate was 0.2 mm / y.
[0070] In vitro antibacterial activity was tested using the plate coating method.
[0071] The results showed that the in vitro bactericidal rate of the cast ingot was 97% for Escherichia coli and 97% for Staphylococcus aureus, with a minimum inhibitory concentration of 16 μg / mL.
[0072] The bone-promoting properties were tested using PCR polymerase chain reaction, see Example 1.
[0073] The results showed that the expression levels of osteogenic-related genes were 1.8 for ALP, 1.7 for RUNX-2, and 1.5 for OCN.
[0074] Example 4
[0075] Alloy composition: Gd 6wt.%, Ag 0.1wt.%, Ga 2.0wt.%, Zr 0.6wt.%, balance Mg.
[0076] Alloy ingot preparation: Mg-20Gd, 99.99Ag, 99.99Ga, Mg-30Zr, and 99.99Mg were added sequentially in an electric resistance furnace: 99.99Mg (melting temperature 650℃), Mg-20Gd (melting temperature 740℃), 99.99Ag (melting temperature 750℃), 99.99Ga (melting temperature 760℃), and Mg-30Zr (melting temperature 780℃). After all the above alloys or metals were completely melted, they were poured into a metal mold and gravity-cast into ingots with a diameter of 200mm and a height of 500mm.
[0077] Hot processing technology: The hot extrusion process has an extrusion ratio of 25:1 and an extrusion speed of 0.1 mm / s.
[0078] Heat treatment regime: solution treatment at 450℃ for 15 hours; aging at 180℃ for 60 hours.
[0079] The prepared alloy was subjected to tensile mechanical and neutral salt spray corrosion resistance tests. The tensile mechanical tests were conducted according to the standard GB / T 228.1-2010 "Metallic Materials - Tensile Testing". The neutral salt spray corrosion resistance tests were conducted according to the standard GB / T 10125-2012 "Artificial Atmosphere Corrosion Tests - Salt Spray Tests".
[0080] The results showed that the tensile strength was 420 MPa, the yield strength was 315 MPa, the elongation after fracture was 21%, the neutral salt spray corrosion rate was 0.2 mm / y, and the Hank's solution weight loss rate was 0.3 mm / y.
[0081] In vitro antibacterial activity was tested using the plate coating method.
[0082] The results showed that the in vitro bactericidal rate of Escherichia coli was 97%, the bactericidal rate of Staphylococcus aureus was 97%, and the minimum inhibitory concentration was 16 μg / mL.
[0083] The bone-promoting properties were tested using PCR polymerase chain reaction, see Example 1.
[0084] The results showed that the expression levels of osteogenic-related genes were 2.0 for ALP, 1.9 for RUNX-2, and 1.6 for OCN.
[0085] Comparative Example 1
[0086] Alloy composition: Gd 2wt.%, Ag 0.1wt.%, Ga 0.2wt.%, Zr 0.6wt.%, balance Mg.
[0087] Alloy ingot preparation: Mg-20Gd, 99.99Ag, 99.99Ga, Mg-30Zr, and 99.99Mg were added sequentially in an electric resistance furnace: 99.99Mg (melting temperature 650℃), Mg-20Gd (melting temperature 740℃), 99.99Ag (melting temperature 750℃), 99.99Ga (melting temperature 760℃), and Mg-30Zr (melting temperature 780℃). After all the above alloys or metals were completely melted, they were poured into a metal mold and gravity-cast into ingots with a diameter of 200mm and a height of 500mm.
[0088] Hot processing technology: The hot extrusion process has an extrusion ratio of 25:1 and an extrusion speed of 0.1 mm / s.
[0089] Heat treatment regime: solution treatment at 450℃ for 15 hours; aging at 180℃ for 60 hours.
[0090] The prepared alloy was subjected to tensile mechanical and neutral salt spray corrosion resistance tests. The tensile mechanical tests were conducted according to the standard GB / T 228.1-2010 "Metallic Materials - Tensile Testing". The neutral salt spray corrosion resistance tests were conducted according to the standard GB / T 10125-2012 "Artificial Atmosphere Corrosion Tests - Salt Spray Tests".
[0091] The results showed that the ingot had a tensile strength of 240 MPa, a yield strength of 100 MPa, an elongation after fracture of 26.0%, a neutral salt spray corrosion rate of 0.05 mm / y, and a Hank's solution weight loss rate of 0.1 mm / y.
[0092] In vitro antibacterial activity was tested using the plate coating method.
[0093] The results showed that the in vitro bactericidal rate of the cast ingot was 96% for Escherichia coli and 96% for Staphylococcus aureus, with a minimum inhibitory concentration of 18 μg / mL.
[0094] The bone-promoting properties were tested using PCR polymerase chain reaction, see Example 1.
[0095] The results showed that the expression levels of osteogenic-related genes were 1.6 for ALP, 1.6 for RUNX-2, and 1.3 for OCN.
[0096] Comparative Example 2
[0097] Alloy composition: Gd 10wt.%, Ag 0.1wt.%, Ga 0.2wt.%, Zr 0.6wt.%, balance Mg.
[0098] Alloy ingot preparation: Mg-20Gd, 99.99Ag, 99.99Ga, Mg-30Zr, and 99.99Mg were added sequentially in an electric resistance furnace: 99.99Mg (melting temperature 650℃), Mg-20Gd (melting temperature 740℃), 99.99Ag (melting temperature 750℃), 99.99Ga (melting temperature 760℃), and Mg-30Zr (melting temperature 780℃). After all the above alloys or metals were completely melted, they were poured into a metal mold and gravity-cast into ingots with a diameter of 200mm and a height of 500mm.
[0099] Hot processing technology: The hot extrusion process has an extrusion ratio of 25:1 and an extrusion speed of 0.1 mm / s.
[0100] Heat treatment regime: solution treatment at 450℃ for 15 hours; aging at 180℃ for 60 hours.
[0101] The prepared alloy was subjected to tensile mechanical and neutral salt spray corrosion resistance tests. The tensile mechanical tests were conducted according to the standard GB / T 228.1-2010 "Metallic Materials - Tensile Testing". The neutral salt spray corrosion resistance tests were conducted according to the standard GB / T 10125-2012 "Artificial Atmosphere Corrosion Tests - Salt Spray Tests".
[0102] The results showed that the ingot had a tensile strength of 480 MPa, a yield strength of 350 MPa, an elongation after fracture of 10.0%, a neutral salt spray corrosion rate of 0.5 mm / y, and a Hank's solution weight loss rate of 0.8 mm / y.
[0103] In vitro antibacterial activity was tested using the plate coating method.
[0104] The results showed that the in vitro Escherichia coli sterilization rate of the ingot was 97%, the sterilization rate of Staphylococcus aureus was 977%, and the minimum inhibitory concentration was 18 μg / mL.
[0105] The bone-promoting properties were tested using PCR polymerase chain reaction, see Example 1.
[0106] The results showed that the expression levels of osteogenic-related genes were 1.8 for ALP, 1.8 for RUNX-2, and 1.5 for OCN.
[0107] Comparative Example 3
[0108] Alloy composition: Gd 6wt.%, Ag 2wt.%, Ga 0.2wt.%, Zr 0.6wt.%, balance Mg.
[0109] Alloy ingot preparation: The alloys were added in the form of Mg-20Gd, 99.99Ag, 99.99Ga, Mg-30Zr, and 99.99Mg, respectively. The following alloys were added sequentially in an electric resistance furnace: 99.99Mg (melting temperature 650℃), Mg-20Gd (melting temperature 740℃), 99.99Ag (melting temperature 750℃), 99.99Ga (melting temperature 760℃), and Mg-30Zr (melting temperature 780℃). After all the above alloys or metals had completely melted, they were poured into a metal mold and gravity-cast into ingots with a diameter of 200 mm and a height of 500 mm.
[0110] Hot processing technology: The hot extrusion process has an extrusion ratio of 25:1 and an extrusion speed of 0.1 mm / s.
[0111] Heat treatment regime: solution treatment at 450℃ for 15 hours; aging at 180℃ for 60 hours.
[0112] The prepared alloy was subjected to tensile mechanical and neutral salt spray corrosion resistance tests. The tensile mechanical tests were conducted according to the standard GB / T 228.1-2010 "Metallic Materials - Tensile Testing". The neutral salt spray corrosion resistance tests were conducted according to the standard GB / T 10125-2012 "Artificial Atmosphere Corrosion Tests - Salt Spray Tests".
[0113] The results showed that the ingot had a tensile strength of 470 MPa, a yield strength of 360 MPa, an elongation after fracture of 6.0%, a neutral salt spray corrosion rate of 0.9 mm / y, and a Hank's solution weight loss rate of 1.4 mm / y.
[0114] In vitro antibacterial activity was tested using the plate coating method.
[0115] The results showed that the in vitro sterilization rate of the ingot was 99% for Escherichia coli and 99% for Staphylococcus aureus, with a minimum inhibitory concentration of 15 μg / mL.
[0116] The bone-promoting properties were tested using PCR polymerase chain reaction, see Example 1.
[0117] The results showed that the expression levels of osteogenic-related genes were 1.8 for ALP, 1.8 for RUNX-2, and 1.5 for OCN.
[0118] Comparative Example 4
[0119] Alloy composition: Gd 2wt.%, Ag 0.1wt.%, Zr 0.6wt.%, balance Mg.
[0120] Alloy ingot preparation: Mg-20Gd, 99.99Ag, Mg-30Zr, and 99.99Mg were added sequentially in an electric resistance furnace: 99.99Mg (melting temperature 650℃), Mg-20Gd (melting temperature 740℃), 99.99Ag (melting temperature 750℃), and Mg-30Zr (melting temperature 780℃). After all the above alloys or metals were completely melted, they were poured into a metal mold and gravity-cast into ingots with a diameter of 200mm and a height of 500mm.
[0121] Hot extrusion process: extrusion ratio 25:1, extrusion speed 0.1mm / s;
[0122] Hot drawing forming process: heating temperature 300℃, drawing speed 3.5mm / s, after 30 hot drawing cycles, a wire with a diameter of 1.0mm is obtained;
[0123] Heat treatment regime: solution treatment at 450℃ for 15 hours; aging at 180℃ for 60 hours.
[0124] The prepared alloy was subjected to tensile mechanical and neutral salt spray corrosion resistance tests. The tensile mechanical tests were conducted according to the standard GB / T 228.1-2010 "Metallic Materials - Tensile Testing". The neutral salt spray corrosion resistance tests were conducted according to the standard GB / T 10125-2012 "Artificial Atmosphere Corrosion Tests - Salt Spray Tests".
[0125] The results showed that the wire diameter was 1.0 mm, the tensile strength was 420 MPa, the yield strength was 110 MPa, the elongation after fracture was 30.0%, the neutral salt spray corrosion rate was 0.1 mm / y, and the Hank's solution weight loss rate was 0.2 mm / y.
[0126] Comparative Example 5
[0127] Alloy composition: Gd 10wt.%, Ag 0.1wt.%, Zr 0.6wt.%, balance Mg.
[0128] Alloy ingot preparation: Mg-20Gd, 99.99Ag, Mg-30Zr, and 99.99Mg were added sequentially in an electric resistance furnace: 99.99Mg (melting temperature 650℃), Mg-20Gd (melting temperature 740℃), 99.99Ag (melting temperature 750℃), and Mg-30Zr (melting temperature 780℃). After all the above alloys or metals were completely melted, they were poured into a metal mold and gravity-cast into ingots with a diameter of 200mm and a height of 500mm.
[0129] Hot extrusion process: extrusion ratio 25:1, extrusion speed 0.1mm / s;
[0130] Hot drawing forming process: heating temperature 300℃, drawing speed 3.5mm / s, after 30 hot drawing cycles, a wire with a diameter of 1.0mm is obtained;
[0131] Heat treatment regime: solution treatment at 450℃ for 15 hours; aging at 180℃ for 60 hours.
[0132] The prepared alloy was subjected to tensile mechanical and neutral salt spray corrosion resistance tests. The tensile mechanical tests were conducted according to the standard GB / T 228.1-2010 "Metallic Materials - Tensile Testing". The neutral salt spray corrosion resistance tests were conducted according to the standard GB / T 10125-2012 "Artificial Atmosphere Corrosion Tests - Salt Spray Tests".
[0133] The results showed that the wire diameter was 1.0 mm, the tensile strength was 520 MPa, the yield strength was 400 MPa, the elongation after fracture was 10.5%, the neutral salt spray corrosion rate was 0.2 mm / y, and the Hank's solution weight loss rate was 0.4 mm / y.
[0134] Comparative Example 6
[0135] Alloy composition: Gd 6wt.%, Ag 2.0wt.%, Zr 0.6wt.%, balance Mg;
[0136] Alloy ingot preparation: Mg-20Gd, 99.99Ag, Mg-30Zr, and 99.99Mg were added sequentially in an electric resistance furnace: 99.99Mg (melting temperature 650℃), Mg-20Gd (melting temperature 740℃), 99.99Ag (melting temperature 750℃), and Mg-30Zr (melting temperature 780℃). After all the above alloys or metals were completely melted, they were poured into a metal mold and gravity-cast into ingots with a diameter of 200mm and a height of 500mm.
[0137] Hot extrusion process: extrusion ratio 25:1, extrusion speed 0.1mm / s;
[0138] Hot drawing forming process: heating temperature 300℃, drawing speed 3.5mm / s, after 30 hot drawing cycles, a wire with a diameter of 1.0mm is obtained;
[0139] Heat treatment regime: solution treatment at 450℃ for 15 hours; aging at 180℃ for 60 hours.
[0140] The prepared alloy was subjected to tensile mechanical and neutral salt spray corrosion resistance tests. The tensile mechanical tests were conducted according to the standard GB / T 228.1-2010 "Metallic Materials - Tensile Testing". The neutral salt spray corrosion resistance tests were conducted according to the standard GB / T 10125-2012 "Artificial Atmosphere Corrosion Tests - Salt Spray Tests".
[0141] The results showed that the wire diameter was 1.0 mm, the tensile strength was 560 MPa, the yield strength was 440 MPa, the elongation after fracture was 6.5%, the neutral salt spray corrosion rate was 0.4 mm / y, and the Hank's solution weight loss rate was 0.6 mm / y.
[0142] The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited to the embodiments described. Those skilled in the art can make various equivalent modifications or substitutions without departing from the spirit of the present invention, and these equivalent modifications or substitutions are all included within the scope defined by the claims of this application.
Claims
1. A magnesium alloy, characterized in that, The magnesium alloy contains the following metallic elements in weight percentage: Gd 3-7%, Ag 0.1-1.0%, Ga 0.2-2.0%, Zr 0.1-0.6%, and the balance Mg.
2. The magnesium alloy according to claim 1, characterized in that, The magnesium alloy has a tensile strength of 400-450 MPa, a yield strength of 300-320 MPa, an elongation after fracture of 16.0-18.0%, a neutral salt spray corrosion rate of 0.1-0.3 mm / y, and a Hank's solution weight loss rate of 0.2-0.4 mm / y.
3. The magnesium alloy according to claim 1, characterized in that, The magnesium alloy has antibacterial and bone-promoting effects.
4. A method for preparing magnesium alloys, comprising: Mg-20Gd, 99.99Ag, 99.99Ga, Mg-30Zr, and 99.99Mg are melted separately, and the fused alloy or metal is cast into a metal mold to form a magnesium alloy ingot. The magnesium alloy contains the following metal elements in weight percentage: Gd 3-7%, Ag 0.1-1.0%, Ga 0.2-2.0%, Zr 0.1-0.6%, and the balance Mg. The magnesium alloy ingot is obtained by hot extrusion and solution treatment.
5. The method according to claim 4, characterized in that, The melting temperature of 99.99Mg is 650℃, that of Mg-20Gd is 740℃, that of 99.99Ag is 750℃, and that of Mg-30Zr is 780℃.
6. The method according to claim 4, characterized in that, The hot extrusion ratio is 16-25:1, and the extrusion speed is 0.1-0.5 mm / s.
7. The method according to claim 4, characterized in that, The solution treatment process has a solution temperature of 450-480℃ and a solution time of 15-20h; the aging temperature is 180-250℃ and the aging time is 10-60h.
8. The application of the magnesium alloy according to any one of claims 1 to 3 in the field of bio-orthopedics.
9. A medical implant, characterized in that, The medical implant is made of a magnesium alloy as described in any one of claims 1 to 3.
Citation Information
Patent Citations
Osteopathic magnesium alloy interstitial implant material and preparation method thereof
CN101899600A
Biodegradable Mg-Gd-Zn-Ag-Zr series magnesium alloy and preparation method thereof
CN103184379A
Micro-alloyed medical degradable magnesium alloy and preparation method thereof
CN107557633A
Biomedical degradable magnesium alloy with antibacterial function and preparation method thereof
CN109161750A
High-strength and high-corrosion-resistance biomedical Mg-Ga alloy and preparation method thereof
CN110016600A