Extrahepatic delivery drug and use thereof

Abstract

The present disclosure relates to an extrahepatic delivery drug and the use thereof. An oligonucleotide comprises a group as shown in general formula (I) located at any position of a nucleic acid chain of the oligonucleotide. A compound and the oligonucleotide of the present disclosure can achieve effective delivery of the oligonucleotide to tissue other than the liver, thus providing more tools for regulating gene expression, and expanding the uses thereof in RNAi drug research and development.

Description

Extrahcpatic delivery of drugs and application thereof TECHNICAL FIELD

[0001] The present disclosure belongs to the technical field of biological medicine, and particularly relates to an extrahcpatic delivery of drugs and application thereof. BACKGROUND

[0002] siRNA is a large molecule with a negative charge composed of two oligonucleotide chains, which cannot effectively target the target tissue in the body and cannot independently enter the cell. siRNA needs to rely on a special delivery carrier to achieve the enrichment of siRNA in the target organ and make it enter the cell to exert the therapeutic effect of siRNA.

[0003] Limited by immature delivery technology, the target tissue of small nucleic acid drugs is still mainly limited to liver tissue (past research has found that when siRNAs such as RNA therapy are modified with N-acetylgalactosamine (GalNAc), they can be delivered to the liver specifically), and the indications are mostly rare diseases and genetic diseases. Extrahcpatic delivery, especially CNS-targeted delivery, is still one of the main challenges that nucleic acid drugs need to face. In April 2023, Alnylam Pharmaceuticals, Inc. announced the interim results of the ongoing phase I single ascending dose trial of ALN-APP, an RNAi therapy targeting amyloid precursor protein (APP), which is being developed for the treatment of Alzheimer's disease (AD) and cerebral amyloid angiopathy (CAA). The early results of this phase I clinical trial mean that Alnylam's proprietary C16-siRNA conjugate platform has achieved its first human clinical translation in CNS delivery, and it is also the first clinical proof of RNAi therapy silencing pathogenic genes in the human brain. However, it is still necessary to develop more extrahcpatic delivery carriers. SUMMARY

[0004] The present disclosure aims to provide an extrahcpatic delivery of drugs and application thereof.

[0005] To achieve the above-mentioned purpose, the technical solution adopted by the present disclosure is as follows:

[0006] The present disclosure provides, in a first aspect, an oligonucleotide comprising a group as shown in general formula (I) at any position of the nucleic acid chain of the oligonucleotide:

[0007] wherein B is a natural nucleobase, a modified nucleobase, a universal base, or an H atom;

[0008] R1 and R2 are each independently H, OH, halogen, NH2, C1-C6 alkyl, C1-C6 alkoxy, C3-C7 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, S-CH3, NCH3(CH3), or OCH2CH2OCH3.

[0009] m, n are each independently 1, 2, or 3;

[0010] Z is absent or is one of the groups of formula (Z1)-(Z4):

[0011] wherein R4 is H, C1-C6 alkyl, C1-C6 alkoxy, C3-C7 cycloalkyl, C2-C6 alkenyl, or C2-C6 alkynyl;

[0012] X is absent or is one, two, three, four, or more of the groups of formula (X1)-(X12) in a linked combination:

[0013] wherein R3 is H, halogen, C1-C6 alkyl, C1-C6 alkoxy, C3-C7 cycloalkyl, C2-C6 alkenyl, or C2-C6 alkynyl;

[0014] j is an integer between 1 and 10; k is 1, 2, 3, or 4;

[0015] Y is one of the groups of formula (Y1)-(Y10):

[0016] wherein p is an integer between 5 and 25;

[0017] denotes the site of covalent linkage of the groups.

[0018] According to some embodiments, R1 and R2 are each independently H, OH, halogen, NH2, C1-C3 alkyl, C1-C3 alkoxy, C3-C6 cycloalkyl, C2-C4 alkenyl, C2-C4 alkynyl, S-CH3, NCH3(CH3), or OCH2CH2OCH3. Further, R1 and R2 are each independently H, OH, halogen, NH2, methyl, ethyl, propyl, methoxy, ethoxy, propoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, ethenyl, propenyl, butenyl, ethynyl, propynyl, butynyl, S-CH3, NCH3(CH3), or OCH2CH2OCH3. Further, R1 and R2 are each independently H, OH, methyl, ethyl, or propyl. Further, R1 and R2 are each H.

[0019] According to some embodiments, m is 1 or 2.

[0020] According to some embodiments, n is 1.

[0021] According to some embodiments, Z is absent, or is a group of formula (Z1) or a group of formula (Z3).

[0022] According to some embodiments, R4is H, C1-C3 alkyl, C1-C3 alkoxy, C3-C6 cycloalkyl, C2-C4 alkenyl, or C2-C4 alkynyl. Further, R4is H, methyl, ethyl, propyl, methoxy, ethoxy, propoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, ethenyl, propenyl, butenyl, ethynyl, propynyl, or butynyl. Further, R4is H, methyl, ethyl, or propyl. Further, R4is H.

[0023] According to some embodiments, the groups represented by X1-X12may be connected in any combination, wherein the left and right ends of the groups represented by X1-X12may be exchanged, for example, the N of X7may be connected to the Y group in formula (I), or to the C in formula (I).

[0024] According to some embodiments, X is absent or is a connecting combination of one, two, three, four, five, six, or seven of the groups represented by formula (X1), (X2), (X3), (X4), (X5), (X6), (X7), (X8), (X9), (X10), (X11), (X12).

[0025] According to some embodiments, X is absent, or is a connecting combination of one, two, three, four, or more of the groups represented by formula (X1), (X2), (X3), (X6), (X7), or (X12). Further, X is absent, or is a connecting combination of the group represented by formula (X1) and the group represented by formula (X6), the group represented by formula (X2) and the group represented by formula (X6), the group represented by formula (X6), the group represented by formula (X12), a connecting combination of the group represented by formula (X3) and the group represented by formula (X6), a connecting combination of the group represented by formula (X6) and the group represented by formula (X7), or a connecting combination of the group represented by formula (X2), the group represented by formula (X3), and the group represented by formula (X6).

[0026] According to some embodiments, R3is H, halogen, C1-C3 alkyl, C1-C3 alkoxy, C3-C6 cycloalkyl, C2-C4 alkenyl, or C2-C4 alkynyl. Further, R3is H, halogen, methyl, ethyl, propyl, methoxy, ethoxy, propoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, ethenyl, propenyl, butenyl, ethynyl, propynyl, or butynyl. Further, R3is H, methyl, ethyl, or propyl. Further, R3is H.

[0027] According to some embodiments, j is 1, 2, 3, 4, or 5. Further, j is 1, 2, or 3. Further, j is 1 or 2.

[0028] According to some embodiments, Y is a group of Formula (Y1), a group of Formula (Y2), a group of Formula (Y3), a group of Formula (Y4), a group of Formula (Y6), a group of Formula (Y7), a group of Formula (Y8), or a group of Formula (Y10).

[0029] According to some embodiments, p is an integer between 10 and 25, for example 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25.

[0030] According to some more specific embodiments, R2 is H, n is 1;

[0031] Z is absent, or is a group of Formula (Z1) or a group of Formula (Z3);

[0032] R1 is H, m is 1 or 2; R4 is H;

[0033] X is absent, or is a combination of a group of Formula (X1) and a group of Formula (X6), a combination of a group of Formula (X2) and a group of Formula (X6), a group of Formula (X6), a group of Formula (X12), a combination of a group of Formula (X3) and a group of Formula (X6), a combination of a group of Formula (X6) and a group of Formula (X7), or a combination of a group of Formula (X2), a group of Formula (X3), and a group of Formula (X6);

[0034] R3 is H;

[0035] j is 1 or 2; k is 1, 2, or 3;

[0036] Y is a group of Formula (Y1), a group of Formula (Y2), a group of Formula (Y3), a group of Formula (Y4), a group of Formula (Y6), a group of Formula (Y7), a group of Formula (Y8), or a group of Formula (Y10).

[0037] p is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25;

[0038] B is adenine, cytosine, guanine, uracil, or thymine.

[0039] According to some embodiments, B is a natural nucleobase, a modified nucleobase, or a universal base. Further, B is a natural nucleobase or a modified nucleobase. Further, B is adenine, cytosine, guanine, uracil, or thymine.

[0040] According to some embodiments, X is absent, and Y is a group of formula (Y1), wherein p is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25.

[0041] According to some embodiments, X is a group of formula (X12), and Y is a group of formula (Y2), wherein k is 1, 2, or 3, R3is H, methyl, ethyl, or propyl, and p is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25.

[0042] According to some embodiments, X is a group of formula (X6), and Y is a group of formula (Y8), wherein j is 1, 2, or 3, and p is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25.

[0043] According to some embodiments, the group formed by the connection of X and Y is any one of the following structural formulae:

[0044] wherein p is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25, R3is H, methyl, ethyl, or propyl, j is 1, 2, or 3, and k is 1, 2, or 3.

[0045] Further, Z is absent, or is a group of formula (Z1) or (Z3); R1and R2are each independently H, OH, methyl, ethyl, or propyl; and m and n are each independently 1 or 2.

[0046] According to some embodiments, Z is absent, R1and R2are each H, and m and n are each 1. The group of general formula (I) is shown in the following formula:

[0047] wherein X, Y, and B are as defined above.

[0048] According to some more specific embodiments, the group of general formula (I) is any one of the following structures:

[0049] Further, B is a natural nucleobase or a modified nucleobase. Still further, B is adenine, cytosine, guanine, uracil, or thymine.

[0050] According to some embodiments, the two covalent bond connection sites of the group as shown in general formula (I) are connected to adjacent nucleotides through phosphodiester bonds or phosphorothioate bonds, respectively. According to some embodiments, the oligonucleotide comprises an antisense strand complementary to a target gene, a sense strand complementary to the antisense strand; wherein the group as shown in general formula (I) is located at any position of the sense strand, for example, the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, fifteenth, sixteenth, seventeenth, eighteenth, or nineteenth position from the 5' end. Further, the group as shown in general formula (I) is located at any one or more of the first, fourth to eighth positions from the 5' end of the sense strand. Still further, the group as shown in general formula (I) is located at any one or more of the fifth, sixth, and seventh positions from the 5' end of the sense strand.

[0051] Further, the oligonucleotide is an siRNA.

[0052] According to some embodiments, the oligonucleotide is a single-stranded oligonucleotide, and the group as shown in general formula (I) is located at any position of the single-stranded oligonucleotide, for example, the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, fifteenth, sixteenth, seventeenth, eighteenth, or nineteenth position from the 5' end. Further, the group as shown in general formula (I) is located at any one or more of the first, fourth to eighth positions from the 5' end of the single-stranded oligonucleotide. Still further, the group as shown in general formula (I) is located at any one or more of the fifth, sixth, and seventh positions from the 5' end of the single-stranded oligonucleotide.

[0053] According to some embodiments, the oligonucleotide is one of a small interfering RNA, a microRNA, an anti-microRNA, a microRNA antagonist, a microRNA mimic, a decoy oligonucleotide, an immunostimulatory, a G-quadruplex, a splice-switching oligomer, a single-stranded RNA, an antisense nucleic acid, an aptamer, a stem-loop RNA, a mRNA fragment, and an activating RNA; optionally, the oligonucleotide is a single-stranded oligonucleotide or a double-stranded oligonucleotide.

[0054] According to some embodiments, the number of groups as shown in general formula (I) in the nucleic acid chain can be one, two, three, four, five, six, or more. When there are two or more groups as shown in general formula (I), the groups as shown in general formula (I) are the same or different.

[0055] According to some embodiments, each of the nucleotides in the oligonucleotide is independently a modified or unmodified nucleotide.

[0056] According to certain embodiments, at least one of the nucleotides in the sense strand or the antisense strand of the oligonucleotide is a modified nucleotide. In certain embodiments, the number of modified nucleotides in the sense strand is one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, or nineteen. In certain embodiments, the number of modified nucleotides in the antisense strand is one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or twenty-one. In certain embodiments, all of the nucleotides in the sense strand and the antisense strand are modified nucleotides.

[0057] According to some embodiments, some or all of the nucleotides in the oligonucleotide are modified nucleotides, and the modifications on the nucleotide groups do not result in a significant impairment or loss of the function of the oligonucleotide in inhibiting the expression of the corresponding gene.

[0058] According to certain embodiments, at least one of the phosphate groups in the sense strand or the antisense strand is a phosphate group with a modification group, preferably, the phosphate group with a modification group is a phosphorothioate group in which at least one of the oxygen atoms in the phosphodiester bond of the phosphate group is replaced by a sulfur atom.

[0059] According to certain embodiments, the 5’ terminal nucleotide of the sense strand is connected to a 5’ phosphate group or a 5’ phosphate derivative group.

[0060] According to certain embodiments, the 5’ terminal nucleotide of the antisense strand is connected to a 5’ phosphate group or a 5’ phosphate derivative group.

[0061] wherein the 5’ phosphate derivative group is a vinylphosphonate modified nucleotide.

[0062] According to certain embodiments, the modified nucleotide is a 2’-fluoro modified nucleotide, a 2’-alkoxy modified nucleotide, a 2’-substituted alkoxy modified nucleotide, a 2’-alkyl modified nucleotide, a 2’-substituted alkyl modified nucleotide, a 2’-deoxynucleotide, a 2’-amino modified nucleotide, a 2’-substituted amino modified nucleotide, a nucleotide analogue, or a combination of any two or more thereof.

[0063] Further, the modified nucleotide is a 2'-fluoro-modified nucleotide, a 2'-methoxy-modified nucleotide, a 2'-O-CH2-CH2-O-CH3 modified nucleotide, a 2'-O-CH2-CH=CH2 modified nucleotide, a 2'-CH2-CH2-CH=CH2 modified nucleotide, a 2'-deoxynucleotide, a nucleotide analogue, an inverted deoxyabasic deoxyribose residue, or a combination of any two or more thereof.

[0064] According to some preferred and specific embodiments, in the sense strand, in the 5' to 3' direction, the 2'-fluoro-modified nucleotide is located at the 7th, 8thand 9thpositions of the sense strand, and the rest of the positions are non-fluoro-modified nucleotides; or, the 2'-fluoro-modified nucleotide is located at the 7th, 9thand 11thpositions of the sense strand, and the rest of the positions are non-fluoro-modified nucleotides; or, the 2'-fluoro-modified nucleotide is located at the 7th, 9th, 10thand 11thpositions of the sense strand, and the rest of the positions are non-fluoro-modified nucleotides.

[0065] According to some preferred and specific embodiments, in the sense strand, in the 5' to 3' direction, the 2'-fluoro-modified nucleotide is located at the 7th, 8thand 9thpositions of the sense strand, and the rest of the positions are non-fluoro-modified nucleotides; or, the 2'-fluoro-modified nucleotide is located at the 7th, 9thand 11thpositions of the sense strand, and the rest of the positions are non-fluoro-modified nucleotides; or, the 2'-fluoro-modified nucleotide is located at the 7th, 9th, 10thand 11thpositions of the sense strand, and the rest of the positions are non-fluoro-modified nucleotides.

[0066] Further, the hydroxyl group at the 2' position of the ribosyl group of the non-fluoro-modified nucleotide is substituted with a methoxyl group.

[0067] Further, in the sense strand and the antisense strand, the base at the 5' end of the sense strand and the base at the 3' end of the sense strand are respectively connected to an inverted deoxyabasic deoxyribose residue containing a phosphate group or a phosphorothioate group.

[0068] According to some preferred and specific embodiments, in the sense strand, in the 5' to 3' direction, the sense strand comprises one or more phosphorothioate groups at any one or more of the following positions:

[0069] between the 1stand 2ndnucleotides from the 5' end of the sense strand;

[0070] between the 2ndand 3rdnucleotides from the 5' end of the sense strand.

[0071] Further, in the sense strand, in the 5' to 3' direction, the sense strand can further optionally comprise one or more phosphorothioate groups at any one or more of the following positions:

[0072] between the 1st and 2nd nucleotides from the 5' end of the antisense strand;

[0073] between the 2nd and 3rd nucleotides from the 5' end of the antisense strand.

[0074] According to some preferred embodiments and specific embodiments, in the antisense strand, in the 5' to 3' direction, the antisense strand comprises a phosphorothioate group at any one or more of the following positions:

[0075] between the 1st and 2nd nucleotides from the 5' end of the antisense strand;

[0076] between the 2nd and 3rd nucleotides from the 5' end of the antisense strand.

[0077] between the 1st and 2nd nucleotides from the 3' end of the antisense strand;

[0078] between the 2nd and 3rd nucleotides from the 3' end of the antisense strand.

[0079] According to some specific embodiments, the oligonucleotide targets a tissue other than the liver.

[0080] According to some specific embodiments, the oligonucleotide targets a CNS tissue, heart, gastrocnemius muscle or adipose tissue.

[0081] The second aspect of the present disclosure provides a compound represented by the following formula (II) or a tautomer thereof,

[0082] wherein E is a leaving group; Q is a phosphorus-containing active reactive group; B, R1, R2, m, n, Z, X and Y are as defined above in the oligonucleotide section, which will not be repeated here.

[0083] According to some specific embodiments, E is MMTr or DMTr.

[0084] According to some specific embodiments, Q is

[0085] According to some specific embodiments, the compound represented by formula (II) is any one of the following compounds:

[0086] The present disclosure also provides a method for preparing the above oligonucleotide, comprising the following steps:

[0087] (1) synthesizing a compound represented by the above general formula (II) or a tautomer thereof;

[0088] (2) synthesizing the oligonucleotide using the compound synthesized in step (1) or a tautomer thereof.

[0089] The present disclosure also provides a pharmaceutical composition comprising the above-mentioned oligonucleotide, and a pharmaceutically acceptable carrier or excipient.

[0090] The present disclosure also provides the use of the above-mentioned oligonucleotide or the above-mentioned pharmaceutical composition in the manufacture of a medicament for extrahepatic delivery.

[0091] The present disclosure also provides a method for reducing the expression of a target gene in a cell or tissue, the method comprising the step of contacting the cell or tissue with the above-mentioned oligonucleotide.

[0092] Further, the cell or tissue is from a human.

[0093] According to some embodiments, the cell is not a liver cell, i.e., the cell or tissue is a cell or tissue other than a liver cell or liver tissue.

[0094] According to some embodiments, the tissue is CNS tissue, heart, gastrocnemius muscle or adipose tissue, and the cell is a cell from CNS tissue, heart, gastrocnemius muscle or adipose tissue.

[0095] The present disclosure also provides a method for reducing the expression of a target gene in a subject, the method comprising the step of administering to the subject the above-mentioned oligonucleotide.

[0096] Further, the subject is a human.

[0097] Thanks to the above technical solutions, the present disclosure has the following advantages compared with the prior art:

[0098] The compounds and oligonucleotides of the present disclosure can effectively deliver oligonucleotides to tissues other than the liver, providing more tools for regulating gene expression and expanding their application in the development of RNAi drugs. BRIEF DESCRIPTION OF DRAWINGS

[0099] Figure 1 is a graph of the results of the in vivo experiment of mice in Example 17;

[0100] Figure 2 is a graph of the results of the in vivo experiment of mice in Example 18;

[0101] Figure 3 is a graph of the results of the in vivo experiment of mice in Example 19;

[0102] Figure 4 is a graph of the results of the in vivo experiment of rats in Example 20;

[0103] Figure 5 is a graph of the results of the in vivo experiment of rats in Example 21;

[0104] Figure 6 is a graph of the results of the in vivo experiment of mice in Example 22. DETAILED DESCRIPTION

[0105] It should be noted that the technical and scientific terms used in the present disclosure should be understood as the common meaning understood by a person skilled in the art, unless otherwise defined. The experimental methods in the following examples are all conventional methods, unless otherwise specified. The medicinal material raw materials, reagent materials and the like used in the following examples are all commercially available products, unless otherwise specified. As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0106] DEFINITIONS

[0107] As used herein, a dash ("-") that is not between two letters or two characters is used to indicate that the conjoined terms are open-ended and have the same meaning as if each term was written out individually i.e., "a combination including at least one of the terms is one of the terms. is used to indicate the position of the point of attachment of a substituent group.

[0108] It will be understood by those skilled in the art that, for any given group containing one or more substituents, such groups do not intend to introduce any substitution or substitution patterns that are not synthetically practical, that are inherently unstable, and / or that would have a very low probability of occurring in nature.

[0109] As used herein, "alkyl" refers to straight chain and branched chain saturated organic groups composed of carbon and hydrogen atoms. For example, C1-C6 alkyl refers to straight chain and branched chain alkyl groups containing from 1 to 6 carbon atoms. When reference is made to an alkyl group having a specific number of carbons, it is intended to encompass all possible branched and straight chain forms having that number of carbons; thus, for example, "butyl" is meant to include n-butyl, sec-butyl, iso-butyl, and t-butyl; "propyl" includes n-propyl and iso-propyl. Alkylene is a subset of alkyl, referring to the same groups as alkyl, but having two points of attachment.

[0110] As used herein, "alkoxy" refers to -OR, where R represents an alkyl group. For example, in C1-C6 alkoxy, R represents a straight chain or branched chain alkyl group containing from 1 to 6 carbon atoms.

[0111] As used herein, "cycloalkyl" refers to non-aromatic carbon rings, C3-C7 cycloalkyl refers to cyclic alkyl groups having from 3 to 7 carbon atoms. The ring can be saturated, or have one or more carbon-carbon double bonds. Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, and cyclohexenyl, as well as bridged and clathrate ring groups such as norbornane.

[0112] As used herein, "alkenyl" refers to a straight or branched hydrocarbon chain radical consisting of carbon and hydrogen atoms and having one or more carbon-carbon double bonds. Each alkenyl group is attached to the rest of the molecule by a single bond. Alkenyl groups containing up to six carbon atoms are C2-C6 alkenyl and alkenyl groups containing up to five carbon atoms are C2-C5 alkenyl. C2-C5 alkenyl includes C5 alkenyl, C4 alkenyl, C3 alkenyl, and C2 alkenyl. C2-C6 alkenyl includes all moieties described above for C2-C5 alkenyl but also includes C6 alkenyl. Non-limiting examples of C2-C6 alkenyl include ethylene (ethenyl), 1-propenyl, 2-propenyl (allyl), isopropenyl, 2-methyl-1-propenyl, 1-butenyl, 2-butenyl, 3-butenyl, 1-pentenyl, 2-pentenyl, 3-pentenyl, 4-pentenyl, 1-hexenyl, 2-hexenyl, 3-hexenyl, 4-hexenyl, 5-hexenyl.

[0113] As used herein, "alkynyl" refers to a straight or branched hydrocarbon chain radical consisting of carbon and hydrogen atoms and having one or more carbon-carbon triple bonds. Each alkynyl group is attached to the rest of the molecule by a single bond. Alkynyl groups containing up to six carbon atoms are C2-C6 alkynyl and alkynyl groups containing up to five carbon atoms are C2-C5 alkynyl. C2-C5 alkynyl includes C5 alkynyl, C4 alkynyl, C3 alkynyl, and C2 alkynyl. C2-C6 alkynyl includes all moieties described above for C2-C5 alkynyl but also includes C6 alkynyl. Non-limiting examples of C2-C6 alkynyl include ethynyl, propynyl, butynyl, pentynyl, and the like. Unless specifically indicated in the specification, hydrocarbyl groups can be optionally substituted.

[0114] The compounds of the present disclosure can contain one or more asymmetric centers and thus can exist in enantiomeric, diastereomeric, and other stereoisomeric forms. The present disclosure is meant to include all such possible isomers, as well as their racemic and optically pure forms. Optical isomers (+) and (-), (R)- and (S)-, or (D)- and (L)- can be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques (e.g., chromatography and fractional crystallization). Conventional techniques for the preparation / isolation of individual enantiomers include chiral synthesis from a suitable optically pure precursor (i.e., a chiral synthesis

[0115] “Stereoisomers” refer to compounds consisting of the same atoms bonded by the same bonds but having different three-dimensional structures that are not interchangeable. The present disclosure encompasses various stereo isomers and mixtures thereof, and includes “enantiomers,” which refer to two stereoisomers whose molecules are non-superimposable mirror images of one another.

[0116] “Tautomers” refer to the transfer of a proton from one atom of a molecule to another atom of the same molecule. The present disclosure includes tautomers of any of the compounds described.

[0117] In the nucleotide sequences of the present disclosure, capital letters A, C, G, U represent adenosine-3'-phosphate, cytidine-3'-phosphate, guanosine-3'-phosphate, uridine-3'-phosphate, respectively; lower case letter m represents that the nucleotide adjacent to the left of the letter m is a methoxy-modified nucleotide; lower case letter f represents that the nucleotide adjacent to the left of the letter f is a fluoro-modified nucleotide; lower case letter s represents that the two nucleotides adjacent to the left and right of the letter s are linked by phosphorothioate group; letter combination VP represents that the nucleotide adjacent to the right of the letter combination VP is a vinylphosphonate-modified nucleotide, as shown in the following figure. Lower case letter d represents that the nucleotide adjacent to the right of the letter is a deoxy nucleotide, such as dT represents thymine deoxy nucleotide.

[0118] As used herein, the term “nucleotide position” refers to the position of a nucleotide in an oligonucleotide as counted from the 5' end of the oligonucleotide. For example, nucleotide position 1 refers to the 5' end nucleotide of an oligonucleotide.

[0119] As used herein, an oligonucleotide refers to a polymeric form of nucleotides within the range of 2 to 2500 nucleotides. In certain embodiments, an oligonucleotide has 500 to 1500 nucleotides, typically, for example, where the oligonucleotide is used in gene therapy. In certain embodiments, an oligonucleotide has 7 to 100 nucleotides. In certain embodiments, an oligonucleotide has 15 to 100 nucleotides. In another embodiment, an oligonucleotide has 15 to 50 nucleotides, typically, for example, where the oligonucleotide is a nucleic acid inhibitor molecule. In another embodiment, an oligonucleotide is double-stranded having 25 to 40 nucleotides. In yet another embodiment, an oligonucleotide has 19 to 40 or 19 to 25 nucleotides, typically, for example, where the oligonucleotide is a double-stranded nucleic acid inhibitor molecule and forms a double helix having at least 18 to 25 base pairs. Typically, as described herein, an oligonucleotide contains one or more phosphorus-containing internucleotide linking groups. In other embodiments, as described herein, the internucleotide linking groups are phosphoramide groups.

[0120] As used herein, the term "natural nucleobase" refers to a nucleobase that has not been modified from the naturally occurring form of the nucleobase in RNA or DNA. Examples of "natural nucleobases" include the purine nucleobases adenine (A) and guanine (G) and the pyrimidine nucleobases thymine (T), cytosine (C), and uracil (U). In addition to "natural nucleobases," a number of modified nucleobases or nucleobase mimetics known to those skilled in the art are suitable for use in the compounds described herein.

[0121] As used herein, the term "modified nucleobase" refers to a nucleobase that is structurally very similar to the parent nucleobase, and the native nucleobase can be modified or substituted to provide iRNA with improved properties. For example, nuclease-resistant oligonucleotides can be prepared using these bases or any of synthetic and native nucleobases (e.g., inosine, xanthine, hypoxanthine, nubularine, isoguanisine, or tubercidine). Alternatively, any of the aforementioned bases and substituted or modified analogs of "universal bases" can be used. When a native base is substituted with a non-native and / or universal base, the nucleotide is referred to as containing the modified nucleobases described herein. Exemplary modified nucleobases include, but are not limited to, other synthetic and natural nucleobases, such as inosine, xanthine, hypoxanthine, muscarin, isoguanosine, tuberculin, 2-(halo)adenine, 2-(alkyl)adenine, 2-(propyl)adenine, 2-(amino)adenine, 2-(aminoalkyl)adenine, 2-(aminopropyl)adenine, 2-(meththio)-N6-(isopentenyl)adenine, 6-(alkyl)adenine, 6-(methyl)adenine, 7-(denitro)adenine, 8-(alkenyl)adenine, 8-(alkyl)adenine, etc. 8-(Alkyne)adenine, 8-(amino)adenine, 8-(halo)adenine, 8-(hydroxy)adenine, 8-(thioalkyl)adenine, 8-(thiol)adenine, N6-(isopentyl)adenine, N6-(methyl)adenine, N6,N6-(dimethyl)adenine, 2-(alkyl)guanine, 2-(propyl)guanine, 6-(alkyl)guanine, 6-(methyl)guanine, 7-(alkyl)guanine, 7-(methyl)guanine, 7-(denitro)guanine, 8-(alkyl)guanine 8-(Alkenyl)guanine, 8-(Alkynyl)guanine, 8-(Amino)guanine, 8-(Hallo)guanine, 8-(Hydroxy)guanine, 8-(Thioalkyl)guanine, 8-(Mthio)guanine, N-(Methyl)guanine, 2-(Thio)cytosine, 3-(Deazon)-5-(Zaza)cytosine, 3-(Alkyl)cytosine, 3-(Methyl)cytosine, 5-(Alkyl)cytosine, 5-(Alkynyl)cytosine, 5-(Hallo)cytosine, 5-(Methyl)cytosine, 5-(Propyynyl)cytosine, 5-(Propyynyl)cytosine 5-(trifluoromethyl)cytosine, 6-(azo)cytosine, N4-(acetyl)cytosine, 3-(3-amino-3-carboxypropyl)uracil, 2-(thio)uracil, 5-(methyl)-2-(thio)uracil, 5-(methylaminomethyl)-2-(thio)uracil, 4-(thio)uracil, 5-(methyl)-4-(thio)uracil, 5-(methylaminomethyl)-4-(thio)uracil, 5-(methyl)-2,4-(dithio)uracil, 5-(methylaminomethyl)-2,4-4-(disulfanyl)uracil, 5-(2-aminopropyl)uracil, 5-(alkyl)uracil, 5-(alkynyl)uracil, 5-(allylamino)uracil, 5-(aminoallyl)uracil, 5-(aminoalkyl)uracil, 5-(guanidinoalkyl)uracil, 5-(1,3-oxadiazol-1-yl)uracil, 5-(cyanoalkyl)uracil, 5-(dialkylaminoalkyl)uracil, 5-(dimethylaminoalkyl)uracil, 5-(halo)uracil, 5-(methoxy)uracil, uracil-5-oxyacetic acid, 5-(methoxycarbonylmethyl)-2-(sulfanyl)uracil, 5-(methoxycarbonyl-methyl)uracil, 5-(propynyl)uracil, 5-(propynyl)uracil, 5-(trifluoromethyl)uracil, 6-(azo)uracil, dihydrouracil, N3-(methyl)uracil, 5-uracil (i.e., pseudouracil), 2-(sulfanyl)pseudouracil, 4-(sulfanyl)pseudouracil, 2,4-(disulfanyl)pseudouracil, 5-(alkyl)pseudouracil, 5-(methyl)pseudouracil, 5-(alkyl)-2-(sulfanyl)pseudouracil, 5-(methyl)-2-(sulfanyl)pseudouracil, 5-(alkyl)-4-(sulfanyl)pseudouracil, 5-(methyl)-4-(sulfanyl)pseudouracil, 5-(alkyl)-2,4-(disulfanyl)pseudouracil, 5-(methyl)-2,4-(disulfanyl)pseudouracil, 1-substituted pseudouracil, 1-substituted 2(sulfanyl)-pseudouracil, 1-substituted 4-(sulfanyl)pseudouracil, 1-substituted 2,4-(disulfanyl)pseudouracil, 1-(aminocarbonylvinyl)-pseudouracil, 1-(aminocarbonylvinyl)-2(sulfanyl)-pseudouracil, 1-(aminocarbonylvinyl)-4-(sulfanyl)pseudouracil, 1-(aminocarbonylvinyl)-2,4-(disulfanyl)pseudouracil, 1-(aminoalkaminocarbonylvinyl)-pseudouracil, 1-(aminoalkamino-carbonylvinyl)-2(sulfanyl)-pseudouracil, 1-(aminoalkaminocarbonylvinyl)-4-(sulfanyl)pseudouracil, 1-(aminoalkaminocarbonylvinyl)-2,4-(disulfanyl)pseudouracil, 1,3-(diazepin-2-yl)-oxo-phenoxazin-1-yl, 1-(azepin-2-yl)-sulfanyl-3-(azepin)-phenoxazin-1-yl, 1,3-(diazepin-2-yl)-oxo-phenothiazin-1-yl, 1-(azepin-2-yl)-sulfanyl-3-(azepin)-phenothiazin-1-yl, 7-substituted 1,3-(diazepin-2-yl)-oxo-phenoxazin-1-yl, 7-substituted 1-(azepin-2-yl)-sulfanyl-3-(azepin)-phenoxazin-1-yl, 7-substituted 1,3-(diazepin-2-yl)-oxo-phenothiazin-1-yl, 7-substituted 1-(azepin-2-yl)-sulfanyl-3-(azepin)-phenothiazin-1-yl, 7-(aminoalkylhydroxy)-1,3-(diazepino)-2-(oxazepino)-phenoxazin-1-yl, 7-(aminoalkylhydroxy)-1,3-(diazepino)-2-(oxazepino)- phenoxazin-1-yl, 7-(aminoalkylhydroxy)-1-(azepino)-2-(thiazepino)-3-(diazepino)- phenoxazin-1-yl, 7-(guanidinoalkylhydroxy)-1,3-(diazepino)-2-(oxazepino)- phenoxazin-1-yl, 7-(guanidinoalkylhydroxy)-1-(azepino)-2-(thiazepino)-3-(diazepino)- phenoxazin-1-yl, 7-(guanidinoalkylhydroxy)-1,3-(diazepino)-2-(oxazepino)- phenoxazin-1-yl, 7-(guanidinoalkylhydroxy)-1-(azepino)-2-(thiazepino)-3-(diazepino)- phenoxazin-1-yl, 1,3,5-(triazepino)-2,6-(dioxazepino)-naphthalene, inosine, xanthine, hypoxanthine, leuco-mycin, tubercidin, isoguanosine, inosinyl, 2-azainosinyl, 7-deaza-inosinyl, nitroimidazolyl, nitro-pyrazolyl, nitro-benzimidazolyl, nitro-indazolyl, amino-indolyl, pyrrolo-pyrimidinyl, 3-(methyl)isoquinolinonyl, 5-(methyl)isoquinolinonyl, 3-(methyl)-7-(propynyl)isoquinolinonyl, 7-(azepino)indolyl, 6-(methyl)-7-(azepino)indolyl, imidazopyridinyl, 9-(methyl)- imidazopyridinyl, pyrrolopyrazinyl, isoquinolinonyl, 7-(propynyl)isoquinolinonyl, propynyl-7-(azepino)indolyl, 2,4,5-(trimethyl)phenyl, 4-(methyl)indolyl, 4,6-(dimethyl)indolyl, phenyl, naphthyl, anthryl, phenanthryl, pyrenyl, pyryl, tetracenyl, pentacenyl, difluorotolyl, 4-(fluoro)-6-(methyl)benzimidazole, 4-(methyl)benzimidazole, 6-(azo)thymine, 2-pyridone, 5-nitroindole, 3-nitro-pyrrole, 6-(azapyrimidine), 2-(amino)purine, 2,6-(diamino)purine, 5-substituted pyrimidine, N2-substituted purine, N6-substituted purine, O6-substituted purine, substituted 1,2,4-triazole, pyrrolo-pyrimidin-2-one-3-yl, 6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, para-substituted 6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, ortho-substituted 6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, bis-ortho-substituted 6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, para-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, bis-ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, pyridopyrimidin-3-yl, 2-oxo-7-amino-pyridopyrimidin-3-yl, 2-oxo-pyridopyrimidin-3-yl, or any O-alkylated or N-alkylated derivative thereof. As used herein, a universal nucleic acid base: a base that can pair complementarily with at least two of the common bases, such as Hypoxanthine (whose nucleoside is Inosine), which can pair with any of A, T, G, or C, with the binding ability I:C > I:A > I:G > I:T; or is such as BrU (5-Bromouridine), which can pair with A or G; alternatively, other universal bases having the ability to pair complementarily with at least two of the common bases can be alternatively used in the present disclosure, such as 3-nitropyrrole, 5-nitroindole, 7-Azaindole, and the like.

[0122] As used herein, a "fluoro-modified nucleotide" refers to a nucleotide in which the hydroxyl group at the 2' position of the ribose group is replaced with a fluorine, having the structure shown in formula (7) below. In some embodiments, the 2'-alkyl-modified nucleotide is a methoxy-modified nucleotide (2'-OMe), as shown in formula (8).

[0123] wherein base represents a base, such as A, U, G, C, or T.

[0124] As used herein, a "non-fluoro-modified nucleotide" refers to a nucleotide in which the hydroxyl group at the 2' position of the ribose group is replaced with a non-fluoro group.

[0125] In the context of the present disclosure, particularly when describing methods of making siRNAs, siRNA-containing compositions, or siRNA conjugates of the present disclosure, the nucleoside monomers refer, unless otherwise specified, to modified or unmodified nucleoside phosphoramidite monomers (unmodified or modified RNA phosphoramidites, sometimes also referred to as Nucleoside phosphoramidites) used in the phosphoramidite solid phase synthesis according to the kind and order of nucleotides in the siRNA or siRNA conjugate to be made. Phosphoramidite solid phase synthesis is a method well known to those skilled in the art for use in RNA synthesis. All nucleoside monomers used in the present disclosure are commercially available.

[0126] Various hydroxyl protecting groups can be used in the present disclosure. In general, a protecting group renders a chemical functional group insensitive to particular reaction conditions, and can be added to and removed from that functional group in a molecule without substantially damaging the rest of the molecule. Representative hydroxyl protecting groups are disclosed in Beaucage et al., Tetrahedron 1992, 48, 2223-2311, and Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2d ed, John Wiley & Sons, New York, 1991, which are incorporated herein by reference in their entireties. In some embodiments, the protecting group is stable under basic conditions, but can be removed under acidic conditions. In some embodiments, nonexclusive examples of hydroxyl protecting groups that can be used herein include dimethoxytrityl (DMT), monomethoxytrityl, 9-phenylxanthine-9-yl (Pixyl), and 9-(p- methoxyphenyl)xanthine-9-yl (Mox). In some embodiments, nonexclusive examples of hydroxyl protecting groups that can be used herein include Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4’-dimethoxytrityl), and TMTr (4,4’,4”-trimethoxytrityl), and tert-butyldimethylsilyl (TBS or TBDMS). Nonexclusive examples of hydroxyl protecting groups that can be used herein include hydrocarbyl acyl groups.

[0127] The pharmaceutically acceptable carrier described in the present disclosure can be a carrier conventionally used in the field of siRNA administration, for example, but not limited to, one or more of magnetic nanoparticles (such as nanoparticles based on Fe3O4 or Fe2O3), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethylenimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine) (PLL), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly(D&L-lactic / glycolic acid) copolymer (PLGA), poly(2-aminoethyl ethylene phosphate) (PPEEA), and poly(2-dimethylaminoethyl methacrylate) (PDMAEMA), and derivatives thereof. The excipient can be one or more of various formulations or compounds conventionally employed in the art. For example, the pharmaceutically acceptable other excipient can include at least one of a pH buffer, a protective agent, and an osmotic pressure adjusting agent.

[0128] The term "subject," as used herein, refers to any animal, such as a mammal or a marsupial. Subjects of the present disclosure include, but are not limited to, humans, non-human primates (e.g., rhesus or other types of macaques), mice, pigs, horses, donkeys, cows, rabbits, sheep, rats, and any species of poultry.

[0129] As used herein, "treatment" refers to an approach for obtaining beneficial or desired results, including but not limited to therapeutic benefit. A "therapeutic benefit" means eradication or amelioration of the underlying disorder being treated. Also, a therapeutic benefit is achieved with the improvement of one or more signs or symptoms of the underlying disorder being treated, even though the subject can still be afflicted with the disorder. As used herein, "treatment" refers to an approach for obtaining beneficial or desired results, including but not limited to therapeutic benefit. A "therapeutic benefit" means eradication or amelioration of the underlying disorder being treated. Also, a therapeutic benefit is achieved with the improvement of one or more signs or symptoms of the underlying disorder being treated, even though the subject can still be afflicted with the disorder.

[0130] "Prevention" as used herein refers to a method of obtaining a beneficial or desired result including, but not limited to, prophylactic benefit. To obtain "prophylactic benefit," the siRNA, siRNA conjugate, or pharmaceutical composition can be administered to a subject at risk of developing a particular disease, or to a subject reporting one or more physiological symptoms of a disease, even though the diagnosis of this disease can not have been made.

[0131] The technical solutions provided by the present disclosure are further described below in combination with specific examples. The following examples are only used to illustrate the present disclosure and will not limit the protection scope of the present disclosure.

[0132] Preparation of compound SA153 of Example 1

[0133] Preparation of intermediate 1-1 in 1.1

[0134] Compound methyl 3-hydroxypropanoate (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (1.2 equiv, 9.43 mmol, 0.98 g) was placed in a clean and dry reaction bottle, 50 mL of tetrahydrofuran was added, and the solution was protected by argon gas replacement, lithium diisopropylamide (2.0 equiv, 15.72 mmol, 7.86 mL, 2.0 M in hexane) was slowly added at -70°C, and then the stirring was continued for 0.5 hours under argon protection at -70°C. Then, heptadecanal (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (1.0 equiv, 7.86 mmol, 2.0 g) was slowly added to the reaction solution, and then the stirring was continued for 10 minutes under argon protection at -70°C. After the reaction, the reaction was quenched with 60 mL of saturated ammonium chloride solution. The organic phase was separated, and the aqueous phase was extracted with ethyl acetate twice. The organic phase was combined, dried, filtered and concentrated, and the obtained crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 100 / 0-50 / 50) to obtain compound 1-1 (1.37 g, 3.82 mmol, 49% yield) as a colorless oil. Compound 1-1: molecular formula: C 21 H 42 O4, molecular weight: 358.3, LC-MS found 359.3 (M+H).

[0135] Preparation of intermediate 1-2 in 1.2

[0136] Compound 1-1 (3.82 mmol, 1.37 g) and imidazole (4.0 equiv, 15.28 mmol, 1.04 g) were placed in a clean and dry reaction flask, 50 mL of N,N-dimethylformamide was added, and t-butyldimethylsilyl chloride (3.0 equiv, 11.46 mmol, 1.73 g) was slowly added at room temperature, followed by continued stirring at room temperature overnight. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine were used for washing, the organic phase was dried, filtered and concentrated, and the obtained crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 20 / 1-5 / 1) to obtain compound 1-2 (1.6 g, 2.73 mmol, 71% yield) as a colorless oil. Compound 1-2: Molecular Formula: C 33 H 70 O4Si2, Molecular Weight: 586.4, LC-MS found 587.4 (M+H).

[0137] 1.3 Preparation of intermediate 1-3

[0138] Compound 1-2 (2.73 mmol, 1.6 g) was placed in a clean and dry reaction flask, and 60 mL of tetrahydrofuran was added, and the solution was protected by argon gas replacement. The reaction solution was cooled to -70°C, and diisobutylaluminum hydride (2.2 equiv, 6.0 mmol, 6.0 mL, 1.0 M in THF) was slowly added dropwise under argon protection. After the dropwise addition was completed, the temperature was raised to 0°C and stirring was continued for one hour. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and 150 mL of saturated potassium sodium tartrate solution was used for washing, the organic phase was dried, filtered and concentrated, and the obtained crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 20 / 1-1 / 1) to obtain compound 1-3 (1.15 g, 2.06 mmol, 75% yield) as a light yellow oil. Compound 1-3: Molecular Formula: C 32 H 70 O3Si2, Molecular Weight: 558.5, LC-MS found 581.5 (M+Na).

[0139] 1.4 Preparation of intermediate 1-4

[0140] Compound 1-3 (2.05 mmol, 1.15 g) was placed in a clean and dry reaction flask, 50 mL of anhydrous tetrahydrofuran was added, and triphenylphosphine (2.0 equiv, 4.1 mmol, 1.08 g) and 3-benzoyluracil (commercially available, purchased from Shanghai Titan Science and Technology Co., Ltd.) (1.1 equiv, 2.26 mmol, 0.49 g) were added at room temperature, followed by dropwise addition of diisopropyl azodicarboxylate (2.0 equiv, 4.1 mmol, 0.83 g) under argon protection. After dropwise addition, the reaction was stirred at room temperature overnight. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, washed with 150 mL of saturated brine, dried the organic phase, filtered and concentrated, and the obtained crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 20 / 1-1 / 4), to obtain compound 1-4 (1.4 g, 1.85 mmol, 90% yield) as an oil. Compound 1-4: Molecular formula: C 43 H 76 N2O5Si2, Molecular weight: 756.5, LC-MS found 757.5 (M+H).

[0141] 1.5 Preparation of intermediate 1-5

[0142] Compound 1-4 (1.85 mmol, 1.4 g) was placed in a clean and dry reaction flask, 30 mL of methanol was added, and sodium methoxide in methanol (3.0 equiv, 5.55 mmol, 1.0 g, 30% wt in MeOH) was added, and the stirring was continued at room temperature for 5 hours. After the reaction, dilute hydrochloric acid was added to adjust the pH to neutral, and the reaction solution was directly concentrated to obtain crude product white solid compound 1-5, which was directly used in the next step without further purification. Compound 1-5: Molecular formula: C 36 H 72 N2O4Si2, Molecular weight: 652.5, LC-MS found 653.5 (M+H).

[0143] 1.6 Preparation of intermediate 1-6

[0144] Compounds 1-5 (1.85 mmol, 1.2 g) were placed in a clean, dry reaction flask, and 50 mL of tetrahydrofuran was added, followed by tetrabutylammonium fluoride (4.0 equiv, 7.4 mmol, 7.4 mL, 1.0 M in THF). The mixture was stirred overnight at room temperature. After the reaction, 150 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 150 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 100 / 1-10 / 1) to give the oily compound 1-6 (0.7 g, 1.65 mmol, 89% two-step yield). The molecular formula of compounds 1-6 is C1. 24 H 44 N2O4, molecular weight: 424.3, LC-MS yielded 425.3 (M+H).

[0145] 1.7 Preparation of intermediates 1-7

[0146] Compounds 1-6 (1.65 mmol, 0.7 g) were placed in a clean, dry reaction flask, and 50 mL of pyridine was added. Then, 4,4'-bismethoxytriphenylmethyl chloride (1.5 equiv, 2.47 mmol, 0.84 g) was added at room temperature, followed by stirring overnight at room temperature. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 50 / 1-8 / 1) to give a pale yellow oily compound 1-7 (0.9 g, 1.23 mmol, 75% yield). The molecular formula of compounds 1-7 is C1. 45 H 62 N2O6, molecular weight: 726.5, LC-MS showed a molecular weight of 727.5 (M+H).

[0147] 1.8 Preparation of compound SA153

[0148] Compounds 1-7 (1.23 mmol, 0.9 g) were placed in a clean, dry reaction flask, and 50 mL of anhydrous dichloromethane was added. Under argon protection at room temperature, compounds 2-cyanoethyl N,N,N',N'-tetraisopropylphosphonamide (2.0 equiv, 2.46 mmol, 0.74 g) and 4,5-dicyanimidazole (1.5 equiv, 1.85 mmol, 0.22 g) were added, and the mixture was stirred at room temperature for one hour. After the reaction, 50 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution. The organic phase was dried, filtered, and concentrated. The crude product was then subjected to a C8 reversed-phase column (size: 30 μm). Compound SA153 (0.72 g, 0.77 mmol, 63% yield) was obtained as colorless oil by preparative HPLC (gradient elution: water / acetonitrile = 95 / 5-0 / 100) from the commercially available starting material (purchased from Shanghai Bioner Biotech Co., Ltd.). Compound SA153 Formula: C 54 H 79 N4O7P, Molecular weight: 926.6, LC-MS found 925.6 (M-H). 1 HNMR (400 MHz, DMSO-d6) δ 11.17 (s, 1H), 7.43 (t, J = 8.5 Hz, 1H), 7.37 - 7.23 (m, 4H), 7.21 - 7.12 (m, 5H), 6.87 - 6.77 (m, 4H), 5.47 (dd, J = 28.7, 7.3 Hz, 1H), 3.96 - 3.84 (m, 1H), 3.83 - 3.75 (m, 1H), 3.71 (s, 6H), 3.63 - 3.55 (m, 2H), 3.53 - 3.43 (m, 2H), 3.24 - 3.03 (m, 1H), 3.01 - 2.85 (m, 1H), 2.72 - 2.61 (m, 2H), 1.59 - 1.35 (m, 2H), 1.33 - 1.22 (m, 30H), 1.09 - 1.01 (m, 12H), 0.84 (t, J = 6.6 Hz, 3H). 31 P NMR (162 MHz, DMSO-d6): δ 147.64, 147.58, 146.97, 146.90.

[0149] Preparation of compound SA145 of Example 2

[0150] Compound SA145 0.86 g was obtained as colorless oil from the starting material hexadecanal (commercially available, purchased from Shanghai Titan Scientific Co., Ltd.) according to the synthetic method of Example 1. Compound SA145 Formula: C 53 H 77 N4O7P, Molecular weight: 912.5, LC-MS found 911.6 (M-H). 1H NMR (400 MHz, DMSO-d6): δ 11.19 (s, 1H), 7.40 (dd, J = 22.6, 7.9 Hz, 1H), 7.34 - 7.23 (m, 4H), 7.21 - 7.15 (m, 5H), 6.86 - 6.80 (m, 4H), 5.47 (dd, J = 28.6, 7.8 Hz, 1H), 3.95 - 3.85 (m, 1H), 3.82 - 3.75 (m, 1H), 3.72 (s, 6H), 3.65 - 3.56 (m, 2H), 3.54 - 3.44 (m, 3H), 3.23 - 3.07 (m, 2H), 2.99 - 2.91 (m, 1H), 2.77 - 2.62 (m, 2H), 1.60 - 1.43 (m, 2H), 1.35 - 1.21 (m, 26H), 1.15 - 1.00 (m, 12H), 0.84 (t, J = 6.7 Hz, 3H). 31 P NMR (162 MHz, DMSO-d6): δ 148.14, 147.89, 146.97, 146.89.

[0151] Preparation of compound SA195 of Example 3

[0152] Preparation of intermediate 3-1 in 3.1

[0153] Compound nonadecanol (6.0 mmol, 1.7 g) (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) was placed in a clean and dry reaction bottle, 50 mL of dichloromethane was added, then Dess-Martin oxidant (2.0 equiv, 12.0 mmol, 5.1 g) was slowly added under ice water bath, stirred at room temperature for 2 hours. After the reaction, 100 mL of dichloromethane was added to the reaction solution, washed with 100 mL of saturated brine, dried the organic phase, filtered and concentrated, the obtained crude product was oily compound 3-1, which was directly used in the next step without further purification. Compound 3-1: molecular formula: C 19 H 38 O, molecular weight: 282.2, LC-MS found 283.3 (M+H).

[0154] Preparation of compound SA195 in 3.2

[0155] According to the synthesis method of Example 1, compound SA195 0.8 g was prepared from intermediate 3-1 as a colorless oil. Compound SA195: molecular formula: C 56 H 83 N4O7P, molecular weight: 954.6, LC-MS found 953.3 (M-H). 1H NMR (400 MHz, DMSO-d6) δ 11.16 (s, 1H), 7.42 (dd, J = 9.9, 8.0 Hz, 1H), 7.33 (dt, J = 11.9, 6.5 Hz, 3H), 7.27 - 7.16 (m, 6H), 6.82 (dt, J = 7.0, 5.5 Hz, 4H), 5.51 - 5.41 (m, 1H), 3.91 (dt, J = 18.1, 11.2 Hz, 1H), 3.79 (dd, J = 13.2, 9.0 Hz, 1H), 3.70 (s, 6H), 3.60 (dt, J = 18.3, 5.5 Hz, 2H), 3.50 - 3.42 (m, 2H), 3.26 - 3.02 (m, 1H), 3.00 - 2.85 (m, 1H), 2.71 - 2.61 (m, 2H), 1.59 - 1.32 (m, 2H), 1.29 - 1.21 (m, 34H), 1.14 - 1.00 (m, 12H), 0.82 (t, J = 6.6 Hz, 3H). 31 P NMR (162 MHz, DMSO-d6): δ 147.97, 147.60, 146.93, 146.84.

[0156] Preparation of compound SA196 of Example 4

[0157] Preparation of intermediate 4-1 in 4.1

[0158] Compound docosanol (6.0 mmol, 1.96 g) (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) was placed in a clean and dry reaction bottle, 50 mL of dichloromethane was added, then Dess-Martin oxidant (2.0 equiv, 12.0 mmol, 5.1 g) was slowly added under ice water bath, stirred at room temperature for 2 hours. After the reaction, 100 mL of dichloromethane was added to the reaction solution, washed with 100 mL of saturated brine, dried the organic phase, filtered and concentrated, the obtained crude product was oily compound 4-1, which was directly used in the next step without further purification. Compound 4-1: Molecular formula: C 22 H 44 O, molecular weight: 324.3, LC-MS found 325.6 (M+H).

[0159] Preparation of compound SA196 in 4.2

[0160] According to the synthesis method of Example 1, compound SA196 1.2 g was prepared from intermediate 4-1 as a colorless oil. Compound SA196: Molecular formula: C 59 H 89 N4O7P, molecular weight: 996.5, LC-MS found 995.4 (M-H).1 H NMR (400 MHz, DMSO-d6) δ 11.16 (s, 1H), 7.43 (dd, J = 10.1, 7.9 Hz, 1H), 7.37 - 7.23 (m, 4H), 7.21 - 7.15 (m, 5H), 6.86 - 6.80 (m, 4H), 5.52 - 5.42 (m, 1H), 3.94 - 3.84 (m, 1H), 3.83 - 3.75 (m, 1H), 3.72 (s, 6H), 3.70 - 3.55 (m, 3H), 3.53 - 3.42 (m, 2H), 3.23 - 3.15 (m, 1H), 3.14 - 3.02 (m, 1H), 3.01 - 2.87 (m, 1H), 2.72 - 2.62 (m, 2H), 2.44 - 2.35 (m, 1H), 1.29 - 1.17 (m, 41H), 1.12 - 1.01 (m, 12H), 0.84 (t, J = 6.7 Hz, 3H). 31 P NMR (162 MHz, DMSO-d6): δ 147.96, 147.61, 146.97, 146.94.

[0161] Preparation of compound SA208 of Example 5

[0162] Preparation of intermediate 5-1 of Example 5.1

[0163] Compound methyl 3-hydroxypropanoate (commercially available, purchased from Shanghai Titan Scientific Co., Ltd.) (1.0 equiv, 48.0 mmol, 5.0 g) was placed in a clean and dry reaction bottle, 100 mL of tetrahydrofuran was added, and the solution was protected by argon gas replacement, lithium diisopropylamide (2.2 equiv, 105.7 mmol, 52.8 mL, 2.0 M in hexane) was slowly added at -70°C, and then the stirring was continued for 0.5 hours under argon protection at -70°C. Then N-BOC-4- aldehyde piperidine (commercially available, purchased from Shanghai Titan Scientific Co., Ltd.) (1.0 equiv, 48.0 mmol, 10.2 g) was slowly added to the reaction solution, and then the stirring was continued for 10 minutes under argon protection at -70°C. After the reaction, the reaction was quenched with 60 mL of saturated ammonium chloride solution. The organic phase was separated, and the aqueous phase was extracted with ethyl acetate twice. The combined and dried organic phase was filtered and concentrated, and the obtained crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 100 / 0-50 / 50) to obtain compound 5-1 (14.0 g, 44.1 mmol, 92% yield) as a colorless oil. Compound 5-1: Molecular formula: C 15 H 27 NO6, molecular weight: 317.3, LC-MS found 318.3 (M+H).

[0164] 5.2 Preparation of intermediate 5-2

[0165] Compound 5-1 (44.1 mmol, 14.0 g) and imidazole (4.0 equiv, 176.4 mmol, 12.0 g) were placed in a clean and dry reaction flask, 130 mL of N,N-dimethylformamide was added, and t-butyldimethylsilyl chloride (3.0 equiv, 132.3 mmol, 19.9 g) was slowly added at room temperature, followed by continued stirring at room temperature overnight. After the reaction, 200 mL of ethyl acetate was added to the reaction solution, and washed with 200 mL of saturated sodium bicarbonate solution and 200 mL of saturated brine, the organic phase was dried, filtered and concentrated, and the obtained crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 20 / 1-1 / 1), to obtain compound 5-2 (13.0 g, 23.8 mmol, 54% yield) as a colorless oil. Compound 5-2 Molecular Formula: C 27 H 55 NO6Si2, Molecular Weight: 545.4, LC-MS found 546.4 (M+H).

[0166] 5.3 Preparation of intermediate 5-3

[0167] Compound 5-2 (23.8 mmol, 13.0 g) was placed in a clean and dry reaction flask, 120 mL of tetrahydrofuran was added, and the solution was protected by argon gas replacement. The reaction solution was cooled to -70°C, and diisobutylaluminum hydride (2.2 equiv, 52.4 mmol, 52.4 mL, 1.0 M in THF) was slowly added dropwise under argon protection. After the dropwise addition was completed, the temperature was raised to 0°C and stirring was continued for one hour. After the reaction, 200 mL of ethyl acetate was added to the reaction solution, and washed with 250 mL of saturated potassium sodium tartrate solution, the organic phase was dried, filtered and concentrated, and the obtained crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 20 / 1-1 / 1), to obtain compound 5-3 (5.2 g, 10.0 mmol, 42% yield) as a light yellow oil. Compound 5-3 Molecular Formula: C 26 H 55 NO5Si2, Molecular Weight: 517.4, LC-MS found 518.4 (M+H).

[0168] 5.4 Preparation of intermediate 5-4

[0169] Compound 5-3 (10.0 mmol, 5.2 g) was placed in a clean and dry reaction flask, 100 mL of anhydrous tetrahydrofuran was added, and triphenylphosphine (2.0 equiv, 20.0 mmol, 5.3 g) and 3-benzoyluracil (commercially available, purchased from Shanghai Titan Science and Technology Co., Ltd.) (1.1 equiv, 11.0 mmol, 2.4 g) were added at room temperature, followed by dropwise addition of diisopropyl azodicarboxylate (2.0 equiv, 20.0 mmol, 4.1 g) under argon protection. After dropwise addition, the reaction was stirred at room temperature overnight. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, washed with 150 mL of saturated brine, dried the organic phase, filtered and concentrated, and the obtained crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 20 / 1-1 / 4) to obtain compound 5-4 (7.0 g, 9.8 mmol, 97% yield) as an oil. Compound 5-4: Molecular formula: C 37 H 61 N3O7Si2, Molecular weight: 715.4, LC-MS found 716.4 (M+H).

[0170] 5.5 Preparation of intermediate 5-5

[0171] Compound 5-4 (4.3 mmol, 3.1 g) was placed in a clean and dry reaction flask, 30 mL of methanol was added, and sodium methoxide in methanol (3.0 equiv, 13.0 mmol, 2.3 g, 30% wt in MeOH) was added, and the stirring was continued at room temperature for 5 hours. After the reaction, dilute hydrochloric acid was added to adjust the pH to neutral, and the reaction solution was directly concentrated to obtain crude product white solid compound 5-5, which was directly used in the next step without further purification. Compound 5-5: Molecular formula: C 30 H 57 N3O6Si2, Molecular weight: 611.3, LC-MS found 612.4 (M+H).

[0172] 5.6 Preparation of intermediate 5-6

[0173] Compound 5-5 (4.3 mmol, 2.7 g) was placed in a clean and dry reaction flask, 30 mL of dichloromethane was added, and trifluoroacetic acid in dichloromethane (2.0 equiv, 8.7 mmol, 6.6 mL, 10 wt% in DCM) was added, and the stirring was continued at room temperature for 2 hours. After the reaction, saturated sodium bicarbonate solution was added to adjust the pH to neutral, and the reaction solution was directly concentrated to obtain crude product, which was separated and purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 100 / 0-15 / 1) to obtain compound 5-6 (0.95 g, 1.8 mmol, 43% yield) as an oil. Compound 5-6: Molecular formula: C25 H 49 N3O4Si2, molecular weight: 511.3, LC-MS found 512.6 (M+H).

[0174] 5.7 Preparation of intermediate 5-7

[0175] Compound hexadecanoic acid (1.86 mmol, 0.48 g) was placed in a clean and dry reaction flask, 20 mL of dichloromethane was added. Benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.3 equiv, 2.42 mmol, 0.92 g) and diisopropylethylamine (3.0 equiv, 5.58 mmol, 0.72 g) were added at room temperature and stirring was continued for 10 minutes at room temperature. Compound 5-6 (1.86 mmol, 0.95 g) was dissolved in 10 mL of dichloromethane and added to the reaction mixture at room temperature, followed by stirring for 2 hours at room temperature. After the reaction, 50 mL of dichloromethane was added to the reaction mixture, washed with 100 mL of saturated brine, the organic phase was dried, filtered and concentrated, the obtained crude product was separated and purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 50 / 1-8 / 1) to obtain compound 5-7 (1.2 g, 1.6 mmol, 86% yield) as a white solid. Compound 5-7 Molecular Formula: C 41 H 79 N3O5Si2, molecular weight: 749.4, LC-MS found 750.6 (M+H).

[0176] 5.8 Preparation of intermediate 5-8

[0177] Compound 5-7 (1.6 mmol, 1.2 g) was placed in a clean and dry reaction flask, 50 mL of tetrahydrofuran was added, followed by the addition of tetrabutylammonium fluoride (4.0 equiv, 6.4 mmol, 6.4 mL, 1.0 M in THF) and stirring at room temperature overnight. After the reaction, 150 mL of ethyl acetate was added to the reaction mixture, washed with 150 mL of saturated brine, the organic phase was dried, filtered and concentrated, the obtained crude product was separated and purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 100 / 1-10 / 1) to obtain compound 5-8 (0.8 g, 1.53 mmol, 96% yield for two steps) as a white solid. Compound 5-8 Molecular Formula: C 29 H 51 N3O5, molecular weight: 521.4, LC-MS found 522.4 (M+H).

[0178] 5.9 Preparation of intermediate 5-9

[0179] Compound 5-8 (1.53 mmol, 0.8 g) was placed in a clean and dry reaction flask, 50 mL of pyridine was added, 4,4'-dimethoxytrityl chloride (1.5 equiv, 2.3 mmol, 0.78 g) was added at room temperature, followed by stirring at room temperature overnight. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine, the organic phase was dried, filtered and concentrated, the obtained crude product was separated and purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 50 / 1-8 / 1), to obtain compound 5-9 (0.6 g, 0.73 mmol, 48% yield) as a light yellow oil. Compound 5-9: Molecular Formula: C 50 H 69 N3O7, Molecular Weight: 823.5, LC-MS found 824.5 (M+H).

[0180] 5.10 Preparation of Compound SA208

[0181] Compound 5-9 (0.73 mmol, 0.6 g) was placed in a clean and dry reaction flask, 50 mL of anhydrous dichloromethane was added, compound 2-cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite (2.0 equiv, 1.46 mmol, 0.44 g) and 4,5-dicyanoimidazole (1.5 equiv, 1.1 mmol, 0.13 g) were added under argon protection at room temperature, and stirred at room temperature for one hour. After the reaction, 50 mL of dichloromethane was added to the reaction solution, and washed with 100 mL of saturated sodium bicarbonate solution, the organic phase was dried, filtered and concentrated, the obtained crude product was prepared by C8 reversed phase column (specification: 30 pm; commercially available, purchased from Shanghai Boyun Biotechnology Co., Ltd.) (gradient elution: water / acetonitrile = 95 / 5-0 / 100) to obtain compound SA208 (0.54 g, 0.52 mmol, 72% yield) as a colorless oil. Compound SA208: Molecular Formula: C 59 H 86 N5O8P, Molecular Weight: 1023.6, LC-MS found 1022.6 (M-H). 1H NMR (400 MHz, DMSO-d6) δ 11.18 (s, 1H), 7.28 (dt, J = 15.8, 7.6 Hz, 4H), 7.22 - 7.16 (m, 5H), 6.86 - 6.81 (m, 4H), 5.60 - 5.51 (m, 1H), 5.44 - 5.39 (m, 1H), 4.44 - 4.35 (m, 1H), 3.95 - 3.79 (m, 2H), 3.72 (s, 6H), 3.64 - 3.36 (m, 5H), 3.13 - 3.05 (m, 1H), 3.01 - 2.76 (m, 2H), 2.73 - 2.60 (m, 2H), 2.33 - 2.16 (m, 4H), 1.70 - 1.56 (m, 2H), 1.48 - 1.40 (m, 3H), 1.23 - 1.16 (m, 27H), 1.12 - 1.04 (m, 9H), 0.93 (dd, J = 12.2, 6.8 Hz, 3H), 0.85 (t, J = 6.8 Hz, 3H). 31 P NMR (162 MHz, DMSO-d6): δ 149.96, 148.97, 148.40, 148.13.

[0182] Preparation of compound SA226 of Example 6

[0183] Compound SA226 was prepared as a colorless oil 0.9 g according to the synthetic procedure of Example 5. Compound SA226 Formula: C 65 H 98 N5O8P, MW: 1107.7, LC-MS found 1106.4 (M-H). 1H NMR (400 MHz, DMSO-d6) δ 11.18 (s, 1H), 7.30 (dt, J = 16.8, 7.5 Hz, 4H), 7.19 (t, J = 8.2 Hz, 5H), 6.84 (br, s, 4H), 5.55 (dd, J = 14.9, 7.6 Hz, 1H), 5.46 - 5.39 (m, 1H), 4.64 (d, J = 4.7 Hz, 1H), 4.40 (t, J = 14.2 Hz, 1H), 3.96 - 3.79 (m, 1H), 3.72 (s, 6H), 3.63 - 3.50 (m, 3H), 3.19 - 2.98 (m, 4H), 2.92 - 2.69 (m, 1H), 2.61 (t, J = 8.3 Hz, 1H), 2.33 - 2.16 (m, 3H), 1.82 - 1.57 (m, 2H), 1.45 - 1.33 (m, 2H), 1.29 - 1.22 (m, 42H), 1.14 - 0.91 (m, 12H), 0.84 (t, J = 6.4 Hz, 3H).31P NMR (162 MHz, DMSO-d6): d 149.95, 148.96, 148.44, 148.10.

[0184] Preparation of compound SA209 of Example 7

[0185] 7.1 Preparation of intermediate 7-1

[0186] Compound Propylene glycol (commercially available, purchased from Shanghai Titan Science and Technology Co., Ltd.) (100.0 mmol, 7.6 g) was placed in a clean and dry reaction bottle, 100 mL of dimethyl sulfoxide was added, 1-bromohexadecane (commercially available, purchased from Shanghai Titan Science and Technology Co., Ltd.) (1.1 equiv, 110.0 mmol, 28.9 g), tetrabutylammonium bromide (1.0 equiv, 100.0 mmol, 32.2 g), sodium hydroxide (3.0 equiv, 300.0 mmol, 12.0 g) were added at room temperature, and then stirring was continued at 50°C for 24 hours. After the reaction, the reaction was quenched with 100 mL of saturated ammonium chloride solution. The organic phase was separated, and the aqueous phase was extracted with ethyl acetate twice. The combined and dried organic phase was filtered and concentrated, and the obtained crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 100 / 0-50 / 50) to obtain compound 7-1 (12.6 g, 42.0 mmol, 42% yield) as a colorless oil. Compound 7-1: Molecular formula: C 19 H 40 O2, molecular weight: 300.3, LC-MS found 301.4 (M+H).

[0187] 7.2 Preparation of intermediate 7-2

[0188] Compound 7-1 (42.0 mmol, 12.6 g) was placed in a clean and dry reaction flask, 50 mL of dichloromethane was added, followed by slow addition of Dess-Martin Oxidizer (2.0 equiv, 84.0 mmol, 35.7 g) under ice water bath, stirred at room temperature for 2 hours. After the reaction, 100 mL of dichloromethane was added to the reaction solution, washed with 100 mL of saturated brine, dried the organic phase, filtered and concentrated, the obtained crude product was oily compound 7-2, which was directly used in the next step without further purification. Compound 7-2 Molecular Formula: C 19 H 38 O2, Molecular Weight: 298.2, LC-MS found 299.3 (M+H).

[0189] 7.3 Preparation of compound SA209

[0190] Compound SA209 1.9 g was prepared from intermediate 7-2 according to the synthetic method of Example 1. Compound SA209 Molecular Formula: C 56 H 83 N4O8P, Molecular Weight: 970.5, LC-MS found 969.4 (M-H).1H NMR (400 MHz, DMSO-d6) δ 11.13 (s, 1H), 7.38 - 7.32 (m, 3H), 7.26 (dd, J = 13.9, 7.2 Hz, 2H), 7.22 - 7.17 (m, 5H), 6.85 - 6.80 (m, 4H), 5.48 - 5.40 (m, 1H), 4.14 - 4.04 (m, 1H), 3.81 - 3.75 (m, 1H), 3.72 (s, 6H), 3.68 - 3.53 (m, 3H), 3.51 - 3.36 (m, 4H), 3.24 - 3.17 (m, 1H), 3.12 - 3.08 (m, 1H), 3.04 - 2.87 (m, 1H), 2.66 (dt, J = 35.4, 5.9 Hz, 2H), 1.90 - 1.56 (m, 2H), 1.50 - 1.42 (m, 2H), 1.28 - 1.21 (m, 28H), 1.12 - 0.99 (m, 12H), 0.85 (t, J = 6.7 Hz, 3H).31P NMR (162 MHz, DMSO-d6): δ 148.33, 148.23, 147.48, 147.42.

[0191] Example 8 Preparation of compound SA214

[0192] Compound SA214 1.3 g was prepared according to the synthetic method of Example 7 from the starting material ethylene glycol (commercially available, purchased from Shanghai Titan Scientific Co., Ltd.) (100.0 mmol, 6.2 g). Compound SA214 Formula: C 55 H 81 N4O8P, MW: 956.5, LC-MS found 955.4 (M-H).1H NMR (400 MHz, DMSO-d6) δ 11.17 (s, 1H), 7.38 (dd, J = 7.8, 3.7 Hz, 1H), 7.32 (dd, J = 7.3, 3.7 Hz, 2H), 7.20 - 7.18 (m, 5H), 7.29 - 7.22 (m, 2H), 6.83 (dt, J = 7.8, 5.1 Hz, 4H), 5.50 - 5.42 (m, 1H), 4.08 - 3.98 (m, 1H), 3.84 - 3.77 (m, 1H), 3.72 (s, 6H), 3.67 - 3.55 (m, 2H), 3.50 - 3.35 (m, 4H), 3.20 - 3.18 (m, 1H), 3.08 - 3.01 (m, 1H), 2.93 - 2.85 (m, 1H), 2.71 - 2.61 (m, 2H), 1.44 (d, J = 4.6 Hz, 2H), 1.22 (br s, 29H), 1.11 - 1.00 (m, 12H), 0.84 (t, J = 6.7 Hz, 3H). 31 P NMR (162 MHz, DMSO-d6): δ 148.94, 148.46, 148.31, 147.41.

[0193] Preparation of compound SA235 of Example 9

[0194] 9.1 Preparation of intermediate 9-1

[0195] Compound 9-1 12.3 g was prepared according to the synthetic method of Example 1 as a light yellow oil. Compound 9-1 Formula: C 37 H 80 Si2O3, MW: 628.5, LC-MS found 627.4 (M-H).

[0196] 9.2 Preparation of intermediate 9-2

[0197] Compound 9-1 (3.0 mmol, 1.89 g) was placed in a clean and dry reaction flask, 50 mL of anhydrous tetrahydrofuran was added, and triphenylphosphine (2.0 equiv, 6.0 mmol, 1.58 g) and N6-benzoyl adenine (commercially available, purchased from Shanghai Titan Science and Technology Co., Ltd.) (1.1 equiv, 3.3 mmol, 0.79 g) were added at room temperature, followed by dropwise addition of diisopropyl azodicarboxylate (2.0 equiv, 6.0 mmol, 1.21 g) under argon protection. After dropwise addition, the reaction was stirred at room temperature overnight. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and 150 mL of saturated brine was used to wash the organic phase, which was dried, filtered and concentrated. The obtained crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 20 / 1-1 / 4), to obtain compound 9-2 (1.58 g, 1.86 mmol, 62% yield) as a light yellow solid. Compound 9-2: Molecular formula: C 49 H 87 N5O3, Molecular weight: 621.4, LC-MS found 622.3 (M+H).

[0198] 9.3 Preparation of intermediate 9-3

[0199] Compound 9-2 (1.86 mmol, 1.58 g) was placed in a clean and dry reaction flask, 50 mL of tetrahydrofuran was added, followed by the addition of tetrabutylammonium fluoride (4.0 equiv, 7.44 mmol, 7.44 mL, 1.0 M in THF), and stirring at room temperature for 4 hours. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and 100 mL of saturated brine was used to wash the organic phase, which was dried, filtered and concentrated. The obtained crude product was separated and purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 100 / 1-10 / 1), to obtain compound 9-3 (0.96 g, 1.54 mmol, 83% yield) as a white solid. Compound 9-3: Molecular formula: C 37 H 59 N5O3, Molecular weight: 621.4, LC-MS found 622.3 (M+H).

[0200] 9.4 Preparation of intermediate 9-4

[0201] Compound 9-3 (1.54 mmol, 0.96 g) was placed in a clean and dry reaction flask, 50 mL of pyridine was added, 4,4'-dimethoxytrityl chloride (1.2 equiv, 1.85 mmol, 0.63 g) was added at room temperature, followed by stirring at room temperature for 2 hours. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine, the organic phase was dried, filtered and concentrated, the obtained crude product was separated and purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 50 / 1-8 / 1), to obtain compound 9-4 (1.21 g, 1.31 mmol, 85% yield) as a light yellow oil. Compound 9-4 Formula: C 58 H 77 N5O5, Molecular weight: 923.5, LC-MS found 924.4 (M+H).

[0202] 9.5 Preparation of compound SA235

[0203] Compound 9-4 (1.31 mmol, 1.21 g) was placed in a clean and dry reaction flask, 50 mL of anhydrous dichloromethane was added, compound 2-cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite (2.0 equiv, 2.62 mmol, 0.79 g) and 4,5-dicyanoimidazole (1.5 equiv, 1.96 mmol, 0.23 g) were added under argon protection at room temperature, and stirred at room temperature for one hour. After the reaction, 50 mL of dichloromethane was added to the reaction solution, and washed with 100 mL of saturated sodium bicarbonate solution, the organic phase was dried, filtered and concentrated, the obtained crude product was prepared by C8 reversed phase column (specification: 30 μm; commercially available, purchased from Shanghai Boyun Biotechnology Co., Ltd.) (gradient elution: water / acetonitrile = 95 / 5-0 / 100) to obtain compound SA235 (1.0 g, 0.89 mmol, 68% yield) as a colorless oil. Compound SA235 Formula: C 67 H 94 N7O6P, Molecular weight: 1123.7, LC-MS found 1122.6 (M-H). 1H NMR (400 MHz, DMSO-d6) δ 11.10 (s, 1H), 8.65 (d, J = 5.1 Hz, 1H), 8.30 (d, J = 3.9 Hz, 1H), 8.05 (d, J = 7.3 Hz, 2H), 7.61 (t, J = 7.1 Hz, 1H), 7.52 (t, J = 7.4 Hz, 2H), 7.17 (dd, J = 19.3, 7.2 Hz, 4H), 7.10 - 6.99 (m, 5H), 6.73 (td, J = 8.7, 3.1 Hz, 4H), 4.38 - 4.25 (m, 1H), 3.96 (s, 1H), 3.75 (dd, J = 16.6, 6.5 Hz, 1H), 3.66 (s, 6H), 3.62 - 3.57 (m, 1H), 3.54 - 3.41 (m, 2H), 3.24 (dd, J = 16.6, 13.1 Hz, 1H), 3.07 - 2.89 (m, 1H), 2.78 - 2.62 (m, 2H), 1.34 - 1.20 (m, 42H), 1.09 - 1.01 (m, 12H), 0.82 - 0.79 (m, 3H). 31 P NMR (162 MHz, DMSO-d6): δ 148.41, 147.42, 147.33, 146.98.

[0204] Preparation of compound SA246 of Example 10

[0205] Preparation of intermediate 10-1

[0206] Compound 9-1 (3.0 mmol, 1.89 g) was placed in a clean and dry reaction bottle, 50 mL of anhydrous tetrahydrofuran was added, and triphenylphosphine (2.0 equiv, 6.0 mmol, 1.58 g) and 2-amino-6-chloropurine (commercially available, purchased from Shanghai Titan Science and Technology Co., Ltd.) (1.1 equiv, 3.3 mmol, 0.56 g) were added at room temperature, followed by dropwise addition of diisopropyl azodicarboxylate (2.0 equiv, 6.0 mmol, 1.21 g) under argon protection. After dropwise addition, the reaction was stirred at room temperature overnight. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, washed with 150 mL of saturated brine, dried the organic phase, filtered and concentrated, and the obtained crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 20 / 1-1 / 1) to obtain compound 10-1 (1.94 g, 2.49 mmol, 83% yield) as a light yellow solid. Compound 10-1: Molecular formula: C 42 H 82 ClN5O2Si2, Molecular weight: 779.5, LC-MS found 780.3 (M+H).

[0207] 10.2 Preparation of intermediate 10-2

[0208] Compound 10-1 (2.49 mmol, 1.94 g) was placed in a clean and dry reaction flask, 30 mL of pyridine was added, isobutyryl chloride (1.5 equiv, 3.74 mmol, 398.0 mg) was added dropwise under ice water bath, then stirred at room temperature for 3 hours. After reaction, the pyridine was removed by vacuum concentration, the obtained crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 20 / 1-3 / 1), to give compound 10-2 (1.86 g, 2.19 mmol, 88% yield) as a light yellow solid. Compound 10-2 Formula: C 46 H 88 ClN5O3Si2, molecular weight: 849.6, LC-MS found 850.3 (M+H).

[0209] 10.3 Preparation of intermediate 10-3

[0210] Compound 10-2 (2.19 mmol, 1.86 g) was placed in a clean and dry reaction flask, 50 mL of tetrahydrofuran was added, then tetrabutylammonium fluoride (4.0 equiv, 8.76 mmol, 8.76 mL, 1.0 M in THF) was added, stirred at room temperature for 4 hours. After reaction, 150 mL of ethyl acetate was added to the reaction solution, washed with 150 mL of saturated brine, dried the organic phase, filtered and concentrated, the obtained crude product was separated and purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 100 / 1-10 / 1), to give compound 10-3 (1.16 g, 1.86 mmol, 85% yield) as a white solid. Compound 10-3 Formula: C 34 H 60 ClN5O3, molecular weight: 621.4, LC-MS found 622.3 (M+H).

[0211] 10.4 Preparation of intermediate 10-4

[0212] Compound 10-3 (1.86 mmol, 1.16 g) was placed in a clean and dry reaction flask, 30 mL of trifluoroacetic acid and 10 mL of water were added respectively, then stirred at 35°C for 12 hours. After reaction, 100 mL of saturated sodium bicarbonate solution was slowly added to the reaction solution to neutralize the excess acid, then 150 mL of ethyl acetate was added, washed with 150 mL of saturated brine, dried the organic phase, filtered and concentrated, the obtained crude product was separated and purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 100 / 1-10 / 1), to give compound 10-4 (0.84 g, 1.4 mmol, 75% yield) as a white solid. Compound 10-4 Formula: C34 H 61 N5O4, molecular weight: 603.4, LC-MS found 604.3 (M+H).

[0213] 10.5 Preparation of intermediate 10-5

[0214] Compound 10-4 (1.4 mmol, 0.84 g) was placed in a clean and dry reaction flask, 30 mL of pyridine was added, 4,4'-dimethoxybenzhydryl chloride (1.2 equiv, 1.68 mmol, 0.57 g) was added at room temperature, followed by stirring at room temperature for 2 hours. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine, the organic phase was dried, filtered and concentrated, the obtained crude product was separated and purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 50 / 1-8 / 1), to obtain compound 10-5 (1.09 g, 1.2 mmol, 86% yield) as a light yellow oil. Compound 10-5 molecular formula: C 55 H 79 N5O6, molecular weight: 905.6, LC-MS found 906.4 (M+H).

[0215] 10.6 Preparation of compound SA246

[0216] Compound 10-5 (1.2 mmol, 1.09 g) was placed in a clean and dry reaction flask, 30 mL of anhydrous dichloromethane was added, compound 2-cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite (2.0 equiv, 2.4 mmol, 0.72 g) and 4,5-dicyanoimidazole (1.5 equiv, 1.8 mmol, 0.21 g) were added under argon protection at room temperature, and stirred at room temperature for one hour. After the reaction, 50 mL of dichloromethane was added to the reaction solution, and washed with 100 mL of saturated sodium bicarbonate solution, the organic phase was dried, filtered and concentrated, the obtained crude product was prepared by C8 reversed phase column (specification: 30 μm; commercially available, purchased from Shanghai Boyun Biotechnology Co., Ltd.) (gradient elution: water / acetonitrile = 95 / 5-0 / 100) to obtain compound SA246 (875.7 mg, 0.79 mmol, 66% yield) as a colorless oil. Compound SA246 molecular formula: C 64 H 96 N7O7P, molecular weight: 1105.7, LC-MS found 1104.6 (M-H). 1H NMR (400 MHz, DMSO-d6) δ 12.03 (s, 1H), 11.46 (s, 1H), 7.86 (dd, J = 25.2, 15.4 Hz, 1H), 7.25 - 7.01 (m, 9H), 6.80 - 6.71 (m, 4H), 4.19 - 4.01 (m, 1H), 3.99 - 3.87 (m, 1H), 3.78 (dd, J = 10.2, 5.8 Hz, 1H), 3.69 (d, J = 2.6 Hz, 6H), 3.64 - 3.55 (m, 2H), 3.53 - 3.42 (m, 2H), 3.23 - 3.04 (m, 1H), 2.96 - 2.90 (m, 1H), 2.84 - 2.76 (m, 1H), 2.72 - 2.57 (m, 3H), 1.59 - 1.34 (m, 2H), 1.20 - 1.13 (m, 38H), 1.09 (dd, J = 9.8, 7.1 Hz, 12H), 1.04 - 0.99 (m, 6H), 0.83 - 0.79 (m, 3H).31P NMR (162 MHz, DMSO-d6): δ 148.51, 147.79, 147.23, 146.43.

[0217] Preparation of compound SM324 of Example 11

[0218] 11.1 Preparation of intermediate 11-1

[0219] Compound 11-1 3.2 g was prepared as a off-white solid according to the synthetic method of Example 1. Compound 11-1 Molecular Formula: C 41 H 82 Si2N2O4, Molecular Weight: 722.5, LC-MS found 721.4 (M-H).

[0220] 11.2 Preparation of intermediate 11-2

[0221] Compound 11-1 (4.43 mmol, 3.2 g) was placed in a clean and dry reaction flask, 1,2,4-triazole (13.9 equiv, 61.58 mmol, 4.25 g) and 50 mL of pyridine were added respectively, 4-chlorophenyl phosphorodichloridate (2.8 equiv, 12.4 mmol, 3.04 g) was added dropwise slowly under ice water bath, then stirred at 30 °C for 16 h. After reaction, 100 mL of saturated sodium bicarbonate solution was added to quench the reaction, then washed with 100 mL of ethyl acetate, 150 mL of saturated brine respectively, the organic phase was dried, filtered and concentrated, the obtained crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 20 / 1-2 / 1), to obtain compound 11-2 (3.15 g, 4.08 mmol, 92% yield) as a white solid. Compound 11-2 Formula: C 43 H 83 N5O3Si2, Molecular weight: 773.6, LC-MS found 774.3 (M+H).

[0222] 11.3 Preparation of intermediate 11-3

[0223] Compound 11-2 (4.08 mmol, 3.15 g) was placed in a clean and dry reaction flask, 50 mL of 1,4-dioxane was added, ammonia water (68.0 equiv, 277.4 mmol, 9.72 g) was added slowly at room temperature, then stirred at 30 °C for 16 h. After reaction, 100 mL of ethyl acetate, 150 mL of saturated brine was added to wash, the organic phase was dried, filtered and concentrated, to obtain compound 11-3 3.2 g as a yellow solid, which was used directly in the next step without further purification. Compound 11-3 Formula: C 41 H 83 N3O3Si2, Molecular weight: 721.6, LC-MS found 722.3 (M+H).

[0224] 11.4 Preparation of intermediate 11-4

[0225] Compound 11-3 (4.08 mmol, 3.2 g) was placed in a clean and dry reaction flask, 30 mL of N,N-dimethylformamide was added, acetic anhydride (1.5 equiv, 6.12 mmol, 0.62 g) was added slowly at room temperature, followed by stirring at room temperature for 3 hours. After the reaction, 100 mL of saturated sodium bicarbonate solution was added to quench the reaction, followed by washing with 100 mL of ethyl acetate, 150 mL of saturated brine, drying the organic phase, filtering and concentrating, the obtained crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 20 / 1-1 / 1), to obtain compound 11-4 (2.24 g, 2.94 mmol, 72% yield for two steps) as a white solid. Compound 11-4 Formula: C 43 H 85 N3O4Si2, Molecular weight: 763.6, LC-MS found 764.3 (M+H).

[0226] 11.5 Preparation of intermediate 11-5

[0227] Compound 11-4 (2.94 mmol, 2.24 g) was placed in a clean and dry reaction flask, 50 mL of tetrahydrofuran was added, followed by the addition of tetrabutylammonium fluoride (4.0 equiv, 11.75 mmol, 11.76 mL, 1.0 M in THF), stirring at room temperature for 4 hours. After the reaction, 150 mL of ethyl acetate was added to the reaction solution, and washed with 150 mL of saturated brine, drying the organic phase, filtering and concentrating, the obtained crude product was separated and purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 100 / 1-10 / 1), to obtain compound 11-5 (1.28 g, 2.38 mmol, 81% yield) as a white solid. Compound 11-5 Formula: C 31 H 57 N3O4, Molecular weight: 535.4, LC-MS found 536.3 (M+H).

[0228] 11.6 Preparation of intermediate 11-6

[0229] Compound 11-5 (2.38 mmol, 1.28 g) was placed in a clean and dry reaction flask, 30 mL of pyridine was added, 4,4'-dimethoxytrityl chloride (1.2 equiv, 2.86 mmol, 0.97 g) was added at room temperature, followed by stirring at room temperature for 2 hours. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine, the organic phase was dried, filtered and concentrated, the obtained crude product was separated and purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 50 / 1-8 / 1), to obtain compound 11-6 (1.63 g, 1.95 mmol, 82% yield) as a light yellow oil. Compound 11-6 Formula: C 52 H 75 N3O6, molecular weight: 837.5, LC-MS found 838.4 (M+H).

[0230] 11.7 Preparation of compound SM324

[0231] Compound 11-6 (1.95 mmol, 1.63 g) was placed in a clean and dry reaction flask, 30 mL of anhydrous dichloromethane was added, compound 2-cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite (2.0 equiv, 3.9 mmol, 1.17 g) and 4,5-dicyanoimidazole (1.5 equiv, 2.93 mmol, 0.34 g) were added under argon protection at room temperature, and stirred at room temperature for one hour. After the reaction, 50 mL of dichloromethane was added to the reaction solution, and washed with 100 mL of saturated sodium bicarbonate solution, the organic phase was dried, filtered and concentrated, the obtained crude product was prepared by C8 reversed phase column (specification: 30 μm; commercially available, purchased from Shanghai Boyun Biotechnology Co., Ltd.) (gradient elution: water / acetonitrile = 95 / 5-0 / 100) to obtain compound SM324 (1.32 g, 1.27 mmol, 65% yield) as a colorless oil. Compound SM324 Formula: C 61 H 92 N5O7P, molecular weight: 1037.6, LC-MS found 1036.4 (M-H). 1H NMR (400 MHz, DMSO-d6) δ 10.78 (s, 1H), 7.80 - 7.72 (m, 1H), 7.30 - 7.19 (m, 4H), 7.17 - 7.11 (m, 5H), 7.03 (dd, J = 19.8, 7.2 Hz, 1H), 6.83 - 6.78 (m, 4H), 3.99 - 3.79 (m, 2H), 3.71 (s, 6H), 3.62 - 3.40 (m, 3H), 3.22 - 3.12 (m, 1H), 3.08 - 2.86 (m, 1H), 2.72 - 2.62 (m, 2H), 2.09 (s, 3H), 1.60 - 1.44 (m, 1H), 1.39 - 1.22 (m, 42H), 1.11 - 1.00 (m, 12H), 0.84 (t, J = 6.6 Hz, 3H). 31 P NMR (162 MHz, DMSO-d6): δ 150.48, 149.68, 149.19, 149.17.

[0232] Preparation of compound SM325 of Example 12

[0233] Compound SM325 1.3 g was prepared as a colorless oil according to the synthetic method of Example 5. Compound SM325 Formula: C 61 H 90 N5O8P, MW: 1051.6, LC-MS found 1050.4 (M-H). 1H NMR (400 MHz, DMSO-d6) δ 11.19 (d, J = 8.2 Hz, 1H), 7.57 - 7.45 (m, 1H), 7.34 - 7.24 (m, 4H), 7.18 (dd, J = 15.0, 7.3 Hz, 5H), 6.87 - 6.80 (m, 4H), 5.55 (dt, J = 12.9, 6.8 Hz, 1H), 5.44 - 5.37 (m, 1H), 4.40 (dd, J = 18.2, 10.8 Hz, 1H), 4.06 - 3.80 (m, 2H), 3.72 (s, 6H), 3.63 - 3.48 (m, 3H), 3.43 - 3.36 (m, 1H), 3.27 - 3.16 (m, 1H), 3.12 - 3.05 (m, 1H), 3.02 - 2.96 (m, 1H), 2.90 (dd, J = 9.9, 6.0 Hz, 1H), 2.84 - 2.75 (m, 1H), 2.73 - 2.59 (m, 2H), 2.33 - 2.23 (m, 3H), 1.70 - 1.57 (m, 2H), 1.45 (d, J = 5.0 Hz, 2H), 1.23 (s, br, 31H), 1.12 - 1.04 (m, 8H), 0.94 (dd, J = 11.9, 6.7 Hz, 4H), 0.85 (t, J = 6.7 Hz, 3H). 31 P NMR (162 MHz, DMSO-d6): δ 150.01, 149.97, 149.00, 148.45, 148.20, 148.15.

[0234] Preparation of compound SA229 of Example 13

[0235] Compound SA229 was prepared as a colorless oil, 0.9 g, according to the synthetic procedure of Example 7. Formula for compound SA229: C 61 H 93 N4O8P, MW: 1040.6, LC-MS found 1039.4 (M-H). 1H NMR (400 MHz, DMSO-d6) δ 11.19 (s, 1H), 7.36 - 7.28 (m, 3H), 7.26 - 7.10 (m, 7H), 6.78 (td, J = 8.5, 4.0 Hz, 4H), 5.48 - 5.39 (m, 1H), 4.02 (d, J = 30.1 Hz, 1H), 3.86 - 3.75 (m, 1H), 3.68 (d, J = 4.7 Hz, 6H), 3.59 - 3.54 (m, 2H), 3.48 - 3.39 (m, 3H), 3.33 - 3.16 (m, 3H), 3.07 - 2.84 (m, 1H), 2.67 - 2.58 (m, 2H), 1.42 (s, br, 2H), 1.19 (s, br, 41H), 1.08 - 0.98 (m, 12H), 0.79 (dd, J = 6.7, 3.0 Hz, 3H). 31 P NMR (162 MHz, DMSO-d6): δ 148.73, 148.47, 148.28, 147.51.

[0236] Preparation of compound SA231 according to the synthesis method of example 5

[0237] Compound SA231 was prepared as a colorless oil 0.65 g according to the synthesis method of example 5. Compound SA231 formula: C 67 H 91 N8O7P, molecular weight: 1150.6, LC-MS found 1149.4 (M-H). 1H NMR (400 MHz, DMSO-d6) δ 11.14 (s, 1H), 8.73 - 8.66 (m, 1H), 8.39 (ddd, J = 21.4, 18.6, 7.7 Hz, 1H), 8.06 (d, J = 7.3 Hz, 2H), 7.65 (t, J = 7.3 Hz, 1H), 7.56 (t, J = 7.5 Hz, 2H), 7.22 - 7.11 (m, 5H), 7.06 - 6.98 (m, 4H), 6.82 - 6.72 (m, 4H), 4.54 - 4.17 (m, 2H), 3.89 - 3.79 (m, 2H), 3.70 (d, J = 2.7 Hz, 6H), 3.64 - 3.50 (m, 3H), 3.49 - 3.39 (m, 1H), 3.24 - 3.12 (m, 1H), 3.05 - 2.93 (m, 1H), 2.81 (dd, J = 22.5, 11.1 Hz, 1H), 2.72 (dt, J = 16.6, 5.4 Hz, 2H), 2.33 - 2.17 (m, 3H), 1.70 - 1.64 (m, 2H), 1.54 - 1.38 (m, 3H), 1.23 (s, br, 28H), 1.14 - 0.97 (m, 12H), 0.84 (t, J = 6.7 Hz, 3H). 31 P NMR (162 MHz, DMSO-d6): δ 150.02, 149.99, 149.21, 148.48, 148.45, 148.36.

[0238] Preparation of compound SM309 of Example 15

[0239] 15.1 Preparation of intermediate 15-1

[0240] Compound N-tert-butoxycarbonyl-dipolyethylene glycol-carboxylic acid (10.0 mmol, 2.77 g) was placed in a clean and dry reaction flask, and 100 mL of dichloromethane was added. 4-Dimethylaminopyridine (10 mol%, 1.0 mmol, 122.1 mg), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (1.5 equiv, 15.0 mmol, 2.87 g) and hydroxylamine hydrochloride (1.1 equiv, 11.0 mmol, 1.07 g) were added at room temperature, respectively, followed by stirring at room temperature for 2 hours. After the reaction, 50 mL of dichloromethane was added to the reaction solution, and washed with 100 mL of saturated brine, the organic phase was dried, filtered and concentrated, and the obtained crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 100 / 1-5 / 1) to obtain compound 15-1 (2.75 g, 8.6 mmol, 86% yield) as a white solid. Compound 15-1 Molecular Formula: C 14 H 28N2O6, MW: 320.1, LC-MS found 265.3 (M-55) and 220.3 (M-100).

[0241] 15.2 Preparation of intermediate 15-2

[0242] Compound 15-1 (8.6 mmol, 2.75 g) was placed in a clean and dry reaction flask, 50 mL of tetrahydrofuran was added. Lithium aluminum hydride (1.1 equiv, 9.5 mmol, 358.5 mg) was slowly added under dry ice ethanol bath, followed by stirring at -70 °C for 2 hours. After the reaction, water was added to the reaction solution to quench the reaction, followed by washing with 100 mL of ethyl acetate and 100 mL of saturated brine, drying the organic phase, filtering and concentrating, the obtained crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 100 / 1-6 / 1) to obtain compound 15-2 (1.48 g, 5.6 mmol, 66% yield) as colorless oil. Compound 15-2 Molecular Formula: C 12 H 23 NO5, MW: 261.1, LC-MS found 206.3 (M-55) and 161.3 (M-100).

[0243] 15.3 Preparation of compound SM309

[0244] According to the synthesis method of Example 5, compound SM309 0.58 g was prepared from intermediate 15-2. Compound SM309 Molecular Formula: C 70 H 99 N8O9P, MW: 1226.7, LC-MS found 1225.4 (M-H). 1H NMR (400 MHz, DMSO-d6) δ 11.11 (s, 1H), 8.68 (dd, J = 11.0, 3.3 Hz, 1H), 8.32 (dd, J = 12.4, 4.8 Hz, 1H), 8.05 (d, J = 7.9 Hz, 2H), 7.78 (dq, J = 10.8, 5.4 Hz, 1H), 7.64 (t, J = 7.3 Hz, 1H), 7.55 (t, J = 7.6 Hz, 2H), 7.23 - 7.15 (m, 5H), 7.11 - 7.01 (m, 4H), 6.78 (dt, J = 11.7, 6.3 Hz, 4H), 4.41 - 4.23 (m, 1H), 4.14 - 4.01 (m, 1H), 3.70 (d, J = 2.7 Hz, 6H), 3.67 - 3.58 (m, 1H), 3.56 - 3.41 (m, 6H), 3.38 (t, J = 5.5 Hz, 2H), 3.24 - 3.16 (m, 2H), 3.08 - 2.87 (m, 1H), 2.79 - 2.70 (m, 2H), 2.67 - 2.60 (m, 1H), 2.05 - 2.00 (m, 2H), 1.97 - 1.90 (m, 1H), 1.86 - 1.73 (m, 1H), 1.63 (q, J = 7.4 Hz, 1H), 1.44 (d, J = 5.6 Hz, 2H), 1.27 - 1.17 (m, 32H), 1.12 - 0.99 (m, 12H), 0.84 (t, J = 6.8 Hz, 3H). 31 P NMR (162 MHz, DMSO-d6): δ 148.31, 148.16, 147.62, 147.34.

[0245] Example 16 Preparation of siRNA conjugate

[0246] The special modified compounds prepared in the above examples and the commercially purchased conventional modified monomers (phosphoramidite monomers of synthetic modified nucleotides dT, Am, Cm, Gm, Um, Af, Cf, Gf, Uf are commercially available) were used to connect the nucleoside monomers one by one in the order of nucleotide arrangement from 3' to 5' direction by solid phase phosphoramidite method. The delivery monomer compound is placed at the sixth position (counted from the 5' end) of the sense strand, and each connection of a nucleoside monomer includes four steps of deprotection, coupling, capping, oxidation or sulfuration. The synthesis conditions adopted for the sense strand and the antisense strand are as follows.

[0247] Instrument equipment model: MerMade 120 oligonucleotide synthesizer solid phase synthesizer, Beijing Haizheng 6 mL synthesis column, Thinky SourceTM 15Q 4.6 / 100PE purification column.

[0248] The reagents used for synthesizing siRNA conjugates were purchased from Suzhou Colema Biotechnology Co., Ltd.

[0249] The synthesis is briefly described as follows:

[0250] The single-strand synthesis reaction process is extended in the direction of 3' to 5' and is completed on a solid-phase synthesizer. It includes four main reaction steps:

[0251] a. 4,4'-dimethoxytrityl (DMTr) removal reaction: the protective group DMTr on the nucleotide is removed with dichloroacetic acid to obtain a 5'-hydroxyl end;

[0252] b. Coupling reaction: the protected nucleotide phosphoramidite monomer is mixed with an activating agent ethylthiotetrazole, the phosphoramidite group is activated, the 5'-hydroxyl is still protected by DMTr, and condensation reaction occurs with the 5'-hydroxyl connected to the solid-phase carrier to generate a phosphite triester;

[0253] c. Oxidation reaction: under the action of an oxidizing agent iodine, the phosphite triester obtained in the previous condensation reaction is converted into a more stable phosphate ester. (That is, the trivalent phosphorus is oxidized to pentavalent phosphorus);

[0254] d. Sulfuration reaction: under the action of a thio reagent phenylacetyl disulfide (PADS), the phosphite triester obtained in the previous condensation reaction is converted into a thiophosphate ester (oxidation or thio is selected according to sequence design);

[0255] e. Cap reaction: a very small number of 5'-hydroxyl groups (less than 2%) that do not participate in the reaction in the condensation reaction are reacted with acetic anhydride and N-methyl imidazole to form an acetic ester end cap that cannot participate in subsequent reactions, preventing further reactions. This short fragment can be separated during purification.

[0256] The above four steps are repeated to complete the synthesis of the required sequence.

[0257] After the connection of the last nucleotide monomer is completed, the nucleic acid sequence connected to the solid-phase carrier is sequentially cut, deprotected, purified, desalted, and then freeze-dried to obtain the sense strand and the antisense strand, wherein:

[0258] The cleavage and deprotection conditions are as follows: first configure the ammonia solution (ammonia: ethanol = 3: 1 mixed solution to 2 mL of volume), and then add the solid phase carrier into the reaction bottle, shake well. Ammonolysis for 16 hours in a constant temperature water bath at 50°C. After ammonolysis, the water bath is cooled to room temperature (25°C ± 2°C), filtered with a sand core funnel, the filtrate is collected in a round bottom flask, and the filter residue is washed with 50% ethanol aqueous solution. The filtrate is collected, concentrated by rotary evaporator, and then transferred to a glass bottle. A small sample of the crude product is sent to the analysis department for detection of the crude LC-MS. The detection method is as follows: the purity of the above sense strand and antisense strand is detected and the molecular weight is analyzed using Waters Acquity UPLC-LTQ LC-MS (Column: ACQUITY UPLC BEH C18). The measured value is consistent with the theoretical value, see Table 1.

[0259] The purification and desalting conditions are as follows: purification is performed using an ion exchange column, and a Thermo Scientific HiPrepTM 26 / 10 Desalting Gel Column is used for desalting, and then single strand freeze-drying. After single strand freeze-drying, sampling is required for LC-MS.

[0260] Finally, the obtained sense strand and antisense strand need to be annealed into double strands.

[0261] The annealing operation is as follows: the purified sense strand and antisense strand are dissolved in water for injection, respectively, to prepare a 0.1 mg / mL-40 mg / mL solution, and then mixed in an equimolar ratio using a Thermo Scientific Nanodrop Eight, heated at 90°C for 5 minutes, and then slowly cooled naturally to form double-stranded structures through hydrogen bonds. Sampling is sent for detection of the SEC purity of the product, and the purity data is shown in Table 2. The double-stranded sample is freeze-dried.

[0262] Table 1

[0263] Table 2

[0264] The structure of the compound Uhd and the structure of the compound Uda in the prior art are as follows, respectively:

[0265] Example 17 Testing the activity of siRNA conjugate in mice in vivo

[0266] SPF level female Balb / c mice aged 8-11 weeks were selected, and the mice weighed 20±2 g. The above mice were weighed and observed before administration, and the animals with uniform weight and no abnormal state were randomly grouped, 4 mice in each group. The mice in the experimental group were given conjugates, and the mice in the solvent group were given artificial cerebrospinal fluid. According to the dose of 0.15 mg of conjugate given to each mouse, the tunica vaginalis was injected. Seven days after administration, the animals were euthanized, and the lumbar spinal cord, thoracic spinal cord, hippocampus, frontal cortex, brain stem, cerebellum, heart, liver and kidney tissues were taken. The tissue was cut and placed in RNALater (Invitrogen, AM7021M) for subsequent RNA extraction. The tissue was ground in the lysis buffer (Zhiang Biological, MNTR / FX96) (Shanghai Jingxin, JXFSTPRP-48L) to extract total RNA, and reverse transcribed into cDNA (Takara, 6210B). The expression level of SOD1 mRNA was detected by probe qPCR (Applied Biosystems, 4444964).

[0267] SOD1 primer of target gene:

[0268] Forward primer: GTCCTTTCCAGCAGTCACAT;

[0269] Reverse primer: GGTTCCACGTCCATCAGTATG;

[0270] Probe primer: CCAACATGCCTCTCTTCATCCGC;

[0271] β-actin primer of reference gene:

[0272] Forward primer: CATTGCTGACAGGATGCAGAA;

[0273] Reverse primer: GCTCAGGAGGAGCAATGATCTT;

[0274] Probe primer: CTCTGGCTCCTAGCACC;

[0275] The results were expressed as the residual expression level of the siRNA administration group compared with the solvent group (100% for the solvent group). The conjugate sequence used for injection is shown in Table 1, and the SOD1 mRNA residual expression level results are shown in Figure 1 (each group of columns in Figure 1 represents the lumbar spinal cord, thoracic spinal cord, hippocampus, frontal cortex, brain stem, cerebellum, heart, liver and kidney from bottom to top). The results show that in the CNS tissue (hippocampus, frontal cortex, brain stem, cerebellum), the conjugate SD005640 has the same activity as the positive control SD004774, and the CNS tissue silencing activity of the conjugate SD005719 is slightly better than the positive control SD004774.

[0276] Example 18 Testing siRNA conjugate activity in vivo in mice

[0277] SPF level female Balb / c mice aged 8-11 weeks were selected, and the body weight of the mice was 20±2 g. The above mice were weighed and observed before administration, and the animals with uniform body weight and no abnormal state were randomly grouped, 4 mice in each group. The mice in the experimental group were given conjugates, and the mice in the solvent group were given artificial cerebrospinal fluid. According to the dose of 0.15 mg of conjugate given to each mouse, the mice were injected with the dose of 0.15 mg of conjugate. Seven days after administration, the animals were euthanized, and the lumbar spinal cord, thoracic spinal cord, hippocampus, frontal cortex, brainstem and cerebellum tissues were taken. The tissues were cut and placed in RNALater (Invitrogen, AM7021M) for subsequent RNA extraction. The tissues were ground in lysis buffer (Zhiang Biological, MNTR / FX96) (Shanghai Jingxin, JXFSTPRP-48L) to extract total RNA, which was reverse transcribed into cDNA (Takara, 6210B). The expression level of SOD1 mRNA was detected by probe qPCR (Applied Biosystems, 4444964). The primers of the target gene SOD1 and the primers of the internal reference gene β-actin were the same as those in Example 17.

[0278] The results were expressed as the residual expression level of the siRNA administration group compared with the solvent group (the solvent group was 100%). The conjugate sequence used for injection was shown in Table 1, and the residual expression level of SOD1 mRNA was shown in Figure 2 (in Figure 2, each column from bottom to top represents the lumbar spinal cord, thoracic spinal cord, hippocampus, frontal cortex, brainstem and cerebellum, respectively). The results showed that the silencing activity of CNS tissues (hippocampus, frontal cortex, brainstem and cerebellum) of conjugates SD006541 and SD006773 was slightly better than that of the positive control SD004774.

[0279] Example 19 Testing siRNA conjugate activity in vivo in mice

[0280] SPF grade female C57BL / 6J mice aged 6-8 weeks were selected, and the weight of the mice was 20±2 g. The above mice were weighed and observed before administration, and the animals with uniform weight and no abnormal state were randomly grouped, 4 in each group. The mice in the experimental group were given the conjugate, and the mice in the solvent group were given phosphate buffered saline (PBS). Tail vein injection was performed according to the dose of 5 mpk conjugate per mouse. Fourteen days after administration, the animals were euthanized, and the gastrocnemius muscle, fat, heart, kidney and liver tissues were taken. The tissues were cut and placed in RNALater (Invitrogen, AM7021M) for subsequent RNA extraction. The tissues were ground in lysis buffer (Zhiang Biological, MNTR / FX96) (Shanghai Jingxin, JXFSTPRP-48L) to extract total RNA, which was reversely transcribed into cDNA (Takara, 6210B). The expression level of SOD1 mRNA was detected by probe qPCR (Applied Biosystems, 4444964). The primers of the target gene SOD1 and the primers of the internal reference gene β-actin were the same as those in Example 17.

[0281] The results were expressed as the residual expression level of the siRNA administration group compared with the solvent group (100% for the solvent group). The conjugate sequence used for injection is shown in Table 1, and the results of the residual expression level of SOD1 mRNA are shown in Figure 3 (each column in Figure 3 from bottom to top represents gastrocnemius muscle, heart, fat, kidney and liver, respectively). The results show that the conjugate SD005722 achieves a silencing activity comparable to the positive control SD005726 in heart, gastrocnemius muscle and fat tissue.

[0282] Example 20 In vivo testing of siRNA conjugate activity in rats

[0283] SPF grade female SD rats aged 6-8 weeks were selected, and the weight of the rats was 175±5 g. The above rats were weighed and observed before administration, and the animals with uniform weight and no abnormal state were randomly grouped, 4 in each group. The rats in the experimental group were given the conjugate, and the rats in the solvent group were given artificial cerebrospinal fluid. Intrathecal injection was performed according to the dose of 0.3 mg conjugate per rat. Fourteen days after administration, the animals were euthanized, and the lumbar cord, thoracic cord, hippocampus, frontal cortex, brainstem, cerebellum, heart, liver and kidney tissues were taken. The tissues were cut and placed in RNALater (Invitrogen, AM7021M) for subsequent RNA extraction. The tissues were ground in lysis buffer (Zhiang Biological, MNTR / FX96) (Shanghai Jingxin, JXFSTPRP-48L) to extract total RNA, which was reversely transcribed into cDNA (Takara, 6210B). The expression level of SOD1 mRNA was detected by probe qPCR (Applied Biosystems, 4444964).

[0284] Primer for the target gene SOD1:

[0285] Forward primer: TGGTCCACGAGAAACAAGATGA;

[0286] Reverse primer: CAAGCGGCTTCCAGCATTT;

[0287] Probe primer: AATGAAGAAAGTACAAAGACTG;

[0288] Primer for the internal reference gene β-actin:

[0289] Forward primer: ACTGCCCTGGCTCCTAGCA;

[0290] Reverse primer: GAGCCACCAATCCACACAGA;

[0291] Probe primer: ATCATTGCTCCTCCTGAG;

[0292] The results are expressed as the remaining expression level of the siRNA administration group compared to the vehicle group (100%). The sequence of the conjugate used for injection is shown in Table 1, and the results of the remaining expression level of SOD1 mRNA are shown in Figure 4 (each column in Figure 4 from bottom to top represents the lumbar spinal cord, thoracic spinal cord, hippocampus, frontal cortex, brain stem, cerebellum, heart, liver and kidney, respectively). The results show that the conjugates SD005640 and SD005719 exhibit silencing activity in the CNS tissues (hippocampus, frontal cortex, brain stem, cerebellum) comparable to the positive control SD004774. SD005614 exhibits silencing activity in the hippocampus, frontal cortex and cerebellum comparable to the positive control SD004774.

[0293] Example 21 Testing of siRNA conjugate activity in vivo in rats

[0294] SPF grade female SD rats aged 6-8 weeks were selected, and the rats weighed 175±5 g. The above rats were weighed and observed before administration, and the animals with uniform weight and no abnormal state were randomly grouped, 4 rats in each group. The rats in the experimental group were given conjugates, and the rats in the solvent group were given artificial cerebrospinal fluid. According to the dose of 0.3 mg of conjugate given to each rat, the tunica vaginalis was injected. Fourteen days after administration, the animals were euthanized, and the lumbar spinal cord, thoracic spinal cord, hippocampus, frontal cortex, brainstem, cerebellum, dorsal root ganglion, heart, liver and kidney tissues were taken. The tissue was cut and placed in RNALater (Invitrogen, AM7021M) for subsequent RNA extraction. The tissue was ground in the lysis buffer (Zhiang Biological, MNTR / FX96) (Shanghai Jingxin, JXFSTPRP-48L) to extract total RNA, and reverse transcribed into cDNA (Takara, 6210B). The expression level of SOD1 mRNA was detected by probe qPCR (Applied Biosystems, 4444964). The primers of the target gene SOD1 and the primers of the internal reference gene β-actin were the same as those in Example 20.

[0295] The results were expressed as the residual expression level of the siRNA administration group compared with the solvent group (the solvent group was 100%). The conjugate sequence used for injection was shown in Table 1, and the results of the residual expression level of SOD1 mRNA were shown in Figure 5 (each group of columns in Figure 5 represented the lumbar spinal cord, thoracic spinal cord, hippocampus, frontal cortex, brainstem, cerebellum, dorsal root ganglion, heart, liver and kidney from bottom to top, respectively). The results showed that the conjugates SD006541 and SD006773 exhibited comparable silencing activity to the positive control SD004774 in the CNS tissues (hippocampus, frontal cortex, brainstem, cerebellum).

[0296] Example 22 Testing the activity of siRNA conjugate in vivo in mice

[0297] SPF grade female C57BL / 6J mice aged 6-8 weeks were selected, and the weight of the mice was 20±2 g. The above mice were weighed and observed before administration, and the animals with uniform weight and no abnormal state were randomly grouped, 4 in each group. The mice in the experimental group were given conjugates, and the mice in the solvent group were given phosphate buffered saline (PBS). The tail vein injection was performed according to the dose of 1 mpk conjugate per mouse. Fourteen days after administration, the animals were euthanized, and the gastrocnemius muscle, fat in different parts, heart, kidney and liver tissues were taken. The tissues were cut and placed in RNALater (Invitrogen, AM7021M) for subsequent RNA extraction. The tissues were ground in the lysis buffer (Zhiang Biological, MNTR / FX96) (Shanghai Jingxin, JXFSTPRP-48L) to extract total RNA, and reverse transcribed into cDNA (Takara, 6210B). The expression level of SOD1 mRNA was detected by probe qPCR (Applied Biosystems, 4444964). The primers of the target gene SOD1 and the primers of the internal reference gene β-actin were the same as those in Example 17.

[0298] The results were expressed as the residual expression level of the siRNA administration group compared with the solvent group (the solvent group was 100%). The conjugate sequence used for injection was shown in Table 1, and the results of the residual expression level of SOD1 mRNA were shown in Figure 6 (each group of columns in Figure 6 represented fat (scapula), fat (inguinal), fat (gonad), liver, kidney, gastrocnemius muscle and heart from bottom to top, respectively). The results showed that the conjugate SD007257 achieved comparable silencing activity in brown adipose tissue, subcutaneous adipose tissue and visceral adipose tissue as the positive control SD005726, and the conjugate SD007257 was significantly superior to the positive control SD005726 in liver and muscle tissue selectivity.

[0299] The above detailed description of the present disclosure is intended to enable those skilled in the art to understand and implement the present disclosure, and cannot limit the protection scope of the present disclosure. Any equivalent changes or modifications made according to the spirit and principle of the present disclosure should be covered within the protection scope of the present disclosure.

Claims

1. An oligonucleotide comprising a group of general formula (I) located at any position on the nucleic acid chain of the oligonucleotide: wherein B is a natural nucleobase, a modified nucleobase, a universal base, or an H atom; R1and R2are each independently H, OH, halogen, NH2, C1-C6alkyl, C1-C6alkoxy, C3-C7cycloalkyl, C2-C6alkenyl, C2-C6alkynyl, S-CH3, NCH3(CH3), or OCH2CH2OCH3; or, m and n are each independently 1, 2, or 3; Z is absent or is one of the groups of formula (Z1) - (Z4): R4is H, C1-C6alkyl, C1-C6alkoxy, C3-C7cycloalkyl, C2-C6alkenyl, or C2-C6alkynyl; X is absent or is a linking combination of one, two, three, four or more of the groups shown in formula (X1)-(X12): R3is H, halogen, C1-C6alkyl, C1-C6alkoxy, C3-C7cycloalkyl, C2-C6alkenyl, or C2-C6alkynyl; j is an integer between 1 and 10; k is 1, 2, 3, or 4; Y is one of the groups of the formula (Y1) to (Y10): p is an integer between 5 and 25; denotes the site of covalent linkage of the groups.

2. The oligonucleotide of claim 1, wherein: R1and R2are each independently H, OH, halogen, NH2, C1-C3alkyl, C1-C3alkoxy, C3-C6cycloalkyl, C2-C4alkenyl, C2-C4alkynyl, S-CH3, NCH3(CH3), or OCH2CH2OCH3; or, m is 1 or 2; or, n is 1; or, Z is absent, or is a group of formula (Z1) or a group of formula (Z3); or, R4is H, C1-C3alkyl, C1-C3alkoxy, C3-C6cycloalkyl, C2-C4alkenyl, or C2-C4alkynyl; or, X is absent, or is a combination of one, two, three, four, or more of a group of formula (X1), a group of formula (X2), a group of formula (X3), a group of formula (X6), a group of formula (X7), a group of formula (X12); or, R3is H, halogen, C1-C3alkyl, C1-C3alkoxy, C3-C6cycloalkyl, C2-C4alkenyl, or C2-C4alkynyl; or, j is 1, 2, 3, 4, or 5; or, Y is a group of formula (Y1), a group of formula (Y2), a group of formula (Y3), a group of formula (Y4), a group of formula (Y6), a group of formula (Y7), a group of formula (Y8), or a group of formula (Y10); or, p is an integer between 10 and 25; or, B is a natural nucleobase, a modified nucleobase, or a universal base.

3. The oligonucleotide of claim 1, wherein: R1and R2are each independently H, OH, halogen, NH2, methyl, ethyl, propyl, methoxy, ethoxy, propoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, ethenyl, propenyl, butenyl, ethynyl, propynyl, butynyl, S-CH3, NCH3(CH3), or OCH2CH2OCH3; or, R4is H, methyl, ethyl, propyl, methoxy, ethoxy, propoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, ethenyl, propenyl, butenyl, ethynyl, propynyl, or butynyl; or, X is absent or is a combination of a group of formula (X1) and a group of formula (X6), a combination of a group of formula (X2) and a group of formula (X6), a group of formula (X6), a group of formula (X12), a combination of a group of formula (X3) and a group of formula (X6), a combination of a group of formula (X6) and a group of formula (X7), or a combination of a group of formula (X2), a group of formula (X3), and a group of formula (X6); or, R3 is H, halogen, methyl, ethyl, propyl, methoxy, ethoxy, propoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, ethenyl, propenyl, butenyl, ethynyl, propynyl, or butynyl; or, j is 1, 2, or 3; or, k is 1, 2, or 3; or, Y is a group of formula (Y1), a group of formula (Y2), a group of formula (Y3), a group of formula (Y4), a group of formula (Y6), a group of formula (Y7), a group of formula (Y8), or a group of formula (Y10); or, p is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25; or, B is a natural nucleobase or a modified nucleobase.

4. The oligonucleotide of claim 1, wherein: R2 is H, and n is 1; Z is absent or is a group of formula (Z1) or a group of formula (Z3); R4 is H; R1 is H, and m is 1 or 2; X is absent or is a combination of a group of formula (X1) and a group of formula (X6), a combination of a group of formula (X2) and a group of formula (X6), a group of formula (X6), a group of formula (X12), a combination of a group of formula (X3) and a group of formula (X6), a combination of a group of formula (X6) and a group of formula (X7), or a combination of a group of formula (X2), a group of formula (X3), and a group of formula (X6); R3 is H; j is 1 or 2; and k is 1, 2, or 3; Y is a group of formula (Y1), a group of formula (Y2), a group of formula (Y3), a group of formula (Y4), a group of formula (Y6), a group of formula (Y7), a group of formula (Y8), or a group of formula (Y10); p is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25; B is adenine, cytosine, guanine, uracil, or thymine.

5. The oligonucleotide of claim 1, wherein: X is absent, and Y is a group of formula (Y1), wherein p is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25.

6. The oligonucleotide of claim 1, wherein: X is a group of formula (X12), and Y is a group of formula (Y2), wherein k is 1, 2, or 3, R3 is H, methyl, ethyl, or propyl, and p is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25.

7. The oligonucleotide of claim 1, wherein: X is a group represented by formula (X6), and Y is a group represented by formula (Y8), wherein j is 1, 2 or 3, and p is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25.

8. The oligonucleotide of claim 1, wherein: X and Y are connected to form a group of any one of the following formulae: wherein p is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25, R3 is H, methyl, ethyl or propyl, j is 1, 2 or 3, and k is 1, 2 or 3.

9. The oligonucleotide of claim 8, wherein: Z is absent, or is a group represented by formula (Z1) or a group represented by formula (Z3); R1 and R2 are each independently H, OH, methyl, ethyl or propyl; m and n are each independently 1 or 2.

10. The oligonucleotide of any one of claims 1, 5 to 8, wherein: Z is absent, R1and R2are both H, m and n are both 1, the group of formula (I) is as shown in the following formula:

11. The oligonucleotide of claim 1, wherein: The group represented by the general formula (I) is any one of the following structures:

12. The oligonucleotide of claim 1 or 11, wherein: B is a natural nucleobase or a modified nucleobase.

13. The oligonucleotide of any one of claims 1 to 12, wherein: the group represented by general formula (I) is connected to the adjacent nucleotide via a phosphodiester bond or a phosphorothioate bond; or, the number of groups represented by general formula (I) in the nucleic acid chain can be 1, 2, 3, 4, 5, 6 or more.

14. The oligonucleotide of any one of claims 1 to 13, wherein: the oligonucleotide comprises an antisense strand complementary to a target gene, and a sense strand complementary to the antisense strand; wherein the group represented by general formula (I) is located at any position of the sense strand, preferably at any one or more of positions 1, 4 to 8 from the 5' end of the sense strand, and more preferably at any one or more of positions 5, 6, 7 from the 5' end of the sense strand.

15. The oligonucleotide of any one of claims 1 to 14, wherein: the oligonucleotide targets a tissue other than the liver; further, the oligonucleotide targets a CNS tissue, heart, gastrocnemius muscle or adipose tissue.

16. A compound or a tautomer thereof as shown in formula (II), E is a leaving group; Q is a phosphorus-containing active reactive group; B, R1, R2, m, n, Z, X and Y are as defined in any one of claims 1 to 12.

17. The compound of claim 16, or a tautomer thereof, wherein: The compound of formula (II) is any one of the following compounds:

18. A pharmaceutical composition, characterized by: It comprises the oligonucleotide of any one of claims 1 to 15, and a pharmaceutically acceptable carrier or excipient.

19. A method of making an oligonucleotide of any one of claims 1 to 15, characterized by: It comprises the following steps: (1) synthesizing a compound represented by general formula (II) or a tautomer thereof as claimed in claim 16 or 17; (2) synthesizing the oligonucleotide using the compound or tautomer thereof synthesized in step (1).

20. Use of the oligonucleotide of any one of claims 1 to 15 or the pharmaceutical composition of claim 18 in the manufacture of a medicament for extrahepatic delivery.

21. A method of reducing expression of a target gene in a cell or tissue, comprising: The method comprises the step of contacting the cell or tissue with the oligonucleotide of any one of claims 1 to 15 or the pharmaceutical composition of claim 18.

22. The method of claim 21, wherein: The cell or tissue is from a human.

23. The method of claim 21, wherein: The cell or tissue is a cell or tissue other than a hepatocyte or liver tissue; or, The tissue is a CNS tissue, heart, gastrocnemius muscle or adipose tissue, and the cell is a cell from a CNS tissue, heart, gastrocnemius muscle or adipose tissue.

24. A method of reducing expression of a target gene in a subject, comprising: The method comprises the step of administering to the subject the oligonucleotide of any one of claims 1 to 15 or the pharmaceutical composition of claim 18.

Images