Gene perturbation in human monocyte-derived macrophages

The method of lentiviral delivery with SAMHD1 inactivation and sequential transduction of CRISPR tools in MDMs addresses the limitations of lentiviral transduction in MDMs, enabling efficient and scalable gene editing and CRISPR screens in human monocyte-derived macrophages.

WO2026062037A1PCT designated stage Publication Date: 2026-03-26MYLLIA BIOTECHNOLOGY GMBH
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-09-17
Publication Date
2026-03-26

AI Technical Summary

Technical Problem

Current methods for inducing genetic perturbations in human monocyte-derived macrophages (MDMs) are limited by the challenge of lentiviral delivery and scalability, particularly due to the cellular restriction factor SAMHD1, which impedes efficient gene editing and transduction.

Method used

A method involving lentiviral delivery of CRISPR tools into MDMs, including inactivation of SAMHD1 using Vpx or other inhibitors, followed by sequential transduction with gRNA and RNA-guided programmable nucleases, enabling efficient genomic perturbation and pooled CRISPR screens.

Benefits of technology

This approach allows for efficient and scalable gene editing in differentiated MDMs, overcoming previous limitations and facilitating large-scale CRISPR screens by enhancing cellular fitness and transduction efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000047_0000
    Figure 00000047_0000
  • Figure 00000048_0000
    Figure 00000048_0000
  • Figure 00000049_0000
    Figure 00000049_0000
Patent Text Reader

Abstract

A method of engineering human monocyte-derived macrophage (MDMs) by a genomic perturbation of a gene in said MDMs using lentiviral delivery of CRISPR tools into said MDMs, wherein the CRISPR tools comprise at least one guide RNA (gRNA) and an RNA-guided programmable nuclease (RPN), comprising method steps for: a) inactivation of the cellular SAM domain HD domain-containing protein 1 (SAMHD1) in said MDMs; b) transduction of said MDMs with lentiviruses bearing said CRISPR tools, thereby obtaining transduced MDMs comprising said genomic perturbation; and c) determining the effect of said genomic perturbation on the MDMs; wherein a gRNA library comprising a repertoire of gRNAs that covers a variety of target genomic sequences of the MDMs is delivered into said MDMs.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] AE006P

[0002] -1-

[0003] GENE PERTURBATION IN HUMAN MONOCYTE-DERIVED MACROPHAGES

[0004] FIELD OF THE INVENTION

[0005] The invention relates to a method of gene perturbation in human monocyte- derived macrophages (MDMs). Such method can be used to produce libraries of MDMs, with a diversity of specific mutations such as knockout or deletion of one or more genes, or specific genetic activation or interference, which are invaluable tools to study single gene or epistatic effects in MDMs, or to screen for targets of improving MDM-based cellular therapy.

[0006] BACKGROUND OF THE INVENTION

[0007] Cells of the myeloid lineage cells such as macrophages, are versatile and vital cells within the immune system, playing a crucial role in both innate and adaptive immunity. These large, phagocytic cells are derived from monocytes, a type of white blood cell, and are found in virtually all tissues of the body. Macrophages are responsible for engulfing and digesting cellular debris, foreign substances, and pathogens, thus maintaining homeostasis and protecting the body against infections. Beyond their scavenging role, macrophages are also essential in orchestrating immune responses by presenting antigens to T cells and secreting various cytokines that modulate inflammation and tissue repair. Their ability to adapt to different microenvironments and perform diverse functions underscores their importance in health and disease, including their involvement in chronic inflammatory conditions, tissue regeneration, and cancer. Understanding the mechanisms and factors that control the differentiation and functional specialization of macrophages is essential to unravel the complexities of immune regulation and to develop therapeutic strategies for various immune-related diseases. A bottleneck in studying myeloid lineage cells at mechanistic level, however, has been the difficulty in inducing genetic perturbations in these cells.

[0008] Genome engineering of other primary human cell types with CRISPR-Cas9 has contributed significantly to uncovering biology and delineating therapeutic interventions. The CRISPR-Cas9 system consists of a guide RNA (gRNA) and the Cas9 effector protein, which together form a ribonucleoprotein (RNP) complex for genomic manipulation. Nucleofection of CRISPR-Cas9 RNP complexes in human monocytes were previously used for precise gene knockouts.

[0009] Hiatt et al., 2021 have described a method to obtain genetically edited MDMs through nucleofection of CRISPR-Cas9 RNPs. Using this approach, they showed a AE006P

[0010] -2- significant depletion of two candidate genes. This method, although robust, is not amenable to large scale pooled screens.

[0011] This approach of nucleofecting CRISPR-Cas9 RNPs can be used in an arrayed CRISPR screen where cells in each well receive a predefined gene knockout. While this method can be combined with different phenotypic readouts, it ultimately lacks the scalability to study complex molecular mechanisms of processes such as differentiation and functional specialization of MDMs.

[0012] In contrast, in a pooled CRISPR screen, each individual cell is perturbed according to the gRNA it receives, allowing the parallel investigation of the function of thousands of genes in a single experiment. In such screens, gRNAs are typically delivered by lentiviral transduction and integrated into the DNA of the target cells. Lentiviruses can infect both dividing and postmitotic cells and are therefore widely used in CRISPR experiments.

[0013] Lentiviral delivery of CRIPSR tools into primary monocytes and monocyte-derived cells, however, remains very challenging. This failure of transduction is orchestrated by the cellular restriction factor SAM domain HD domain-containing protein 1 (SAMHD1), a dNTPase that regulates intracellular dNTP pools, and thus, limits reverse transcription of viruses in host cells. Viruses such as HIV-2 and SIV, on the other hand, have evolved mechanisms to counteract such restriction factors by utilizing antagonistic accessory proteins such as the viral protein X (Vpx). Vpx is a component of cullin4A-RING E3 ubiquitin ligase (CRL4), which targets SAMHD1 for proteasomal degradation, thus rendering the otherwise refractory host cells permissive to lentiviral infection.

[0014] Berger et al., 2011 describe a method to genetically modify human monocyte- derived dendritic cells (MDDCs) with HIV-1-derived lentiviral vectors to improve the overall efficacy of LV-mediated gene transfer in MDDC. The method involves the simultaneous addition of noninfectious Vpx-VLPs and of the LV of interest onto MDDCs.

[0015] Berger et al., 2009 describe that the transduction efficiency of dendritic cells with nonintegrative HIV-1 vectors can be improved via Vpx-VLPs that promote the accumulation of complete and episomal viral DNA. In this setting, Vpx increases both the number of transduced cells and the levels of transgene expression.

[0016] Hrecka et al., 2011 disclose that Vpx relieves inhibition of HIV-1 infection of macrophages mediated by the SAMHD1 protein.

[0017] Liu et al., 2020, describe an approach to target a single gene for CRISPRi in primary human monocytes. AE006P

[0018] -3-

[0019] US2020155597A1 discloses genetic engineering of macrophages for immunotherapy. Immune cells are genetically engineered for modifying a tumor microenvironment. Methods are described for making a genetically modified immune cell, comprising delivering a first vector to an immune cell, wherein the first vector comprises a VPX protein and a nucleic acid encoding a payload protein.

[0020] WO2024168301A2 discloses personalized CRISPR profiling for cancer, and a method of treating cancer comprising administering to a subject a therapeutic molecule selected from a compilation of therapeutic molecules; wherein the therapeutic molecule has been selected by a method comprising modifying cancer cells from the subject by knocking down the function of a plurality of genes without targeted DNA cleavage of one or more genomic loci to generate modified cancer cells, each gene in the plurality of genes encoding for a protein target of a therapeutic molecule in the compilation of therapeutic molecules, whereby the therapeutic molecule has been selected if knocking down the function of the gene that encodes for the protein target of the selected therapeutic molecule impairs cancer cell viability or proliferation rate during in vitro propagation.

[0021] Bobadilla et al. (Gene Therapy 2013, 20(5): 514-520) discloses transduction of myeloid cells by a lentiviral vector that packagesss the Vpx accessory protein.

[0022] Hiatt et al. (Cell Reports 2021 , 35(6): 109105) discloses generation of isogenic primary human myeloid cells using CRISPR-Cas9 ribonucleoproteins.

[0023] Nazitto Rodolfo et al. (Journal of Immunology 2021 , 206(12): 2949-2965) discloses that ILF3 is a negative transcriptional regulator of innate immune responses and myeloid dendritic cell maturation.

[0024] Roesch et al. (Retrovirology 2018, 15:26) discloses a CRISPR screen for factors regulating SAMHD1 degradation identifies IFITMs as potent inhibitors of lentiviral particle delivery.

[0025] Freund et al. (Journal of Experimental Medicine 2020, 217(7):e20191692) discloses knockout of a single gene in primary human and murine myeloid cells by a non-viral delivery of CRISPR-Cas9.

[0026] There is a need for a pooled and an improved CRISPR screen in MDMs. AE006P

[0027] -4-

[0028] SUMMARY OF THE INVENTION

[0029] It is the objective to provide an improved method of CRISPR screening that overcomes the limitation of prior art nucleofection of MDMs. It is a particular objective to produce repertoires of diverse MDMs by lentiviral delivery of the CRISPR machinery, alongside the lentiviral delivery of a library of sgRNAs, such as to allow performing pooled CRISPR screens in MDMs.

[0030] The object is solved by the subject matter as claimed and as further described herein.

[0031] The invention provides for a method of perturbing a gene in a human monocyte- derived macrophage (MDMs) using lentiviral delivery of CRISPR tools into MDMs, wherein the CRISPR tools comprise at least one guide RNA (gRNA, also referred to as single guide RNAs, sgRNA) and an RNA-guided programmable nuclease (RPN), comprising method steps for: a) inactivation of the cellular SAM domain HD domain-containing protein 1 (SAMHD1) in MDMs; b) transduction of said MDMs with one or more lentiviruses bearing said CRISPR tools, thereby obtaining transduced MDMs comprising said genomic perturbation; and c) determining the effect of said genomic perturbation on the MDMs.

[0032] According to a specific aspect, the invention provides for a method of engineering human monocyte-derived macrophage (MDMs) by a genomic perturbation of a gene in said MDMs using lentiviral delivery of CRISPR tools into said MDMs, wherein the CRISPR tools comprise at least one guide RNA (gRNA) and an RNA-guided programmable nuclease (RPN), comprising method steps for: a) inactivation of the cellular SAM domain HD domain-containing protein 1 (SAMHD1) in said MDMs; b) transduction of said MDMs with lentiviruses bearing said CRISPR tools, thereby obtaining transduced MDMs comprising said genomic perturbation; and c) determining the effect of said genomic perturbation on the MDMs; wherein a gRNA library comprising a repertoire of gRNAs that covers a variety of target genomic sequences of the MDMs is delivered into said MDMs, preferably wherein the gRNA comprises at least 10 different gRNAs.

[0033] Specifically, said at least one gRNA is provided as a library of gRNAs comprising a repertoire of gRNAs that covers a variety of target genomic sequences.

[0034] Specifically, the lentiviruses are replication-deficient. AE006P

[0035] -5-

[0036] Specifically, the lentiviruses are integrative lentiviruses.

[0037] Specifically, the lentiviruses are integrative and replication-deficient.

[0038] Specifically, the MDMs are monocytes that are fully differentiated into MDMs.

[0039] Specifically, primary monocytes are used as a source of MDMs. Specific examples of monocytes are blood leukocytes, in particular of peripheral blood mononuclear cells (PBMC). Monocytes can be freshly prepared from a donor, or obtained from a cryopreserved source.

[0040] Fully differentiated MDMs are specifically characterized by expression of markers such as CD80, CD206, EGR2, CD38, Cd163, CD86, CD64, HLA-DR and VSIG4 or functional tests like phagocytosis and secretion of cytokines such as TNF, IL-1 , IL-6, IL- 8, and IL-12 release assays.

[0041] Specifically, the MDMs are mature MDMs.

[0042] By the method described herein it was the first time demonstrated that CRISPR was feasible in differentiated MDMs via a lentiviral method. It has been further demonstrated that the present approach can also be used to perform pooled CRISPR screens.

[0043] The present findings were surprising because MDMs were known as difficult to transduce immune cells and the prior art suggested to transduce monocytes before being differentiated into MDMs. It was particular surprising that inactivation of SAMHD1 was effective in differentiated MDMs, such as to allow efficient lentiviral delivery of CRISPR tools.

[0044] Surprisingly, lentiviral delivery of the CRISPR tools outperformed a hybrid approach, where the gRNA is introduced using a lentivirus and the RPN is delivered e.g. via electroporation into MDMs. Specifically, lentiviral delivery of the CRISPR tools into MDMs as described herein, wherein the gRNA and the RPN are delivered via lentivirus, is significantly more efficient than hybrid delivery.

[0045] Specifically, the MDMs are infected with the lentiviruses to deliver the RPN and the gRNA library ( / .e. the CRISPR tools). In particular, delivery of the RPN is herein understood as lentivirus transduction of an RPN coding sequence or an RPN expression cassette.

[0046] According to a specific aspect, the MDMs are infected with the lentiviruses to consecutively deliver the RPN and said gRNA library.

[0047] Specifically, in the method described herein, the MDMs are not co-transduced with lentiviruses delivering the RPN and gRNA library CRISPR tools. AE006P

[0048] -6-

[0049] Specifically, lentiviral delivery of the CRISPR tools is consecutively, meaning that the MDMs are consecutively (i.e., sequentially) infected with lentiviruses, to allow a staged process of lentiviral infection and transduction. Specifically, there is a first lentiviral delivery for the transduction of the cells with one of the CRISPR tools, namely one of the RPN or gRNA library, and a second lentiviral delivery for the transduction of the cells with the other one of the CRISPR tools. In particular, there is a recovery time between the first lentiviral delivery and the second lentiviral delivery to the MDMs.

[0050] According to a specific aspect, a) the MDMs are first delivered with said RPN, and following a recovery time, the MDMs are delivered with said gRNA library; or b) the MDMs are first delivered with said gRNA library, and following a recovery time, the MDMs are delivered with said RPN; preferably wherein the recovery time is at least one day.

[0051] Specifically, the recovery time is at least 1 day, preferably any one of at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 days.

[0052] This allows effective recovery of the MDMs after the first lentiviral delivery before being further delivered by lentiviruses with the other one of the CRISPR tools.

[0053] Considering such consecutive delivery and an optional recovery time, the cellular fitness and yield of MDMs turned out to be surprisingly increased. Cellular fitness is a special prerequisite for a successful pooled CRISPR screen.

[0054] Specifically, each of the lentiviral deliveries is in the presence of the SAMHD1 inactivator as further described herein.

[0055] According to a specific aspect, the inactivation of SAMHD1 is by the introduction of any one of: a) a lentiviral accessory protein that induces degradation of SAMHD1 , preferably Vpx of simian immunodeficiency virus (SIV) or of human immunodeficiency virus 2 (HIV- 2), or a lentivirus paralog of Vpx, preferably using a lentivirus vector expressing said lentiviral accessory protein, preferably a virus-like particle bearing a respective coding sequence, preferably a Vpx-expressing SIVsm virus-like particle (Vpx-VLPs); b) an inhibitor that targets said SAMHD1 , preferably an siRNA, antisense oligonucleotide or small molecule inhibitor; c) a SAMHD1 inactivating CRISPR tool comprising at least one SAMHD1 targeting guide RNA (SAMHD1-gRNA) and an RPN that is inactivating SAMHD1.

[0056] Specifically, SAMHD1 is a native protein that is endogenous to MDMs. AE006P

[0057] -7-

[0058] SAMHD1 is e.g., specified in the NCBI database as NM_015474.4(SAMHD1), or NM_015474.4(SAMHD1 ):c.1324C>T (p.Arg442Ter).

[0059] Specifically, human SAMHD1 comprises or consists of the amino acid sequence SEQ ID NO:1. Specifically, the gene encoding human SAMHD1 comprises or consists of SEQ ID NO:2.

[0060] Specifically, the lentiviral accessory protein originates from primate lentiviruses such as the simian immunodeficiency virus (SIV), the human immunodeficiency virus, type 2 (HIV-2), or the human immunodeficiency virus, type 1 (HIV-1), or is a lentivirus paralog of Vpx.

[0061] A suitable lentiviral accessory protein is Vpx that originates from certain SIVs, in particular Vpx of SIVsm (sooty mangabeys (SM), SEQ ID NO:3), or Vpx of SIVagm (African green monkeys (AGM), SEQ ID NO:4) or Vpx of SlVmac (Rhesus Macaque), SEQ ID NO:5, or of HIV-2 (SEQ ID NO:6).

[0062] Specifically, a lentivirus paralog of Vpx can be suitably used.

[0063] The respective lentiviral accessory protein that originates from HIV-1 is the Vpu protein (SEQ ID NO:7).

[0064] Further lentivirus paralogs of Vpx such asVpr can be used, e.g., originating from SIV-cpz (Chimpanzee immunodeficiency virus) SEQ ID NO:8, SIV-md (SIV mandrill) SEQ ID NO:9, SIV-sm (Sooty managabey): SEQ ID NO: 10, SIV-mac (Rhesus macaque) SEQ ID NO:11.

[0065] Any of the foregoing lentiviral accessory proteins are understood as wild-type proteins such as naturally occurring or expressed by the respective lentiviruses.

[0066] It is understood that any suitable variant of any of the foregoing lentiviral accessory proteins can be used which is functional as lentiviral accessory protein that induces degradation of SAMHD1 , preferably wherein the variant comprises at least any one of 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, up to 100% sequence identity to the respective wild-type protein sequence, for example comprising one or more point mutations e.g., only 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 point mutations in the amino acid sequence.

[0067] Specifically, the lentiviral accessory protein is functional in degrading SAMHD1 by recruiting a cullin4A-RING E3 ubiquitin ligase (CRL4) that targets SAMHD1 for proteasomal degradation.

[0068] According to a specific aspect, the lentiviral accessory protein is introduced into the MDMs using a lentivirus vector expressing said lentiviral accessory protein, AE006P

[0069] -8- preferably a virus-like particle (VLP) bearing a respective coding sequence, preferably a Vpx-expressing SIVsm virus-like particle (Vpx-VLPs).

[0070] Alternatively, the VLP comprises the lentiviral accessory protein]. Specific VLPs can be used as a carrier to introduce the lentiviral accessory protein into the MDMs.

[0071] Specifically, the lentivirus vector comprises an expression cassette which comprises the nucleic acid sequence encoding the lentiviral accessory protein and regulatory sequences such as expression control sequences to express the coding nucleic acid sequence in the MDMs following delivery of the lentivirus vector.

[0072] Specifically, the lentivirus vector is in the form of a VLP. Specifically, the VLP is an intact replication-defective virion, in particular a lentiviral virion. Lentivirus-based VLPs can be suitably engineered as protein (in particular the lentiviral accessory protein) delivery tool using well-known techniques.

[0073] Specifically, the VLP is based on a lentivirus that originate from primate lentiviruses such as the simian immunodeficiency virus (SIV), the human immunodeficiency virus, type 2 (HIV-2), or the human immunodeficiency virus, type 1 (HIV-1). Further suitable VLPs are based on lentiviruses such as Moloney leukemia Virus (MLV), Human Papilloma Virus (HPV), Friend Murine Leukemia Virus (FMLV), FIV (Feline Immunodeficiency Virus), BIV (Bovine Immunodeficiency Virus), EIAV (Equine Infectious Anemia Virus), Visna-Maedi Virus (VMV).

[0074] Specifically, the VLP comprises a viral envelope surface glycoprotein which originates from any of the lentiviruses listed above. Specifically, the viral surface envelope glycoprotein is expressed on the surface of the VLP. Specifically, the VLP comprises envelope proteins from another virus, specifically VSV-G.

[0075] Specifically, the VLP comprises the following components: Gag and Pol retroviral proteins and an envelope glycoprotein, but not comprising any virus-derived genetic information.

[0076] Specifically, the VLP-components originate from the same lentivirus, but may as well originate from different lentiviruses. Variants of one or more of the VLP components may be used to produce a hybrid lentiviral VLP.

[0077] Specifically, the VLP expressing the lentiviral accessory protein comprises the lentiviral accessory protein (e.g., the Vpx protein), Gag and Pol lentiviral proteins and an envelope glycoprotein. The Gag and Pol lentiviral proteins preferably originate from the same lentivirus, but may as well originate from different lentiviruses. AE006P

[0078] -9-

[0079] The origin of the Gag and Pol genes gives its name to the virus-like particle. For instance, the “SIVsm VLP” usually indicates that the Gag and Pol genes are those of SIVsm (sooty mangabeys), or are variant Gag and Pol genes from SIVsm.

[0080] Specifically, the SIVsm Gag protein comprises or consists of SEQ ID NO: 12

[0081] Specifically, the SIVsm Pol protein comprises or consists of SEQ ID NO:13

[0082] The envelope glycoprotein may be an envelope glycoprotein G or H.

[0083] The envelope glycoprotein is for example the envelope glycoprotein G from Vesicular Stomatitis Virus (VSV) SEQ ID NO:14

[0084] A preferred VLP according to the invention for example comprises or consists of products from the Gag, Pol, and Vpx genes from SIV (in particular, SIVsm) and the envelope glycoprotein G from VSV.

[0085] It is understood that any suitable variant of the wild-type VLP components that are functional to produce a lentiviral VLP can be used, preferably wherein the variant comprises at least any one of 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, up to 100% sequence identity to the respective wild-type amino acid sequence, for example comprising one or more point mutations e.g., only 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 point mutations in the amino acid sequence.

[0086] Specifically, SAMHD1 is inactivated by modulating expression or the levels of the SAMHD1 protein, which includes e.g., down-modulating the transcription of the mRNA from the gene encoding SAMHD1 and / or the translation of mRNA into SAMHD1 protein from the mRNA; or inhibiting the activity of the SAMHD1 protein, or deleting, knockingout, or otherwise mutating the gene encoding SAMHD1 for its inactivation.

[0087] According to a specific aspect, SAMHD1 can be inactivated using an inhibitor that targets said SAMHD1 , preferably an siRNA, antisense oligonucleotide or small molecule inhibitor.

[0088] Specific SAMHD1 gene silencers can be used as SAMHD1 inactivator.

[0089] Typically, gene silencers that are antisense oligonucleotides are one or more antisense oligonucleotides such as e.g., one, two, three, four or five different single stranded oligonucleotides, each being about 19-25 nt long and complementary to a specific region of the SAMHD1 gene.

[0090] Specifically, gene silencers which are effective by RNA interference (RNAi) can be achieved by using siRNA targeting SAMHD1 , or by intracellular expression of a short hairpin RNA (shRNA) that is processed into the effective small interfering RNA (siRNA) inhibitor by the RNAi machinery (Qiagen Cat. No. SI04243673, Franzolin et al., 2013), AE006P

[0091] -10-

[0092] (siSAMHDI , L-013950-01 , ON-TARGETplus Human SAMHD1 siRNA Smartpool, Dharmacon, Gutierrez-Chamorro et aL, 2023), SEQ ID NO:15 and SEQ ID NO:16 (Daddacha et aL, 2017)

[0093] Specifically, a selective small molecule inhibitor can be used as SAMHD1 inactivator. Suitable inhibitors can be identified by a biochemical screening campaign and complementary biochemical, biophysical, and cell-based readouts for further characterization of the screen output. Exemplary inhibitors are TH6342 and analogs thereof (Zhang et aL, 2024), (ProbeChem, Catalog no: PC-21770) and ribonucleotide reductase inhibitors such as gemcitabine and hydroxyurea. Specifically, a SAMHD1 inactivator could be a PROTAC or a molecular glue, which, upon binding to SAMHD1 , triggers the degradation of SAMHD1 .

[0094] According to a specific aspect, SAMHD1 can be inactivated using a SAMHD1 inactivating CRISPR tool comprising at least one SAMHD1 targeting guide RNA (SAMHD1-gRNA) and an RPN that is inactivating SAMHD1.

[0095] CRISPR tools as further described herein can be used for the purpose of inactivating SAMHD1. As a respective SAMHD1-gRNA any one of the following can be used: SEQ ID NO:17-20.

[0096] According to a specific aspect, the MDMs are transduced with said one or more lentiviruses bearing the CRISPR tools for genomic perturbation. Specifically, said transduction step is carried out after said SAMHD1 inactivation step, or said SAMHD1 inactivation and transduction steps are carried out simultaneously.

[0097] Specifically, the SAMHD1 inactivation step is performed using suitable amounts of the SAMHD1 inactivator or the respective inactivating tools thereby reducing the protein levels or protein activity of SAMHD1 dNTPase to less than 25% (w / w)

[0098] According to a specific aspect, the lentiviruses used for infection and transduction of the MDMs are of primate lentivirus origin, such as the simian immunodeficiency virus (SIV), the human immunodeficiency virus, type 2 (HIV-2), or the human immunodeficiency virus, type 1 (HIV-1). Further suitable lentiviruses are FIV (Feline Immunodeficiency Virus), BIV (Bovine Immunodeficiency Virus), EIAV (Equine Infectious Anemia Virus), Visna-Maedi Virus (VMV).

[0099] Specifically, the lentiviral transduction of the CRPSR tools provides for the CRISPR machinery to effect genomic perturbation of the MDMs. In particular, lentiviral transduction is performed in the presence of the SAMHD1 inactivator or the respective inactivating tools. AE006P

[0100] -11-

[0101] Specifically, one or more lentiviruses can be used to deliver the CRISPR tools and the Vpx at the same time. This can be achieved by transducing the cells with a mixture of three components: VLP containing VPX, a lentivirus encoding Cas9, and a lentivirus encoding sgRNA. Alternatively, this can be achieved through an 'all-in-one strategy' where a lentivirus encodes for both- Cas9 and sgRNA and is loaded with VPX as an accessory protein.

[0102] According to a specific aspect, a Vpx expression cassette may be included in the lentiviral donor sequence. Specifically, the Vpx coding sequence may be fused to a component of the lentivirus, such as Gag or Pol or the Envelope protein. Specifically, Vpx may be indirectly linked to the lentiviral particle.

[0103] According to a specific aspect, a library of different gRNAs is used to provide said at least one gRNA, for editing corresponding different genomic sequences of the MDMs by said CRISPR tools, thereby obtaining a variety of transduced MDMs comprising different genomic perturbations. Typically, a genomic sequence of interest (GOI) is a gene or target region of DNA that is associated with a gene. The approach is not limited to coding genes, but can be used to perturb other genetic elements such as non-coding RNA as well as promoters, enhancers and any other DNA elements.

[0104] Specifically, the gRNA library is a library of different gRNAs, whereby corresponding different genomic sequences of said MDMs that are targeted by said gRNA library are edited by said CRISPR tools, thereby obtaining a variety of transduced MDMs comprising different genomic perturbations, preferably wherein the variety of transduced MDMs is obtained in a pool of differently perturbed MDMs in the same containment, or in an array that comprises differently perturbed MDMs in separate containments.

[0105] Specifically, at least one of said repertoire of gRNAs is targeting a regulatory region selected from promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites and locus control regions.

[0106] Specifically, at least one of said repertoire of gRNAs is targeting a non-coding or untranslated region (UTR) of a gene within the MDM genome, preferably a target site in proximity to a promoter region, or a transcriptional start site (TSS), a 5’UTR, or 3’UTR of a gene. AE006P

[0107] -12-

[0108] Specifically, the gRNA library comprises a plurality of different gRNAs. Specifically, the plurality comprises at least 3 different gRNAs to target one or more different genomic sequences of interest.

[0109] In particular, the gRNA library comprises a number of gRNAs to target multiple genes of interest in a CRISPR screen, such as a pooled CRISPR screen or arrayed CRISPR screen.

[0110] Specifically, one or more gRNAs are targeting the same genomic sequence of interest such as a gene or target region of DNA that is associated with the same gene. For example, at least one, two or three different gRNAs are targeting the same genomic sequence of interest.

[0111] For a plurality of target GOIs such as a plurality of genes or respective target regions of DNA, a respective number of gRNAs is suitably used.

[0112] Specifically, the number of different gRNAs in the gRNA library is at least 3 (preferably at least 10) to target at least one GOI (preferably at least 3 different GOIs). Preferably, the number of different gRNAs in the gRNA library is at least any one of 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or even more e.g., up to 1.000, 2.000, 3.000, 4.000, 5.000, 6.000, 7.000, 8.000, 9.000, 10.000, 20.000, 30.000, 40.000, 50.000, 60.000, 70.000, 80.000, 90.000, 100.000, 200.000, or 300.000.

[0113] Specifically, a number of gRNAs is suitably used to target at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or even more e.g., up to 1.000, 10.000, or 100.000 different GOIs, preferably wherein each GOI is targeted by at least one, two or three different gRNAs.

[0114] In particular, a genome-scale gRNA library can be created using a large repertoire of corresponding gRNAs.

[0115] Specifically, the library of gRNAs is provided as a library of expression constructs wherein the members of the library encode the respective gRNA sequences.

[0116] Specifically, a library of gRNAs is delivered to the MDMs, such that individual cells receive one or more single gRNAs. For example, each cell of a perturbed MDM repertoire receives a different gRNA, or a different set of gRNAs.

[0117] Specifically, the gRNA library can be administered using a wide range of multiplicities of infection (MOIs). In particular, a lower MOI can be used to encourage delivery of only one gRNA per cell. Alternatively, a plurality of gRNAs can be introduced into the MDMs, which plurality comprises gRNAs that target a unique (different) genomic sequence of interest, it is possible to perturb multiple factors in a single cell. AE006P

[0118] -13-

[0119] Specifically, the gRNAs are perturbation gRNAs.

[0120] Specifically, the genomic perturbation results in perturbed MDMs, wherein MDMs are perturbed e.g., for the silencing, knock-down or knockout of a target GOI, or otherwise for activating a GOI.

[0121] According to a specific aspect, a variety of transduced MDMs is obtained in a pool of differently perturbed MDMs in the same containment, or in an array that comprises differently perturbed MDMs in separate containments.

[0122] For producing a pool of differently perturbed MDMs, a pool of gRNA lentiviruses targeting a number of different genomic sequences of interest is used. Such pooled approach allows pooled CRISPR screens.

[0123] Alternatively, the gRNAs lentiviruses can be used for individual gene perturbations in separate containments e.g., different wells.

[0124] According to a specific aspect, the RPN comprises or consists of a) a CRISPR nuclease, preferably any one of a type II or type V CRISPR nucleases, preferably Cas9 or Cas12a; or b) a CRISPR protein containing fusion or complex with an effector, preferably a transcription-modulating domain, or an editor such as a base editor or prime editor, and optionally one or more accessory proteins, or c) a nucleic acid encoding any of the foregoing.

[0125] Specifically, the RPN is delivered as a nucleic acid encoding said RPN.

[0126] Specifically, the RPN is a CRISPR nuclease such as a Cas nuclease.

[0127] Specifically, the RPN is a CRISPR protein that is catalytically inactive.

[0128] Specifically, the DNA-targeting protein is an RNA-guided catalytically inactive nuclease comprising a guide RNA (gRNA) having a targeting domain that is complementary to the target of modulation, preferably a nuclease-dead CRISPR protein (dCRISPR), in particular a nuclease-dead Cas9 (dCas9) protein.

[0129] For example, the Cas9 protein can be mutated so that the nuclease activity is reduced or inactivated. An inactivated Cas9 protein (“iCas9”, also referred to as “dCas9”) with no endonuclease activity has been targeted to genes in bacteria, yeast, and human cells by gRNAs to silence gene expression through steric hindrance. Exemplary mutations with reference to the S. pyogenes Cas9 sequence (UniProtKB - Q99ZW2) to inactivate the nuclease activity include: D10A, E762A, H840A, N854A, N863A, and / or D986A. Exemplary mutations with reference to the S. aureus Cas9 sequence (UniProtKB - J7RUA5) to inactivate the nuclease activity include D10A and N580A. AE006P

[0130] -14-

[0131] Specifically , the Cas9 protein is a mutant S. aureus Cas9 protein. Specifically, CRISPRi can be based on Acidaminococcus sp. (strain BV3L6) Cas12a / Cpf1 (UniProtKB - U2UMQ6). Exemplary mutations with reference to the Acidaminococcus sp. (strain BV3L6) Cas12a sequence include D908A.

[0132] A variety of different Cas nucleases, such as Cas9 (from Streptococcus pyogenes), Cas14, CasX, CasY, Cas12a, Cas13a, Cas13b, Cas13d, Cas14a, etc. can be used. Variant forms of such Cas nucleases are also contemplated, e.g., High-Fidelity Cas9, eSpCas9, SpCas9-HF1 , HypaCas9, Fokl-Fused dCas9, xCas9, dCas9, etc.

[0133] Specifically, the RPN is a CRISPR-Cas complex, preferably selected from the group consisting of a Cas9, Cas12a, Cas12f.

[0134] Specifically, the RPN is a fusion of a CRISPR protein (such as a Cas nuclease e.g., Cas9) with cytidine deaminase, also referred to as base editor, and optionally one or more accessory proteins. A base editor combines a catalytically impaired Cas protein with a nucleotide deaminase to convert one base to another at a target genomic region of interest. Thereby, specific nucleotide changes, such as transition and transversion mutations can be introduced in the targeted region.

[0135] Specifically, the RPN is a fusion of a CRISPR protein (such as a Cas nickase e.g., nCas9, in particular with a H840A mutation) with a prime editor such as reverse transcriptase, and optionally one or more accessory proteins. Prime editing can create precise insertions, deletions, and all 12 types of point mutations using the “search-and- replace” method without requiring double stranded breaks or donor DNA templates. A prime editor is typically a versatile, precise genome editing tool that is composed of a Cas9 nickase fused to an engineered reverse transcriptase (RT) and a prime editing guide RNA (pegRNA) containing a primer binding site (PBS) and an RT template.

[0136] Specifically, the RPN is a fusion which is a direct or indirect fusion. Specifically, the fusion is by tethering or translationally fusing a transcriptional modulator with the DNA-targeting protein, such as a dCRISPR protein ( / .e., through the use of a fusion construct).

[0137] In particular, the RPN fusion can be a CRISPR protein that is directly fused to the effector, or an unaltered CRISPR protein which is indirectly bound (“fused”) to the effector, by a gRNA vector that harbors an RNA aptamer that recruits the effector such as a transcriptional modulator domain, or a combination of the foregoing.

[0138] Specifically, the present disclosure teaches modified guide RNAs with RNA aptamers capable of recruiting one or more transcriptional modulator domain. The RNA AE006P

[0139] -15- aptamers may be operably linked to the 5' or 3' end of a guide RNA, and are designed so as to not affect the DNA-targeting protein (e.g., the dCRISPR protein) binding to a DNA target site. Instead, the RNA aptamers provide an additional tether from which to recruit one or more transcriptional modulators.

[0140] Specifically, a CRISPR system is used employing a targeted repressor or activator. Regulatory factors appended to a CRISPR protein may affect histone methylation or acetylation, DNA methylation or heterochromatin status. They may also aid in the recruitment of active transcription factors. Specifically, CRISPR-mediated gene silencing may occur using an CRISPRoff approach. Compact multipartite transactivation modules (MSN, NMS and eN3x9) can be used to build a CRISPR-dCas9 recruited enhanced activation module (CRISPR-DREAM) platform (Mahata etal., 2023).

[0141] According to a specific aspect, a transcriptional effector is used as a modulator of gene expression. Specifically, transcriptional effectors are chosen based on their ability to further repress, or alternatively, to activate the expression of a gene targeted by the DNA-targeting protein. Specifically, CRISPR modulation (CRISPRmod) is used, which includes either one or both of CRISPR interference (CRISPRi) and CRISPR activation (CRISPRa). CRISPR interference (CRISPRi) and activation (CRISPRa) are widely used to modulate gene expression. For the purpose of CRISPRi or CRISPRa, guide RNA designs in proximity to the gene’s promoter region or the transcriptional start site (TSS) are used, to result in silencing or activation, respectively.

[0142] Specifically, an effector is used that is selected from: a) a transcriptional repressor peptide for gene silencing, preferably a Kruppel- associated box (KRAB) domain, such as selected from the group consisting of ZIM3, or the KRAB domain of KOX1 ; or b) a transcriptional effector for gene activation, preferably a single transcriptional activation domain or combinatorial activation system, preferably selected from the group consisting of VP64, VPR (VP64, p65 and Rta), the SAM domain (consisting of p65 and HS1), the SunTag, the p300 / CBP histone acetyl transferase, SPH, or a transactivation module such as CRISPR DREAM (MSN, NMS or eN3x9); preferably wherein the RPN fused to the effector is any one of a dCas9-KRAB (repressor), dCas9-VP64 (activator), dCas9-VPR, VP64-dCas9-VP64, dCas9-p300, or dCas9-Tet1c, dCas9-EZH2, dCas9-NMS.

[0143] Specifically, the transcriptional effector for gene activation is selected from the group consisting of VP64, VPR such as VP64, p65 or Rta, the SAM domain such as AE006P

[0144] -16- consisting of p65 and HS1 , the SunTag, the p300 / CBP histone acetyl transferase, SPH, or a transactivation module such as MSN, NMS or eN3x9.

[0145] Specifically, the RPN fused to the effector is any one of a dCas9-KRAB such as a dCas9-KRAB repressor, dCas9-VP64 such as a dCas9-VP64 activator, dCas9-VPR, VP64-dCas9-VP64, dCas9-p300, dCas9-Tet1c, or dCas9-EZH2.

[0146] According to a specific aspect, the MDMs are derived from human CD14+ monocytes, in particular monocytes originating from human peripheral blood.

[0147] Blood-derived CD14+ monocytes can be obtained using standard protocols. Suitable sources of CD14+ monocytes are peripheral blood mononuclear cells isolated from healthy donors obtained from Red cross or commercial vendors like BiolVT, LLC; Research Donors Ltd (UK), Discovery Life Sciences, or Lonza.

[0148] According to a specific aspect, the monocytes cells are autologous in relation to a subject (e.g., a patient) who is concerned when identifying one or more suitable targets of cell therapy using the method and tools as described herein.

[0149] Specifically, the MDMs are obtained through (in vitro) differentiation by incubating the monocytes in the presence of a macrophage differentiating factor, preferably a cytokine such as M-CSF, optionally followed by incubating with one or more polarization stimuli, such as LPS, IFN-gamma, IL-4, IL-13, or TGF-beta.

[0150] Various protocols exist to differentiate MDMs such as incubating the monocytes with M-CSF in a suitable media, such as RPMI GM-CSF, RPMI M-CSF, Mac-SFM GM- CSF, or Mac-SFM M-CSF e.g., for at least 3 days. Typically, the MDMs are harvested about 3-5 days following addition of M-CSF to the monocytes.

[0151] Specifically, the MDMs are stimulated by a polarization stimulus following genomic perturbation. Typically, polarization is carried out within 24 hours. In particular, the gRNA-perturbed cells can be stimulated by different conditions, or treated with various small molecules, such as LPS, IFN-gamma, IL-4, IL-13, or TGF-beta.

[0152] Specifically, the methods and kit described herein are used for a CRISPR screen, in particular a pooled CRISPR screen, or an arrayed CRISPR screen.

[0153] According to a specific aspect, the effect of genomic perturbation is determined by screening the engineered MDMs for at least one phenotypic characteristic. Specifically, said at least one phenotypic characteristic is related to the respective genomic perturbation.

[0154] Specifically, said at least one phenotypic characteristic is determined upon singularization of said MDMs, or in a pool of the MDMs. AE006P

[0155] -17-

[0156] Specifically, at least one phenotypic characteristic is determined by measuring cellular fitness, or expression of one or more markers. Specifically, cellular fitness is determined by analyzing the number of gRNAs targeting a specific gene at different time points following perturbation by next generation sequencing. gRNAs targeting genes that support growth or survival of MDMs will disappear over time, whereas gRNAs targeting genes that limit growth or survival of MDMs will become over-abundant.

[0157] One or more suitable assays can be used such as selected from: MTT (3-(4, 5- dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide) assay, Trypan blue staining, membrane integrity assays, ATP assays like Cell Titer Blue / Glow, live-dead cellular stainings, proliferation markers (e.g. Ki67), or mitochondrial RNA content measurement.

[0158] Specifically, marker expression is determined at the RNA or protein level, preferably by flow-cytometry, immunohistochemistry, RNA-Seq (in particular single cell (sc) RNA-Seq, qRT-PCR, proteomics, ELISA, or microscopic imaging.

[0159] In particular, one read-out for the pooled CRISPR screen is single-cell RNA sequencing. This procedure is referred to as CROP-seq or Perturb-seq or CRISP-seq. Perturb-seq analysis elucidates the genotype-to-phenotype relations in perturbed MDMs by linking the transcriptomic phenotype to the CRISPR perturbation that triggered it.

[0160] In particular, for arrayed read-outs, ELISA, qPCR, or microscopic imaging is conveniently used.

[0161] High-throughput methods can be used for determining (or tracking) perturbations in a plurality of single cells. Specifically, a high-throughput method for determining perturbations in a plurality of single cells comprises expressing in each of a plurality of single cells one or more perturbation gRNAs, with or without a barcode nucleic acid sequence (of e.g., 3-400 nucleotides) that allows identifying the gRNA that is responsible for the specific perturbation. Specifically, the transduced MDMs are annotated with sgRNA-specific barcodes. Specifically, the gRNAs can be detected directly and can be utilized to decode which perturbation was present in the respective cell.

[0162] Specifically, a gRNA and a barcode sequence can be operatively linked to cisacting transcriptional regulatory elements. Such elements may include promoter sequences, polyA signals and enhancer elements.

[0163] Specifically, a gRNA may comprise a barcode which is a unique identifiable nucleotide sequence that is indicative for the respective perturbation of the host cell induced by the gRNA. In such case, the gRNA-barcode can be conveniently determined by sequencing the gRNA sequence. AE006P

[0164] -18-

[0165] Specifically, the gRNA sequence itself is a unique identifiable nucleotide sequence and can thus be used as a gRNA-barcode.

[0166] The amount of the gRNA-barcode within a perturbed MDM pool can be conveniently determined by any method of determining RNA or a corresponding nucleic acid sequence, such as e.g., described herein.

[0167] For example, a sequencing analysis of the gRNA-barcode library can be performed, which allows for a quantitative assessment of the gRNA-barcodes in the perturbed MDM pool. By comparing the read counts of the gRNA-barcode to a known standard, such as a reference or a control sample, the absolute amount of the gRNA- barcode in the MDM pool can be estimated. Specifically, gRNA-barcodes may also be detected by hybridization to suitable (e.g., complementary) DNA or RNA probes.

[0168] Specifically, the lentiviral expression constructs may also encode a detectable or selectable moiety. These moieties serve to provide information regarding which cells have been successfully infected or transfected and express the gRNA.

[0169] The detectable moiety can be a reporter polypeptide which is directly visualized or a member of a binding pair, which is identifiable via its interaction with an additional member of the binding pair.

[0170] Specifically, the reporter polypeptide can be a fluorescent protein. Exemplary fluorescent proteins include but are not limited to green fluorescent protein (Genbank Accession No. AAL33912), Fluorescein isothiocyanate (Genbank Accession No. AAF22695), orange fluorescent protein (Genbank Accession No. AAL33917) and blue fluorescent protein (e.g. Uniprot No. D6NKF4).

[0171] Additional reporter polypeptides may include products of bacterial luciferase genes, e.g., the luciferase genes encoded by Vibrio harveyi, Vibrio fischeri, and Xenorhabdus luminescens, the firefly luciferase gene FFlux, and the like.

[0172] In another example, the detectable moiety can be an enzyme producing a colorimetric reaction.), alkaline phosphatase (Genbank Accession No. AAK73766), peroxidase (Genbank Accession No. NP_568674), histidine tag (Genbank Accession No. AAK09208), Myc tag (Genbank Accession No. AF329457), biotin ligase tag (Genbank Accession No. NP 561589), beta galactosidase (Genbank Accession No. NM_1 25776), and strepavidin (Genbank Accession No. S 11540).

[0173] Methods of measuring a reporter polypeptide are well-known to those of skill in the art and the selection of the particular method is dependent upon the detectable moiety which is used in the system. For example, the reporter polypeptide may be AE006P

[0174] -19- detected using standard techniques (e.g., radioimmunoassay, radio-labeling, immunoassay, assay for enzymatic activity, absorbance, fluorescence, luminescence, and Western blot). More preferably, the level of the reporter protein is easily quantifiable using standard techniques even at low levels. Specifically, the reporter polypeptide is measured using a fluorescence-activated cell sorter (FACS).

[0175] According to a specific aspect, the invention provides for the use of the method described herein in a method of studying single gene or epistatic effects in MDMs. Specifically, epistatic effects are explored to determine the interaction of the effect of a gene mutation that is dependent on the presence or absence of mutations in one or more other genes.

[0176] According to another specific aspect, the invention provides for the use of the method described herein in a method of identifying or validating a therapeutic target. Specifically, the target is identified or validated, if its perturbation induces a desired effect of said MDMs. Specifically, the target is identified or validated for the development of a drug, a cell therapy, or gene therapy.

[0177] Specifically, the MDMs originate from a patient for which the target is identified or validated, in particular to develop a respective targeted therapy.

[0178] According to another specific aspect, the invention provides for the use of the method described herein in a method for improving macrophage cell therapy, preferably wherein the macrophage cell therapy is improved as compared a method using to MDMs that are not engineered for said genomic perturbation.

[0179] Specifically, the macrophage cell therapy is improved by using MDMs that are engineered for a specific genomic perturbation.

[0180] Specifically, the macrophage cell therapy is improved by using MDMs that are engineered and selected for perturbing one or more target GOIs.

[0181] Improvements can relate to activity, stability, longevity, or reduced side effects. The cell therapy can be improved as compared to MDMs that are not engineered for said genomic perturbation.

[0182] Specifically, the improvement is caused by at least one phenotypic characteristic of the engineered MDMs, such as cellular fitness, or expression of one or more marker.

[0183] Specifically, the present method can be applied to an MDM that is selected for utilization in cell therapy (e.g., a CAR macrophage), to screen for genes whose perturbation leads to an improved cell product. Improvements can relate to activity, stability, longevity, or reduced side effects. Following the CRISPR screen and AE006P

[0184] -20- identification of the relevant gene(s), the cell therapy product is suitably treated with a drug that targets the relevant gene(s), or the cells are engineered with CRISPR to obtain an enhanced cell therapy product.

[0185] According to a specific aspect, a library of perturbed MDMs is obtained from the perturbation screen described herein, wherein the library covers perturbation of a diversity of at least 10 different genes, preferably wherein the diversity of genes is as further described herein.

[0186] Specifically, the MDM library comprises a repertoire of perturbed MDMs which covers perturbation of a diversity of at least 10 different genes.

[0187] Specifically, the perturbation is directed to the MDM’s genome, in particular the genome of a wild-type MDM.

[0188] Specifically, the diversity is at least any one of 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 different genes, in specific cases up to 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or all of the endogenous genes comprised the MDM genome, in particular the wild-type MDM genome.

[0189] The library may be contained in one or more containments e.g., in a pool or in an arrayed device.

[0190] According to a specific aspect, the invention provides for a kit for performing a method as described herein, comprising:

[0191] (i) an inactivator of SAMHD1 such as described herein; and

[0192] (ii) one or more lentivirus vectors bearing said RPN and a library of at least 10 different gRNAs.

[0193] FIGURES

[0194] Figure 1 : Lentiviral transduction efficiency in MDMs. Cells were either left untransduced, or transduced with lentivirus encoding sgRNA-NTC, or a combination of sgRNA-NTC and VLP-Vpx. Transduction efficiency is read out in terms of %GFP+ cells.

[0195] Figure 2: B2M and CD81 levels in MDMs transduced with sgRNA against NTC, B2M or CD81. Cells were either transduced on day 0, immediately after thawing of monocytes (A) or on day 5, after differentiation into MDMs (B). Histograms depict the distribution of fluorescence levels for antibodies targeting B2M or CD81 proteins.

[0196] Figure 3: B2M and CD81 levels in MDMs transduced with sgRNA against NTC, B2M or CD81. Cells were transduced on day 5, after differentiation into MDMs. Knockdown of markers was evaluated on day 14 (A) or day 21 (B). Histograms depict the distribution of fluorescence levels for antibodies targeting B2M or CD81 proteins. AE006P

[0197] -21-

[0198] Fiqure 4: Sequences provided herein

[0199] Figure 5: (A). Uniform manifold approximation and projection (UMAP) plot of 35,464 perturbed hMDMs post quality control, KRAB-dCas9, and gRNA assignment, shaded by macrophage subtype. (B) and (C). Contour density plots of hMDMs assigned to indicated sgRNA targets in UMAP space. The total perturbed cells contour is shown in greyscale underneath.

[0200] Figure 6: Heatmap summarizing the effects of CRISPRi targeting 78 individual genes, with each gene perturbation labeled along the x-axis and the normalized gene expression values measured along the y-axis. The log2fold changes in gene expression are measured and indicated as the grey tiles. The bar graph on the right indicates the expression level of each of the target genes in human MDMs.

[0201] Figure 7: Transcriptome comparison of MDMs transduced with gRNA for the indicated genes versus those transduced with NTC. Each knockdown is represented as a dot. The dots on the left represent knockdowns that inhibit M1 polarization and those on the right represent knockdowns that promote M1 polarization. X-axis shows shift on the LDA scale; Y-axis shows statistical of the shift.

[0202] Figure 8: (A). B2M levels in MDMs transduced with sgRNA against B2M or NTC. dCas9 was introduced either via a lentivirus (left) or electroporation (right) Histograms depict the distribution of fluorescence levels for antibodies targeting B2M protein. (B). Viable MDM count at the endpoint for the experiment in Fig. 8A.

[0203] Figure 9: B2M levels in MDMs transduced with sgRNA against NTC or B2M. Cells were transduced with (A) an all-in-one LV that encodes for KRAB-dCas9 and sgRNA or (B) with two separate LVs- one encoding for KRAB-dCas9 and the second one for sgRNA. Histograms depict the distribution of fluorescence levels for antibodies targeting B2M.

[0204] DETAILED DESCRIPTION OF THE INVENTION

[0205] Unless indicated or defined otherwise, all terms used herein have their usual meaning in the art, which will be clear to the skilled person. Reference is for example made to the standard handbooks. Genetic modifications described herein may employ tools, methods and techniques known in the art, such as described by J. Sambrook et al., Molecular Cloning: A Laboratory Manual(3rdedition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York (2001), Lewin “Genes ”V”, Oxford University Press, New York, (1990), and Janeway et al. “Immunobiology” (5thEd., or more recent editions), Garland Science, New York, 2001. AE006P

[0206] -22-

[0207] The terms “comprise”, “contain”, “have” and “include” as used herein can be used synonymously and shall be understood as an open definition, allowing further members or parts or elements. “Consisting” is considered as a closest definition without further elements of the consisting definition feature. Thus “comprising” is broader and contains the “consisting” definition.

[0208] The subject matter of the claims specifically refers to artificial products or methods employing or producing such artificial products, which may be variants of native (wildtype) products, such as MDMs. Though there can be a certain degree of sequence identity to the native structure, it is well understood that the materials, methods and uses of the invention, e.g., specifically referring to isolated nucleic acid sequences, amino acid sequences, fusion constructs, expression constructs, perturbed MDMs and modified proteins, are “man-made” or synthetic, and are therefore not considered as a result of “laws of nature”.

[0209] Specific terms as used throughout the specification have the following meaning:

[0210] The term “CRIPSR screen” is herein understood as RPN-mediated perturbation screen which employs CRISPR tools.

[0211] CRISPR technology allows functional genetic screens for understanding the genetic underpinnings of biological pathways at a systems level. Typically, CRISPR screening is a large-scale experimental approach used to screen a population of mutant cells to discover genes involved in a specific phenotype. Instead of modulating expression of genes at the post-transcriptional level, CRISPR introduces mutations to genes for a specific genetic perturbation by editing genetic sequences of interest using the CRISPR gene editing machinery ( / .e. the CRISPR system).

[0212] These screens employ a genetics approach, in which cellular phenotypes arising from genetic perturbations, in particular genome-wide perturbations, are analyzed. Causal relationships between the genes and phenotypes can then be validated through further screening and experimentation. In principle, there are two modalities of genetic perturbations used in screens: gain-of-function or loss-of-function. The former involves driving the expression of a gene so that more mRNA / protein is produced. The latter method involves reducing the amount of or terminating mRNA / protein associated with genes of interest. For both types of manipulation, changes in resulting phenotypes indicate the involvement of a gene in the pathway or disease state of interest.

[0213] Loss-of-function screens play an important role in drug discovery, the process through which new drugs are developed to treat diseases. In the target-based approach AE006P

[0214] -23- to drug discovery, a target gene (or gene product) that is associated with a disease is first identified and target-specific therapies or chemical compounds can then be screened for a desired therapeutic effect.

[0215] The first step of a drug discovery pipeline, called target identification, aims to identify genes (or mRNA or proteins) that are associated with a disease of interest. Loss- of-function screens often play a pivotal role in identifying putative targets. Large-scale screens systematically perturb large sets of genes in order to discover targets in an unbiased fashion. For instance, gene disruptions in healthy cells that recapitulate a disease phenotype implicates the gene’s association with the disease. Alternatively, genetic disruptions in diseased cells (e.g., cancer) that revert the disease phenotype and cause a normal or healthy phenotype can mimic the therapeutic effect of a drug.

[0216] In addition to discovering novel drug targets, loss-of-function screens can also be used to improve existing therapies. For instance, genes can be identified that confer resistance or increase sensitivity to an existing therapy or drug.

[0217] CRISPR screens can further be used to develop potent combinations of therapies or drugs. Combinatorial screens, in which multiple genes are knocked out, can uncover genetic interactions that can be leveraged for therapy development. Using such screens helps researchers gain insights on the complexities of different diseases and enable the development of more personalized medicines.

[0218] Genes identified in a primary screen typically undergo a process of target validation to confidently determine whether an identified gene is directly linked to the phenotypic effect. Ways to increase confidence in gene-disease relationships include reproducing the results in biologically relevant cell types. Another approach is to design different gRNA sequences for the same gene targets and observe whether the same change in phenotype occurs. Another strategy is to choose an orthogonal method of gene perturbation. For instance, if RNAi was used in a primary screen, CRISPR can be used in a secondary screen, or vice versa. Another strategy is to engineer monoclonal cell lines bearing the gene perturbation and assessing the phenotypic consequences in these monoclonal cells. Specific expression products described herein are CRISPR expression products such as CRISPR enzymes or CRISPR proteins (including e.g., protein fusions) which are used in methods of genomic perturbation of a cell that expresses such CRISPR expression product in conjunction with a guiding element to target genomic site of interest. A specific expression system herein described is referred to as CRISPR system or CRISPR machinery. AE006P

[0219] -24-

[0220] The term “expression” of a coding DNA or of a gene product of the coding DNA, such as expression of a respective polypeptide, protein or nucleic acid encoded by the DNA, in particular RNA, is herein meant to encompass at least one step selected from the group consisting of DNA transcription into mRNA, mRNA processing, mRNA splicing, mRNA maturation, mRNA export, mRNA translation, protein folding and / or protein transport.

[0221] The term “expression cassette” is herein understood to refer to nucleic acid molecules (herein also referred to as polynucleotides), which contain a desired coding sequence (herein referred to as a gene), and control sequences in operable linkage, so that host cells transformed or transfected with these molecules incorporate the respective sequences and are capable of producing the encoded proteins.

[0222] One or more expression cassettes are herein also understood as “expression system”. The expression system may be included in an expression construct, such as an artificial expression cassette, a vector and in particular a plasmid. The relevant DNA of an expression cassette or construct may also be integrated into a host cell chromosome.

[0223] Expression cassettes are conveniently provided as expression constructs e.g., in the form of “vectors”, which are typically DNA sequences that are required for the transcription of cloned recombinant nucleotide sequences i.e., of recombinant genes and the translation of their mRNA in a suitable host organism. The term “vector” as used herein specifically includes lentiviral vectors which comprise genome integrating nucleotide sequences.

[0224] Preferred expression vectors described herein are expression vectors suitable for expressing a recombinant gene in eukaryotic host cells such as human MDMs. Appropriate expression vectors typically comprise regulatory sequences suitable for expressing DNA encoding a polypeptide or protein of interest in the host cells. Examples of regulatory sequences include promoter, operators, enhancers, ribosomal binding sites, polyadenylation sites and sequences that control transcription and translation initiation and termination. The regulatory sequences are typically operably linked to the DNA sequence to be expressed.

[0225] To allow expression of a recombinant nucleotide sequence in a host cell, a promoter sequence is typically regulating and initiating transcription of the downstream nucleotide sequence, with which it is operably linked. An expression cassette or vector typically comprises a promoter nucleotide sequence which is adjacent to the 5’ end of a AE006P

[0226] -25- coding sequence, e.g., upstream from and adjacent to the coding sequence (e.g., gene of interest) or if a signal or leader sequence is used, upstream from and adjacent to said signal and leader sequence, respectively, to facilitate translation initiation and expression of coding sequences to obtain the expression product.

[0227] The term “genetic region of interest” or “genomic region of interest” (GOI) as used herein shall mean a genomic DNA region encoding a gene product of a specific gene, or one or more (or all) DNA regions which regulate the production of the gene product, whether or not such regulatory sequences are adjacent to coding and / or transcribed sequences. Accordingly, a GOI is understood to not only include genes, but also to include promoter sequences, exons and introns, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites and locus control regions.

[0228] The term “lentivirus” (LV) as used herein shall refer to a retrovirus of the genus lentivirus that express reverse transcriptase and optionally integrase. These two enzymes are used to integrate viral RNA into host DNA, allowing for the exploitation of host machinery to express viral genes. Lentiviruses can convert viral RNA into complementary DNA (cDNA) and may integrate a significant amount of viral cDNA into the DNA of a host cell. Lentiviruses can efficiently infect nondividing cells, so they are one of the most efficient methods of gene delivery and are broadly applicable across proliferating and non-proliferating cell types. They can become endogenous, integrating their genome into the host germline genome, so that the virus is henceforth inherited by the host’s descendants. According to the classification of the International Committee on Taxonomy of Viruses (ICTV), the genus lentivirus belongs to the family Retroviridae and currently comprise of nine species: seven animal lentiviruses and two human lentiviruses. Animal lentiviruses are bovine immunodeficiency virus (BIV), caprine arthritis encephalitis virus (CAEV), equine infectious anemia virus (EIAV), feline immunodeficiency virus (FIV), puma lentivirus (PLV), simian immunodeficiency virus (SIV) and visna / maedi virus (VMV). Human species are well-known human immunodeficiency virus 1 (HIV-1) and human immunodeficiency virus 2 (HIV-2).

[0229] As used herein, the term “lentivirus”, shall also encompass lentiviral particles, and in particular replication-incompetent lentiviral particles.

[0230] Using lentiviral vectors to deliver genes into targeted cells has proven to be a dependable, efficient, and safe method for research. Typically, lentiviral vectors are AE006P

[0231] -26- modified from a wild-type lentivirus, with many of the viral genes removed. Such lentiviral vectors are referred to as “lentiviral particles” or “lentivirus particles”.

[0232] LV are commonly used as a vector (or plasmid) for delivery of a nucleic acid molecule (or gene) into the host cell’s genome. Such nucleic acid molecule is herein referred to as a “transgene”. LV can be packaged with a transgene for transgene delivery.

[0233] A transgene sequence is typically flanked by long terminal repeat (LTR) sequences, which facilitate integration of the transfer plasmid sequences into the host genome. In particular, it is the sequences between and including the LTRs that is integrated into the host genome upon viral transduction.

[0234] Upon infection of a cell, a LV may or may not replicate, depending on whether the virus is replication-incompetent or replication-competent. For safety reasons, commonly used lentiviral transfer plasmids are replication incompetent. In particular, the lentiviral transfer plasmids may contain an additional deletion in the 3'LTR, rendering the virus “self-inactivating” (SIN) after integration. Specifically, a lentiviral vector only contains the LTRs and the packaging signal, 4. In addition, lentiviral packaging genes can be provided on separate plasmids (one or more “packaging plasmids”), so the pseudo lentiviral particles are replication-incompetent, with a deficiency to replicate.

[0235] The term “monocyte-derived macrophage” or “MDM” as used herein shall refer to immune cells that originate from the differentiation of monocytes, in particular blood monocytes, such as CD14positive(CD14+) monocytes (including CD14 high or low expressors). The term “MDM” shall particularly refer to a differentiated, mature blood monocyte-derived macrophage, such as derived from CD14+-monocytes.

[0236] The term not only refers to wild-type MDMs as naturally occurring, but also includes perturbed or otherwise engineered MDMs such as CAR-MDMs. MDMs are herein understood as single cell, a plurality of single cells, or a mixture (pool) of a plurality of MDMs e.g., an MDM pool of differently perturbed cells.

[0237] MDMs are typically generated from peripheral blood monocytes and are widely used to model human macrophages for in vitro studies.

[0238] MDMs can present with a spectrum of different phenotypes, ranging from pro- inflammatory (M1 -like) to anti-inflammatory (M2-like) macrophages. M2-like macrophages can be further subdivided into M2a, M2b, and M2c macrophages. Polarization of macrophages in vitro, can be accomplished by stimulation with a suitable polarization stimulus such as lipopolysaccharide (LPS) and interferon-y (IFN-y) (M1 AE006P

[0239] -27- polarization), or interleukin-4 (IL-4) and IL-13, or IL-10 (M2a and M2c polarization, respectively). Typically, MDMs are highly plastic cells, with the ability to switch between phenotypes and polarization states. In vitro culture techniques can impact polarization and phenotype of the MDMs.

[0240] Primary monocytes are MDM precursors and together they constitute part of the mononuclear phagocyte system. Ex vivo monocytes can be divided into three distinct subpopulations based on their expression of CD14 and CD16: classical monocytes with CD14highCD16negexpression, intermediate monocytes with CD14highCD16pos, and non- classical monocytes with CD14|OWCD16high. Ex vivo monocytes purified from donor peripheral blood mononuclear cells (PBMCs e.g., from cryopreserved PBMC) are a key source of monocytes, and MDMs are the principal source of cells for in vitro studies in human macrophages.

[0241] Different methods can be employed to purify monocytes from PBMCs. Commonly used methods employ plastic adhesion and / or magnetic bead-based immuno-isolation kits (negative and CD14posselection). It is preferred that any such purification method produces pure monocyte / MDM population or products with low contamination by lymphocytes, granulocytes, and platelets.

[0242] The term “genomic perturbation” and “genomic perturbation screen” as used herein is specifically understood in the following way.

[0243] A host cell can be mutagenized or engineered by genomic perturbation, in particular CRISPR-mediated perturbation, of one or more targets in the genome.

[0244] A genomic target of perturbation is herein also referred to as a “perturbed gene” or “perturbed GOI”. A cell that is undergoing targeted perturbation is also referred to as “perturbed cell”. Specifically, the methods described herein produce “perturbed MDMs”.

[0245] A cell may be engineered for genomic perturbation of one or more genes ( / .e., targets(s) of genomic perturbation), thereby modulating the expression of respective gene(s), such as upregulating, downregulating, overexpressing or underexpressing (understood as expressing at higher and lower levels than normal, respectively), or completely inactivating, deleting or knocking out the target(s) of the perturbation.

[0246] Genomic perturbation may lead to a change in expressing a gene or a gene product. Expression of a gene may be upregulated or downregulated. A gene may be overexpressed, such as expressed at higher levels, or underexpressed, such as expressed at lower levels, as compared to a host cell without such engineering. The yield of host cell products may be increased or reduced by genomic perturbation. A gene AE006P

[0247] -28- editing method may be used for host cell engineering. Specifically, the host cell may express a CRISPR enzyme or protein to support engineering the host cell’s genome by CRISPR-mediated perturbation.

[0248] Genomic perturbation of a host cell line or population which targets a variety of different host cell genes or respective regulatory elements, can result in a diversity of host cells with differences in the respective host cell’s genome.

[0249] As described herein, specific perturbed host cells are perturbed MDMs. A repertoire of host cells (MDMs) can be produced by genomic perturbation of the host cell. Specifically, host cells originating from the same source are subject to genomic perturbation, which may result in the same type of host cells, but with a difference in their genome that corresponds to the target and type of genomic modulation caused by the perturbation.

[0250] A repertoire of diverse perturbed cells (e.g., MDMs) can be produced by genomic perturbation of host cells to target different genes in a cell population or in individual cells. For example, a repertoire comprises a diversity of cells, wherein each cell is differently perturbed, and / or perturbed to target a different gene.

[0251] For perturbation of a diversity of genes, a library of targeting molecules can be used, such as e.g., a library of different guide RNAs (e.g., gRNA, sgRNAs), each targeting a different gene.

[0252] In an RPN-mediated perturbation screen (CRISPR screen) described herein, the library of targeting molecules can be used in the presence of an RPN that mediates the genomic perturbation in cells, thereby obtaining a repertoire of diverse cells, wherein the diversity originates from the respective targeting molecules (such as guide RNAs e.g., gRNA, sgRNAs) which cause a variety of perturbations in the cells.

[0253] Perturbation methods and tools are well-known in the art. Specifically, the method comprises (1) introducing single-order or combinatorial perturbations to a population of cells, (2) measuring genomic, genetic, proteomic, epigenetic and / or phenotypic differences in single cells and (3) assigning a perturbation(s) to the single cells. A perturbation may be linked to a phenotypic change, preferably changes in gene or protein expression. Specifically, measured differences that are relevant to the perturbations are determined by applying a model accounting for co-variates to the measured differences. The model may include the capture rate of measured signals, whether the perturbation actually affected the cell (phenotypic impact), the presence of subpopulations of either different cells or cell states, and / or analysis of matched cells AE006P

[0254] -29- without any perturbation. Specifically, the measuring of phenotypic differences and assigning a perturbation to a single host cell can be determined by determining a respective marker (e.g., barcode) in the host cell’s product and / or by determining structure, function or activity of the host cell’s product.

[0255] Specifically, CRISPR systems and respective CRISPR tools may be used for targeted genomic perturbation of MDMs such as described herein.

[0256] In the context of a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) system, a “target”, refers to a genomic sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Where a transcription-modulating domain is employed, upon such hybridization of the guide sequence, the target GOI is typically upregulated or downregulated in terms of its expression level. Typically, the target sequence is a regulatory sequence, such as a promoter or a transcriptional start site, which controls the expression of said GOI.

[0257] A target (in particular, a target GOI) is understood to be “perturbed”, if there is a genomic perturbation that affects the GOI, its expression or respective gene products (e.g., gene transcripts).

[0258] Specifically, genomic perturbation can result in the inactivation, deletion of knockout of a target. Genomic elements are suitably targeted by using a number of guide RNAs, e.g., one, two or three guide RNAs, to delete (or inactivate, or knockout) regions of a defined size.

[0259] The CRISPR-based methods described herein may cause perturbations for silencing, knock-down or knockout of a GOI, or otherwise for activating of a GOI. Silencing, knock-down or knockout refers to techniques by which the expression of a GOI is reduced. Activating or knockin refers to techniques by which the expression of a GOI is increased. Differential expression of a target GOI may result from its perturbation, such as by interfering (or downregulating) or activating (or upregulating) of the target gene expression.

[0260] Specifically, a gene knockout refers to techniques by which the expression of a gene is fully blocked i.e., the respective gene is inoperative, or even removed. Methodological approaches to achieve this goal are manifold and known to the skilled person. Examples are the production of a knockout mutant which is dominantly negative for the given gene. Other examples refer to gene alteration which may lead to a dysfunctional gene product or to a gene product with reduced activity. This approach AE006P

[0261] -30- involves the introduction of frame shift mutations, nonsense mutations ( / .e., introduction of a premature stop codon) or mutations which lead to an amino acid substitution which renders the whole gene product dysfunctional, or causing a reduced activity. Protocols describing the practical application of gene silencing, gene knock-down, gene knockout, delivery of a dominant negative construct, and / or gene alteration are routine and commonly available to the skilled person. The technical teaching provided herein is thus entirely enabled with respect to all conceivable methods leading to an inactivation, inhibition, deletion, knockout, or reduction of gene expression of a gene product, or to the expression of a dysfunctional, inactive gene product, or a gene product with reduced activity.

[0262] Specifically, the gene expression can be downregulated (thereby reducing expression) or upregulated (thereby increasing expression). According to a specific example, the perturbation can occur by introducing a small insertion or deletion into a coding exon, thus partially or completely eliminating the respective functional gene product from the target cell.

[0263] The term “reduce expression” generally refers to any amount less than an expression level exhibited by a reference standard, which is a cell prior to the engineering to reduce expression of a certain gene, or which is otherwise expressed in a cell of the same type or species which is not engineered to downregulate expression of said gene. Typically, a cell is engineered to downregulate expression of a GOI by genetic modification to reduce expression of said gene, thereby obtaining an expression level of a gene product which is less than the expression of the same gene product prior to said genetic modification or in a comparable cell which does not comprise said genetic modification. “Less than” includes, e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80, 90% difference, or more. No expression of the gene product is also encompassed by the term “reduction of expression”.

[0264] The term “reduction” in the context of gene expression as used herein refers to an experimental approach leading to reduced expression of a given gene compared to expression in a control cell. Downregulation of expression of a gene can be achieved by various experimental means such as introducing nucleic acid molecules into the cell which hybridize with parts of the gene’s mRNA leading to its degradation (e.g., shRNAs, RNAi, miRNAs) or altering the sequence of the gene in a way that leads to reduced transcription, reduced mRNA stability or diminished mRNA translation. A specific approach uses CRISPRi. AE006P

[0265] -31-

[0266] The term “increase expression” generally refers to any amount higher than an expression level exhibited by a reference standard, which is a cell prior to the engineering to reduce expression of a certain gene, or which is otherwise expressed in a cell of the same type or species which is not engineered to upregulate expression of said gene. Typically, a cell is engineered to upregulate expression of a GOI by genetic modification to increase expression of said gene, thereby obtaining an expression level of a gene product which is higher than the expression of the same gene product prior to said genetic modification or in a comparable cell which does not comprise said genetic modification. “Higher than” includes, e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80, 90% difference, or more.

[0267] CRISPR tools described herein may or may not comprise an effector such as a transcription effector. Effectors described herein may be repressors or activators, and typically contain DNA binding domains that recognize and bind recognition sites or sequences in the promoters of transcriptionally active or inactive genes, and also may contain activation or repression domains that activate or suppress gene transcription when the transcription modulator binds to the recognition site or sequence. Transcription effector binding motifs are known in the art. As a specific example, a transcription effector binds to an enhancer and a promoter region of the genome of the cell. Specifically, the enhancer and promoter regions can be both located in the same insulated neighborhood of the genome of the cell.

[0268] The term “sequence identity” of a variant, homologue, paralog or orthologue as compared to a parent nucleotide or amino acid sequence indicates the degree of identity of two or more sequences. Two or more amino acid sequences may have the same or conserved amino acid residues at a corresponding position, to a certain degree, up to 100%. Two or more nucleotide sequences may have the same or conserved base pairs at a corresponding position, to a certain degree, up to 100%. The compared molecules may comprise sequences of different lengths.

[0269] The degree of sequence identity can be determined by comparing similar overlapping sequences, wherein the similar overlapping sequences may have a certain degree of sequence identity. The overlapping sequences may comprise a part or the full-length of one of the compared sequences e.g., the shorter one of the compared sequences, wherein the part is e.g., at least any one of 50%, 60%, 70%, 80%, 90%, or 95% of said one the compared sequences. In particular, sequence identity refers to AE006P

[0270] -32- comparing the full-length sequence of one of the compared sequences e.g., the shorter one of the compared sequences.

[0271] The term “comprising or consisting of’ with respect to a certain sequence identity described herein, shall particularly mean the respective sequence identity to the part or the full-length of one of the compared sequences e.g., the shorter one of the compared sequences, wherein the part is e.g., at least any one of 50%, 60%, 70%, 80%, 90%, or 95% of said one the compared sequences.

[0272] In particular, where a molecule comprises a certain sequence identity to a compared molecule, the sequence identity is determined for at least part of said compared molecule e.g., at least any one of 50%, 60%, 70%, 80%, 90%, 95%, or 100% of said compared sequence. Where a molecule consists of a certain sequence identity to a compared molecule, the sequence identity is determined for the full-length of said compared molecule i.e., 100% of said compared sequence.

[0273] Sequence similarity searching is an effective and reliable strategy for identifying homologs with excess (e.g., at least 50%) sequence identity. Sequence similarity search tools frequently used are e.g., BLAST, FASTA, and HMMER.

[0274] Sequence similarity searches can identify such homologous proteins or genes by detecting excess similarity, and statistically significant similarity that reflects common ancestry. Homologues may encompass orthologues, which are herein understood as the same protein in different organisms, e.g., variants of such protein in different organisms or species.

[0275] “Percent (%) amino acid sequence identity” with respect to an amino acid sequence, homologs and orthologues described herein is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the specific polypeptide sequence, after aligning the sequence and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

[0276] For purposes described herein, the sequence identity between two amino acid sequences can be determined using the NCBI BLAST program version BLASTP 2.8.1 with the following exemplary parameters: Program: blastp, Word size: 6, Expect value: AE006P

[0277] -33-

[0278] 10, Hitlist size: 100, Gapcosts: 11.1 , Matrix: BLOSUM62, Filter string: F, Compositional adjustment: Conditional compositional score matrix adjustment.

[0279] For pairwise protein sequence alignment of two amino acid sequences along their entire length the EMBOSS Needle webserver (https: / / www.ebi.ac.uk / Tools / psa / emboss_needle / ) can be used with default settings (Matrix: EBLOSUM62; Gap open: 10; Gap extend: 0.5; End Gap Penalty: false; End Gap Open: 10; End Gap Extend: 0.5). EMBOSS Needle uses the Needleman-Wunsch alignment algorithm to find the optimum alignment (including gaps) of the two input sequences and writes their optimal global sequence alignment to file.

[0280] "Percent (%) identity" with respect to a nucleotide sequence e.g., of a GOI, a promoter or a gene, is defined as the percentage of nucleotides in a candidate DNA sequence that is identical with the nucleotides in the DNA sequence, after aligning the sequence and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent nucleotide sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

[0281] For purposes described herein (unless indicated otherwise), the sequence identity between two amino acid sequences is determined using the NCBI BLAST program version BLASTN 2.8.1 with the following exemplary parameters: Program: blastn, Word size: 11 , Expect threshold: 10, Hitlist size: 100, Gap Costs: 5.2, Match / Mismatch Scores: 2,-3, Filter string: Low complexity regions, Mark for lookup table only.

[0282] Therefore, the present disclosure provides for a workflow that enables pooled CRISPR screens in MDMs. In specific examples, MDMs were infected with Vpx- containing SIVsm virus-like particles (VLPs), as described by Berger et al. (2011). This allowed transduction with lentiviruses bearing the gRNA and the CRISPR machinery into the MDMs with a high transduction efficiency of more than 50%, whereas transduction into primary (non-differentiated) CD14-positive monocytes was not successful even in the presence of Vpx-VLPs.

[0283] The functionality of the CRISPR interference machinery was tested using this approach by targeting two different cell surface receptors in a pool of MDMs: beta-2 AE006P

[0284] -34- microglobulin (B2M) which is extremely abundant in monocytes and monocyte-derived cell types (17860 TPM) and CD81 which is expressed at relatively lower levels (5.7 TPM). CD14+ monocytes differentiated to MDMs were simultaneously transduced with VLP-Vpx and two-part lentiviral vectors, a first which encoded KRAB-dCas9 and a second which encoded suitable gRNAs targeting the transcriptional start sites of B2M and CD81 , respectively. Downregulation of the levels of these target genes could be assessed through flow cytometry analysis, and a significant reduction of both surface receptors in MDMs was observed.

[0285] According to a specific example, a dual lentiviral (LV) approach was tested and the specific kinetics of introducing individual modules of the CRISPR machinery was found to greatly enhance the efficiency of CRISPR editing in comparison to an approach presented where cells are transduced with an all-in-one LV that encodes for both components. Specifically, the monocytes are o first differentiated to MDMs from day 0 to day 5; o then transduced with a first lentivirus encoding an RPN such as a Cas9 / KRAB-dCas9 on day 5; and o then transduced with a second lentivirus encoding an sgRNA on day 7. The subject matter is further described by one or more of the following items:

[0286] 1. A method of perturbing a gene in a human monocyte-derived macrophage (MDMs) using lentiviral delivery of CRISPR tools into MDMs, wherein the CRISPR tools comprise at least one guide RNA (gRNA) and an RNA-guided programmable nuclease (RPN), comprising method steps for: a) inactivation of the cellular SAM domain HD domain-containing protein 1 (SAMHD1) in MDMs; b) transduction of said MDMs with one or more lentiviruses bearing said CRISPR tools, thereby obtaining transduced MDMs comprising said genomic perturbation; and c) determining the effect of said genomic perturbation on the MDMs.

[0287] 2. The method of item 1 , wherein said inactivation of SAMHD1 is by the introduction of any one of: a) a lentiviral accessory protein that induces degradation of SAMHD1 , preferably Vpx of simian immunodeficiency virus (SIV) or of human immunodeficiency virus 2 (HIV- 2), or a lentivirus paralog of Vpx, preferably using a lentivirus vector expressing said lentiviral accessory protein, preferably a virus-like particle bearing a respective coding sequence, preferably a Vpx-expressing SIVsm virus-like particle (Vpx-VLPs); AE006P

[0288] -35- b) an inhibitor that targets said SAMHD1 , preferably an siRNA, antisense oligonucleotide or small molecule inhibitor; c) a SAMHD1 inactivating CRISPR tool comprising at least one SAMHD1 targeting guide RNA (SAMHD1-gRNA) and an RPN that is inactivating SAMHD1.

[0289] 3. The method of item 1 or 2, wherein said transduction step is carried out after said inactivation step, or said inactivation and transduction steps are carried out simultaneously.

[0290] 4. The method of any one of items 1 to 3, wherein a library of different gRNAs is used to provide said at least one gRNA, for editing corresponding different genomic sequences of the MDMs by said CRISPR tools, thereby obtaining a variety of transduced MDMs comprising different genomic perturbations, preferably wherein the variety of transduced MDMs is obtained in a pool of differently perturbed MDMs in the same containment, or in an array that comprises differently perturbed MDMs in separate containments.

[0291] 5. The method of any one of items 1 to 4, wherein a) at least one of said gRNAs is targeting a regulatory region selected from promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites and locus control regions; or b) at least one of said gRNAs is targeting a non-coding or untranslated region (UTR) of a gene within the MDM genome, preferably a target site in proximity to a promoter region, or a transcriptional start site (TSS), a 5’UTR, or 3’UTR of a gene.

[0292] 6. The method of any one of items 1 to 5, wherein said RPN comprises or consists of a) a CRISPR nuclease, preferably any one of a type II or type V CRISPR nucleases, preferably Cas9 or Cas12a; or b) a CRISPR protein containing fusion or complex with an effector, preferably a transcription-modulating domain, or an editor such as a base editor or prime editor, and optionally one or more accessory proteins; or c) a nucleic acid encoding any of the foregoing.

[0293] 7. The method of item 6, wherein the effector is selected from: AE006P

[0294] -36- a) a transcriptional repressor peptide for gene silencing, preferably a Kruppel- associated box (KRAB) domain, such as selected from the group consisting of ZIM3, or the KRAB domain of K0X1 ; or b) a transcriptional effector for gene activation, preferably a single transcriptional activation domain or combinatorial activation system, preferably selected from the group consisting of VP64, VPR (VP64, p65 and Rta), the SAM domain (consisting of p65 and HS1), the SunTag, the p300 / CBP histone acetyl transferase, SPH, or a transactivation module such as MSN, NMS or eN3x9; preferably wherein the RPN fused to the effector is any one of a dCas9-KRAB (repressor), dCas9-VP64 (activator), dCas9-VPR, VP64-dCas9-VP64, dCas9-p300, or dCas9-Tet1c, dCas9-EZH2.

[0295] 8. The method of any one of items 1 to 7, wherein the MDMs are derived from human CD14+ monocytes through differentiation by incubating the monocytes in the presence of a macrophage differentiating factor, preferably a cytokine such as M-CSF, optionally followed by incubating with one or more polarization stimuli, such as LPS, IFN- gamma, IL-4, IL-13, or TGF-beta.

[0296] 9. The method of any one of items 1 to 8, wherein said effect is determined by screening the MDMs for at least one phenotypic characteristic of said genomic perturbation, preferably wherein said at least one phenotypic characteristic is determined upon singularization of said MDMs, or in a pool of the MDMs.

[0297] 10. The method of item 9, wherein at least one phenotypic characteristic is determined by measuring cellular fitness, or expression of one or more markers, preferably wherein marker expression is determined at the RNA or protein level, preferably by flow-cytometry, immunohistochemistry, RNA-Seq, qRT-PCR, proteomics, ELISA, or microscopic imaging.

[0298] 11 . Use of the method of any one of items 1 to 10, in a method of studying single gene or epistatic effects in MDMs.

[0299] 12. Use of the method of any one of items 1 to 10, in a method of identifying or validating a therapeutic target, preferably wherein the target is identified or validated, if its perturbation induces a desired effect of said MDMs, preferably wherein the target is identified or validated for the development a drug, a cell therapy, or gene therapy.

[0300] 13. Use of the method of any one of items 1 to 10, in a method for improving macrophage cell therapy. AE006P

[0301] -37-

[0302] 14. The use according to item 12 or 13, wherein the MDMs originate from a patient for which the target is identified or validated.

[0303] 15. A kit for performing a method of any one of items 1 to 10, comprising:

[0304] (i) an inactivator of SAMHD1 ;

[0305] (ii) one or more lentivirus vectors bearing said RPN and a library of at least 10 different gRNAs.s

[0306] EXAMPLES

[0307] Example 1: SIV-derived VLP-Vpx for transducing monocyte-derived macrophages (MDMs)

[0308] CRISPRi machinery composed of two-part lentiviruses was produced with the 2ndgeneration lentivirus production system comprising the helper plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) and the KRAB-dCas9 cassette (SEQ ID NO: 21) for KRAB-dCas9 virus or sgRNA-EGFP cassette (SEQ ID NO: 22) for sgRNA virus. For VLP-Vpx production, Lenti-X™ 293T cells (632180, Takara) were transfected with SIV VLP-Vpx (Addgene Id #132928) and pMD2.G (Addgene #12259) in 6:1 ratio. 16 h post-transfection, culture medium was refreshed. Viral supernatant was harvested 72 h later, passed through 0.45 pm filter, concentrated using 50% PEG-8000, and frozen at -80°C until further use.

[0309] In the example described here, primary CD14-positive monocytes (obtained from Research Donors Ltd. UK) were transduced with a lentivirus generated bearing eGFP as well as a sgRNA expression cassette (SEQ ID NO:22) driving the expression of an NTC (non-targeting control) sgRNA (GGCTCGATCCGGTACGCTTA, SEQ ID NO:23); with or without the addition of Vpx-containing VLPs. Next, the cells were differentiated to monocyte-derived macrophages (MDMs) by addition of 100 ng / ml human M-CSF. EGFP was used to assess transduction efficiency by flow cytometry after 7 days of transduction and differentiation stimulus (M-CSF). In parallel, Vpx-VLPs and a lentivirus generated from EGFP-NTC cassette were added to differentiated MDMs on day 5, and transduction efficiency was evaluated on day 14 (Fig 1 B)

[0310] As shown in Figure 1 (cells incubated with the lentivirus alone show 0.5% EGFP- positive cells, comparable to the background controls (UT). In contrast, the addition of VLP-Vpx in combination with the lentiviral vectors increased the transduction efficiency to 59% (sgNTC and VLP-Vpx) (Fig 1A).

[0311] This means that the delivery of Vpx supports efficient lentiviral transduction of monocyte-derived macrophages (MDMs). Vpx addition facilitated lentiviral transduction AE006P

[0312] -38- of MDMs with equal efficiency even when introduced to the cells post-differentiation (Fig 1 B). Thus, Vpx facilitates transduction of macrophages when introduced at an undifferentiated or a differentiated stage.

[0313] Example 2: CRISPRi in monocyte-derived macrophages

[0314] The functionality of the CRISPR interference machinery was tested using this approach by targeting two cell surface receptors: B2M which is extremely abundant in monocytes and monocyte-derived cell types (17860 TPM) and CD81 which is expressed at relatively lower levels (5.7 TPM).

[0315] CD14-positive monocytes were thawed and first differentiated to MDMs by addition of 100 ng / ml human M-CSF for 5 days. Following this, cells were simultaneously transduced with VLP-Vpx and two-part lentiviral vectors- first generated from a cassette encoding KRAB-dCas9 (SEQ ID NO:21) and the second encoding suitable gRNAs targeting the transcriptional start sites of B2M (seq: GGCCACGGAGCGAGACATCT, SEQ ID NO:24) or CD81 (seq: GGAGGCCTGGCAGGATGCG, SEQ ID NO:25), or sgRNA against NTC (seq: GGCTCGATCCGGTACGCTTA, SEQ ID NO:22). Downregulation of the levels of these target genes was assessed through flow cytometry analysis at Day 21. A significant reduction of both surface receptors in MDMs was observed (Fig 2B). This indicates that CRISPRi works efficiently when MDMs are transduced only after completion of their differentiation process.

[0316] In another setting performed for comparison, primary monocytes were thawed and on the same day, were simultaneously transduced with VLP-Vpx and the lentiviral vectors- KRAB-dCas9 and suitable gRNAs for B2M, CD81 , or NTC. As stated before, cells were then differentiated to MDMs by addition of human M-CSF. On day 9, downregulation of these genes was assessed by flow cytometry. No downregulation of both target genes was observed. In contrast, an apparent upregulation in the levels of both B2M and CD81 was observed (Fig 2A). This indicates that the CRISPRi machinery is ineffective when introduced to monocytes at an early time-point when they are primed towards differentiation into macrophages.

[0317] Example 3: CRISPRi efficiency increases with longer incubation period post-transduction

[0318] The stability and efficiency of the transduced CRISPRi machinery over longer periods of cell culture was tested. CD14+ monocytes were thawed and first differentiated to MDMs by addition of M-CSF for 5 days. Following this, cells were simultaneously transduced with VLP-Vpx and two-part lentiviral vectors- KRAB-dCas9 and gRNAs AE006P

[0319] -39- targeting the transcriptional start sites of B2M or CD81. Downregulation of the levels of these target genes was assessed through flow cytometry analysis at Day 14 and Day 21. These cells were stained with anti-B2M and anti-CD81 antibody to assess CRISPRi efficacy at given timepoints. It was observed that B2M and CD81 levels dropped significantly on Day 21 compared to Day 14 in cells transduced with respective guides (Fig 3, note the shift of histogram towards the left in the lower panel of Day 21). The difference was more pronounced for CD81 (60% knockdown), but was also clearly evident for B2M (15% knockdown). Overall, these results indicated the stability of the CRISPRi-induced downregulation of the target genes. It also highlights that longer incubation periods following transduction (day 21 versus day 14) lead to a more pronounced effect.

[0320] Example 4: Pooled CRISPRi screen to identify factors influencing M1 polarization of monocyte-derived macrophages (MDMs)

[0321] Having established the feasibility of the VLP-Vpx mediated lentiviral delivery of the CRISPR machinery to perturb a single target gene, it was tested whether this approach can be upscaled and applied to perform a pooled perturbation screen, targeting multiple genes at the same time. To this end, 78 genes including potential factors influencing polarization of MDMs to a pro-inflammatory state (M1) and some essential and non-essential control genes were targeted. A lentiviral library was prepared encoding 324 gRNAs targeting the transcriptional start sites of these 78 genes (4 gRNAs per target gene). The sgRNAs were cloned into the sgRNA expression cassette mentioned in Example 1. sgRNA representation was validated via next generation sequencing, ensuring that the library displayed a uniform representation of all sgRNAs (data not shown). Primary CD14-positive monocytes (obtained from BiolVT (USA)) were thawed and fully differentiated to MDMs by addition of 100 ng / ml human M-CSF. On day 6, MDMs were transduced with KRAB-dCas9 assisted by VLP-Vpx and allowed to rest. Subsequently, they were transduced with the lentiviral sgRNA library assisted by VLP-Vpx on day 8. Cells were then cultured until day 22, with a medium refreshment carried out every 72 h. On day 22, the differentiated MDMs were subjected to IFNy priming (10 ng / ml) for 4 h to generate M1 macrophages or left untreated to represent the MO macrophage population. Cells were then washed in PBS and resuspended in cell-staining buffer BD Pharmingen™ Stain Buffer. To achieve stimulation-specific labeling of cells, cells from each treatment condition were “hash- tagged” using the BD™ Hu Single Cell Sample Multiplexing Kit (BD Biosciences). Cells AE006P

[0322] -40- were then pooled, and single cells were captured using the BD Rhapsody™ HT Xpress System (BD Biosciences). The captured single cells were lysed, bound RNA was reverse transcribed and gene expression and sample tag libraries targeting were prepared following manufacturer’s instructions. The libraries were subjected to Illumina sequencing using a NovaseqX flowcell (4 billion reads). Analysis of the NGS data gave rise to 37,464 high-quality single-cell profiles after removal of dead and mitotic cells and successful assignment of cells to sgRNAs, KRAB-dCas9, and the hash tag assignment, with a median of 455 cells per genetic perturbation. Uniform manifold approximation and projection (UMAP) dimensionality reduction of cellular mRNA profiles showed a distinct separation between unstimulated and IFNy-stimulated cells highlighting the possibility to separate MO and M1 macrophages based on a transcriptomic signature (Fig. 5A). A significant knockdown was achieved for 68 out of 78 genes. Four out of the remaining 10 genes had no detectable expression in human MDMs at steady state, thus making it impossible to measure a downregulation by CRISPRi. Two of the 10 genes were essential for MDM survival, hence sgRNAs targeting them dropped out during 22-day screen. The heatmap (Fig. 6) depicts the effects of CRISPRi-mediated knockdown across 78 individual genes. The x-axis indicates the CRISPR perturbation, whereas the y-axis indicates the mRNA levels of the indicated genes. The clear diagonal line (at x = y) represented in dark grey tiles denotes that the expression of a given gene was reduced upon CRISPRi-mediated knockdown of the corresponding gene, thus highlighting that CRISPR perturbation was successful across the great majority of the 78 genes perturbed. Notably, the strength of knockdowns predominantly scaled with the expression levels of the target genes in MDMs (Fig. 6, right panel).

[0323] Gene expression profiles of cells from each target gene knockdown were analysed with reference to cells harbouring a non-targeting control (NTC) gRNA. Then, Linear Discriminant Analysis (LDA) was applied to distinguish between polarized and unstimulated macrophage populations based on their gene expression profiles. The volcano plot (Fig. 7) shows genes whose knockdown is enriched in the resting condition (left side) For instance, knockdowns of key components of the IFNy signalling pathway (e.g. IFNGR1 , IFNGR2, JAK1 , JAK2) prevented macrophage M1 polarization. Conversely, knockdowns of some known negative regulators of interferon signalling (e.g. SOCS1) enhanced M1 polarization (right side). Notably, UMAP projections also indicated that cells with IFNGR1 knockdown completely partition with the unstimulated cell population regardless of IFNy stimulation (Fig. 5B). This indicates that the AE006P

[0324] -41- knockdown of these key receptors makes the cells completely refractory to IFNy stimulation. On the other hand, UMAP projections indicated that cells with SOCS1 knockdown cluster strongly within the M1 macrophage population (Fig. 5C). This indicates that the knockdown of SOCS1 generates a cluster M1 macrophages with a unique transcriptomic fingerprint.

[0325] Together, with this screening approach, 26 key factors that either promote or attenuate M1 macrophage polarization were identified. The volcano plot in Fig. 7 illustrates the effect of CRISPR-Cas9-mediated knockdown of genes that significantly influence the IFNy-mediated M1 polarization.

[0326] Example 5: Comparison of efficiency of CRISPR mediated by either a dual LV strategy or a hybrid strategy (sgRNA LV + Cas9 protein)

[0327] The two components of the CRISPR machinery are Cas9 and a sgRNA. In this example the efficiency of a dual lentivirus (LV) approach- where each of these components are encoded and expressed by two separate lentiviruses was compared directly with a hybrid approach- wherein the sgRNA is introduced via a lentivirus (includes an EGFP marker) in combination with a recombinantly purified Cas9 protein that was electroporated into MDMs. To address this, primary CD14-positive monocytes (obtained from BiolVT (USA)) were thawed and fully differentiated to MDMs by addition of 100 ng / ml human M-CSF. On day 6, MDMs were transduced with either a gRNA targeting B2M (GAAGTTGACTTACTGAAGAA, SEQ ID NO:26) or a non-targeting control sequence (NTC) (GGCTCGATCCGGTACGCTTA, SEQ ID NO:23) in the presence of VLP-Vpx. On day 8, cells were either transduced with an LV encoding for Cas9 nuclease in the presence of VLP-Vpx or were electroporated with recombinant Cas9 nuclease (Alt-R™ S.p. Cas9 Nuclease V3). The cells were then cultured until day 15, with a medium refreshment carried out every 72 h. Flow cytometry analysis indicated that the dual LV approach (~ 67% knockout) outcompetes the hybrid approach in which Cas9 protein was delivered by electroporation (~ 37% knockout) (Fig. 8A). This is surprising, given the notion that hybrid protocols are often considered superior, e.g. in primary human T cells (Shifrut et al., 2018).

[0328] Strikingly, the dual LV approach outperformed the hybrid approach in a second performance metric, i.e. in terms of cellular yield and viability at the endpoint of the experiment. When starting the experiment with 10e6 cells on day 0, approximately 3.5x10e5 viable cells could be harvested for endpoint analysis using the dual LV approach. On the other hand, the hybrid approach only yielded some 7x10e3 viable cells AE006P

[0329] -42- at the endpoint (Fig. 8B). This 50-fold difference in the cellular recovery indicates that the introduction of CRISPR machinery via the dual LV approach is more conducive for MDMs than the hybrid approach that is based on Cas9 protein electroporation. This is of great significance when considering large scale single cell screens where cell numbers are the key limiting factors and typically a high cellular representation per genetic perturbation is desired to facilitate downstream statistical analyses.

[0330] Example 6: Comparison of efficiency of CRISPR mediated by either an all- in-one LV or a dual LV approach

[0331] According to this example, the two components of the CRISPRi machinery are KRAB-dCas9 and a sgRNA. In this example the efficiency of CRISPRi, mediated by an all-in-one LV where both components are encoded and expressed by a single LV vector (SEQ ID NO:27) was directly compared to a dual lentivirus (LV) approach, where each of these components are encoded and expressed by two separate LVs (SEQ ID NO: 21 , 22). In both cases, the B2M sgRNA (SEQ ID NO:24) was introduced and efficiency of B2M knockdown was evaluated using flow cytometry. Transduction of LV for both conditions was mediated by a concurrent addition of VLP-VPX. As presented in Fig 9A, when MDMs were introduced with a B2M sgRNA by means of an all-in-one LV, no visible downregulation in B2M levels was observed. In contrast, ~29% downregulation in B2M levels was observed upon introduction of KRAB-dCas9 and B2M sgRNA via separate lentiviruses (Fig 9B). Thus, introduction of the CRISPRi machinery in the form of individual modules greatly enhances efficiency of CRISPR editing.

[0332] REFERENCES

[0333] Berger et al. (2011), Nat Protoc. 6(6):806-16.

[0334] Berger et al. (2009), Gene Ther. 16(1): 159-63.

[0335] Hiatt et al. (2021), Cell Rep. 35(6): 109105.

[0336] Hrecka et al. (2011) Nature 474:658.

[0337] Liu et al. (2020), bioRxiv version posted December 24, 2020. 2020.12.23.424242.

[0338] Franzolin et al. (2013), PNAS. 110 (35) 14272-14277

[0339] Gutierrez-Chamorro et al. (2023), Front Immunol. 2023; 14: 1112761 Daddacha et al. (2017), Cell Rep. Volume 20, Issue 8p1921 -1935 Zhang et al. (2024) iScience, Volume 27, Issue 2108907 Mahata et al. (2023), Nat Methods 20, 1716-1728.

[0340] Schifrut et al., (2018), Cell, 175(7): 1958-1971

Claims

AE006P-43-CLAIMS1. A method of engineering human monocyte-derived macrophage (MDMs) by a genomic perturbation of a gene in said MDMs using lentiviral delivery of CRISPR tools into said MDMs, wherein the CRISPR tools comprise at least one guide RNA (gRNA) and an RNA-guided programmable nuclease (RPN), comprising method steps for: a) inactivation of the cellular SAM domain HD domain-containing protein 1 (SAMHD1) in said MDMs; b) transduction of said MDMs with lentiviruses bearing said CRISPR tools, thereby obtaining transduced MDMs comprising said genomic perturbation; and c) determining the effect of said genomic perturbation on the MDMs; wherein a gRNA library comprising a repertoire of gRNAs that covers a variety of target genomic sequences of the MDMs is delivered into said MDMs.

2. The method of claim 1 , wherein the MDMs are infected with the lentiviruses to consecutively deliver the RPN and said gRNA library.

3. The method of claim 1 or 2, wherein a) the MDMs are first delivered with said RPN, and following a recovery time, the MDMs are delivered with said gRNA; or b) the MDMs are first delivered with said gRNA, and following a recovery time, the MDMs are delivered with said RPN; preferably wherein the recovery time is at least one day.

4. The method of any one of claims 1 to 3, wherein said inactivation of SAMHD1 is by the introduction of any one of: a) a lentiviral accessory protein that induces degradation of SAMHD1 , preferably Vpx of simian immunodeficiency virus (SIV) or of human immunodeficiency virus 2 (HIV- 2), or a lentivirus paralog of Vpx, preferably using a lentivirus vector expressing said lentiviral accessory protein, preferably a virus-like particle bearing a respective coding sequence, preferably a Vpx-expressing SIVsm virus-like particle (Vpx-VLPs); b) an inhibitor which is a siRNA, antisense oligonucleotide or small molecule inhibitor;AE006P-44- c) a SAMHD1 inactivating CRISPR tool comprising at least one SAMHD1 targeting guide RNA (SAMHD1-gRNA) and an RPN that is inactivating SAMHD1.

5. The method of any one of claims 1 to 4, wherein said transduction step is carried out after said inactivation step, or said inactivation and transduction steps are carried out simultaneously.

6. The method of any one of claims 1 to 5, wherein the gRNA library is a library of different gRNAs, whereby corresponding different genomic sequences of said MDMs that are targeted by said gRNA library are edited by said CRISPR tools, thereby obtaining a variety of transduced MDMs comprising different genomic perturbations, preferably wherein the variety of transduced MDMs is obtained in a pool of differently perturbed MDMs in the same containment, or in an array that comprises differently perturbed MDMs in separate containments.

7. The method of any one of claims 1 to 6, wherein a) at least one of said repertoire of gRNAs is targeting a regulatory region selected from promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites and locus control regions; or b) at least one of said repertoire of gRNAs is targeting a non-coding or untranslated region (UTR) of a gene within the MDM genome, preferably a target site in proximity to a promoter region, or a transcriptional start site (TSS), a 5’UTR, or 3’UTR of a gene.

8. The method of any one of claims 1 to 7, wherein said RPN comprises or consists of a) a CRISPR nuclease, preferably any one of a type II or type V CRISPR nucleases, preferably Cas9 or Cas12a; or b) a CRISPR protein containing fusion or complex with an effector, preferably a transcription-modulating domain, or an editor such as a base editor or prime editor, and optionally one or more accessory proteins.AE006P-45-9. The method of any one of claims 1 to 8, wherein the RPN is delivered as a nucleic acid encoding said RPN.

10. The method of claim 8 or 9, wherein the effector is selected from: a) a transcriptional repressor peptide for gene silencing, preferably a Kruppel- associated box (KRAB) domain, such as selected from the group consisting of ZIM3, or the KRAB domain of KOX1 ; or b) a transcriptional effector for gene activation, preferably a single transcriptional activation domain or combinatorial activation system;11. The method of claim 10, wherein the transcriptional effector for gene activation is selected from the group consisting of VP64, VPR such as VP64, p65 or Rta, the SAM domain such as consisting of p65 and HS1 , the SunTag, the p300 / CBP histone acetyl transferase, SPH, or a transactivation module such as MSN, NMS or eN3x9.

12. The method of claim 10 or 11 , wherein the RPN fused to the effector is any one of a dCas9-KRAB such as a dCas9-KRAB repressor, dCas9-VP64 such as a dCas9-VP64 activator, dCas9-VPR, VP64-dCas9-VP64, dCas9-p300, dCas9-Tet1c, or dCas9-EZH2.

13. The method of any one of claims 1 to 12, wherein the MDMs are derived from human CD14+ monocytes through differentiation by incubating the monocytes in the presence of a macrophage differentiating factor, preferably a cytokine such as M-CSF, optionally followed by incubating with one or more polarization stimuli, such as LPS, IFN- gamma, IL-4, IL-13, or TGF-beta.

14. The method of any one of claims 1 to 13, wherein said effect is determined by screening the engineered MDMs for at least one phenotypic characteristic of said genomic perturbation, preferably wherein said at least one phenotypic characteristic is determined upon singularization of said MDMs, or in a pool of the MDMs.

15. The method of claim 14, wherein at least one phenotypic characteristic is determined by measuring cellular fitness, or expression of one or more markers, preferably wherein marker expression is determined at the RNA or protein level,AE006P-46- preferably by flow-cytometry, immunohistochemistry, RNA-Seq, qRT-PCR, proteomics, ELISA, or microscopic imaging.

16. Use of the method of any one of claims 1 to 15, in a method of studying single gene or epistatic effects in MDMs.

17. Use of the method of any one of claims 1 to 15, in a method of identifying or validating a therapeutic target, preferably wherein the target is identified or validated, if its perturbation induces a desired effect of said MDMs, preferably wherein the target is identified or validated for the development a drug, a cell therapy, or gene therapy.

18. Use of the method of any one of claims 1 to 15, in a method for improving macrophage cell therapy, wherein the macrophage cell therapy is improved as compared to a method using MDMs that are not engineered for said genomic perturbation.

19. The use according to claim 16 to 18, wherein the MDMs originate from a patient for which the target is identified or validated.

20. A kit for performing a method of any one of claims 1 to 15, comprising:(i) an inactivator of SAMHD1 ;(ii) one or more lentivirus vectors bearing said RPN and a library of at least 10 different gRNAs.

Citation Information

Patent Citations

  • Genetic engineering of macrophages for immunotherapy

    US20200155597A1

  • Personalized crispr profiling for cancer

    WO2024168301A2